- Email: [email protected]
Genomic variant in porcine TNFRSF1A gene and its effects on TNF signaling pathway in vitro
Gene 700 (2019) 105–109
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Genomic variant in porcine TNFRSF1A gene and its effects on TNF signaling pathway in vitro
T
Zhengzheng Hua, Hejun Lib, Rui Xiea, Shiwei Wanga, Zongjun Yinc, Yang Liua,
⁎
a
Department of Animal Genetics, Breeding and Reproduction, National Experimental Teaching Demonstration Center of Animal Science, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China b Shanghai Animal Disease Control Center, Shanghai 201103, China c College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China
ARTICLE INFO
ABSTRACT
Keywords: TNFRSF1A SNP Association RNAi Overexpression
Our initial genome-wide association study (GWAS) revealed the presence of single nucleotide polymorphisms (SNPs) related to immune traits in the tumor necrosis factor receptor superfamily member 1A (TNFRSF1A) gene, suggesting the association of this gene with immune function in pigs. To better understand the immune functions of the TNFRSF1A gene, SNPs within the TNFRSF1A gene were detected by sequencing. One SNP (c.1394C > T) in exon 6 of TNFRSF1A was identified, and association analysis in two pig populations was subsequently performed. The results showed that this SNP was significantly associated with CD4−CD8−CD3−, CD4+CD8−CD3+, and CD4+/ CD8+ (P = 0.0038, P = 0.0007, and P = 0.0076, respectively). Based on quantitative real-time polymerase chain reaction (RT-qPCR), the TNFRSF1A mRNA was shown to be widely expressed in six different tissues. Finally, functional verification of the TNFRSF1A gene was performed in vitro to better understand its role. RNAi was used to generate a porcine PK15 cell line with a silenced TNFRSF1A gene, and a vector was also constructed to assess overexpression of TNFRSF1A. RT-qPCR was then used to detect changes in the expression levels of five critical genes. Our results indicated that TNFRSF1A activated the TNF signaling pathway and inhibited the NFκB signaling pathway in vitro. These findings provide evidence for an immune-related regulatory function for porcine TNFRSF1A.
1. Introduction Tumor necrosis factor α (TNF-α) is a pleiotropic cytokine responsible for a number of signaling events within cells that can lead to necrosis or apoptosis (Molnar et al., 2000). The deregulation of TNF-α is involved in chronic inflammation and has also been implicated in human autoimmune diseases (Fischer et al., 2015). TNF-α interacts with TNF receptors, resulting in immediate activation of nuclear factor-κB (NF-κB) and subsequent apoptosis, which plays a role in cell survival, apoptosis, and inflammation (Borghini et al., 2011). The tumor necrosis factor receptor superfamily member 1A (TNFRSF1A) gene encodes a member of the TNF receptor superfamily of proteins (TNFR1), and mutations in the TNFRSF1A gene are associated with the human TNF receptor-associated periodic syndrome (TRAPS) (Greco et al., 2015). TNFRSF1A also functions as a novel predictive factor for radiotherapy-induced oral mucositis in patients with head and neck cancer (HNC) (Brzozowska et al., 2017).
Our previous genome-wide association study (GWAS) identified the presence of five significant single nucleotide polymorphisms (SNPs), including the highly significant MARC0028162 (P = 6.58E08, n = 324), harbored within a 1.05 Mb stretch containing many immune-related genes of SSC5 (Lu et al., 2012). The TNFRSF1A gene is located within this genomic region. From a statistically significant standpoint, there was a clear association with T-lymphocyte traits, supporting the results of many earlier studies that have shown TNFRSF1A regulates adaptive immunity during the pathogenesis of TNFR-associated periodic syndrome involving both CD4 (+) conventional T cells (Pucino et al., 2016). Based on comparative genomics, as well as the significant signals identified in the GWAS, we postulated that the TNFRSF1A gene might be a good target gene for exploring immune capacity in pigs. The association of a TNFRSF1A polymorphism with T-lymphocyte traits and immune-related function in pigs has not been previously reported.
Abbreviations: TNFRSF1A, tumor necrosis factor receptor superfamily member 1A; GWAS, genome-wide association study; SNPs, single nucleotide polymorphisms; TNF-α, tumor necrosis factor α; TNFR1, TNF receptor superfamily of proteins; TRAPS, TNF receptor-associated periodic syndrome; HNC, head and neck cancer; NFΚb, nuclear factor-κB; CDS, coding sequences; TLR3, toll-like receptor 3; LPS-G, porphyromonas gingivalis ⁎ Corresponding author. E-mail address: [email protected] (Y. Liu). https://doi.org/10.1016/j.gene.2019.03.046 Received 5 January 2019; Received in revised form 19 March 2019; Accepted 21 March 2019 Available online 23 March 2019 0378-1119/ © 2019 Published by Elsevier B.V.
Gene 700 (2019) 105–109
Z. Hu, et al.
To understand the relationship between the porcine TNFRSF1A gene and T lymphocytes, genetic variants associated with T-lymphocyte subpopulation traits were investigated. To achieve this, an association study of the SNP within the TNFRSF1A gene was performed. One SNP of the TNFRSF1A gene was identified, and mRNA expression patterns were assessed and an association analysis was performed to estimate its potential effects in two pig breeds. Furthermore, RNAi was used to generate a porcine PK15 cell line with a silenced TNFRSF1A gene, and a vector was also constructed for overexpression of the TNFRSF1A gene. RT-qPCR was then used to detect any changes in the expression levels of five critical genes in the two immune-related signaling pathways, TNF and NFκB. The results indicated that the TNFRSF1A gene might be an important genetic factor implicated in the porcine TNF and NFκB signaling pathways and that it might serve as a useful functional gene for assessing immune capacity in pig resistance breeding programs.
breed effect, and e is the vector of residual errors. The significance level was set at α = 0.05.
2. Materials and methods
2.4. Total RNA isolation, cDNA synthesis, and real-time quantitative PCR
2.1. SNP identification and genotyping
All tissue samples were frozen in liquid nitrogen and stored at −80 °C, including lymph node, spleen, liver, lung, thymus, and intestines. Six tissues were collected from three 35-day-old Large White pigs. For each tissue, three samples were collected. Total RNA was extracted from the sample of six tissues using TRIzol reagent (Life Technology, USA) following the manufacture's protocols. The quality of the extracted RNA was assessed by 1% agarose gel electrophoresis before the first-strand cDNA was synthesized. The RNA was then purified and reverse transcribed into cDNA using the TaKaRa Prime Script®RT reagent kit with gDNA Eraser (TaKaRa Bio, Japan) following the manufacturer's instructions. Expression levels of the mRNA were quantified by real-time PCR using a LightCycler 480 instrument (Roche Applied Science, Switzerland). The reaction system contained 10 μL of 2 × SYBR Green 1 mixture, 10 Pm each of the forward and reverse primers, and 20 ng of cDNA in a final volume of 20 μL. Primers for amplifying the TNFRSF1A gene were: F: 5′-GACGCGCTGGAAGGA GTT-3′, R: 5′-TCAGGGCGGCCTCCAG-3′. β-Actin was used as a housekeeping gene for normalization, the primers sequences were: F: 5′-GGAC TTCGAGCAGGAGATGG-3′, R: 5′-AGGAAGGAGGGCTGGAAGAG-3′. The reaction conditions were as follows: 95 °C for 10 s, 60 °C for 10 s, 72 °C for 10 s. The Roche LightCycler 480 system (Roche Applied Science, Switzerland) was used for the detection of real time qPCR products.
2.3. Cell transfection and verification of interference efficiency The interference and expression vectors were co-transfected into PK15 cells to evaluate interference efficacy, and the vectors with the best interference efficiency were selected. Transfections were performed using Lipofectamine 2000 once the coverage of PK15 cells cultured with DMEM (8% FBS) in six-well plates reached ∼90%. Cell culture medium was replaced with fresh complete medium after it was warmed to 37 °C in a 5% CO2 incubator for 6 h. When cells had been transiently transfected for 48 h, total RNA was extracted from the cells, and real time qPCR was used to detect the expression level of target genes in the cells according to the manufacturer's instructions (TaKaRa Bio, Japan).
A DNA pool was constructed from 60 piglets, which were selected randomly, with an equal DNA concentration of 50 ng/uL from each individual. A total of six pairs of PCR primers (Table S1) were designed based on the porcine TNFRSF1A genomic sequence, referring to the Sscrofa 10.2 database (Ensembl Gene ID: ENSSSCG00000000708). PCRs were performed in a 25 μL volume containing 50 ng pooled DNA, 2.5 μL of 10× PCR buffer, 5 mM of dNTPs, 10 pmol of forward and reverse primers, 0.625 U Taq DNA polymerase (Takara Biotechnology Co. Ltd., Dalian, China), and ddH2O. A total of 263 Large White and 124 Dapu lotus pigs were collected to construct the animal population. Dapu lotus pigs were obtained from the original breeding farm of Dapu lotus pig in Jining city, and the Large White pigs were obtained from the original pig breeding farm in Jining city, Shandong province, China. A dead vaccine selectively stimulates CD4+ T helper cells, which act as stimulators for antibody producing B lymphocytes and CD8+ cytotoxic T lymphocytes, while a live vaccine selectively stimulates CD8+ T lymphocytes. As such, all of the pigs were vaccinated with four doses of live CSF vaccine (Rabbit origin, tissue ≧ 0.01 mg/dose) (Qilu Animal Health Products Co., Ltd., Shandong, China) via intramuscular injection on Day 21 after birth. Blood samples were collected from the jugular vein of each piglet one day before the vaccination (Day 20) and 2 weeks after the vaccination (Day 35). The blood samples were injected into Eppendorf tubes containing 60 μL of 20% EDTA in phosphate-buffered saline (PBS). For all individuals, ten different phenotypes of T-lymphocyte subpopulations, CD4−CD8−CD3−, CD4+CD8+CD3−, CD4+CD8−CD3−, CD4−CD8+CD3−, CD4−CD8−CD3+, CD4+CD8−CD3+, CD4−CD8+ CD3+, CD4+CD8+CD3+, CD3+, and the ratio of CD4+ to CD8+ T cell were obtained based on three-color cytofluorometric analysis. The blood cells were incubated with 10 μL of mouse anti-porcine CD4-FITC (Serotec, UK), 10 μL of mouse anti-porcine CD8-RPE (Serotec, UK), and 10 μL of mouse anti-porcine CD3-SPRD (Serotec, UK) for 30 min and then washed with 0.1 M PBS (PH7.2, containing 0.3% bovine serum albumin). The red blood cells were digested with a 0.1% ammonium oxalate solution. The stained cells were analyzed by flow cytofluorometry (Epicselite, BeckmanCoulter, USA).
2.5. Construction of the TNFRSF1A overexpression vector The overexpression vector containing the full-length coding sequence of the TNFRSF1A gene was constructed for in vitro transfection. The primers (TNFRSF1A-CDF and TNFRSF1A-CDR) were used to amplify the coding sequences (CDS) of the TNFRSF1A gene from the cDNA of a heterozygous individual. F: 5′-AGCGCTACCGGACTCAGATCTCGA GCTCATGGCTCTTCTCCTCTTCCTCGCCCTTATCAC-3′, R: 5′-GTACCGT CGACTGCAGAATTCGAAGCTTGGAAAACTCCTCGGATTCTGCTGTGAC TCTATAG-3′. The PCR products were cloned into the XhoI and SacII sites of the pEGFP-N1 vector to generate pEGFP-N1-TNFRSF1A. The Escherichia coli strain DH5α was used for construction of plasmid DNA and was routinely cultured in Luria-Bertani medium at 37 °C. Centrifugal with pEGFP-N1-TNFRSF1A were inoculated into 15 mL containing kanamycin tub, and cultured for 12–16 h at 37 °C, then the plasmids were amplified. The recombinant cloning vector was identified by double enzyme digestion of PCR products, and was then extracted using a E.Z.N.A Endo-free plasmid Mini KitII (Omega Bio-Tek, USA). Finally, the recombined plasmid was transfected into PK15 cells using Lipofectamine 2000. After 48 h of transfection, the expression level of the TNFRSF1A gene in cells was detected. To determine the transfection efficiency, the pEGFP-N1 plasmid was also co-transfected.
2.2. Association analysis In order to confirm the effect of the TNFRSF1A gene on T-lymphocyte subpopulations, association analysis between the genotypes of SNPs and seven immune traits was performed using SAS software (9.2) based on the following model:
y=µ+g+s+v+e
2.6. Cell transfection and verification of interference efficiency
where y is the vector of trait observation for all pigs on Day 35; μ is the overall mean; g is the genotypic effect, s is the sex effect, v is the
PK15 cells were suspended in DMEM supplemented with 5% calf 106
Gene 700 (2019) 105–109
Z. Hu, et al.
Table 1 The sequences of the siRNA fragments for the TNFRSF1A gene. Name
siRNA sequences
TNFRSF1A-Sus-586
GCCACAUCUGAAACUCGUATT UACGAGUUUCAGAUGUGGCTT GGGAAAUCGACUCCUGUAATT UUACAGGAGUCGAUUUCCCTT
TNFRSF1A-Sus-742
bovine serum (CBS; Life Technologies, USA) and 1% penicillin-streptomycin (Life Technologies, USA). The cell suspension was adjusted to a concentration of 2.5 × 106 cells/mL and cultured for 24 h in a 6 well plastic culture plate in a final volume of 2 mL at 37 °C in 5% CO2. Subsequently, the PK15 cells were transfected with siRNA586 or the negative control and siRNA742 or the negative control using Lipofectamine 2000 according to the manufacturer's instructions (Table 1). To determine the transfection efficiency, PK15 cells were cultured for 48 h and three replicates were used to detect the expression of the TNFRSF1A gene by RT-qPCR. Approximately 10 μL of Lipofectamine 2000 was added to 500 μL serum free media. The interference and expression vectors were co-transfected into PK15 cells to evaluate interference efficiency, and the vectors with the best interference efficiency were then selected. Relative levels of transcription were determined using the ΔCt values for each gene obtained by subtracting the mean threshold cycle (Ct) of the β-actin housekeeping gene from the Ct value of the gene of the interest (Livak and Schmittgen, 2001). Namely, ΔCt = the Ct values of target gene (TNFRSF1A) – the Ct values of housekeeping gene (β-actin), and ΔΔCt = the ΔCt values of experimental group (the ΔCt values of TNFRSF1A gene in each RNAi treatment respectively) – the ΔCt values of reference group (the average of ΔCt values of TNFRSF1A gene for BLANK group), then the relative expression level of TNFRSF1A was defined as 2−ΔΔCt. Significant differences were identified when P was < 0.05.
Fig. 1. Relative quantification of mRNA expression levels of the porcine TNFRSF1A gene in six different tissues from three piglets. The values were normalized to the internal reference gene β-actin.
results indicated that there was a likely association between the TNFRSF1A gene and T-lymphocyte subpopulations; however, this should be further confirmed in a larger pig population. 3.2. Tissues expression of the TNFRSF1A gene Real-time quantitative PCR was applied to identify the relative mRNA expression levels of the porcine TNFRSF1A gene in six different tissues. The results showed that the mRNA of TNFRSF1A was expressed in all of the analyzed tissues. The highest level of expression was in the lymph node, followed by the thymus, spleen, liver, lung, and intestine (Fig. 1). 3.3. Overexpression and silencing of the TNFRSF1A gene in porcine PK15 cells
3. Results
The overexpression vector was constructed and used to co-transfect porcine PK15 cells (Fig. 2). The interference RNA fragments were also co-transfected into porcine PK15 cells, and the transcript levels of the TNFRSF1A gene were then detected using the RT-qPCR method. In addition, the interference efficacy was evaluated. As shown in Fig. 3, TNFRSF1A levels were strongly decreased after siRNA inhibitor transfection for 48 h. A total of 5 genes (IKBKB, IL8, IL6, TLR3, and NFKB1A) were selected for quantitative PCR detection. The results showed that the expression levels of the IL8 and NFKB1A genes were significantly downregulated in PK15 cells with TNFRSF1A silencing. In contrast, the expression of the IL6 gene was upregulated; however, there were no significant changes in the expression levels of the IKBKB or TLR3 genes (Fig. 4).
3.1. Association analysis The results of association analysis showed that the SNP (c.1394C > T) associated significantly with CD4−CD8−CD3−, CD4+CD8−CD3+, and CD4+/CD8+ (P = 0.0038, P = 0.0007, and P = 0.0076, respectively) (Table 2). To determine the significance of the different genotypes acting on the T-lymphocyte subpopulations, multiple comparison tests were performed. The CD4−CD8−CD3− of pigs with the genotype CC was significantly higher than that in pigs with the genotype TT (P < 0.05). However, the CD4+CD8−CD3+ and CD4+/CD8+ of pigs with the genotype TT were significantly higher than that in pigs with the genotype CC (P < 0.05) (Table 2). These
Table 2 Association of the SNP (c.1394C > T) of the TNFRSF1A gene with 10 T-lymphocyte subpopulations (LSM ± SE). Traits
Genotypes
P value
CC (n = 342) CD4-CD8-CD3CD4 + CD8-CD3CD4-CD8 + CD3CD4 + CD8 + CD3CD4-CD8-CD3+ CD4 + CD8-CD3+ CD4-CD8 + CD3+ CD4 + CD8 + CD3+ CD3+ CD4+/CD8+
CT (n = 42) A
26.28 ± 0.49 0.27 ± 0.02 7.32 ± 0.31 0.15 ± 0.02 17.20 ± 0.42 27.33 ± 0.40A 20.74 ± 0.40 0.71 ± 0.03 1364.22 ± 21.30 1.53 ± 0.05A
TT (n = 8) B
21.84 ± 1.27 0.37 ± 0.06 8.38 ± 0.81 0.23 ± 0.04 18.07 ± 1.07 29.63 ± 1.02A 20.65 ± 1.02 0.83 ± 0.08 1333.16 ± 54.80 1.64 ± 0.12A
Note: A,B Statistically different based on least square means (P < 0.01). ⁎⁎ P < 0.01 107
23.45 ± 2.63B 0.34 ± 0.12 4.48 ± 1.68 0.12 ± 0.09 18.43 ± 2.23 34.74 ± 2.12B 17.87 ± 2.12 0.57 ± 0.17 1333.90 ± 113.64 2.34 ± 0.26B
0.0038⁎⁎ 0.240 0.090 0.190 0.670 0.0007⁎⁎ 0.410 0.270 0.850 0.0076⁎⁎
Gene 700 (2019) 105–109
Z. Hu, et al.
Fig. 5. Changes in mRNA levels of IKBKB, IL8, IL6, TLR3, and NFKB1A after overexpression of TNFRSF1A.
significant change in the mRNA transcript levels of other two genes, IKBKB and IL8 (Fig. 5). 4. Discussion Our results showed the SNP (c.1394C > T) was significantly associated with the CD4−CD8−CD3−, CD4+CD8−CD3+, and ratio of CD4+ and CD8, which are highly relevant to immune capacity. In humans, CD4 may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system (Buttini et al., 1998). The ratio of CD4+ and CD8+ also can indicate the general state of immune function, as a high ratio of CD4+/CD8+ may be an indicator of improved immune activity. In pigs, a QTL for the ratio of CD4+/CD8+ was mapped to the region proximal to the toll-like receptor 3 (TLR3) gene on SSC15 (Lu et al., 2011), and CD8+ T cells can be activated by triggering their TLR3 (Salem et al., 2009). The TNFRSF1A mRNA was widely expressed in six different tissues, with the highest level of expression observed in the lymph node. The lymph node is one of the most important immune-related tissues, and a critical hallmark of adaptive immune responses is the rapid and extensive expansion of lymph nodes (Acton and Reis e Sousa, 2016). The tissue-specific mRNA expression pattern is usually considered an important clue revealing the physiological function of a gene, and our results were consistent with gene expression annotation based on a new porcine Affymetrix expression array (Snowball) analysis in the BioGPS dataset (http://biogps.org/). The TNFRSF1A gene encodes the TNFR1 protein, which is a member of the TNF signal pathway. The tumor necrosis family of proteins are involved in the extrinsic apoptotic pathway, and their membrane receptors (TNFR1/TNFR2) recruit an adapter protein located on the cytoplasmic side of the receptors (Sugino and Okuda, 2007). The binding of TNF to TNFR1 results in immediate NF-κB activation and subsequent apoptosis (Wajant et al., 2003). The NF-κB pathway plays an extensive role in regulating the immune response, and aberrant NF-κB signaling is critical for the development of various diseases, especially inflammatory diseases and tumors (Wan and Lenardo, 2010). As a member of transcription factor nuclear factor-kappa B family, dysregulation in the expression of the TNFRSF1 gene could lead to the overproduction of pro-inflammatory cytokines, which are associated with several human inflammatory disorders (Hinson and Haren, 2006). The TNFRSF1A gene interference vector was successfully constructed using RNAi technology, which showed good infection and interference effects, and is an ideal reagent for functional study of the TNFRSF1A gene. A recombinant plasmid for overexpression was also constructed, and some key factors in the NF-κB signaling pathway were observed to be upregulated after overexpression of the TNFRSF1A gene, including the TLR3, IL8, and IKBKB genes. In contrast, the IL6 gene was observed to be down-regulated. IL6 and IL8 are important pro-inflammatory cytokines that can be released by signaling via the TNF signaling pathway. The observed
Fig. 2. Identification of the endotoxin-free plasmid by double enzyme digestion.
Fig. 3. The mRNA expression level of the TNFRSF1A gene after silencing by RNAi.
Fig. 4. Changes in mRNA expression levels of IKBKB, IL8, IL6, TLR3, and NFKB1A after silencing of TNFRSF1A.
The TNFRSF1A transcription levels were significantly increased when the overexpression vectors were co-transfected in to porcine PK15 cells. RT-qPCR results indicated that the mRNA transcript levels of the IL6 gene in the treatment group were significantly reduced. In contrast, the TLR3 and NFKB1A genes were increased, and there was no 108
Gene 700 (2019) 105–109
Z. Hu, et al.
down-regulation of IL6 indicated that overexpression of TNFRSF1A could reduce TNF signal transduction, subsequently inhibit the release of pro-inflammatory cytokines, and finally leaded to immunosuppression. IL8 is a member of the chemokine family, which is known for its role in leukocyte and lymphocyte chemotaxis. It can simultaneously act as a pro-inflammatory cytokine and chemokine to activate neutrophils, chemotactic T cells, and basophils, and it possesses chemotactic activity against T cells and basophils (Gura, 1996; Jundi and Greene, 2015). As the only TLR involved in the MyD88-independent pathway, TLR3 activates immune cells in response to double-stranded viral RNA (Botos et al., 2009). TLR4, as a member of toll-like receptors, can recognize lipopolysaccharides from Porphyromonas gingivalis (LPS-G), which leads the activation of the TLR4/MyD88 complex, triggering the secretion of pro-inflammatory cytokines (Diomede et al., 2017). In the TNFRSF1A knockdown PK15 cells, key genes of the NF-κB signaling pathway were generally down-regulated and key factors of the TNF signaling pathway were up-regulated. This was the opposite trend as compared to the TNFRSF1A overexpressing PK15 cells. These results indicated that the TNFRSF1A gene likely participates in the NFκB and TNF signaling pathway.
References Acton, S.E., Reis e Sousa, C., 2016. Dendritic cells in remodeling of lymph nodes during immune responses. Immunol. Rev. 271, 221–229. Borghini, S., Fiore, M., Di Duca, M., Caroli, F., Finetti, M., Santamaria, G., Ferlito, F., Bua, F., Picco, P., Obici, L., Martini, A., Gattorno, M., Ceccherini, I., 2011. Candidate genes in patients with autoinflammatory syndrome resembling tumor necrosis factor receptor-associated periodic syndrome without mutations in the TNFRSF1A gene. J. Rheumatol. 38, 1378–1384. Botos, I., Liu, L., Wang, Y., Segal, D.M., Davies, D.R., 2009. The toll-like receptor 3: dsRNA signaling complex. Biochim. Biophys. Acta 1789, 667–674. Brzozowska, A., Powrozek, T., Homa-Mlak, I., Mlak, R., Ciesielka, M., Golebiowski, P., Malecka-Massalska, T., 2017. Polymorphism of promoter region of TNFRSF1A gene (−610 T > G) as a novel predictive factor for radiotherapy induced oral mucositis in HNC patients. Pathol. Oncol. Res. https://doi.org/10.1007/s12253-017-0227-1. Buttini, M., Westland, C.E., Masliah, E., Yafeh, A.M., Wyss-Coray, T., Mucke, L., 1998. Novel role of human CD4 molecule identified in neurodegeneration. Nat. Med. 4, 441–446. Diomede, F., Zingariello, M., Cavalcanti, M., Merciaro, I., Pizzicannella, J., De Isla, N., Caputi, S., Ballerini, P., Trubiani, O., 2017. MyD88/ERK/NFkB pathways and proinflammatory cytokines release in periodontal ligament stem cells stimulated by Porphyromonas gingivalis. Eur. J. Histochem. 61, 2791. Fischer, R., Kontermann, R.E., Maier, O., 2015. Targeting sTNF/TNFR1 signaling as a new therapeutic strategy. Antibodies 4, 48–70. Greco, E., Aita, A., Galozzi, P., Gava, A., Sfriso, P., Negm, O.H., Tighe, P., Caso, F., Navaglia, F., Dazzo, E., De Bortoli, M., Rampazzo, A., Obici, L., Donadei, S., Merlini, G., Plebani, M., Todd, I., Basso, D., Punzi, L., 2015. The novel S59P mutation in the TNFRSF1A gene identified in an adult onset TNF receptor associated periodic syndrome (TRAPS) constitutively activates NF-kappaB pathway. Arthritis Res. Ther. 17, 93. Gura, T., 1996. Chemokines take center stage in inflammatory ills. Science 272, 954–956. Hinson, V.K., Haren, W.B., 2006. Psychogenic movement disorders. Lancet Neurol. 5, 695–700. Jundi, K., Greene, C.M., 2015. Transcription of interleukin-8: how altered regulation can affect cystic fibrosis lung disease. Biomolecules 5, 1386–1398. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods 25, 402–408. Lu, X., Liu, J.F., Gong, Y.F., Wang, Z.P., Liu, Y., Zhang, Q., 2011. Mapping quantitative trait loci for T lymphocyte subpopulations in peripheral blood in swine. BMC Genet. 12, 79. Lu, X., Fu, W.X., Luo, Y.R., Ding, X.D., Zhou, J.P., Liu, Y., Liu, J.F., Zhang, Q., 2012. Genome-wide association study for T lymphocyte subpopulations in swine. BMC Genomics 13, 488. Molnar, L., Berki, T., Hussain, A., Nemeth, P., Losonczy, H., 2000. Detection of TNFalpha expression in the bone marrow and determination of TNFalpha production of peripheral blood mononuclear cells in myelodysplastic syndrome. Pathol. Oncol. Res. 6, 18–23. Pucino, V., Lucherini, O.M., Perna, F., Obici, L., Merlini, G., Cattalini, M., La Torre, F., Maggio, M.C., Lepore, M.T., Magnotti, F., Galgani, M., Galeazzi, M., Marone, G., De Rosa, V., Talarico, R., Cantarini, L., Matarese, G., 2016. Differential impact of high and low penetrance TNFRSF1A gene mutations on conventional and regulatory CD4+ T cell functions in TNFR1-associated periodic syndrome. J. Leukoc. Biol. 99, 761–769. Salem, M.L., Diaz-Montero, C.M., El-Naggar, S.A., Chen, Y., Moussa, O., Cole, D.J., 2009. The TLR3 agonist poly(I:C) targets CD8+ T cells and augments their antigen-specific responses upon their adoptive transfer into naive recipient mice. Vaccine 27, 549–557. Sugino, N., Okuda, K., 2007. Species-related differences in the mechanism of apoptosis during structural luteolysis. J. Reprod. Dev. 53, 977–986. Wajant, H., Pfizenmaier, K., Scheurich, P., 2003. Tumor necrosis factor signaling. Cell Death Differ. 10, 45–65. Wan, F., Lenardo, M.J., 2010. The nuclear signaling of NF-κB—current knowledge, new insights, and future perspectives. Cell Res. 20, 24–33.
5. Conclusions The TNFRSF1A gene was widely expressed in six different tissues. One SNP in exon 6 of the TNFRSF1A gene was identified, and the results of association analysis showed that the SNP (c.1394C > T) was significantly associated with CD4−CD8−CD3−, CD4+CD8−CD3+, and CD4+/CD8+ T lymphocyte subpopulations in two pig populations. The results of overexpression and RNAi in porcine PK15 cells indicated that the TNFRSF1A gene activated the TNF signaling pathway and inhibited the NF-κB signaling pathway in vitro. These results provide evidence for an immune-related regulatory function for the porcine TNFRSF1A gene and indicate that this gene might serve as a useful marker in pig breeding programs. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.gene.2019.03.046. Competing interests The authors have declared that no competing interests exist. Acknowledgement This work is supported by the Natural Science Foundation of Jiangsu Province, China (Grand No. BK20190516), the China Scholarship Council Funds (Grand No. 201706855037) and Shanghai Special Fund for Modern Agro-industry Technology Research System [No. 2019-6].
109
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Genomic variant in porcine TNFRSF1A gene and its effects on TNF signaling pathway in vitro
T
Zhengzheng Hua, Hejun Lib, Rui Xiea, Shiwei Wanga, Zongjun Yinc, Yang Liua,
⁎
a
Department of Animal Genetics, Breeding and Reproduction, National Experimental Teaching Demonstration Center of Animal Science, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China b Shanghai Animal Disease Control Center, Shanghai 201103, China c College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China
ARTICLE INFO
ABSTRACT
Keywords: TNFRSF1A SNP Association RNAi Overexpression
Our initial genome-wide association study (GWAS) revealed the presence of single nucleotide polymorphisms (SNPs) related to immune traits in the tumor necrosis factor receptor superfamily member 1A (TNFRSF1A) gene, suggesting the association of this gene with immune function in pigs. To better understand the immune functions of the TNFRSF1A gene, SNPs within the TNFRSF1A gene were detected by sequencing. One SNP (c.1394C > T) in exon 6 of TNFRSF1A was identified, and association analysis in two pig populations was subsequently performed. The results showed that this SNP was significantly associated with CD4−CD8−CD3−, CD4+CD8−CD3+, and CD4+/ CD8+ (P = 0.0038, P = 0.0007, and P = 0.0076, respectively). Based on quantitative real-time polymerase chain reaction (RT-qPCR), the TNFRSF1A mRNA was shown to be widely expressed in six different tissues. Finally, functional verification of the TNFRSF1A gene was performed in vitro to better understand its role. RNAi was used to generate a porcine PK15 cell line with a silenced TNFRSF1A gene, and a vector was also constructed to assess overexpression of TNFRSF1A. RT-qPCR was then used to detect changes in the expression levels of five critical genes. Our results indicated that TNFRSF1A activated the TNF signaling pathway and inhibited the NFκB signaling pathway in vitro. These findings provide evidence for an immune-related regulatory function for porcine TNFRSF1A.
1. Introduction Tumor necrosis factor α (TNF-α) is a pleiotropic cytokine responsible for a number of signaling events within cells that can lead to necrosis or apoptosis (Molnar et al., 2000). The deregulation of TNF-α is involved in chronic inflammation and has also been implicated in human autoimmune diseases (Fischer et al., 2015). TNF-α interacts with TNF receptors, resulting in immediate activation of nuclear factor-κB (NF-κB) and subsequent apoptosis, which plays a role in cell survival, apoptosis, and inflammation (Borghini et al., 2011). The tumor necrosis factor receptor superfamily member 1A (TNFRSF1A) gene encodes a member of the TNF receptor superfamily of proteins (TNFR1), and mutations in the TNFRSF1A gene are associated with the human TNF receptor-associated periodic syndrome (TRAPS) (Greco et al., 2015). TNFRSF1A also functions as a novel predictive factor for radiotherapy-induced oral mucositis in patients with head and neck cancer (HNC) (Brzozowska et al., 2017).
Our previous genome-wide association study (GWAS) identified the presence of five significant single nucleotide polymorphisms (SNPs), including the highly significant MARC0028162 (P = 6.58E08, n = 324), harbored within a 1.05 Mb stretch containing many immune-related genes of SSC5 (Lu et al., 2012). The TNFRSF1A gene is located within this genomic region. From a statistically significant standpoint, there was a clear association with T-lymphocyte traits, supporting the results of many earlier studies that have shown TNFRSF1A regulates adaptive immunity during the pathogenesis of TNFR-associated periodic syndrome involving both CD4 (+) conventional T cells (Pucino et al., 2016). Based on comparative genomics, as well as the significant signals identified in the GWAS, we postulated that the TNFRSF1A gene might be a good target gene for exploring immune capacity in pigs. The association of a TNFRSF1A polymorphism with T-lymphocyte traits and immune-related function in pigs has not been previously reported.
Abbreviations: TNFRSF1A, tumor necrosis factor receptor superfamily member 1A; GWAS, genome-wide association study; SNPs, single nucleotide polymorphisms; TNF-α, tumor necrosis factor α; TNFR1, TNF receptor superfamily of proteins; TRAPS, TNF receptor-associated periodic syndrome; HNC, head and neck cancer; NFΚb, nuclear factor-κB; CDS, coding sequences; TLR3, toll-like receptor 3; LPS-G, porphyromonas gingivalis ⁎ Corresponding author. E-mail address: [email protected] (Y. Liu). https://doi.org/10.1016/j.gene.2019.03.046 Received 5 January 2019; Received in revised form 19 March 2019; Accepted 21 March 2019 Available online 23 March 2019 0378-1119/ © 2019 Published by Elsevier B.V.
Gene 700 (2019) 105–109
Z. Hu, et al.
To understand the relationship between the porcine TNFRSF1A gene and T lymphocytes, genetic variants associated with T-lymphocyte subpopulation traits were investigated. To achieve this, an association study of the SNP within the TNFRSF1A gene was performed. One SNP of the TNFRSF1A gene was identified, and mRNA expression patterns were assessed and an association analysis was performed to estimate its potential effects in two pig breeds. Furthermore, RNAi was used to generate a porcine PK15 cell line with a silenced TNFRSF1A gene, and a vector was also constructed for overexpression of the TNFRSF1A gene. RT-qPCR was then used to detect any changes in the expression levels of five critical genes in the two immune-related signaling pathways, TNF and NFκB. The results indicated that the TNFRSF1A gene might be an important genetic factor implicated in the porcine TNF and NFκB signaling pathways and that it might serve as a useful functional gene for assessing immune capacity in pig resistance breeding programs.
breed effect, and e is the vector of residual errors. The significance level was set at α = 0.05.
2. Materials and methods
2.4. Total RNA isolation, cDNA synthesis, and real-time quantitative PCR
2.1. SNP identification and genotyping
All tissue samples were frozen in liquid nitrogen and stored at −80 °C, including lymph node, spleen, liver, lung, thymus, and intestines. Six tissues were collected from three 35-day-old Large White pigs. For each tissue, three samples were collected. Total RNA was extracted from the sample of six tissues using TRIzol reagent (Life Technology, USA) following the manufacture's protocols. The quality of the extracted RNA was assessed by 1% agarose gel electrophoresis before the first-strand cDNA was synthesized. The RNA was then purified and reverse transcribed into cDNA using the TaKaRa Prime Script®RT reagent kit with gDNA Eraser (TaKaRa Bio, Japan) following the manufacturer's instructions. Expression levels of the mRNA were quantified by real-time PCR using a LightCycler 480 instrument (Roche Applied Science, Switzerland). The reaction system contained 10 μL of 2 × SYBR Green 1 mixture, 10 Pm each of the forward and reverse primers, and 20 ng of cDNA in a final volume of 20 μL. Primers for amplifying the TNFRSF1A gene were: F: 5′-GACGCGCTGGAAGGA GTT-3′, R: 5′-TCAGGGCGGCCTCCAG-3′. β-Actin was used as a housekeeping gene for normalization, the primers sequences were: F: 5′-GGAC TTCGAGCAGGAGATGG-3′, R: 5′-AGGAAGGAGGGCTGGAAGAG-3′. The reaction conditions were as follows: 95 °C for 10 s, 60 °C for 10 s, 72 °C for 10 s. The Roche LightCycler 480 system (Roche Applied Science, Switzerland) was used for the detection of real time qPCR products.
2.3. Cell transfection and verification of interference efficiency The interference and expression vectors were co-transfected into PK15 cells to evaluate interference efficacy, and the vectors with the best interference efficiency were selected. Transfections were performed using Lipofectamine 2000 once the coverage of PK15 cells cultured with DMEM (8% FBS) in six-well plates reached ∼90%. Cell culture medium was replaced with fresh complete medium after it was warmed to 37 °C in a 5% CO2 incubator for 6 h. When cells had been transiently transfected for 48 h, total RNA was extracted from the cells, and real time qPCR was used to detect the expression level of target genes in the cells according to the manufacturer's instructions (TaKaRa Bio, Japan).
A DNA pool was constructed from 60 piglets, which were selected randomly, with an equal DNA concentration of 50 ng/uL from each individual. A total of six pairs of PCR primers (Table S1) were designed based on the porcine TNFRSF1A genomic sequence, referring to the Sscrofa 10.2 database (Ensembl Gene ID: ENSSSCG00000000708). PCRs were performed in a 25 μL volume containing 50 ng pooled DNA, 2.5 μL of 10× PCR buffer, 5 mM of dNTPs, 10 pmol of forward and reverse primers, 0.625 U Taq DNA polymerase (Takara Biotechnology Co. Ltd., Dalian, China), and ddH2O. A total of 263 Large White and 124 Dapu lotus pigs were collected to construct the animal population. Dapu lotus pigs were obtained from the original breeding farm of Dapu lotus pig in Jining city, and the Large White pigs were obtained from the original pig breeding farm in Jining city, Shandong province, China. A dead vaccine selectively stimulates CD4+ T helper cells, which act as stimulators for antibody producing B lymphocytes and CD8+ cytotoxic T lymphocytes, while a live vaccine selectively stimulates CD8+ T lymphocytes. As such, all of the pigs were vaccinated with four doses of live CSF vaccine (Rabbit origin, tissue ≧ 0.01 mg/dose) (Qilu Animal Health Products Co., Ltd., Shandong, China) via intramuscular injection on Day 21 after birth. Blood samples were collected from the jugular vein of each piglet one day before the vaccination (Day 20) and 2 weeks after the vaccination (Day 35). The blood samples were injected into Eppendorf tubes containing 60 μL of 20% EDTA in phosphate-buffered saline (PBS). For all individuals, ten different phenotypes of T-lymphocyte subpopulations, CD4−CD8−CD3−, CD4+CD8+CD3−, CD4+CD8−CD3−, CD4−CD8+CD3−, CD4−CD8−CD3+, CD4+CD8−CD3+, CD4−CD8+ CD3+, CD4+CD8+CD3+, CD3+, and the ratio of CD4+ to CD8+ T cell were obtained based on three-color cytofluorometric analysis. The blood cells were incubated with 10 μL of mouse anti-porcine CD4-FITC (Serotec, UK), 10 μL of mouse anti-porcine CD8-RPE (Serotec, UK), and 10 μL of mouse anti-porcine CD3-SPRD (Serotec, UK) for 30 min and then washed with 0.1 M PBS (PH7.2, containing 0.3% bovine serum albumin). The red blood cells were digested with a 0.1% ammonium oxalate solution. The stained cells were analyzed by flow cytofluorometry (Epicselite, BeckmanCoulter, USA).
2.5. Construction of the TNFRSF1A overexpression vector The overexpression vector containing the full-length coding sequence of the TNFRSF1A gene was constructed for in vitro transfection. The primers (TNFRSF1A-CDF and TNFRSF1A-CDR) were used to amplify the coding sequences (CDS) of the TNFRSF1A gene from the cDNA of a heterozygous individual. F: 5′-AGCGCTACCGGACTCAGATCTCGA GCTCATGGCTCTTCTCCTCTTCCTCGCCCTTATCAC-3′, R: 5′-GTACCGT CGACTGCAGAATTCGAAGCTTGGAAAACTCCTCGGATTCTGCTGTGAC TCTATAG-3′. The PCR products were cloned into the XhoI and SacII sites of the pEGFP-N1 vector to generate pEGFP-N1-TNFRSF1A. The Escherichia coli strain DH5α was used for construction of plasmid DNA and was routinely cultured in Luria-Bertani medium at 37 °C. Centrifugal with pEGFP-N1-TNFRSF1A were inoculated into 15 mL containing kanamycin tub, and cultured for 12–16 h at 37 °C, then the plasmids were amplified. The recombinant cloning vector was identified by double enzyme digestion of PCR products, and was then extracted using a E.Z.N.A Endo-free plasmid Mini KitII (Omega Bio-Tek, USA). Finally, the recombined plasmid was transfected into PK15 cells using Lipofectamine 2000. After 48 h of transfection, the expression level of the TNFRSF1A gene in cells was detected. To determine the transfection efficiency, the pEGFP-N1 plasmid was also co-transfected.
2.2. Association analysis In order to confirm the effect of the TNFRSF1A gene on T-lymphocyte subpopulations, association analysis between the genotypes of SNPs and seven immune traits was performed using SAS software (9.2) based on the following model:
y=µ+g+s+v+e
2.6. Cell transfection and verification of interference efficiency
where y is the vector of trait observation for all pigs on Day 35; μ is the overall mean; g is the genotypic effect, s is the sex effect, v is the
PK15 cells were suspended in DMEM supplemented with 5% calf 106
Gene 700 (2019) 105–109
Z. Hu, et al.
Table 1 The sequences of the siRNA fragments for the TNFRSF1A gene. Name
siRNA sequences
TNFRSF1A-Sus-586
GCCACAUCUGAAACUCGUATT UACGAGUUUCAGAUGUGGCTT GGGAAAUCGACUCCUGUAATT UUACAGGAGUCGAUUUCCCTT
TNFRSF1A-Sus-742
bovine serum (CBS; Life Technologies, USA) and 1% penicillin-streptomycin (Life Technologies, USA). The cell suspension was adjusted to a concentration of 2.5 × 106 cells/mL and cultured for 24 h in a 6 well plastic culture plate in a final volume of 2 mL at 37 °C in 5% CO2. Subsequently, the PK15 cells were transfected with siRNA586 or the negative control and siRNA742 or the negative control using Lipofectamine 2000 according to the manufacturer's instructions (Table 1). To determine the transfection efficiency, PK15 cells were cultured for 48 h and three replicates were used to detect the expression of the TNFRSF1A gene by RT-qPCR. Approximately 10 μL of Lipofectamine 2000 was added to 500 μL serum free media. The interference and expression vectors were co-transfected into PK15 cells to evaluate interference efficiency, and the vectors with the best interference efficiency were then selected. Relative levels of transcription were determined using the ΔCt values for each gene obtained by subtracting the mean threshold cycle (Ct) of the β-actin housekeeping gene from the Ct value of the gene of the interest (Livak and Schmittgen, 2001). Namely, ΔCt = the Ct values of target gene (TNFRSF1A) – the Ct values of housekeeping gene (β-actin), and ΔΔCt = the ΔCt values of experimental group (the ΔCt values of TNFRSF1A gene in each RNAi treatment respectively) – the ΔCt values of reference group (the average of ΔCt values of TNFRSF1A gene for BLANK group), then the relative expression level of TNFRSF1A was defined as 2−ΔΔCt. Significant differences were identified when P was < 0.05.
Fig. 1. Relative quantification of mRNA expression levels of the porcine TNFRSF1A gene in six different tissues from three piglets. The values were normalized to the internal reference gene β-actin.
results indicated that there was a likely association between the TNFRSF1A gene and T-lymphocyte subpopulations; however, this should be further confirmed in a larger pig population. 3.2. Tissues expression of the TNFRSF1A gene Real-time quantitative PCR was applied to identify the relative mRNA expression levels of the porcine TNFRSF1A gene in six different tissues. The results showed that the mRNA of TNFRSF1A was expressed in all of the analyzed tissues. The highest level of expression was in the lymph node, followed by the thymus, spleen, liver, lung, and intestine (Fig. 1). 3.3. Overexpression and silencing of the TNFRSF1A gene in porcine PK15 cells
3. Results
The overexpression vector was constructed and used to co-transfect porcine PK15 cells (Fig. 2). The interference RNA fragments were also co-transfected into porcine PK15 cells, and the transcript levels of the TNFRSF1A gene were then detected using the RT-qPCR method. In addition, the interference efficacy was evaluated. As shown in Fig. 3, TNFRSF1A levels were strongly decreased after siRNA inhibitor transfection for 48 h. A total of 5 genes (IKBKB, IL8, IL6, TLR3, and NFKB1A) were selected for quantitative PCR detection. The results showed that the expression levels of the IL8 and NFKB1A genes were significantly downregulated in PK15 cells with TNFRSF1A silencing. In contrast, the expression of the IL6 gene was upregulated; however, there were no significant changes in the expression levels of the IKBKB or TLR3 genes (Fig. 4).
3.1. Association analysis The results of association analysis showed that the SNP (c.1394C > T) associated significantly with CD4−CD8−CD3−, CD4+CD8−CD3+, and CD4+/CD8+ (P = 0.0038, P = 0.0007, and P = 0.0076, respectively) (Table 2). To determine the significance of the different genotypes acting on the T-lymphocyte subpopulations, multiple comparison tests were performed. The CD4−CD8−CD3− of pigs with the genotype CC was significantly higher than that in pigs with the genotype TT (P < 0.05). However, the CD4+CD8−CD3+ and CD4+/CD8+ of pigs with the genotype TT were significantly higher than that in pigs with the genotype CC (P < 0.05) (Table 2). These
Table 2 Association of the SNP (c.1394C > T) of the TNFRSF1A gene with 10 T-lymphocyte subpopulations (LSM ± SE). Traits
Genotypes
P value
CC (n = 342) CD4-CD8-CD3CD4 + CD8-CD3CD4-CD8 + CD3CD4 + CD8 + CD3CD4-CD8-CD3+ CD4 + CD8-CD3+ CD4-CD8 + CD3+ CD4 + CD8 + CD3+ CD3+ CD4+/CD8+
CT (n = 42) A
26.28 ± 0.49 0.27 ± 0.02 7.32 ± 0.31 0.15 ± 0.02 17.20 ± 0.42 27.33 ± 0.40A 20.74 ± 0.40 0.71 ± 0.03 1364.22 ± 21.30 1.53 ± 0.05A
TT (n = 8) B
21.84 ± 1.27 0.37 ± 0.06 8.38 ± 0.81 0.23 ± 0.04 18.07 ± 1.07 29.63 ± 1.02A 20.65 ± 1.02 0.83 ± 0.08 1333.16 ± 54.80 1.64 ± 0.12A
Note: A,B Statistically different based on least square means (P < 0.01). ⁎⁎ P < 0.01 107
23.45 ± 2.63B 0.34 ± 0.12 4.48 ± 1.68 0.12 ± 0.09 18.43 ± 2.23 34.74 ± 2.12B 17.87 ± 2.12 0.57 ± 0.17 1333.90 ± 113.64 2.34 ± 0.26B
0.0038⁎⁎ 0.240 0.090 0.190 0.670 0.0007⁎⁎ 0.410 0.270 0.850 0.0076⁎⁎
Gene 700 (2019) 105–109
Z. Hu, et al.
Fig. 5. Changes in mRNA levels of IKBKB, IL8, IL6, TLR3, and NFKB1A after overexpression of TNFRSF1A.
significant change in the mRNA transcript levels of other two genes, IKBKB and IL8 (Fig. 5). 4. Discussion Our results showed the SNP (c.1394C > T) was significantly associated with the CD4−CD8−CD3−, CD4+CD8−CD3+, and ratio of CD4+ and CD8, which are highly relevant to immune capacity. In humans, CD4 may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system (Buttini et al., 1998). The ratio of CD4+ and CD8+ also can indicate the general state of immune function, as a high ratio of CD4+/CD8+ may be an indicator of improved immune activity. In pigs, a QTL for the ratio of CD4+/CD8+ was mapped to the region proximal to the toll-like receptor 3 (TLR3) gene on SSC15 (Lu et al., 2011), and CD8+ T cells can be activated by triggering their TLR3 (Salem et al., 2009). The TNFRSF1A mRNA was widely expressed in six different tissues, with the highest level of expression observed in the lymph node. The lymph node is one of the most important immune-related tissues, and a critical hallmark of adaptive immune responses is the rapid and extensive expansion of lymph nodes (Acton and Reis e Sousa, 2016). The tissue-specific mRNA expression pattern is usually considered an important clue revealing the physiological function of a gene, and our results were consistent with gene expression annotation based on a new porcine Affymetrix expression array (Snowball) analysis in the BioGPS dataset (http://biogps.org/). The TNFRSF1A gene encodes the TNFR1 protein, which is a member of the TNF signal pathway. The tumor necrosis family of proteins are involved in the extrinsic apoptotic pathway, and their membrane receptors (TNFR1/TNFR2) recruit an adapter protein located on the cytoplasmic side of the receptors (Sugino and Okuda, 2007). The binding of TNF to TNFR1 results in immediate NF-κB activation and subsequent apoptosis (Wajant et al., 2003). The NF-κB pathway plays an extensive role in regulating the immune response, and aberrant NF-κB signaling is critical for the development of various diseases, especially inflammatory diseases and tumors (Wan and Lenardo, 2010). As a member of transcription factor nuclear factor-kappa B family, dysregulation in the expression of the TNFRSF1 gene could lead to the overproduction of pro-inflammatory cytokines, which are associated with several human inflammatory disorders (Hinson and Haren, 2006). The TNFRSF1A gene interference vector was successfully constructed using RNAi technology, which showed good infection and interference effects, and is an ideal reagent for functional study of the TNFRSF1A gene. A recombinant plasmid for overexpression was also constructed, and some key factors in the NF-κB signaling pathway were observed to be upregulated after overexpression of the TNFRSF1A gene, including the TLR3, IL8, and IKBKB genes. In contrast, the IL6 gene was observed to be down-regulated. IL6 and IL8 are important pro-inflammatory cytokines that can be released by signaling via the TNF signaling pathway. The observed
Fig. 2. Identification of the endotoxin-free plasmid by double enzyme digestion.
Fig. 3. The mRNA expression level of the TNFRSF1A gene after silencing by RNAi.
Fig. 4. Changes in mRNA expression levels of IKBKB, IL8, IL6, TLR3, and NFKB1A after silencing of TNFRSF1A.
The TNFRSF1A transcription levels were significantly increased when the overexpression vectors were co-transfected in to porcine PK15 cells. RT-qPCR results indicated that the mRNA transcript levels of the IL6 gene in the treatment group were significantly reduced. In contrast, the TLR3 and NFKB1A genes were increased, and there was no 108
Gene 700 (2019) 105–109
Z. Hu, et al.
down-regulation of IL6 indicated that overexpression of TNFRSF1A could reduce TNF signal transduction, subsequently inhibit the release of pro-inflammatory cytokines, and finally leaded to immunosuppression. IL8 is a member of the chemokine family, which is known for its role in leukocyte and lymphocyte chemotaxis. It can simultaneously act as a pro-inflammatory cytokine and chemokine to activate neutrophils, chemotactic T cells, and basophils, and it possesses chemotactic activity against T cells and basophils (Gura, 1996; Jundi and Greene, 2015). As the only TLR involved in the MyD88-independent pathway, TLR3 activates immune cells in response to double-stranded viral RNA (Botos et al., 2009). TLR4, as a member of toll-like receptors, can recognize lipopolysaccharides from Porphyromonas gingivalis (LPS-G), which leads the activation of the TLR4/MyD88 complex, triggering the secretion of pro-inflammatory cytokines (Diomede et al., 2017). In the TNFRSF1A knockdown PK15 cells, key genes of the NF-κB signaling pathway were generally down-regulated and key factors of the TNF signaling pathway were up-regulated. This was the opposite trend as compared to the TNFRSF1A overexpressing PK15 cells. These results indicated that the TNFRSF1A gene likely participates in the NFκB and TNF signaling pathway.
References Acton, S.E., Reis e Sousa, C., 2016. Dendritic cells in remodeling of lymph nodes during immune responses. Immunol. Rev. 271, 221–229. Borghini, S., Fiore, M., Di Duca, M., Caroli, F., Finetti, M., Santamaria, G., Ferlito, F., Bua, F., Picco, P., Obici, L., Martini, A., Gattorno, M., Ceccherini, I., 2011. Candidate genes in patients with autoinflammatory syndrome resembling tumor necrosis factor receptor-associated periodic syndrome without mutations in the TNFRSF1A gene. J. Rheumatol. 38, 1378–1384. Botos, I., Liu, L., Wang, Y., Segal, D.M., Davies, D.R., 2009. The toll-like receptor 3: dsRNA signaling complex. Biochim. Biophys. Acta 1789, 667–674. Brzozowska, A., Powrozek, T., Homa-Mlak, I., Mlak, R., Ciesielka, M., Golebiowski, P., Malecka-Massalska, T., 2017. Polymorphism of promoter region of TNFRSF1A gene (−610 T > G) as a novel predictive factor for radiotherapy induced oral mucositis in HNC patients. Pathol. Oncol. Res. https://doi.org/10.1007/s12253-017-0227-1. Buttini, M., Westland, C.E., Masliah, E., Yafeh, A.M., Wyss-Coray, T., Mucke, L., 1998. Novel role of human CD4 molecule identified in neurodegeneration. Nat. Med. 4, 441–446. Diomede, F., Zingariello, M., Cavalcanti, M., Merciaro, I., Pizzicannella, J., De Isla, N., Caputi, S., Ballerini, P., Trubiani, O., 2017. MyD88/ERK/NFkB pathways and proinflammatory cytokines release in periodontal ligament stem cells stimulated by Porphyromonas gingivalis. Eur. J. Histochem. 61, 2791. Fischer, R., Kontermann, R.E., Maier, O., 2015. Targeting sTNF/TNFR1 signaling as a new therapeutic strategy. Antibodies 4, 48–70. Greco, E., Aita, A., Galozzi, P., Gava, A., Sfriso, P., Negm, O.H., Tighe, P., Caso, F., Navaglia, F., Dazzo, E., De Bortoli, M., Rampazzo, A., Obici, L., Donadei, S., Merlini, G., Plebani, M., Todd, I., Basso, D., Punzi, L., 2015. The novel S59P mutation in the TNFRSF1A gene identified in an adult onset TNF receptor associated periodic syndrome (TRAPS) constitutively activates NF-kappaB pathway. Arthritis Res. Ther. 17, 93. Gura, T., 1996. Chemokines take center stage in inflammatory ills. Science 272, 954–956. Hinson, V.K., Haren, W.B., 2006. Psychogenic movement disorders. Lancet Neurol. 5, 695–700. Jundi, K., Greene, C.M., 2015. Transcription of interleukin-8: how altered regulation can affect cystic fibrosis lung disease. Biomolecules 5, 1386–1398. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods 25, 402–408. Lu, X., Liu, J.F., Gong, Y.F., Wang, Z.P., Liu, Y., Zhang, Q., 2011. Mapping quantitative trait loci for T lymphocyte subpopulations in peripheral blood in swine. BMC Genet. 12, 79. Lu, X., Fu, W.X., Luo, Y.R., Ding, X.D., Zhou, J.P., Liu, Y., Liu, J.F., Zhang, Q., 2012. Genome-wide association study for T lymphocyte subpopulations in swine. BMC Genomics 13, 488. Molnar, L., Berki, T., Hussain, A., Nemeth, P., Losonczy, H., 2000. Detection of TNFalpha expression in the bone marrow and determination of TNFalpha production of peripheral blood mononuclear cells in myelodysplastic syndrome. Pathol. Oncol. Res. 6, 18–23. Pucino, V., Lucherini, O.M., Perna, F., Obici, L., Merlini, G., Cattalini, M., La Torre, F., Maggio, M.C., Lepore, M.T., Magnotti, F., Galgani, M., Galeazzi, M., Marone, G., De Rosa, V., Talarico, R., Cantarini, L., Matarese, G., 2016. Differential impact of high and low penetrance TNFRSF1A gene mutations on conventional and regulatory CD4+ T cell functions in TNFR1-associated periodic syndrome. J. Leukoc. Biol. 99, 761–769. Salem, M.L., Diaz-Montero, C.M., El-Naggar, S.A., Chen, Y., Moussa, O., Cole, D.J., 2009. The TLR3 agonist poly(I:C) targets CD8+ T cells and augments their antigen-specific responses upon their adoptive transfer into naive recipient mice. Vaccine 27, 549–557. Sugino, N., Okuda, K., 2007. Species-related differences in the mechanism of apoptosis during structural luteolysis. J. Reprod. Dev. 53, 977–986. Wajant, H., Pfizenmaier, K., Scheurich, P., 2003. Tumor necrosis factor signaling. Cell Death Differ. 10, 45–65. Wan, F., Lenardo, M.J., 2010. The nuclear signaling of NF-κB—current knowledge, new insights, and future perspectives. Cell Res. 20, 24–33.
5. Conclusions The TNFRSF1A gene was widely expressed in six different tissues. One SNP in exon 6 of the TNFRSF1A gene was identified, and the results of association analysis showed that the SNP (c.1394C > T) was significantly associated with CD4−CD8−CD3−, CD4+CD8−CD3+, and CD4+/CD8+ T lymphocyte subpopulations in two pig populations. The results of overexpression and RNAi in porcine PK15 cells indicated that the TNFRSF1A gene activated the TNF signaling pathway and inhibited the NF-κB signaling pathway in vitro. These results provide evidence for an immune-related regulatory function for the porcine TNFRSF1A gene and indicate that this gene might serve as a useful marker in pig breeding programs. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.gene.2019.03.046. Competing interests The authors have declared that no competing interests exist. Acknowledgement This work is supported by the Natural Science Foundation of Jiangsu Province, China (Grand No. BK20190516), the China Scholarship Council Funds (Grand No. 201706855037) and Shanghai Special Fund for Modern Agro-industry Technology Research System [No. 2019-6].
109