- Email: [email protected]
Genotyping and screening of reassortant live-attenuated influenza B vaccine strain
Journal of Virological Methods 165 (2010) 133–138
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Genotyping and screening of reassortant live-attenuated influenza B vaccine strain Eun-Young Lee a,1 , Kwang-Hee Lee a,1 , Eun-Ju Jung a , Yo Han Jang a , Sang-Uk Seo a , Hyun-Ah Kim b , Baik Lin Seong a,∗ a b
Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, 134 Shinchon-Dong, Seodaemun-Gu, Seoul 120-749, South Korea R&D Center of Pharmaceuticals, CJ Corp., 522-1, Dokpyong-Ri, Majang-Myun, Ichon-Si, Kyonggi-Do 467-180, South Korea
a b s t r a c t Article history: Received 13 July 2009 Received in revised form 16 October 2009 Accepted 22 October 2009 Available online 31 October 2009 Keywords: Influenza B virus Reassortants Multiplex RT-PCR Genotyping Live vaccine
Live-attenuated influenza virus vaccines can be generated by reassortment of gene segments between an attenuated donor strain and a virulent wild-type virus. The annual production schedule for the seasonal influenza vaccine necessitates rapid and efficient genotyping of the reassorted progeny to identify the desired vaccine strains. This study describes a multiplex RT-PCR system capable of identifying each gene segment from the cold-adapted attenuated donor virus, B/Lee/40ca. The specificity of the amplification system was optimized by testing various wild-type influenza B viruses. The resulting RT-PCR method is sensitive and efficient enough for routine identification of reassortant clones to identify the desired gene constellation, consisting of six segments from the attenuated donor virus and the H and N genes from the wild-type virus. By providing a more rapid and efficient means of genotyping the candidate reassortant strains, this method could be implemented to expedite the generation of each component strain and allow more time to culture and process the final seasonal influenza vaccine. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Influenza virus is an enveloped virus with a negative-sense segmented RNA genome that belongs to the Orthomyxoviridae family (Beigel, 2008). Influenza A and influenza B viruses are globally important respiratory human pathogens that cause annual epidemics and occasional pandemics necessitating annual vaccination against newly circulating strains. Annual influenza epidemics are caused typically by antigenic drift, point mutations within gene segments, while pandemics are typically caused by antigenic shift, the reassortment of a whole gene segment that changes completely the antigenicity of a circulating virus (Carrat and Flahault, 2007; Hampson and Mackenzie, 2006; Wright et al., 2007). Influenza specific antiviral drugs are able to reduce the extent of virus spread throughout the population (Beigel and Bray, 2008; De Clercq, 2004; Intharathep et al., 2008; Moscona, 2008), but vaccination remains the primary means of protecting people against influenza disease. Every year the World Health Organization (WHO) predicts the virus strains likely to circulate in the upcoming influenza season in each hemisphere and recommends three strains, two
∗ Corresponding author. Tel.: +82 2 2123 2885; fax: +82 2 362 7265. E-mail address: [email protected] (B.L. Seong). 1 These authors contributed equally to this work. 0166-0934/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2009.10.022
influenza A types and one influenza B type, to be included into the vaccine formulation. Currently, inactivated influenza vaccines are licensed worldwide, but live-attenuated influenza vaccines are used only in Russia and have been licensed recently in the USA (Bardiya and Bae, 2005; Belshe, 2004; Ohmit et al., 2008). Immunization with the live-attenuated influenza vaccine induces a broader immune response that resembles natural infection, which establishes better long-term immunity against influenza virus (Cox et al., 2004; Wareing and Tannock, 2001). The segmented nature of the influenza genome allows attenuated reassortant viruses to be produced by co-infecting cells with an attenuated influenza strain, which serves as the source of attenuated genes and a circulating wild-type human influenza virus. The co-infection results in a pool of reassortant viruses with a random combination of the eight RNA genomes from the two parental viruses. Among the 256 possible reassortants, it is necessary to isolate and identify the reassortant that inherited the two gene segments encoding the hemagglutinin (HA) and neuraminidase (NA) surface glycoproteins from the epidemic wild-type virus and the remaining six gene segments (PB2, PB1, PA, NP, M, and NS) from the attenuated donor virus (Maassab and Bryant, 1999; Seo et al., 2008). The tight schedule associated with the annual production of the trivalent influenza vaccine necessitates an accurate and rapid method to genotype reassortants to identify clones with the desired genetic constellation. Recently a multiplex RT-PCR
134
E.-Y. Lee et al. / Journal of Virological Methods 165 (2010) 133–138
technique was developed to identify rapidly gene segments originating from a live-attenuated influenza A virus strain (Ha et al., 2006). This report presents a similar multiplex RT-PCR system for genotyping reassortant influenza B viruses. This method could be implemented to facilitate progeny genotyping and expedite the production of the trivalent live-attenuated influenza vaccines each year. 2. Materials and methods 2.1. Viruses and cell The cold-adapted influenza B virus (B/Lee/40ca) was generated from repeated passages at low temperature in embryonated hen’s eggs, as previously described (Seo et al., 2008). Wild-type influenza B viruses (B/Shangdong/7/97, B/Hong Kong/330/2001, B/Jillin/20/2003, B/Shanghai/361/2002, B/Yamagata/16/88, B/Beijing/76/98, B/Panama/45/90, B/Hawaii/10/2001, and B/Jiangsu/10/2003) were obtained from the National Institute for Biological Standards and Control (NIBSC, UK). All viruses were propagated in 11-day-old specific-pathogen-free (SPF) embryonated hen’s eggs (Charles River, Jinan, China) or in Madin–Darby canine kidney (MDCK) cells, which were maintained in Eagle’s minimal essential medium (MEM) supplemented with 10% fetal bovine serum. Virus-infected MDCK cells were maintained in MEM with 0.025 g/ml of TPCKtreated trypsin (Invitrogen, Life Technologies, Carlsbad, CA, USA). 2.2. Primer selection Primers were designed on the basis of sequence information from the Influenza Sequence Database of Los Alamos National Laboratories, Los Alamos, New Mexico (http://www.flu.lanl.gov). Multiple sequence alignments were performed using the alignment program of MAFFT version 6 from the Medical Institute of Bioregulation, Kyushu University (http://align.bmr.kyushuu.ac.jp/mafft/online/serv-er). Regions of naturally occurring sequence diversity were identified to design virus strainspecific primers. The primers were designed to have an annealing temperature of ∼58–60 ◦ C and to minimize baseparing at the 3 -end of the primer binding site for the majority of wild-type influenza B viruses. Positive control primers were chosen to amplify the two internal PB2 and PB1 genes that are highly conserved among all influenza B viruses (PB2-F: 5 -gcaggaataccaagagaatc-3 ; PB2-R: 5 tcttgagaaaataccatgca-3 ; PB1-F: 5 -tagtagttgaaaacttccc-3 ; and PB1-R: 5 -cagtaacttttctttttgctc-3 ). All of the primers were synthesized using a DNA synthesizer (PerkinElmer, Foster City, CA, USA and Cosmogenetech, Seoul, Korea). 2.3. RNA isolation and cDNA synthesis Total RNA was isolated from virus-infected MDCK cells grown in 6-well plates (about 1 × 105 cells per well) using the easyBLUETM Total RNA Extraction kit (INtRON Biotechnology, Korea) according to the manufacturer’s protocol. The concentration of RNA was measured spectrophotometrically at 260 nm, and stored at −70 ◦ C. The reverse transcription (RT) reaction was performed using the Omniscript Reverse Transcriptase kit (Qiagen, Valencia, Germany) according to the manufacturer’s protocol. Each reaction contained 5.25 l RNase-free water, 1 l 10× RT buffer, 1 l 5 mM of each dNTPs, 0.5 l Omniscript reverse transcriptase, 0.25 l RNase inhibitor (10,000 unit), 10 pmol synthesized 18mer oligo-dT primer, and 800 ng total RNA (1 l).
The thermal cycler program for the RT reaction was as follows (per cycle): 37 ◦ C for 60 min, 95 ◦ C for 5 min, and 4 ◦ C for 5 min. 2.4. Polymerase chain reaction (PCR) The PCR was performed using 50 ng cDNA and 48 l of a master mixture containing 28.5 l distilled water, 5 l 1× i-Taq enzyme buffer (INtRON Biotechnology, Korea), 4 l 4 mM of each dNTP (Takara, Japan), 10 l of a 10 pmol mixture of each primer set, and 1 U i-Taq polymerase (0.5 l) (INtRON Biotechnology, Korea). The reaction was performed on a PE 9700 thermocycler (Applied Biosystems, PerkinElmer) using the following cycling conditions: 94 ◦ C for 5 min, 25 cycles of 94 ◦ C for 1 min, 57 ◦ C for 1 min, and 72 ◦ C for 2 min, and a final extension step at 72 ◦ C for 7 min. The PCR products were resolved by electrophoresis on 2% agarose gels, stained by ethidium bromide (0.2 g/ml) and visualized by a UV transilluminator. 2.5. Sequencing Amplified RT-PCR products from the reassortant viruses were sequenced directly to confirm their origins. Sequencing was performed by Cosmogenetech, Seoul, Korea, using the ABI 3730XL automated sequencing machine (Applied Biosystems, Foster City, CA, USA). 3. Results 3.1. Design of B/Lee/40ca specific primers Strain-specific and segment-specific primer pairs were designed to match the B/Lee/40ca genome but result in mismatched base pairs at the 3 -end of the primer binding site for non-homologous wild-type influenza B viruses. The number of individual influenza B virus sequences used for the alignment of each gene segment were 56 for PB2, 65 for PB1, 64 for PA, 59 for HA, 70 for NP, 110 for NA, 58 for M, and 50 for NS gene. Each primer pair was validated to amplify specific products from the attenuated vaccine donor strain B/Lee/40ca and not to amplify products from wild-type influenza B viruses. To determine the specificity of the primer pairs, five influenza B strains (B/Lee/40ca, B/Panama/45/90, B/Beijing/76/98, B/Jilin/20/2003, and B/Shangdong/7/97) were examined. From the initial screening, low-specificity primer pairs were excluded and primer pairs with high-specificity (Table 1) were further tested using five additional wild-type influenza B virus strains (B/Yamagata/16/88, B/Shanghai/361/2002, B/Jiangsu/10/2003, B/Hawaii/10/2001, and B/Hong Kong/330/2001) (data not shown). A subset of the validation experiments are shown in Fig. 1, and a summary of the amplified PCR products for each virus strain/primer set combination are shown in Table 2. The positive control primers were chosen from conserved regions of the PB2 and PB1 genes and included in each reaction (Fig. 1, lanes 19, 20, 36, and 37). 3.2. Selection of multiplex primer sets specific for the cold-adapted donor virus A multiplex RT-PCR format was developed that enabled the simultaneous amplification of multiple RNA influenza gene segments. Since the RT-PCR products for the different gene segments can be easily distinguished by size, three different multiplex reactions were tested, each composed of two or three segment-specific primer pairs (Table 3). All eight segment-specific PCR products were amplified successfully when B/Lee/40ca RNA was used as a template and no nonspecific bands were observed. Further, no PCR
E.-Y. Lee et al. / Journal of Virological Methods 165 (2010) 133–138
135
Table 1 Oligonucleotide primers used for RT-PCR amplification of B/Lee/40ca virus. Segment
a
PCR products
Positiona
Length (bp)
Sense primer
Anti-sense primer
PB2
B-PB2-1 B-PB2-2 B-PB2-3 B-PB2-4
37–831 37–1024 37–1708 151–2011
795 988 1672 1861
5 -1 AAATTGAACTACTAAAGCAGC 5 -1 AAATTGAACTACTAAAGCAGC 5 -1 AAATTGAACTACTAAAGCAGC 5 -2 AGAACCCTTCATTGAGAATG
3 -1 TGATTATCTTCCTGCAGGCT 3 -2 CTCTTTAGTTCAAGTCTCCC 3 -3 TTCAATGTTACTAAATTTTTAAGC 3 -4 GGATTGTAGGAGAACAAGGG
PB1
B-PB1-1 B-PB1-2 B-PB1-3 B-PB1-4 B-PB1-5
1303–1979 194–929 194–1655 372–1979 194–1979
677 736 1476 1608 1786
5 -3 GGCATCTCTTTCGCCAGG 5 -1 TGATGTTACAGGATGTGTAAT 5 -1 TGATGTTACAGGATGTGTAAT 5 -2 ACAGTGGACAAATTGACTCAG 5 -1 TGATGTTACAGGATGTGTAAT
3 -3 GAGGATGCAGTAACCGTCC 3 -1 TGTCACAGTCATACTGACCC 3 -2 ATTCATTCACTCCAGCGAC 3 -3 GAGGATGCAGTAACCGTCC 3 -3 GAGGATGCAGTAACCGTCC
PA
B-PA-1 B-PA-2 B-PA-3 B-PA-4 B-PA-5
785–1278 187–722 785–1513 187–1278 187–1513
494 538 729 1092 1327
5 -2 TACACCCAAAAGTTGAAGTG 5 -1 TTCTTGATGAGGAAGGAAAGA 5 -2 TACACCCAAAAGTTGAAGTG 5 -1 TTCTTGATGAGGAAGGAAAGA 5 -1 TTCTTGATGAGGAAGGAAAGA
3 -2 TTTTACTTGTCAGAGTACTTAG 3 -1 TTGTCTATGTAACTTCTCATCT 3 -3 ATGTCAAAGCTTTCCCCTTC 3 -2 TTTTACTTGTCAGAGTACTTAG 3 -3 ATGTCAAAGCTTTCCCCTTC
HA
B-HA-1 B-HA-2 B-HA-3 B-HA-4
172–463 521–814 664–1350 172–1350
292 294 687 1179
5 -1 CTAACAACAACACCTACCAG 5 -2 ATAGGAACGGCTTCTTCAAC 5 -3 GACAAAACCCAAATGGAAAGA 5 -1 CTAACAACAACACCTACCAG
3 -1 TCTCTGCATTGATAACATTACT 3 -2 CAATTCTGCCGCTTTGTTTTAA 3 -3 GAGTATTTCGTCGTGAAGCC 3 -3 GAGTATTTCGTCGTGAAGCC
NP
B-NP-1 B-NP-2 B-NP-3 B-NP-4 B-NP-5 B-NP-6
1238–1423 1238–1594 689–1264 292–901 292–1030 292–1264
186 357 576 610 739 973
5 -3 ATGAAGATCTAAGAGTGTTA 5 -3 ATGAAGATCTAAGAGTGTTA 5 -2 GATCAAAGGCACTGAAAAGG 5 -1 GTCTACAACATGGTGGTAAAG 5 -1 GTCTACAACATGGTGGTAAAG 5 -1 GTCTACAACATGGTGGTAAAG
3 -4 CTCCACTTACTTCATTCCCT 3 -5 TGGTTTTCTTTGCCATCGAA 3 -3 GTGCAGATAACACTCTTAGA 3 -1 TGCATCACGTCCTTCAACG 3 -2 TGACAACTATCATGCTTCTG 3 -3 GTGCAGATAACACTCTTAGA
NA
B-NA-1 B-NA-2
266–538 220–250
273 1031
5 -2 GACATTTCCACCCCCAGAGC 5 -1 ACGCATCAAATGCCCAGACT
3 -1 CCCAATTTGACTGATACTAG 3 -2 TACTCCACTAAGAGTAAGAG
M
B-M-1 B-M-2 B-M-3
651–913 482–913 413–913
263 432 501
5 -3 TGGAGTGTTGAGATCTCTAG 5 -2 AACAAGCATCGCACTCGCATA 5 -1 TCATGTACCTAAACCCTGAA
3 -1 GCCTCCTTATTTGGATTCCT 3 -1 GCCTCCTTATTTGGATTCCT 3 -1 GCCTCCTTATTTGGATTCCT
NS
B-NS-1 B-NS-2 B-NS-3 B-NS-4
360–526 446–704 360–627 168–471
167 259 268 304
5 -2 AAATCCCTTAACTAGCAAA 5 -3 AGCCGGAAAATGTCGATCAC 5 -2 AAATCCCTTAACTAGCAAA 5 -1 TCCTGGTCAAGACCGCCTAC
3 -2 CATCCCTTATCTTTTGTCG 3 -4 GCCTCCTTATTTGGATTCCT 3 -3 CCTGAGGAAGGTTCCGTTC 3 -1 AATTGGGTGATCGACATTT
Nucleotide positions represents the nucleotide from the 5 -end of the positive sense genome.
Table 2 Specificities of RT-PCR of B/Lee/40ca virusa . Viruses
Genome segments (number of primer sets for each RNA)
B/Lee/40ca B/Panama/45/90 B/Beijing/76/98 B/Jilin/20/2003 B/Shangdong/7/97 B/Yamagata/16/88 B/Shahai/361/2002 B/Jiangsu/10/2003 B/Hawaii/10/2001 B/Hongkong/330/2001
PB2 (1–4)
PB1 (1–5)
PA (1–5)
HA (1–4)
NP (1–6)
NA (1–2)
M (1–3)
NS (1–4)
All – – – – 1, 4 – 4 2 –
All – – – – – 1, 2, 4 – – –
All – – – – 2, 4, 5 – – – –
All – – – – – – – – –
All – – – – – – 4 – –
All – – – – – – – – –
All – – – – – 3 2 – –
All – – – – 1, 3 – 1 – –
a Summary of the RT-PCR amplification of various influenza B viruses with primers designed for B/Lee/40ca virus. Numbers in table represents the primer set number that allowed the amplification of PCR product.
products were generated from the wild-type B/Yamagata/16/88 under the same conditions (Fig. 2). These results indicate that the selected primer sets, even when combined in a multiplex reaction, specifically amplified only the desired products of the expected
sizes, which could be easily distinguished by agarose gel electrophoresis.
Table 3 Primer sets used for three-tube multiplex RT-PCR.
The feasibility of the three-tube multiplex RT-PCR system was then extended to demonstrate its utility for genotyping and selection of live-attenuated vaccine candidates. For this purpose, reassortant viruses were generated by co-infection of 10- to 11-day-old embryonated hen’s eggs with B/Lee/40ca and B/Shangdong/7/97 viruses (Maassab and Bryant, 1999; Seo et al., 2008). Then, MDCK cells were infected with each plaque purified virus, and total RNA was extracted from the virus-infected cells.
Primer
Segment-specific
Primer set (test tube) (I)
(II)
(III)
PB2-2 (988 bp) PB1-6 (677 bp) M-14 (263 bp)
NP-11 (610 bp) PA-9 (494 bp) NS-15 (259 bp)
HA-16 (687 bp) NA-21 (273 bp)
3.3. Screening of reassortant viruses
136
E.-Y. Lee et al. / Journal of Virological Methods 165 (2010) 133–138
Fig. 1. RT-PCR analysis of five wild-type influenza B test strains using segment-specific primer pairs for the B/Lee/40ca strain, as shown in Table 1. Total RNA from each virus was mixed and annealed to segment-specific primers to B/Lee/40ca for RT-PCR amplification. The PCR products were separated on a 2% agarose gel and stained with ethidium bromide. Segment-specific primers are PB2 (lanes 1–4), PB1 (lanes 5–9), PA (lanes 10–14), HA (lanes 15–18), NA (lanes 19, 20, 36 and 37), NP (lanes 21–26), NA (lanes 27 and 28), M (lanes 29–31), and NS (lanes 32–35), respectively. The data are summarized in Table 2. Positive control (Ctrl) primers were chosen for the two internal PB2 and PB1 genes that are highly conserved among all influenza B viruses.
Using the three-tube multiplex RT-PCR system, the genome origin was identified for each reassortant virus (Fig. 3). From 15 independent plaque isolates, eight distinct RNA genotypes were identified. The genome composition, as deduced from the pattern of PCR products, is summarized in Table 4. Each target RNA was amplified specifically without production of nonspecific PCR products (Fig. 3). The multiplex genotyping procedure enabled the identification of a reassortant with the desired 6:2 RNA constellation (Fig. 3, R-8). This isolate contained the six genome segments that encode the intracellular protein, inherited from the attenuated donor virus B/Lee/40ca, and two genome segments encoding the HA and NA surface glycoproteins, inherited from the wild-type B/Shangdong/9/97 virus. Other reassortant clones displayed various combinations of the RNA segments, such as 7:1 (R-1, R-4, and
R-5), 6:2 (R-2 and R-3), and 5:3 (R-6 and R-7), respectively. The RTPCR experiment was repeated three times using the same primer sets with similar results (data not shown). The whole genome of the R-8 reassortant virus was sequenced directly, confirming the origins of each RNA segment and verifying the accuracy of the multiplex RT-PCR method. 4. Discussion Live-attenuated influenza virus vaccines (LAIV) provide effective and broad-spectrum protection against various influenza strains (Belshe et al., 2004; Seo et al., 2007; Suguitan et al., 2006). This report describes the development of a multiplex RT-PCR system that can identify simultaneously the origin of each genome
E.-Y. Lee et al. / Journal of Virological Methods 165 (2010) 133–138
Fig. 2. Simultaneous detection of influenza RNAs by a three-tube multiplex RT-PCR. B/Lee/40ca and B/Yamagata/16/88 viruses are used for comparison. Lane M: 1 kb ladder molecular weight marker; lanes 1 and 4: PB2 (988 bp), PB1 (677 bp), and M (263 bp); lanes 2 and 5: NP (610 bp), PA (494 bp), and NS (255 bp); lanes 3 and 6: HA (687 bp) and NA (273 bp); lanes 7 and 8: positive control.
segment of reassortant isolates to facilitate the process of trivalent live-attenuated vaccine manufacturing. A number of methods have been reported for genotyping influenza viruses, such as polyacrylamide gel electrophoresis (PAGE) analysis in partial denaturing conditions (Palese and Schulman, 1976), DNA–RNA hybridizations (Nerome et al., 1983), multiplex RT-PCR followed by florescent single-strand conformation polymorphism analysis (Cha et al., 1997), RT-PCR followed by digestion of PCR products with restriction enzymes (Cooper and Subbarao, 2000; Klimov and Cox, 1995; Offringa et al., 2000; Sakamoto et al., 1996), and a heteroduplex
137
mobility assay (HMA) (Ellis and Zambon, 2001). While these techniques are reliable, they are laborious, time-consuming, and in some cases expensive. The present system utilizes three sets of multiple segmentspecific primer pairs. Multiplex RT-PCR has been employed widely as a highly sensitive and specific method for the detection of infectious diseases, including influenza viruses (Chi et al., 2007; Poddar, 2002; Stockton et al., 1998). Recently reverse genetic techniques have been developed that allow the generation of vaccine reassortant strains from cDNAs (Hoffmann et al., 2000, 2002; Neumann et al., 1999). While this method has been used for the development of a vaccine against the highly pathogenic avian influenza (HPAI) (Shi et al., 2007; Song et al., 2009; Suguitan et al., 2006), it has yet to be used to manufacture seasonal human influenza vaccines. Therefore, the selection of vaccine strains still relies on classical reassortment of wild-type and vaccine donor viruses, and the identification of isolated reassortant viruses with the desired genetic composition. The present multiplex RT-PCR method for identification of influenza B vaccine strains, in combination with a similar method developed for influenza A vaccine strains (Ha et al., 2006), would be instrumental for the generation of the trivalent vaccine formula according to the annual WHO recommendations. The design of the primers to include a mismatched base at the 3 -terminus enhanced the specificity and prevented amplification of non-homologous strains (Kwok et al., 1990). In this study, the specificity of the primer pairs were tested against nine different heterologous wild-type influenza B viruses and the cold-adapted
Fig. 3. Genotyping of reassortant influenza B viruses by a three-tube multiplex RT-PCR. Lane M: 1-kb ladder molecular weight marker; lane 1: PB2 (988 bp), PB1 (677 bp), and M (263 bp); lane 2: NP (610 bp), PA (494 bp), and NS (255 bp); lane 3: HA (687 bp) and NA (273 bp); lanes 4 and 5: HA (1112 bp) and NA (1382 bp) specific for B/Shandong/7/97 virus, respectively. Table 4 Genotyping and identification of the origin of RNA segments in reassortant viruses. Clone no.
RNA ratio (B/Lee/40ca vs. B/Shangdong/7/97)
Segment derived from B/Lee/40ca
Segment derived from B/Shangdong/7/97
Re-1 Re-2 Re-3 Re-4 Re-5 Re-6 Re-7
7:1 6:2 6:2 7:1 7:1 5:3 5:3
PB2, PB1, PA, NP, NA, M, NS PB2, PB1, PA, NP, NA, M PB2, PB1, HA, NP, NA, M PB2, PB1, PA, HA, NP, NA, M PB2, PB1, PA, HA, NP, NA, NS PB2, PA, HA, NP, NA, PB2, HA, NP, M, NS
HA HA, NS PA, NS NS NA PB1, M, NS PB2, PA, NA
138
E.-Y. Lee et al. / Journal of Virological Methods 165 (2010) 133–138
B/Lee/40ca homologous virus, and only the primers specific for B/Lee/40ca virus were selected for the multiplex reactions (Table 1). In some instances, a ∼350 bp PCR product also was amplified from the NA primer pair (Fig. 1, lane 27), but this did not create difficulties for analyzing the results. No other nonspecific PCR products were observed for any of the other primer pairs. The present multiplex RT-PCR was adopted for up to three sets of primer pairs per tube. A prerequisite for a multiplex RT-PCR assay is the generation of PCR products that can be distinguished easily by size after gel electrophoresis. A single-tube multiplex RT-PCR that allows identification of all eight influenza RNAs in one reaction would be an ideal experimental set-up. However, we were not able to design suitable primer combinations that enable amplification of all eight gene segments in a single-tube reaction. From the five possible multiplex combinations tested with B/Yamagata/16/88 and B/Lee/40ca viruses (data not shown), the sets of primer pairs that optimally amplify all of the RNA segments is shown in Table 3. Using the three-tube multiplex RT-PCR system, the feasibility of this system for genotyping a pool of reassortant viruses from the mixed infection of attenuated donor virus and wild-type virus (Fig. 3 and Table 4) was demonstrated. The origin of each gene segment of the 6:2 genome composition vaccine candidates was confirmed by direct sequencing of each RT-PCR product. In conclusion, the strain-specific multiplex RT-PCR system was shown to provide an efficient method for genotyping and screening of candidate influenza B reassortant vaccine strains. This method could be implemented to expedite the generation of each component strain, to allow more time to culture and process the final seasonal influenza vaccine, and to minimize the morbidity and mortality associated with influenza infections. Acknowledgements This work was supported by a contract research grant from the Korea Food and Drug Administration (KFDA) (06092-KFDA346), a grant from the Ministry of Health, Welfare, and Family Affairs (A085105) from the Korean Government, and from Biotrion Co., Seoul, Korea. References Bardiya, N., Bae, J.H., 2005. Influenza vaccines: recent advances in production technologies. Appl. Microbiol. Biotechnol. 67, 299–305. Beigel, J., Bray, M., 2008. Current and future antiviral therapy of severe seasonal and avian influenza. Antiviral Res. 78, 91–102. Beigel, J.H., 2008. Influenza. Crit. Care Med. 36, 2660–2666. Belshe, R., Lee, M.S., Walker, R.E., Stoddard, J., Mendelman, P.M., 2004. Safety, immunogenicity and efficacy of intranasal, live attenuated influenza vaccine. Expert Rev. Vaccines 3, 643–654. Belshe, R.B., 2004. Current status of live attenuated influenza virus vaccine in the US. Virus Res. 103, 177–185. Carrat, F., Flahault, A., 2007. Influenza vaccine: the challenge of antigenic drift. Vaccine 25, 6852–6862. Cha, T.A., Zhao, J., Lane, E., Murray, M.A., Stec, D.S., 1997. Determination of the genome composition of influenza virus reassortants using multiplex reverse transcription-polymerase chain reaction followed by fluorescent single-strand conformation polymorphism analysis. Anal. Biochem. 252, 24–32. Chi, X.S., Li, F., Tam, J.S., Rappaport, R., Cheng, S.M., 2007. Semiquantitative onestep RT-PCR for simultaneous identification of human influenza and respiratory syncytial viruses. J. Virol. Methods 139, 90–92. Cooper, L.A., Subbarao, K., 2000. A simple restriction fragment length polymorphismbased strategy that can distinguish the internal genes of human H1N1, H3N2, and H5N1 influenza A viruses. J. Clin. Microbiol. 38, 2579–2583. Cox, R.J., Brokstad, K.A., Ogra, P., 2004. Influenza virus: immunity and vaccination strategies. Comparison of the immune response to inactivated and live, attenuated influenza vaccines. Scand. J. Immunol. 59, 1–15.
De Clercq, E., 2004. Antiviral drugs in current clinical use. J. Clin. Virol. 30, 115–133. Ellis, J.S., Zambon, M.C., 2001. Combined PCR-heteroduplex mobility assay for detection and differentiation of influenza A viruses from different animal species. J. Clin. Microbiol. 39, 4097–4102. Ha, S.H., Kim, H.A., Kim, Y.H., Kim, J.S., Lee, K.H., Park, S.Y., Park, W.J., Seong, B.L., 2006. A multiplex RT-PCR method for screening of reassortant live influenza vaccine virus strains. J. Virol. Methods 134, 154–163. Hampson, A.W., Mackenzie, J.S., 2006. The influenza viruses. Med. J. Aust. 185, S39–S43. Hoffmann, E., Krauss, S., Perez, D., Webby, R., Webster, R.G., 2002. Eight-plasmid system for rapid generation of influenza virus vaccines. Vaccine 20, 3165–3170. Hoffmann, E., Neumann, G., Kawaoka, Y., Hobom, G., Webster, R.G., 2000. A DNA transfection system for generation of influenza A virus from eight plasmids. Proc. Natl. Acad. Sci. U.S.A. 97, 6108–6113. Intharathep, P., Laohpongspaisan, C., Rungrotmongkol, T., Loisruangsin, A., Malaisree, M., Decha, P., Aruksakunwong, O., Chuenpennit, K., Kaiyawet, N., Sompornpisut, P., Pianwanit, S., Hannongbua, S., 2008. How amantadine and rimantadine inhibit proton transport in the M2 protein channel. J. Mol. Graph. Model. 27, 342–348. Klimov, A.I., Cox, N.J., 1995. PCR restriction analysis of genome composition and stability of cold-adapted reassortant live influenza vaccines. J. Virol. Methods 52, 41–49. Kwok, S., Kellogg, D.E., McKinney, N., Spasic, D., Goda, L., Levenson, C., Sninsky, J.J., 1990. Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus type 1 model studies. Nucleic Acids Res. 18, 999–1005. Maassab, H.F., Bryant, M.L., 1999. The development of live attenuated cold-adapted influenza virus vaccine for humans. Rev. Med. Virol. 9, 237–244. Moscona, A., 2008. Medical management of influenza infection. Annu. Rev. Med. 59, 397–413. Nerome, K., Sakamoto, S., Yano, N., Yamamoto, T., Kobayashi, S., Webster, R.G., Oya, A., 1983. Antigenic characteristics and genome composition of a naturally occurring recombinant influenza virus isolated from a pig in Japan. J. Gen. Virol. 64 (Pt 12), 2611–2620. Neumann, G., Watanabe, T., Ito, H., Watanabe, S., Goto, H., Gao, P., Hughes, M., Perez, D.R., Donis, R., Hoffmann, E., Hobom, G., Kawaoka, Y., 1999. Generation of influenza A viruses entirely from cloned cDNAs. Proc. Natl. Acad. Sci. U.S.A. 96, 9345–9350. Offringa, D.P., Tyson-Medlock, V., Ye, Z., Levandowski, R.A., 2000. A comprehensive systematic approach to identification of influenza A virus genotype using RT-PCR and RFLP. J. Virol. Methods 88, 15–24. Ohmit, S.E., Victor, J.C., Teich, E.R., Truscon, R.K., Rotthoff, J.R., Newton, D.W., Campbell, S.A., Boulton, M.L., Monto, A.S., 2008. Prevention of symptomatic seasonal influenza in 2005–2006 by inactivated and live attenuated vaccines. J. Infect. Dis. 198, 312–317. Palese, P., Schulman, J.L., 1976. Differences in RNA patterns of influenza A viruses. J. Virol. 17, 876–884. Poddar, S.K., 2002. Influenza virus types and subtypes detection by single step single tube multiplex reverse transcription-polymerase chain reaction (RT-PCR) and agarose gel electrophoresis. J. Virol. Methods 99, 63–70. Sakamoto, S., Kino, Y., Oka, T., Herlocher, M.L., Maassab, F., 1996. Gene analysis of reassortant influenza virus by RT-PCR followed by restriction enzyme digestion. J. Virol. Methods 56, 161–171. Seo, S.U., Byun, Y.H., Lee, E.Y., Jung, E.J., Jang, Y.H., Kim, H.A., Ha, S.H., Lee, K.H., Seong, B.L., 2008. Development and characterization of a live attenuated influenza B virus vaccine candidate. Vaccine 26, 874–8781. Seo, S.U., Lee, K.H., Byun, Y.H., Kweon, M.N., Seong, B.L., 2007. Immediate and broadspectrum protection against heterologous and heterotypic lethal challenge in mice by live influenza vaccine. Vaccine 25, 8067–8076. Shi, H., Liu, X.F., Zhang, X., Chen, S., Sun, L., Lu, J., 2007. Generation of an attenuated H5N1 avian influenza virus vaccine with all eight genes from avian viruses. Vaccine 25, 7379–7384. Song, M.S., Oh, T.K., Pascua, P.N., Moon, H.J., Lee, J.H., Baek, Y.H., Woo, K.J., Yoon, Y., Sung, M.H., Poo, H., Kim, C.J., Choi, Y.K., 2009. Investigation of the biological indicator for vaccine efficacy against highly pathogenic avian influenza (HPAI) H5N1 virus challenge in mice and ferrets. Vaccine 27, 3145–3152. Stockton, J., Ellis, J.S., Saville, M., Clewley, J.P., Zambon, M.C., 1998. Multiplex PCR for typing and subtyping influenza and respiratory syncytial viruses. J. Clin. Microbiol. 36, 2990–2995. Suguitan Jr., A.L., McAuliffe, J., Mills, K.L., Jin, H., Duke, G., Lu, B., Luke, C.J., Murphy, B., Swayne, D.E., Kemble, G., Subbarao, K., 2006. Live, attenuated influenza A H5N1 candidate vaccines provide broad cross-protection in mice and ferrets. PLoS Med. 3, 1541–1555. Wareing, M.D., Tannock, G.A., 2001. Live attenuated vaccines against influenza; an historical review. Vaccine 19, 3320–3330. Wright, P.F., Newman, G., Kawaoka, Y., 2007. Orthomyxoviruses. In: Knipe, D.M., Howley, P.M., Griffin, D.E. (Eds.), Fields Virology. Lippincott Williams and Wilkins, a Wolters Kluwer Business, Philadelphia, pp. 1691–1740.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Genotyping and screening of reassortant live-attenuated influenza B vaccine strain Eun-Young Lee a,1 , Kwang-Hee Lee a,1 , Eun-Ju Jung a , Yo Han Jang a , Sang-Uk Seo a , Hyun-Ah Kim b , Baik Lin Seong a,∗ a b
Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, 134 Shinchon-Dong, Seodaemun-Gu, Seoul 120-749, South Korea R&D Center of Pharmaceuticals, CJ Corp., 522-1, Dokpyong-Ri, Majang-Myun, Ichon-Si, Kyonggi-Do 467-180, South Korea
a b s t r a c t Article history: Received 13 July 2009 Received in revised form 16 October 2009 Accepted 22 October 2009 Available online 31 October 2009 Keywords: Influenza B virus Reassortants Multiplex RT-PCR Genotyping Live vaccine
Live-attenuated influenza virus vaccines can be generated by reassortment of gene segments between an attenuated donor strain and a virulent wild-type virus. The annual production schedule for the seasonal influenza vaccine necessitates rapid and efficient genotyping of the reassorted progeny to identify the desired vaccine strains. This study describes a multiplex RT-PCR system capable of identifying each gene segment from the cold-adapted attenuated donor virus, B/Lee/40ca. The specificity of the amplification system was optimized by testing various wild-type influenza B viruses. The resulting RT-PCR method is sensitive and efficient enough for routine identification of reassortant clones to identify the desired gene constellation, consisting of six segments from the attenuated donor virus and the H and N genes from the wild-type virus. By providing a more rapid and efficient means of genotyping the candidate reassortant strains, this method could be implemented to expedite the generation of each component strain and allow more time to culture and process the final seasonal influenza vaccine. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Influenza virus is an enveloped virus with a negative-sense segmented RNA genome that belongs to the Orthomyxoviridae family (Beigel, 2008). Influenza A and influenza B viruses are globally important respiratory human pathogens that cause annual epidemics and occasional pandemics necessitating annual vaccination against newly circulating strains. Annual influenza epidemics are caused typically by antigenic drift, point mutations within gene segments, while pandemics are typically caused by antigenic shift, the reassortment of a whole gene segment that changes completely the antigenicity of a circulating virus (Carrat and Flahault, 2007; Hampson and Mackenzie, 2006; Wright et al., 2007). Influenza specific antiviral drugs are able to reduce the extent of virus spread throughout the population (Beigel and Bray, 2008; De Clercq, 2004; Intharathep et al., 2008; Moscona, 2008), but vaccination remains the primary means of protecting people against influenza disease. Every year the World Health Organization (WHO) predicts the virus strains likely to circulate in the upcoming influenza season in each hemisphere and recommends three strains, two
∗ Corresponding author. Tel.: +82 2 2123 2885; fax: +82 2 362 7265. E-mail address: [email protected] (B.L. Seong). 1 These authors contributed equally to this work. 0166-0934/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2009.10.022
influenza A types and one influenza B type, to be included into the vaccine formulation. Currently, inactivated influenza vaccines are licensed worldwide, but live-attenuated influenza vaccines are used only in Russia and have been licensed recently in the USA (Bardiya and Bae, 2005; Belshe, 2004; Ohmit et al., 2008). Immunization with the live-attenuated influenza vaccine induces a broader immune response that resembles natural infection, which establishes better long-term immunity against influenza virus (Cox et al., 2004; Wareing and Tannock, 2001). The segmented nature of the influenza genome allows attenuated reassortant viruses to be produced by co-infecting cells with an attenuated influenza strain, which serves as the source of attenuated genes and a circulating wild-type human influenza virus. The co-infection results in a pool of reassortant viruses with a random combination of the eight RNA genomes from the two parental viruses. Among the 256 possible reassortants, it is necessary to isolate and identify the reassortant that inherited the two gene segments encoding the hemagglutinin (HA) and neuraminidase (NA) surface glycoproteins from the epidemic wild-type virus and the remaining six gene segments (PB2, PB1, PA, NP, M, and NS) from the attenuated donor virus (Maassab and Bryant, 1999; Seo et al., 2008). The tight schedule associated with the annual production of the trivalent influenza vaccine necessitates an accurate and rapid method to genotype reassortants to identify clones with the desired genetic constellation. Recently a multiplex RT-PCR
134
E.-Y. Lee et al. / Journal of Virological Methods 165 (2010) 133–138
technique was developed to identify rapidly gene segments originating from a live-attenuated influenza A virus strain (Ha et al., 2006). This report presents a similar multiplex RT-PCR system for genotyping reassortant influenza B viruses. This method could be implemented to facilitate progeny genotyping and expedite the production of the trivalent live-attenuated influenza vaccines each year. 2. Materials and methods 2.1. Viruses and cell The cold-adapted influenza B virus (B/Lee/40ca) was generated from repeated passages at low temperature in embryonated hen’s eggs, as previously described (Seo et al., 2008). Wild-type influenza B viruses (B/Shangdong/7/97, B/Hong Kong/330/2001, B/Jillin/20/2003, B/Shanghai/361/2002, B/Yamagata/16/88, B/Beijing/76/98, B/Panama/45/90, B/Hawaii/10/2001, and B/Jiangsu/10/2003) were obtained from the National Institute for Biological Standards and Control (NIBSC, UK). All viruses were propagated in 11-day-old specific-pathogen-free (SPF) embryonated hen’s eggs (Charles River, Jinan, China) or in Madin–Darby canine kidney (MDCK) cells, which were maintained in Eagle’s minimal essential medium (MEM) supplemented with 10% fetal bovine serum. Virus-infected MDCK cells were maintained in MEM with 0.025 g/ml of TPCKtreated trypsin (Invitrogen, Life Technologies, Carlsbad, CA, USA). 2.2. Primer selection Primers were designed on the basis of sequence information from the Influenza Sequence Database of Los Alamos National Laboratories, Los Alamos, New Mexico (http://www.flu.lanl.gov). Multiple sequence alignments were performed using the alignment program of MAFFT version 6 from the Medical Institute of Bioregulation, Kyushu University (http://align.bmr.kyushuu.ac.jp/mafft/online/serv-er). Regions of naturally occurring sequence diversity were identified to design virus strainspecific primers. The primers were designed to have an annealing temperature of ∼58–60 ◦ C and to minimize baseparing at the 3 -end of the primer binding site for the majority of wild-type influenza B viruses. Positive control primers were chosen to amplify the two internal PB2 and PB1 genes that are highly conserved among all influenza B viruses (PB2-F: 5 -gcaggaataccaagagaatc-3 ; PB2-R: 5 tcttgagaaaataccatgca-3 ; PB1-F: 5 -tagtagttgaaaacttccc-3 ; and PB1-R: 5 -cagtaacttttctttttgctc-3 ). All of the primers were synthesized using a DNA synthesizer (PerkinElmer, Foster City, CA, USA and Cosmogenetech, Seoul, Korea). 2.3. RNA isolation and cDNA synthesis Total RNA was isolated from virus-infected MDCK cells grown in 6-well plates (about 1 × 105 cells per well) using the easyBLUETM Total RNA Extraction kit (INtRON Biotechnology, Korea) according to the manufacturer’s protocol. The concentration of RNA was measured spectrophotometrically at 260 nm, and stored at −70 ◦ C. The reverse transcription (RT) reaction was performed using the Omniscript Reverse Transcriptase kit (Qiagen, Valencia, Germany) according to the manufacturer’s protocol. Each reaction contained 5.25 l RNase-free water, 1 l 10× RT buffer, 1 l 5 mM of each dNTPs, 0.5 l Omniscript reverse transcriptase, 0.25 l RNase inhibitor (10,000 unit), 10 pmol synthesized 18mer oligo-dT primer, and 800 ng total RNA (1 l).
The thermal cycler program for the RT reaction was as follows (per cycle): 37 ◦ C for 60 min, 95 ◦ C for 5 min, and 4 ◦ C for 5 min. 2.4. Polymerase chain reaction (PCR) The PCR was performed using 50 ng cDNA and 48 l of a master mixture containing 28.5 l distilled water, 5 l 1× i-Taq enzyme buffer (INtRON Biotechnology, Korea), 4 l 4 mM of each dNTP (Takara, Japan), 10 l of a 10 pmol mixture of each primer set, and 1 U i-Taq polymerase (0.5 l) (INtRON Biotechnology, Korea). The reaction was performed on a PE 9700 thermocycler (Applied Biosystems, PerkinElmer) using the following cycling conditions: 94 ◦ C for 5 min, 25 cycles of 94 ◦ C for 1 min, 57 ◦ C for 1 min, and 72 ◦ C for 2 min, and a final extension step at 72 ◦ C for 7 min. The PCR products were resolved by electrophoresis on 2% agarose gels, stained by ethidium bromide (0.2 g/ml) and visualized by a UV transilluminator. 2.5. Sequencing Amplified RT-PCR products from the reassortant viruses were sequenced directly to confirm their origins. Sequencing was performed by Cosmogenetech, Seoul, Korea, using the ABI 3730XL automated sequencing machine (Applied Biosystems, Foster City, CA, USA). 3. Results 3.1. Design of B/Lee/40ca specific primers Strain-specific and segment-specific primer pairs were designed to match the B/Lee/40ca genome but result in mismatched base pairs at the 3 -end of the primer binding site for non-homologous wild-type influenza B viruses. The number of individual influenza B virus sequences used for the alignment of each gene segment were 56 for PB2, 65 for PB1, 64 for PA, 59 for HA, 70 for NP, 110 for NA, 58 for M, and 50 for NS gene. Each primer pair was validated to amplify specific products from the attenuated vaccine donor strain B/Lee/40ca and not to amplify products from wild-type influenza B viruses. To determine the specificity of the primer pairs, five influenza B strains (B/Lee/40ca, B/Panama/45/90, B/Beijing/76/98, B/Jilin/20/2003, and B/Shangdong/7/97) were examined. From the initial screening, low-specificity primer pairs were excluded and primer pairs with high-specificity (Table 1) were further tested using five additional wild-type influenza B virus strains (B/Yamagata/16/88, B/Shanghai/361/2002, B/Jiangsu/10/2003, B/Hawaii/10/2001, and B/Hong Kong/330/2001) (data not shown). A subset of the validation experiments are shown in Fig. 1, and a summary of the amplified PCR products for each virus strain/primer set combination are shown in Table 2. The positive control primers were chosen from conserved regions of the PB2 and PB1 genes and included in each reaction (Fig. 1, lanes 19, 20, 36, and 37). 3.2. Selection of multiplex primer sets specific for the cold-adapted donor virus A multiplex RT-PCR format was developed that enabled the simultaneous amplification of multiple RNA influenza gene segments. Since the RT-PCR products for the different gene segments can be easily distinguished by size, three different multiplex reactions were tested, each composed of two or three segment-specific primer pairs (Table 3). All eight segment-specific PCR products were amplified successfully when B/Lee/40ca RNA was used as a template and no nonspecific bands were observed. Further, no PCR
E.-Y. Lee et al. / Journal of Virological Methods 165 (2010) 133–138
135
Table 1 Oligonucleotide primers used for RT-PCR amplification of B/Lee/40ca virus. Segment
a
PCR products
Positiona
Length (bp)
Sense primer
Anti-sense primer
PB2
B-PB2-1 B-PB2-2 B-PB2-3 B-PB2-4
37–831 37–1024 37–1708 151–2011
795 988 1672 1861
5 -1 AAATTGAACTACTAAAGCAGC 5 -1 AAATTGAACTACTAAAGCAGC 5 -1 AAATTGAACTACTAAAGCAGC 5 -2 AGAACCCTTCATTGAGAATG
3 -1 TGATTATCTTCCTGCAGGCT 3 -2 CTCTTTAGTTCAAGTCTCCC 3 -3 TTCAATGTTACTAAATTTTTAAGC 3 -4 GGATTGTAGGAGAACAAGGG
PB1
B-PB1-1 B-PB1-2 B-PB1-3 B-PB1-4 B-PB1-5
1303–1979 194–929 194–1655 372–1979 194–1979
677 736 1476 1608 1786
5 -3 GGCATCTCTTTCGCCAGG 5 -1 TGATGTTACAGGATGTGTAAT 5 -1 TGATGTTACAGGATGTGTAAT 5 -2 ACAGTGGACAAATTGACTCAG 5 -1 TGATGTTACAGGATGTGTAAT
3 -3 GAGGATGCAGTAACCGTCC 3 -1 TGTCACAGTCATACTGACCC 3 -2 ATTCATTCACTCCAGCGAC 3 -3 GAGGATGCAGTAACCGTCC 3 -3 GAGGATGCAGTAACCGTCC
PA
B-PA-1 B-PA-2 B-PA-3 B-PA-4 B-PA-5
785–1278 187–722 785–1513 187–1278 187–1513
494 538 729 1092 1327
5 -2 TACACCCAAAAGTTGAAGTG 5 -1 TTCTTGATGAGGAAGGAAAGA 5 -2 TACACCCAAAAGTTGAAGTG 5 -1 TTCTTGATGAGGAAGGAAAGA 5 -1 TTCTTGATGAGGAAGGAAAGA
3 -2 TTTTACTTGTCAGAGTACTTAG 3 -1 TTGTCTATGTAACTTCTCATCT 3 -3 ATGTCAAAGCTTTCCCCTTC 3 -2 TTTTACTTGTCAGAGTACTTAG 3 -3 ATGTCAAAGCTTTCCCCTTC
HA
B-HA-1 B-HA-2 B-HA-3 B-HA-4
172–463 521–814 664–1350 172–1350
292 294 687 1179
5 -1 CTAACAACAACACCTACCAG 5 -2 ATAGGAACGGCTTCTTCAAC 5 -3 GACAAAACCCAAATGGAAAGA 5 -1 CTAACAACAACACCTACCAG
3 -1 TCTCTGCATTGATAACATTACT 3 -2 CAATTCTGCCGCTTTGTTTTAA 3 -3 GAGTATTTCGTCGTGAAGCC 3 -3 GAGTATTTCGTCGTGAAGCC
NP
B-NP-1 B-NP-2 B-NP-3 B-NP-4 B-NP-5 B-NP-6
1238–1423 1238–1594 689–1264 292–901 292–1030 292–1264
186 357 576 610 739 973
5 -3 ATGAAGATCTAAGAGTGTTA 5 -3 ATGAAGATCTAAGAGTGTTA 5 -2 GATCAAAGGCACTGAAAAGG 5 -1 GTCTACAACATGGTGGTAAAG 5 -1 GTCTACAACATGGTGGTAAAG 5 -1 GTCTACAACATGGTGGTAAAG
3 -4 CTCCACTTACTTCATTCCCT 3 -5 TGGTTTTCTTTGCCATCGAA 3 -3 GTGCAGATAACACTCTTAGA 3 -1 TGCATCACGTCCTTCAACG 3 -2 TGACAACTATCATGCTTCTG 3 -3 GTGCAGATAACACTCTTAGA
NA
B-NA-1 B-NA-2
266–538 220–250
273 1031
5 -2 GACATTTCCACCCCCAGAGC 5 -1 ACGCATCAAATGCCCAGACT
3 -1 CCCAATTTGACTGATACTAG 3 -2 TACTCCACTAAGAGTAAGAG
M
B-M-1 B-M-2 B-M-3
651–913 482–913 413–913
263 432 501
5 -3 TGGAGTGTTGAGATCTCTAG 5 -2 AACAAGCATCGCACTCGCATA 5 -1 TCATGTACCTAAACCCTGAA
3 -1 GCCTCCTTATTTGGATTCCT 3 -1 GCCTCCTTATTTGGATTCCT 3 -1 GCCTCCTTATTTGGATTCCT
NS
B-NS-1 B-NS-2 B-NS-3 B-NS-4
360–526 446–704 360–627 168–471
167 259 268 304
5 -2 AAATCCCTTAACTAGCAAA 5 -3 AGCCGGAAAATGTCGATCAC 5 -2 AAATCCCTTAACTAGCAAA 5 -1 TCCTGGTCAAGACCGCCTAC
3 -2 CATCCCTTATCTTTTGTCG 3 -4 GCCTCCTTATTTGGATTCCT 3 -3 CCTGAGGAAGGTTCCGTTC 3 -1 AATTGGGTGATCGACATTT
Nucleotide positions represents the nucleotide from the 5 -end of the positive sense genome.
Table 2 Specificities of RT-PCR of B/Lee/40ca virusa . Viruses
Genome segments (number of primer sets for each RNA)
B/Lee/40ca B/Panama/45/90 B/Beijing/76/98 B/Jilin/20/2003 B/Shangdong/7/97 B/Yamagata/16/88 B/Shahai/361/2002 B/Jiangsu/10/2003 B/Hawaii/10/2001 B/Hongkong/330/2001
PB2 (1–4)
PB1 (1–5)
PA (1–5)
HA (1–4)
NP (1–6)
NA (1–2)
M (1–3)
NS (1–4)
All – – – – 1, 4 – 4 2 –
All – – – – – 1, 2, 4 – – –
All – – – – 2, 4, 5 – – – –
All – – – – – – – – –
All – – – – – – 4 – –
All – – – – – – – – –
All – – – – – 3 2 – –
All – – – – 1, 3 – 1 – –
a Summary of the RT-PCR amplification of various influenza B viruses with primers designed for B/Lee/40ca virus. Numbers in table represents the primer set number that allowed the amplification of PCR product.
products were generated from the wild-type B/Yamagata/16/88 under the same conditions (Fig. 2). These results indicate that the selected primer sets, even when combined in a multiplex reaction, specifically amplified only the desired products of the expected
sizes, which could be easily distinguished by agarose gel electrophoresis.
Table 3 Primer sets used for three-tube multiplex RT-PCR.
The feasibility of the three-tube multiplex RT-PCR system was then extended to demonstrate its utility for genotyping and selection of live-attenuated vaccine candidates. For this purpose, reassortant viruses were generated by co-infection of 10- to 11-day-old embryonated hen’s eggs with B/Lee/40ca and B/Shangdong/7/97 viruses (Maassab and Bryant, 1999; Seo et al., 2008). Then, MDCK cells were infected with each plaque purified virus, and total RNA was extracted from the virus-infected cells.
Primer
Segment-specific
Primer set (test tube) (I)
(II)
(III)
PB2-2 (988 bp) PB1-6 (677 bp) M-14 (263 bp)
NP-11 (610 bp) PA-9 (494 bp) NS-15 (259 bp)
HA-16 (687 bp) NA-21 (273 bp)
3.3. Screening of reassortant viruses
136
E.-Y. Lee et al. / Journal of Virological Methods 165 (2010) 133–138
Fig. 1. RT-PCR analysis of five wild-type influenza B test strains using segment-specific primer pairs for the B/Lee/40ca strain, as shown in Table 1. Total RNA from each virus was mixed and annealed to segment-specific primers to B/Lee/40ca for RT-PCR amplification. The PCR products were separated on a 2% agarose gel and stained with ethidium bromide. Segment-specific primers are PB2 (lanes 1–4), PB1 (lanes 5–9), PA (lanes 10–14), HA (lanes 15–18), NA (lanes 19, 20, 36 and 37), NP (lanes 21–26), NA (lanes 27 and 28), M (lanes 29–31), and NS (lanes 32–35), respectively. The data are summarized in Table 2. Positive control (Ctrl) primers were chosen for the two internal PB2 and PB1 genes that are highly conserved among all influenza B viruses.
Using the three-tube multiplex RT-PCR system, the genome origin was identified for each reassortant virus (Fig. 3). From 15 independent plaque isolates, eight distinct RNA genotypes were identified. The genome composition, as deduced from the pattern of PCR products, is summarized in Table 4. Each target RNA was amplified specifically without production of nonspecific PCR products (Fig. 3). The multiplex genotyping procedure enabled the identification of a reassortant with the desired 6:2 RNA constellation (Fig. 3, R-8). This isolate contained the six genome segments that encode the intracellular protein, inherited from the attenuated donor virus B/Lee/40ca, and two genome segments encoding the HA and NA surface glycoproteins, inherited from the wild-type B/Shangdong/9/97 virus. Other reassortant clones displayed various combinations of the RNA segments, such as 7:1 (R-1, R-4, and
R-5), 6:2 (R-2 and R-3), and 5:3 (R-6 and R-7), respectively. The RTPCR experiment was repeated three times using the same primer sets with similar results (data not shown). The whole genome of the R-8 reassortant virus was sequenced directly, confirming the origins of each RNA segment and verifying the accuracy of the multiplex RT-PCR method. 4. Discussion Live-attenuated influenza virus vaccines (LAIV) provide effective and broad-spectrum protection against various influenza strains (Belshe et al., 2004; Seo et al., 2007; Suguitan et al., 2006). This report describes the development of a multiplex RT-PCR system that can identify simultaneously the origin of each genome
E.-Y. Lee et al. / Journal of Virological Methods 165 (2010) 133–138
Fig. 2. Simultaneous detection of influenza RNAs by a three-tube multiplex RT-PCR. B/Lee/40ca and B/Yamagata/16/88 viruses are used for comparison. Lane M: 1 kb ladder molecular weight marker; lanes 1 and 4: PB2 (988 bp), PB1 (677 bp), and M (263 bp); lanes 2 and 5: NP (610 bp), PA (494 bp), and NS (255 bp); lanes 3 and 6: HA (687 bp) and NA (273 bp); lanes 7 and 8: positive control.
segment of reassortant isolates to facilitate the process of trivalent live-attenuated vaccine manufacturing. A number of methods have been reported for genotyping influenza viruses, such as polyacrylamide gel electrophoresis (PAGE) analysis in partial denaturing conditions (Palese and Schulman, 1976), DNA–RNA hybridizations (Nerome et al., 1983), multiplex RT-PCR followed by florescent single-strand conformation polymorphism analysis (Cha et al., 1997), RT-PCR followed by digestion of PCR products with restriction enzymes (Cooper and Subbarao, 2000; Klimov and Cox, 1995; Offringa et al., 2000; Sakamoto et al., 1996), and a heteroduplex
137
mobility assay (HMA) (Ellis and Zambon, 2001). While these techniques are reliable, they are laborious, time-consuming, and in some cases expensive. The present system utilizes three sets of multiple segmentspecific primer pairs. Multiplex RT-PCR has been employed widely as a highly sensitive and specific method for the detection of infectious diseases, including influenza viruses (Chi et al., 2007; Poddar, 2002; Stockton et al., 1998). Recently reverse genetic techniques have been developed that allow the generation of vaccine reassortant strains from cDNAs (Hoffmann et al., 2000, 2002; Neumann et al., 1999). While this method has been used for the development of a vaccine against the highly pathogenic avian influenza (HPAI) (Shi et al., 2007; Song et al., 2009; Suguitan et al., 2006), it has yet to be used to manufacture seasonal human influenza vaccines. Therefore, the selection of vaccine strains still relies on classical reassortment of wild-type and vaccine donor viruses, and the identification of isolated reassortant viruses with the desired genetic composition. The present multiplex RT-PCR method for identification of influenza B vaccine strains, in combination with a similar method developed for influenza A vaccine strains (Ha et al., 2006), would be instrumental for the generation of the trivalent vaccine formula according to the annual WHO recommendations. The design of the primers to include a mismatched base at the 3 -terminus enhanced the specificity and prevented amplification of non-homologous strains (Kwok et al., 1990). In this study, the specificity of the primer pairs were tested against nine different heterologous wild-type influenza B viruses and the cold-adapted
Fig. 3. Genotyping of reassortant influenza B viruses by a three-tube multiplex RT-PCR. Lane M: 1-kb ladder molecular weight marker; lane 1: PB2 (988 bp), PB1 (677 bp), and M (263 bp); lane 2: NP (610 bp), PA (494 bp), and NS (255 bp); lane 3: HA (687 bp) and NA (273 bp); lanes 4 and 5: HA (1112 bp) and NA (1382 bp) specific for B/Shandong/7/97 virus, respectively. Table 4 Genotyping and identification of the origin of RNA segments in reassortant viruses. Clone no.
RNA ratio (B/Lee/40ca vs. B/Shangdong/7/97)
Segment derived from B/Lee/40ca
Segment derived from B/Shangdong/7/97
Re-1 Re-2 Re-3 Re-4 Re-5 Re-6 Re-7
7:1 6:2 6:2 7:1 7:1 5:3 5:3
PB2, PB1, PA, NP, NA, M, NS PB2, PB1, PA, NP, NA, M PB2, PB1, HA, NP, NA, M PB2, PB1, PA, HA, NP, NA, M PB2, PB1, PA, HA, NP, NA, NS PB2, PA, HA, NP, NA, PB2, HA, NP, M, NS
HA HA, NS PA, NS NS NA PB1, M, NS PB2, PA, NA
138
E.-Y. Lee et al. / Journal of Virological Methods 165 (2010) 133–138
B/Lee/40ca homologous virus, and only the primers specific for B/Lee/40ca virus were selected for the multiplex reactions (Table 1). In some instances, a ∼350 bp PCR product also was amplified from the NA primer pair (Fig. 1, lane 27), but this did not create difficulties for analyzing the results. No other nonspecific PCR products were observed for any of the other primer pairs. The present multiplex RT-PCR was adopted for up to three sets of primer pairs per tube. A prerequisite for a multiplex RT-PCR assay is the generation of PCR products that can be distinguished easily by size after gel electrophoresis. A single-tube multiplex RT-PCR that allows identification of all eight influenza RNAs in one reaction would be an ideal experimental set-up. However, we were not able to design suitable primer combinations that enable amplification of all eight gene segments in a single-tube reaction. From the five possible multiplex combinations tested with B/Yamagata/16/88 and B/Lee/40ca viruses (data not shown), the sets of primer pairs that optimally amplify all of the RNA segments is shown in Table 3. Using the three-tube multiplex RT-PCR system, the feasibility of this system for genotyping a pool of reassortant viruses from the mixed infection of attenuated donor virus and wild-type virus (Fig. 3 and Table 4) was demonstrated. The origin of each gene segment of the 6:2 genome composition vaccine candidates was confirmed by direct sequencing of each RT-PCR product. In conclusion, the strain-specific multiplex RT-PCR system was shown to provide an efficient method for genotyping and screening of candidate influenza B reassortant vaccine strains. This method could be implemented to expedite the generation of each component strain, to allow more time to culture and process the final seasonal influenza vaccine, and to minimize the morbidity and mortality associated with influenza infections. Acknowledgements This work was supported by a contract research grant from the Korea Food and Drug Administration (KFDA) (06092-KFDA346), a grant from the Ministry of Health, Welfare, and Family Affairs (A085105) from the Korean Government, and from Biotrion Co., Seoul, Korea. References Bardiya, N., Bae, J.H., 2005. Influenza vaccines: recent advances in production technologies. Appl. Microbiol. Biotechnol. 67, 299–305. Beigel, J., Bray, M., 2008. Current and future antiviral therapy of severe seasonal and avian influenza. Antiviral Res. 78, 91–102. Beigel, J.H., 2008. Influenza. Crit. Care Med. 36, 2660–2666. Belshe, R., Lee, M.S., Walker, R.E., Stoddard, J., Mendelman, P.M., 2004. Safety, immunogenicity and efficacy of intranasal, live attenuated influenza vaccine. Expert Rev. Vaccines 3, 643–654. Belshe, R.B., 2004. Current status of live attenuated influenza virus vaccine in the US. Virus Res. 103, 177–185. Carrat, F., Flahault, A., 2007. Influenza vaccine: the challenge of antigenic drift. Vaccine 25, 6852–6862. Cha, T.A., Zhao, J., Lane, E., Murray, M.A., Stec, D.S., 1997. Determination of the genome composition of influenza virus reassortants using multiplex reverse transcription-polymerase chain reaction followed by fluorescent single-strand conformation polymorphism analysis. Anal. Biochem. 252, 24–32. Chi, X.S., Li, F., Tam, J.S., Rappaport, R., Cheng, S.M., 2007. Semiquantitative onestep RT-PCR for simultaneous identification of human influenza and respiratory syncytial viruses. J. Virol. Methods 139, 90–92. Cooper, L.A., Subbarao, K., 2000. A simple restriction fragment length polymorphismbased strategy that can distinguish the internal genes of human H1N1, H3N2, and H5N1 influenza A viruses. J. Clin. Microbiol. 38, 2579–2583. Cox, R.J., Brokstad, K.A., Ogra, P., 2004. Influenza virus: immunity and vaccination strategies. Comparison of the immune response to inactivated and live, attenuated influenza vaccines. Scand. J. Immunol. 59, 1–15.
De Clercq, E., 2004. Antiviral drugs in current clinical use. J. Clin. Virol. 30, 115–133. Ellis, J.S., Zambon, M.C., 2001. Combined PCR-heteroduplex mobility assay for detection and differentiation of influenza A viruses from different animal species. J. Clin. Microbiol. 39, 4097–4102. Ha, S.H., Kim, H.A., Kim, Y.H., Kim, J.S., Lee, K.H., Park, S.Y., Park, W.J., Seong, B.L., 2006. A multiplex RT-PCR method for screening of reassortant live influenza vaccine virus strains. J. Virol. Methods 134, 154–163. Hampson, A.W., Mackenzie, J.S., 2006. The influenza viruses. Med. J. Aust. 185, S39–S43. Hoffmann, E., Krauss, S., Perez, D., Webby, R., Webster, R.G., 2002. Eight-plasmid system for rapid generation of influenza virus vaccines. Vaccine 20, 3165–3170. Hoffmann, E., Neumann, G., Kawaoka, Y., Hobom, G., Webster, R.G., 2000. A DNA transfection system for generation of influenza A virus from eight plasmids. Proc. Natl. Acad. Sci. U.S.A. 97, 6108–6113. Intharathep, P., Laohpongspaisan, C., Rungrotmongkol, T., Loisruangsin, A., Malaisree, M., Decha, P., Aruksakunwong, O., Chuenpennit, K., Kaiyawet, N., Sompornpisut, P., Pianwanit, S., Hannongbua, S., 2008. How amantadine and rimantadine inhibit proton transport in the M2 protein channel. J. Mol. Graph. Model. 27, 342–348. Klimov, A.I., Cox, N.J., 1995. PCR restriction analysis of genome composition and stability of cold-adapted reassortant live influenza vaccines. J. Virol. Methods 52, 41–49. Kwok, S., Kellogg, D.E., McKinney, N., Spasic, D., Goda, L., Levenson, C., Sninsky, J.J., 1990. Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus type 1 model studies. Nucleic Acids Res. 18, 999–1005. Maassab, H.F., Bryant, M.L., 1999. The development of live attenuated cold-adapted influenza virus vaccine for humans. Rev. Med. Virol. 9, 237–244. Moscona, A., 2008. Medical management of influenza infection. Annu. Rev. Med. 59, 397–413. Nerome, K., Sakamoto, S., Yano, N., Yamamoto, T., Kobayashi, S., Webster, R.G., Oya, A., 1983. Antigenic characteristics and genome composition of a naturally occurring recombinant influenza virus isolated from a pig in Japan. J. Gen. Virol. 64 (Pt 12), 2611–2620. Neumann, G., Watanabe, T., Ito, H., Watanabe, S., Goto, H., Gao, P., Hughes, M., Perez, D.R., Donis, R., Hoffmann, E., Hobom, G., Kawaoka, Y., 1999. Generation of influenza A viruses entirely from cloned cDNAs. Proc. Natl. Acad. Sci. U.S.A. 96, 9345–9350. Offringa, D.P., Tyson-Medlock, V., Ye, Z., Levandowski, R.A., 2000. A comprehensive systematic approach to identification of influenza A virus genotype using RT-PCR and RFLP. J. Virol. Methods 88, 15–24. Ohmit, S.E., Victor, J.C., Teich, E.R., Truscon, R.K., Rotthoff, J.R., Newton, D.W., Campbell, S.A., Boulton, M.L., Monto, A.S., 2008. Prevention of symptomatic seasonal influenza in 2005–2006 by inactivated and live attenuated vaccines. J. Infect. Dis. 198, 312–317. Palese, P., Schulman, J.L., 1976. Differences in RNA patterns of influenza A viruses. J. Virol. 17, 876–884. Poddar, S.K., 2002. Influenza virus types and subtypes detection by single step single tube multiplex reverse transcription-polymerase chain reaction (RT-PCR) and agarose gel electrophoresis. J. Virol. Methods 99, 63–70. Sakamoto, S., Kino, Y., Oka, T., Herlocher, M.L., Maassab, F., 1996. Gene analysis of reassortant influenza virus by RT-PCR followed by restriction enzyme digestion. J. Virol. Methods 56, 161–171. Seo, S.U., Byun, Y.H., Lee, E.Y., Jung, E.J., Jang, Y.H., Kim, H.A., Ha, S.H., Lee, K.H., Seong, B.L., 2008. Development and characterization of a live attenuated influenza B virus vaccine candidate. Vaccine 26, 874–8781. Seo, S.U., Lee, K.H., Byun, Y.H., Kweon, M.N., Seong, B.L., 2007. Immediate and broadspectrum protection against heterologous and heterotypic lethal challenge in mice by live influenza vaccine. Vaccine 25, 8067–8076. Shi, H., Liu, X.F., Zhang, X., Chen, S., Sun, L., Lu, J., 2007. Generation of an attenuated H5N1 avian influenza virus vaccine with all eight genes from avian viruses. Vaccine 25, 7379–7384. Song, M.S., Oh, T.K., Pascua, P.N., Moon, H.J., Lee, J.H., Baek, Y.H., Woo, K.J., Yoon, Y., Sung, M.H., Poo, H., Kim, C.J., Choi, Y.K., 2009. Investigation of the biological indicator for vaccine efficacy against highly pathogenic avian influenza (HPAI) H5N1 virus challenge in mice and ferrets. Vaccine 27, 3145–3152. Stockton, J., Ellis, J.S., Saville, M., Clewley, J.P., Zambon, M.C., 1998. Multiplex PCR for typing and subtyping influenza and respiratory syncytial viruses. J. Clin. Microbiol. 36, 2990–2995. Suguitan Jr., A.L., McAuliffe, J., Mills, K.L., Jin, H., Duke, G., Lu, B., Luke, C.J., Murphy, B., Swayne, D.E., Kemble, G., Subbarao, K., 2006. Live, attenuated influenza A H5N1 candidate vaccines provide broad cross-protection in mice and ferrets. PLoS Med. 3, 1541–1555. Wareing, M.D., Tannock, G.A., 2001. Live attenuated vaccines against influenza; an historical review. Vaccine 19, 3320–3330. Wright, P.F., Newman, G., Kawaoka, Y., 2007. Orthomyxoviruses. In: Knipe, D.M., Howley, P.M., Griffin, D.E. (Eds.), Fields Virology. Lippincott Williams and Wilkins, a Wolters Kluwer Business, Philadelphia, pp. 1691–1740.