- Email: [email protected]
Genomic structure of the human MAD2 gene and mutation analysis in human lung and breast cancers
Lung Cancer 32 (2001) 289– 295 www.elsevier.nl/locate/lungcan
Genomic structure of the human MAD2 gene and mutation analysis in human lung and breast cancers Akihiko Gemma a,*, Yoko Hosoya a, Masahiro Seike a, Kazutsugu Uematsu a, Futoshi Kurimoto a, Suguru Hibino a, Akinobu Yoshimura a, Masahiko Shibuya a, Shoji Kudoh a, Mitsuru Emi b a b
Fourth Department of Internal Medicine, Nippon Medical School, 1 -1 -5, Sendagi, Bunkyo-ku, Tokyo 113 -8602, Japan Department of Molecular Biology, Institute of Gerontology, Nippon Medical School, 1 -396, Kosugi-tyo, nakahara-ku, Kanagawa 211 -8533 Kawasaki, Japan Received 5 July 2000; received in revised form 26 October 2000; accepted 30 October 2000
Abstract Some of the many human cancers that exhibit chromosomal instability also carry mutations in mitotic checkpoint genes and/or reveal reduced expression of some of those genes, such as hMAD2. To facilitate investigation of alterations of hMAD2, we determined its genomic structure and intronic primers designed to amplify the entire coding region. Since general impairment of the mitotic checkpoint is frequently reported in lung cancers, and reduced expression of hMAD2 has been reported in breast cancers as well, we searched for mutations throughout the coding sequence of this gene in the genomic DNA of 30 primary lung tumors, 30 lung-cancer cell lines and 48 primary breast cancers. Our approach, which involved polymerase chain reaction-single strand conformation polymorphism (PCRSSCP) analysis and direct sequencing, revealed nucleotide variants in only two of the 108 specimens. One was a cytosine-to-adenine substitution 3 bp upstream of exon 4 that occurred in one lung cancer cell line and one primary breast tumor, a change that did not alter transcriptional sequence. The other was an adenine-to-guanine substitution within exon 4, of the same lung cell line; this change already had been reported as a polymorphism. The results suggested that the hMAD2 gene is not commonly mutated in either lung nor breast cancers. Further studies should focus on other mechanisms that might account for reduced expression of the hMAD2 gene, and/or pursue analyses of other mitotic checkpoint genes for mutations in human cancer. Nevertheless, the genomic structure, the intronic primer sequences, and polymorphisms of the hMAD2 gene presented here will facilitate future studies to determine the full spectrum and frequency of the genetic events that can affect expression of the hMAD2 gene in human tumors. © 2001 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Human MAD2 gene; Genomic structure; Mutation-polymorphism; Lung cancer; Breast cancer
* Corresponding author. Tel.: + 81-3-38222131 ext. 6651; fax: +81-3-56853075. E-mail address: gemma – [email protected] (A. Gemma). 0169-5002/01/$ - see front matter © 2001 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 1 6 9 - 5 0 0 2 ( 0 0 ) 0 0 2 2 3 - 3
290
A. Gemma et al. / Lung Cancer 32 (2001) 289–295
1. Introduction A large proportion of human cancers contain aneuploid cells, which may form as a result of chromosomal instability (CIN) [1,2]. CIN may reflect alterations of one or several of the numerous mitotic-checkpoint genes that encode proteins involved in chromosome condensation, sisterchromatid cohesion, kinetochore structure, centrosome formation, or microtubule formation [3 – 6]. For example, the hBUB1 and hBUBR1 spindle-checkpoint genes, which encode proteins that regulate the separation of chromatids before the chromosomes are aligned appropriately along the mitotic spindle, are sometimes mutated in human colorectal cancers [7]. Mutation of hBUB1 can cause CIN [7] and we ourselves have detected a different mutation of the hBUB1 gene in DNA from a lung cancer [8]. Li and Benezra [9] reported decreased expression of another mitoticcheckpoint gene, hMAD2, which is located at chromosome 4q27, in breast cancers. Aneuploid cells are frequently present in lung cancers, including stage I [10 – 14]. The degree of aneuploidy is positively correlated with certain malignant properties and poor prognosis [11 – 13]. We earlier reported an analysis of the nuclearDNA content in un-resected lung cancers from which tissue was obtained by transbronchial biopsy. In that study, the lung cancers of 72% of the patients contained aneuploid stem cells; patients whose tumors contained a large mean nuclear-DNA content and aneuploid stem cells, more frequently showed metastases to lymph nodes or distant organs, and had significantly shorter survival time than patients whose tumors were free of aneuploid stem cells [14]. Many cultured cell lines derived from aneuploid tumors show CIN [2]. Impairment of mitotic checkpoints is another frequent observation in lung cancers [15], possibly due to alteration of mitotic-checkpoint genes. Since the mutation we found earlier in one of them, hBUB1, in a lung-cancer specimen was not common in this type of tumor [8], we considered that future studies should focus on mutational analysis of other mitotic-checkpoint genes, notably hMAD2, in lung cancers.
To facilitate mutational analysis of hMAD2 in genomic DNA and to determine whether alteration of this gene may be involved in CIN and aneuploidy in human tumors, we determined its genomic structure and designed five sets of intronic primers for PCR amplification of all five exons. Then, to shed light on the mechanisms responsible for mitotic-checkpoint defects in lung cancers and for reduced expression of hMAD2 in breast cancers, we analysed this gene for mutations in the genomic DNA of 30 primary lung tumors, 30 lung-cancer cell lines, and 48 breast cancers.
2. Materials and methods
2.1. Identification of yeast artificial chromosome (YAC) clone yhCEPH668F4 To identify a YAC clone spanning the hMAD2 gene, we screened the CEPH human mega-YAC library available from Research Genetics, Inc. (Huntsville, AL), using primer pairs hMAD2s (5%-GGTGACATTTCTGCCACTGTTGG-3%, sense) and hMAD2-a (5%-TTGGTAATAAACTGTGGTCCCGAC-3%, antisense) and hMAD2s2 (5%-CACCCAGAGAAAAGTCTCAGAAAGC-3%, sense) and hMAD2-a2 (5%-GAACAAGAAACTTCCAACAGTGGC-3%, antisense) [16,17]. Polymerase chain reaction (PCR) conditions for screening the mega-YAC library were as follows; 40 cycles of 94°C for 40 s, 60°C for 30 s, and 68°C for 90 s, followed 68°C for 8 min. The reaction mixture contained 1× XL buffer, 200 mM deoxynucleotide triphosphate, 1100 mM Mg(OAc)2, 0.5 U rTth DNA Polymerase XL, 0.3 mM each of the hMAD2-s and hMAD2-a primers or 0.3 mM each of the hMAD2-s2 and hMAD2-a2 primers, and 25 ng of DNA (Gene Amp XL PCR kit; Perkin Elmer/Roche, Branchburg, NJ).
2.2. Sequencing of yhCEPH668F4 The YAC clone obtained from the screening procedure was sequenced using the ‘long distance sequencer’ method [16 –18] determine the genomic structure of the hMAD2 gene (Table 1). Briefly,
A. Gemma et al. / Lung Cancer 32 (2001) 289–295
291
multiple samples of YAC yhCEPH668F4 were digested with different restriction enzymes and then ligated to vectorette bubbles. Relevant sequences were amplified using exon-specific primers containing the M13 sequence (TGTAAAACGACGGCCAGT) and a vectorettespecific primer, using the Gene Amp XL PCR kit (Perkin Elmer/Roche, Branchburg, NJ). PCR conditions were the same as for the screening described above, but each reaction mixture contained in 1× XL buffer, 200 mM deoxynucleotide triphosphate, 1100 mM Mg(OAc)2, 0.5 U rTth DNA Polymerase XL, 0.3 mM of each primer, and 25 ng of YAC DNA. The two or three fragments amplified in this manner were sequenced directly using -21M13 dye primer (Perkin Elmer/Roche, Branchburg, NJ) and a fluorescent automated sequencer (Applied Biosystems Inc., Foster City, CA).
Fourth Department of Internal Medicine at Nippon Medical School Main Hospital in Tokyo, Japan [20]. The histologic types included six small cell carcinomas, 14 adenocarcinomas, eight squamous-cell carcinomas, one large-cell carcinoma and one adenosquamous cell carcinoma. The breast-cancer tissues and matched normal tissues were provided by Dr Fujio Kasumi and Dr Masataka Yoshimoto, Department of Sugery, Cancer Institute Hospital, Tokyo. Tissues were obtained at surgery from patients with primary ductal breast carcinomas, who were undergoing surgery at the Cancer Institute Hospital. Samples of genomic DNA and RNA were processed from each cell line or tissue sample, according to standard protocols [19,20].
2.3. Human tumors and cell lines
From each genomic DNA sample all five exons of the hMAD2 gene were amplified separately with the PCR primers shown in Table 3, using the Gene Amp XL PCR kit (Perkin Elmer/Roche, Branchburg, NJ) and the PCR conditions described above. Each reaction mixture contained of 1× XL buffer, 200 mM deoxynucleotide triphosphate, 1100 mM Mg(OAc)2, 0.5 U rTth DNA Polymerase XL, 0.3 mM of each primer (one of each pair labeled with Fluorescein isothiocyanate), and 25 ng of genomic DNA. FITC-labeled PCR products were denatured, cooled on ice, and loaded on neutral 6% polyacrylamide gels with or without 5% (vol/vol) glycerol, as described earlier [16,17]. After electrophoresis, the gels were analysed with the FluorImager 595 (Molecular Dynamics Inc.).
Thirty primary lung cancers, 30 human lungcancer cell lines and 48 primary breast cancers were analysed. All cell lines were provided by Curtis C. Harris (National Cancer Institute, Bethesda, MD) [19]; they consisted of cultures derived from 15 non-small cell lung cancers (PC1, PC3, PC7, PC9, PC10, PC13, PC14, Lu65, A427, A549, NCI-H358, NCI-H157, NCI-H23, NCIH441, NCI-H520) and 15 small cell lung cancers (Lu24, Lu130, Lu134, Lu135, Lu138, Lu139, Lu140, Lu141, NCI-H69, NCI-H82, NCI-N230, NCI-N231, NCI-N417, SBC-5, NCI-H526). Lung-cancer tissues and matched normal tissues were obtained at autopsy from 30 subjects with primary lung cancer, who had been patients at the
2.4. Polymerase chain reaction–single strand conformation polymorphism (PCR –SSCP) analysis
Table 1 Organization of the hMAD2 gene Exon
3% splice acceptor
5% end of exon
Exon size (bp)
3% end of exon
5% splice donor
Accession no.
1 2 3 4 5
ttgcttgcag tatgttgcag tttttgacag cccaatttag
CATTCGGCAT ATTGGTTATA TGCACCCAGA GTTCATTTGA
147 121 104
GAGTTCTTCT CAACTGAAAG AAGATGACAG GAAGTTTCTT
gtaaagttct gtattttaat gtaaatagga gtaagtatta
AF202269 AF202270 AF202271 AF202272 AF202273
A. Gemma et al. / Lung Cancer 32 (2001) 289–295
292
Table 2 List of the intron-based primer sequences used in the PCR amplification of each exon of hMAD2 gene coding region Exon
Sense primer sequence
1
TGTTGGAGCCGCTG TACTGAGCCGTCACGAC TGGTTG TCCGTTCC CAGCAAGATACACG GAGCGGAAAAATGACT TGTG GC GAGCTACTTTATGA TGAGCACAATTCTTTTC TGCAGTGGACC CATAGGTG CCCTGCTTATTTGAT GGCAGTAGCTTAGTCTT GTTGAGAGC TTTGC GAAGAGAGGCAGC CCTGATTTCAGGAAAAC AAGATTAG CAC
2 3 4 5
Antisense primer sequence
2.5. Sequencing of genomic DNA from cell lines and tissue samples Each DNA sample was amplified by the PCR using all five primer pairs, with the M13 sequence (TGTAAAACGACGGCCAGT) added in each case to the appropriate primer. The PCR was performed as described above; the products were purified and sequenced by fluorescent automated sequencing (Perkin Elmer/Applied Biosystems, Foster City, CA).
2.6. Re6erse transcription (RT – PCR) Using the Gene Amp XL RNA PCR kit (Perkin Elmer/Roche, Branchburg, NJ), we performed RT –PCR experiments using 250 ng of total RNA that had been treated with Rnase-free DNAse. Primers (5% – 3%) GTGGTGGAACAACTGAAAGATTGG (sense) and (5% –3%) TGGTAATAAACTGTGGTCCCGACTC (antisense) amplified the hMAD2 gene from exon 3 to 5.
primer pair designed according to genomic sequences of hMAD2 [16,17]. We sequenced this YAC by the ‘long-distance sequencer’ method [18], and determined the nucleotide sequences of exons 1 through 5 and their adjacent introns by comparing the yhCEPH668F4 insert with the cDNA sequence reported by Li and Benezra [9]. All of the boundaries conformed to the ‘GT-AG rule’ (Table 1). The open reading frame (ORF) included all five exons. Each exonic sequence has been deposited with the EMBL/GenBank Data Libraries under Accession Nos. AF202269AF202273.
3.2. Mutation analysis of the hMAD2 gene in primary lung cancers, lung-cancer cell lines, and primary breast cancers We designed five primer pairs based on intronic sequences flanking each exon of the hMAD2 gene, to permit analysis of the entire coding region (Table 2). We detected no homozygous deletions of this gene in any of the 30 cell lines examined. It was difficult to determine whether any tumor samples had undergone homozygous deletion, in view of unavoidable contamination by normal tissue. However, one of the 30 lung-cancer cell lines, A427, and one of the 48 primary breast cancers showed mobility shifts in the PCR– SSCP analysis of exon 4 (Fig. 1A). The PCR– SSCP analysis for exon 4 was repeated, twice. Sequence analysis of the PCR product in both cases showed a cytosine-to-adenine substitution 3 bp upstream of exon 4 (Fig. 1B), but this change did not alter the RNA sequence of hMAD2. Also in A427, we detected an adenine-to-guanine substitution in exon 4. The hMAD2 gene was not altered in any of the remaining 30 primary lung tumors, 29 lung-cancer cell lines, or 47 breast cancers.
3. Results
4. Discussion
3.1. Genomic structure of the hMAD2 gene
Chromosomal instability (CIN), which usually is manifested by aneuploidy, is present in a large majority of tumors that have been examined to date [1,2]. Mutations in a human mitotic-checkpoint gene, BUB1, appear to be involved in CIN
A human YAC clone that spans the hMAD2 gene, yhCEPH668F4, was obtained by screening a human mega-YAC library by PCR, using a
A. Gemma et al. / Lung Cancer 32 (2001) 289–295
in some colon cancers, as Cahill et al. [7,21] identified hBUB1 mutations in a small subset of these tumors. In an earlier study, we ourselves found a mutated hBUB1 gene in one lung cancer among a panel of 30 primary tumors and 30 cell lines [8]. So, although mutation of the hBUB1
293
gene is not limited to colorectal cancer, it is not common in lung cancer. Nevertheless, as the mitotic checkpoint appears to be defective in many tumors, other genes involved in mitotic checkpoints should be examined in cancer specimens. The hMAD2 gene is such a candidate because its
Fig. 1. (A) PCR – SSCP analysis for exon 4 of the hMAD2 gene shows an aberrant band in lung-cancer cell line A427; (B) DNA sequence data reveal a C-to-A nucleotide substitution 3 bp upstream of exon 4. This substitution does not alter the transcriptional sequence. I, DNA sequence of aberrant band; II, control DNA sequence.
294
A. Gemma et al. / Lung Cancer 32 (2001) 289–295
expression is sometimes reduced in breast cancers [9]. The results of the present study indicate, however, that mutation of the hMAD2 gene might not be common in either lung or breast cancers. We detected nucleotide variants in only two of 108 specimens, of which one in both cases was a cytosine-to-adenine substitution in an intron 3 bp upstream of exon 4 that would not influence the transcriptional sequence of hMAD2 in the tumor. The other, present in one of the same specimens, was an adenine-to-guanine substitution within exon 4 that had already been reported as a polymorphism by Cahill et al. [21]. A427, a lung cancer cell line with both nucleotide variants, was reported to have a defective spindle assembly checkpoint and normal level of the MDAD2 protein [22]. The nucleotide variants did not result in an amino acid substitution in A427. These results suggested that the checkpoint defect in the A427 cells is downstream of hMAD2. Cahill et al. had failed to detect any mutated hMAD2 genes among DNAs from 19 aneuploid colon-cancer cell lines. Imai et al. [23] reported the rare occurrence of hMAD2 gene mutation in sporadic digestive tract cancers. With respect to lung cancers in general, inactivation of the mitotic checkpoint is a frequent observation [15]. Mutations of the hBUB1 or hMAD2 genes might be associated with CIN in lung cancers, but only rarely. Therefore, future studies must focus on other mitotic-checkpoint genes such as BUBR1, which is mutated in some human colon cancers [7], to shed light on mechanisms that impair the mitotic checkpoint in lung cancers. However, since we know from its reduced expression that hMAD2 is likely to be involved somehow in this impairment, the genomic structure, intronic primer sequences, and polymorphisms reported here should facilitate future efforts to define the role of the hMAD2 gene in human carcinogenesis and tumor progression.
Acknowledgements This study was supported in part by a Grant-inAid from the Ministry of Education, Science, Sports, and Culture of Japan. We thank Dr Fujio
Kasumi and Dr Masataka Yoshimoto at Cancer Institute Hospital, Tokyo for providing tumor tissues and Dr Curtis C. Harris at National Cancer Institute, Bethesda, MD, for providing tumor cell lines. References [1] Mitelman F, Johansson B, Mertens F. Catalog of Chromosome Aberrations in Cancer, vol. 2. New York: WileyLiss, 1994. [2] Lengauer C, Kinzler KW, Vogelstein B. Genetic instabilities in human cancers. Nature 1998;396:643 – 9. [3] Murray AW. The genetics of cell cycle checkpoints. Curr Opin Genet Dev 1995;5:5 – 11. [4] Elledge SJ. Cell cycle checkpoints: preventing an identity crisis. Science 1996;274:1664 – 72. [5] Nasmyth K. At the heart of the budding yeast cell cycle. Trends Genet 1996;12:405 – 12. [6] Paulovich AG, Toczyski DP, Hartwell LH. When checkpoints fail. Cell 1997;88:315 – 21. [7] Cahill DP, Lengauer C, Yu J, et al. Mutations of mitotic checkpoint genes in human cancers. Nature 1998;392:300 – 3. [8] Gemma A, Seike M, Seike Y, et al. Somatic mutation of the hBUB1 mitotic checkpoint gene in primary lung cancer. Genes Chromosomes Cancer 2000;29:213 – 8. [9] Li Y, Benezra R. Identification of a human mitotic checkpoint gene: hsMAD2. Science 1996;274:246 – 8. [10] Bloendal T, Lindgram A. Fluorescence cytophotometric measurement of nuclear DNA in adenocarcinoma of the lung: relation of proliferative activity and DNA ploidy to prognosis. Ann Quant Cytol 1982;4:225 – 32. [11] Asamura H, Nakajima T, Mukai K, Shimosato Y. Nuclear DNA content by cytofluorometry of stage I adenocarcinoma of the lung in relation to postoperative recurrence. Chest 1989;96:312 – 8. [12] Cibas ES, Melamed MR, Zaman MB, Kimmel M. The effect of tumor size and tumor cell DNA content on the survival of patients with stage I adenocarcinoma of the lung. Cancer 1989;63:1552 – 6. [13] Van Bodegom PC, Baak JPA, Galen CS, et al. The percentage of aneuploid cells is significantly correlated with survival in accurately staged patients with stage I resected squamous cell lung cancer and long term follow up. Cancer 1989;63:143 – 7. [14] Gemma A, Hisakatu S, Yamano Y, et al. Significance of nuclear DNA content analysis in advanced lung cancer using transbronchial biopsy samples. J Jpn Soc Clin Cytol 1993;32(6):840 – 5. [15] Takahashi T, Haruki N, Nomoto S, et al. Identification of frequent impairment of the mitotic checkpoint and molecular analysis of the mitotic checkpoint genes, hsMAD2 and p55CDC, in human lung cancers. Oncogene 1999;18:4295 – 300.
A. Gemma et al. / Lung Cancer 32 (2001) 289–295 [16] Gemma A, Hagiwara K, Ke Y, et al. FHIT mutations in human primary gastric cancer. Cancer Res 1997;57:1435 – 7. [17] Gemma A, Hagiwara K, Vincent F, et al. hSmad5 gene, a human hSmad family member: its full length cDNA, genomic structure, promoter region and mutation analysis in human tumors. Oncogene 1998;16:951 –6. [18] Hagiwara K, Harris CC. ‘Long distance sequencer method’: a novel strategy for large DNA sequencing projects. Nucleic Acids Res 1996;24:2460 –1. [19] Gemma A, Takenoshita S, Hagiwara K, et al. Molecular analysis of the cyclin-dependent kinase inhibitor genes p15INK4B/MTS2, p16 INK4/MTS1, p18 and p19 in human cancer cell lines. Int J Cancer 1996;68:605 – 11.
295
[20] Taniguchi Y, Gemma A, Takeda Y, et al. Stability of p53 tumor suppressor gene mutations during the process of metastasis and during chemotherapy. Lung Cancer 1996;14:219 – 28. [21] Cahill DP, da Costa LT, Carson-Walter EB, Kinzler KW, Vogelstein B, Lengauer C. Characterization of MAD2B and other mitotic spindle checkpoint genes. Genomics 1999;58:181 – 7. [22] Weitzel DH, Vandre DD. Differential spindle assembly checkpoint response in human lung adenocarcinoma cells. Cell Tissue Res 2000;300:57 – 65. [23] Imai Y, Shiratori Y, Kato N, Inoue T, Omata M. Mutation inactivation of mitotic checkpoint genes, hsMAD2 and hBUB1 is rare in sporadic digestive tract cancers. Jpn J Cancer Res 1999;90:837 – 40.
.
Genomic structure of the human MAD2 gene and mutation analysis in human lung and breast cancers Akihiko Gemma a,*, Yoko Hosoya a, Masahiro Seike a, Kazutsugu Uematsu a, Futoshi Kurimoto a, Suguru Hibino a, Akinobu Yoshimura a, Masahiko Shibuya a, Shoji Kudoh a, Mitsuru Emi b a b
Fourth Department of Internal Medicine, Nippon Medical School, 1 -1 -5, Sendagi, Bunkyo-ku, Tokyo 113 -8602, Japan Department of Molecular Biology, Institute of Gerontology, Nippon Medical School, 1 -396, Kosugi-tyo, nakahara-ku, Kanagawa 211 -8533 Kawasaki, Japan Received 5 July 2000; received in revised form 26 October 2000; accepted 30 October 2000
Abstract Some of the many human cancers that exhibit chromosomal instability also carry mutations in mitotic checkpoint genes and/or reveal reduced expression of some of those genes, such as hMAD2. To facilitate investigation of alterations of hMAD2, we determined its genomic structure and intronic primers designed to amplify the entire coding region. Since general impairment of the mitotic checkpoint is frequently reported in lung cancers, and reduced expression of hMAD2 has been reported in breast cancers as well, we searched for mutations throughout the coding sequence of this gene in the genomic DNA of 30 primary lung tumors, 30 lung-cancer cell lines and 48 primary breast cancers. Our approach, which involved polymerase chain reaction-single strand conformation polymorphism (PCRSSCP) analysis and direct sequencing, revealed nucleotide variants in only two of the 108 specimens. One was a cytosine-to-adenine substitution 3 bp upstream of exon 4 that occurred in one lung cancer cell line and one primary breast tumor, a change that did not alter transcriptional sequence. The other was an adenine-to-guanine substitution within exon 4, of the same lung cell line; this change already had been reported as a polymorphism. The results suggested that the hMAD2 gene is not commonly mutated in either lung nor breast cancers. Further studies should focus on other mechanisms that might account for reduced expression of the hMAD2 gene, and/or pursue analyses of other mitotic checkpoint genes for mutations in human cancer. Nevertheless, the genomic structure, the intronic primer sequences, and polymorphisms of the hMAD2 gene presented here will facilitate future studies to determine the full spectrum and frequency of the genetic events that can affect expression of the hMAD2 gene in human tumors. © 2001 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Human MAD2 gene; Genomic structure; Mutation-polymorphism; Lung cancer; Breast cancer
* Corresponding author. Tel.: + 81-3-38222131 ext. 6651; fax: +81-3-56853075. E-mail address: gemma – [email protected] (A. Gemma). 0169-5002/01/$ - see front matter © 2001 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 1 6 9 - 5 0 0 2 ( 0 0 ) 0 0 2 2 3 - 3
290
A. Gemma et al. / Lung Cancer 32 (2001) 289–295
1. Introduction A large proportion of human cancers contain aneuploid cells, which may form as a result of chromosomal instability (CIN) [1,2]. CIN may reflect alterations of one or several of the numerous mitotic-checkpoint genes that encode proteins involved in chromosome condensation, sisterchromatid cohesion, kinetochore structure, centrosome formation, or microtubule formation [3 – 6]. For example, the hBUB1 and hBUBR1 spindle-checkpoint genes, which encode proteins that regulate the separation of chromatids before the chromosomes are aligned appropriately along the mitotic spindle, are sometimes mutated in human colorectal cancers [7]. Mutation of hBUB1 can cause CIN [7] and we ourselves have detected a different mutation of the hBUB1 gene in DNA from a lung cancer [8]. Li and Benezra [9] reported decreased expression of another mitoticcheckpoint gene, hMAD2, which is located at chromosome 4q27, in breast cancers. Aneuploid cells are frequently present in lung cancers, including stage I [10 – 14]. The degree of aneuploidy is positively correlated with certain malignant properties and poor prognosis [11 – 13]. We earlier reported an analysis of the nuclearDNA content in un-resected lung cancers from which tissue was obtained by transbronchial biopsy. In that study, the lung cancers of 72% of the patients contained aneuploid stem cells; patients whose tumors contained a large mean nuclear-DNA content and aneuploid stem cells, more frequently showed metastases to lymph nodes or distant organs, and had significantly shorter survival time than patients whose tumors were free of aneuploid stem cells [14]. Many cultured cell lines derived from aneuploid tumors show CIN [2]. Impairment of mitotic checkpoints is another frequent observation in lung cancers [15], possibly due to alteration of mitotic-checkpoint genes. Since the mutation we found earlier in one of them, hBUB1, in a lung-cancer specimen was not common in this type of tumor [8], we considered that future studies should focus on mutational analysis of other mitotic-checkpoint genes, notably hMAD2, in lung cancers.
To facilitate mutational analysis of hMAD2 in genomic DNA and to determine whether alteration of this gene may be involved in CIN and aneuploidy in human tumors, we determined its genomic structure and designed five sets of intronic primers for PCR amplification of all five exons. Then, to shed light on the mechanisms responsible for mitotic-checkpoint defects in lung cancers and for reduced expression of hMAD2 in breast cancers, we analysed this gene for mutations in the genomic DNA of 30 primary lung tumors, 30 lung-cancer cell lines, and 48 breast cancers.
2. Materials and methods
2.1. Identification of yeast artificial chromosome (YAC) clone yhCEPH668F4 To identify a YAC clone spanning the hMAD2 gene, we screened the CEPH human mega-YAC library available from Research Genetics, Inc. (Huntsville, AL), using primer pairs hMAD2s (5%-GGTGACATTTCTGCCACTGTTGG-3%, sense) and hMAD2-a (5%-TTGGTAATAAACTGTGGTCCCGAC-3%, antisense) and hMAD2s2 (5%-CACCCAGAGAAAAGTCTCAGAAAGC-3%, sense) and hMAD2-a2 (5%-GAACAAGAAACTTCCAACAGTGGC-3%, antisense) [16,17]. Polymerase chain reaction (PCR) conditions for screening the mega-YAC library were as follows; 40 cycles of 94°C for 40 s, 60°C for 30 s, and 68°C for 90 s, followed 68°C for 8 min. The reaction mixture contained 1× XL buffer, 200 mM deoxynucleotide triphosphate, 1100 mM Mg(OAc)2, 0.5 U rTth DNA Polymerase XL, 0.3 mM each of the hMAD2-s and hMAD2-a primers or 0.3 mM each of the hMAD2-s2 and hMAD2-a2 primers, and 25 ng of DNA (Gene Amp XL PCR kit; Perkin Elmer/Roche, Branchburg, NJ).
2.2. Sequencing of yhCEPH668F4 The YAC clone obtained from the screening procedure was sequenced using the ‘long distance sequencer’ method [16 –18] determine the genomic structure of the hMAD2 gene (Table 1). Briefly,
A. Gemma et al. / Lung Cancer 32 (2001) 289–295
291
multiple samples of YAC yhCEPH668F4 were digested with different restriction enzymes and then ligated to vectorette bubbles. Relevant sequences were amplified using exon-specific primers containing the M13 sequence (TGTAAAACGACGGCCAGT) and a vectorettespecific primer, using the Gene Amp XL PCR kit (Perkin Elmer/Roche, Branchburg, NJ). PCR conditions were the same as for the screening described above, but each reaction mixture contained in 1× XL buffer, 200 mM deoxynucleotide triphosphate, 1100 mM Mg(OAc)2, 0.5 U rTth DNA Polymerase XL, 0.3 mM of each primer, and 25 ng of YAC DNA. The two or three fragments amplified in this manner were sequenced directly using -21M13 dye primer (Perkin Elmer/Roche, Branchburg, NJ) and a fluorescent automated sequencer (Applied Biosystems Inc., Foster City, CA).
Fourth Department of Internal Medicine at Nippon Medical School Main Hospital in Tokyo, Japan [20]. The histologic types included six small cell carcinomas, 14 adenocarcinomas, eight squamous-cell carcinomas, one large-cell carcinoma and one adenosquamous cell carcinoma. The breast-cancer tissues and matched normal tissues were provided by Dr Fujio Kasumi and Dr Masataka Yoshimoto, Department of Sugery, Cancer Institute Hospital, Tokyo. Tissues were obtained at surgery from patients with primary ductal breast carcinomas, who were undergoing surgery at the Cancer Institute Hospital. Samples of genomic DNA and RNA were processed from each cell line or tissue sample, according to standard protocols [19,20].
2.3. Human tumors and cell lines
From each genomic DNA sample all five exons of the hMAD2 gene were amplified separately with the PCR primers shown in Table 3, using the Gene Amp XL PCR kit (Perkin Elmer/Roche, Branchburg, NJ) and the PCR conditions described above. Each reaction mixture contained of 1× XL buffer, 200 mM deoxynucleotide triphosphate, 1100 mM Mg(OAc)2, 0.5 U rTth DNA Polymerase XL, 0.3 mM of each primer (one of each pair labeled with Fluorescein isothiocyanate), and 25 ng of genomic DNA. FITC-labeled PCR products were denatured, cooled on ice, and loaded on neutral 6% polyacrylamide gels with or without 5% (vol/vol) glycerol, as described earlier [16,17]. After electrophoresis, the gels were analysed with the FluorImager 595 (Molecular Dynamics Inc.).
Thirty primary lung cancers, 30 human lungcancer cell lines and 48 primary breast cancers were analysed. All cell lines were provided by Curtis C. Harris (National Cancer Institute, Bethesda, MD) [19]; they consisted of cultures derived from 15 non-small cell lung cancers (PC1, PC3, PC7, PC9, PC10, PC13, PC14, Lu65, A427, A549, NCI-H358, NCI-H157, NCI-H23, NCIH441, NCI-H520) and 15 small cell lung cancers (Lu24, Lu130, Lu134, Lu135, Lu138, Lu139, Lu140, Lu141, NCI-H69, NCI-H82, NCI-N230, NCI-N231, NCI-N417, SBC-5, NCI-H526). Lung-cancer tissues and matched normal tissues were obtained at autopsy from 30 subjects with primary lung cancer, who had been patients at the
2.4. Polymerase chain reaction–single strand conformation polymorphism (PCR –SSCP) analysis
Table 1 Organization of the hMAD2 gene Exon
3% splice acceptor
5% end of exon
Exon size (bp)
3% end of exon
5% splice donor
Accession no.
1 2 3 4 5
ttgcttgcag tatgttgcag tttttgacag cccaatttag
CATTCGGCAT ATTGGTTATA TGCACCCAGA GTTCATTTGA
147 121 104
GAGTTCTTCT CAACTGAAAG AAGATGACAG GAAGTTTCTT
gtaaagttct gtattttaat gtaaatagga gtaagtatta
AF202269 AF202270 AF202271 AF202272 AF202273
A. Gemma et al. / Lung Cancer 32 (2001) 289–295
292
Table 2 List of the intron-based primer sequences used in the PCR amplification of each exon of hMAD2 gene coding region Exon
Sense primer sequence
1
TGTTGGAGCCGCTG TACTGAGCCGTCACGAC TGGTTG TCCGTTCC CAGCAAGATACACG GAGCGGAAAAATGACT TGTG GC GAGCTACTTTATGA TGAGCACAATTCTTTTC TGCAGTGGACC CATAGGTG CCCTGCTTATTTGAT GGCAGTAGCTTAGTCTT GTTGAGAGC TTTGC GAAGAGAGGCAGC CCTGATTTCAGGAAAAC AAGATTAG CAC
2 3 4 5
Antisense primer sequence
2.5. Sequencing of genomic DNA from cell lines and tissue samples Each DNA sample was amplified by the PCR using all five primer pairs, with the M13 sequence (TGTAAAACGACGGCCAGT) added in each case to the appropriate primer. The PCR was performed as described above; the products were purified and sequenced by fluorescent automated sequencing (Perkin Elmer/Applied Biosystems, Foster City, CA).
2.6. Re6erse transcription (RT – PCR) Using the Gene Amp XL RNA PCR kit (Perkin Elmer/Roche, Branchburg, NJ), we performed RT –PCR experiments using 250 ng of total RNA that had been treated with Rnase-free DNAse. Primers (5% – 3%) GTGGTGGAACAACTGAAAGATTGG (sense) and (5% –3%) TGGTAATAAACTGTGGTCCCGACTC (antisense) amplified the hMAD2 gene from exon 3 to 5.
primer pair designed according to genomic sequences of hMAD2 [16,17]. We sequenced this YAC by the ‘long-distance sequencer’ method [18], and determined the nucleotide sequences of exons 1 through 5 and their adjacent introns by comparing the yhCEPH668F4 insert with the cDNA sequence reported by Li and Benezra [9]. All of the boundaries conformed to the ‘GT-AG rule’ (Table 1). The open reading frame (ORF) included all five exons. Each exonic sequence has been deposited with the EMBL/GenBank Data Libraries under Accession Nos. AF202269AF202273.
3.2. Mutation analysis of the hMAD2 gene in primary lung cancers, lung-cancer cell lines, and primary breast cancers We designed five primer pairs based on intronic sequences flanking each exon of the hMAD2 gene, to permit analysis of the entire coding region (Table 2). We detected no homozygous deletions of this gene in any of the 30 cell lines examined. It was difficult to determine whether any tumor samples had undergone homozygous deletion, in view of unavoidable contamination by normal tissue. However, one of the 30 lung-cancer cell lines, A427, and one of the 48 primary breast cancers showed mobility shifts in the PCR– SSCP analysis of exon 4 (Fig. 1A). The PCR– SSCP analysis for exon 4 was repeated, twice. Sequence analysis of the PCR product in both cases showed a cytosine-to-adenine substitution 3 bp upstream of exon 4 (Fig. 1B), but this change did not alter the RNA sequence of hMAD2. Also in A427, we detected an adenine-to-guanine substitution in exon 4. The hMAD2 gene was not altered in any of the remaining 30 primary lung tumors, 29 lung-cancer cell lines, or 47 breast cancers.
3. Results
4. Discussion
3.1. Genomic structure of the hMAD2 gene
Chromosomal instability (CIN), which usually is manifested by aneuploidy, is present in a large majority of tumors that have been examined to date [1,2]. Mutations in a human mitotic-checkpoint gene, BUB1, appear to be involved in CIN
A human YAC clone that spans the hMAD2 gene, yhCEPH668F4, was obtained by screening a human mega-YAC library by PCR, using a
A. Gemma et al. / Lung Cancer 32 (2001) 289–295
in some colon cancers, as Cahill et al. [7,21] identified hBUB1 mutations in a small subset of these tumors. In an earlier study, we ourselves found a mutated hBUB1 gene in one lung cancer among a panel of 30 primary tumors and 30 cell lines [8]. So, although mutation of the hBUB1
293
gene is not limited to colorectal cancer, it is not common in lung cancer. Nevertheless, as the mitotic checkpoint appears to be defective in many tumors, other genes involved in mitotic checkpoints should be examined in cancer specimens. The hMAD2 gene is such a candidate because its
Fig. 1. (A) PCR – SSCP analysis for exon 4 of the hMAD2 gene shows an aberrant band in lung-cancer cell line A427; (B) DNA sequence data reveal a C-to-A nucleotide substitution 3 bp upstream of exon 4. This substitution does not alter the transcriptional sequence. I, DNA sequence of aberrant band; II, control DNA sequence.
294
A. Gemma et al. / Lung Cancer 32 (2001) 289–295
expression is sometimes reduced in breast cancers [9]. The results of the present study indicate, however, that mutation of the hMAD2 gene might not be common in either lung or breast cancers. We detected nucleotide variants in only two of 108 specimens, of which one in both cases was a cytosine-to-adenine substitution in an intron 3 bp upstream of exon 4 that would not influence the transcriptional sequence of hMAD2 in the tumor. The other, present in one of the same specimens, was an adenine-to-guanine substitution within exon 4 that had already been reported as a polymorphism by Cahill et al. [21]. A427, a lung cancer cell line with both nucleotide variants, was reported to have a defective spindle assembly checkpoint and normal level of the MDAD2 protein [22]. The nucleotide variants did not result in an amino acid substitution in A427. These results suggested that the checkpoint defect in the A427 cells is downstream of hMAD2. Cahill et al. had failed to detect any mutated hMAD2 genes among DNAs from 19 aneuploid colon-cancer cell lines. Imai et al. [23] reported the rare occurrence of hMAD2 gene mutation in sporadic digestive tract cancers. With respect to lung cancers in general, inactivation of the mitotic checkpoint is a frequent observation [15]. Mutations of the hBUB1 or hMAD2 genes might be associated with CIN in lung cancers, but only rarely. Therefore, future studies must focus on other mitotic-checkpoint genes such as BUBR1, which is mutated in some human colon cancers [7], to shed light on mechanisms that impair the mitotic checkpoint in lung cancers. However, since we know from its reduced expression that hMAD2 is likely to be involved somehow in this impairment, the genomic structure, intronic primer sequences, and polymorphisms reported here should facilitate future efforts to define the role of the hMAD2 gene in human carcinogenesis and tumor progression.
Acknowledgements This study was supported in part by a Grant-inAid from the Ministry of Education, Science, Sports, and Culture of Japan. We thank Dr Fujio
Kasumi and Dr Masataka Yoshimoto at Cancer Institute Hospital, Tokyo for providing tumor tissues and Dr Curtis C. Harris at National Cancer Institute, Bethesda, MD, for providing tumor cell lines. References [1] Mitelman F, Johansson B, Mertens F. Catalog of Chromosome Aberrations in Cancer, vol. 2. New York: WileyLiss, 1994. [2] Lengauer C, Kinzler KW, Vogelstein B. Genetic instabilities in human cancers. Nature 1998;396:643 – 9. [3] Murray AW. The genetics of cell cycle checkpoints. Curr Opin Genet Dev 1995;5:5 – 11. [4] Elledge SJ. Cell cycle checkpoints: preventing an identity crisis. Science 1996;274:1664 – 72. [5] Nasmyth K. At the heart of the budding yeast cell cycle. Trends Genet 1996;12:405 – 12. [6] Paulovich AG, Toczyski DP, Hartwell LH. When checkpoints fail. Cell 1997;88:315 – 21. [7] Cahill DP, Lengauer C, Yu J, et al. Mutations of mitotic checkpoint genes in human cancers. Nature 1998;392:300 – 3. [8] Gemma A, Seike M, Seike Y, et al. Somatic mutation of the hBUB1 mitotic checkpoint gene in primary lung cancer. Genes Chromosomes Cancer 2000;29:213 – 8. [9] Li Y, Benezra R. Identification of a human mitotic checkpoint gene: hsMAD2. Science 1996;274:246 – 8. [10] Bloendal T, Lindgram A. Fluorescence cytophotometric measurement of nuclear DNA in adenocarcinoma of the lung: relation of proliferative activity and DNA ploidy to prognosis. Ann Quant Cytol 1982;4:225 – 32. [11] Asamura H, Nakajima T, Mukai K, Shimosato Y. Nuclear DNA content by cytofluorometry of stage I adenocarcinoma of the lung in relation to postoperative recurrence. Chest 1989;96:312 – 8. [12] Cibas ES, Melamed MR, Zaman MB, Kimmel M. The effect of tumor size and tumor cell DNA content on the survival of patients with stage I adenocarcinoma of the lung. Cancer 1989;63:1552 – 6. [13] Van Bodegom PC, Baak JPA, Galen CS, et al. The percentage of aneuploid cells is significantly correlated with survival in accurately staged patients with stage I resected squamous cell lung cancer and long term follow up. Cancer 1989;63:143 – 7. [14] Gemma A, Hisakatu S, Yamano Y, et al. Significance of nuclear DNA content analysis in advanced lung cancer using transbronchial biopsy samples. J Jpn Soc Clin Cytol 1993;32(6):840 – 5. [15] Takahashi T, Haruki N, Nomoto S, et al. Identification of frequent impairment of the mitotic checkpoint and molecular analysis of the mitotic checkpoint genes, hsMAD2 and p55CDC, in human lung cancers. Oncogene 1999;18:4295 – 300.
A. Gemma et al. / Lung Cancer 32 (2001) 289–295 [16] Gemma A, Hagiwara K, Ke Y, et al. FHIT mutations in human primary gastric cancer. Cancer Res 1997;57:1435 – 7. [17] Gemma A, Hagiwara K, Vincent F, et al. hSmad5 gene, a human hSmad family member: its full length cDNA, genomic structure, promoter region and mutation analysis in human tumors. Oncogene 1998;16:951 –6. [18] Hagiwara K, Harris CC. ‘Long distance sequencer method’: a novel strategy for large DNA sequencing projects. Nucleic Acids Res 1996;24:2460 –1. [19] Gemma A, Takenoshita S, Hagiwara K, et al. Molecular analysis of the cyclin-dependent kinase inhibitor genes p15INK4B/MTS2, p16 INK4/MTS1, p18 and p19 in human cancer cell lines. Int J Cancer 1996;68:605 – 11.
295
[20] Taniguchi Y, Gemma A, Takeda Y, et al. Stability of p53 tumor suppressor gene mutations during the process of metastasis and during chemotherapy. Lung Cancer 1996;14:219 – 28. [21] Cahill DP, da Costa LT, Carson-Walter EB, Kinzler KW, Vogelstein B, Lengauer C. Characterization of MAD2B and other mitotic spindle checkpoint genes. Genomics 1999;58:181 – 7. [22] Weitzel DH, Vandre DD. Differential spindle assembly checkpoint response in human lung adenocarcinoma cells. Cell Tissue Res 2000;300:57 – 65. [23] Imai Y, Shiratori Y, Kato N, Inoue T, Omata M. Mutation inactivation of mitotic checkpoint genes, hsMAD2 and hBUB1 is rare in sporadic digestive tract cancers. Jpn J Cancer Res 1999;90:837 – 40.
.