- Email: [email protected]
Genotyping of Bifidobacterium longum subsp. longum strains by multilocus variable number of tandem repeat analysis
Journal of Microbiological Methods 87 (2011) 378–380
Contents lists available at SciVerse ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Note
Genotyping of Bifidobacterium longum subsp. longum strains by multilocus variable number of tandem repeat analysis Sébastien Matamoros, Patricia Savard, Denis Roy ⁎ Institut des nutraceutiques et aliments fonctionnels (INAF), Département des Sciences des aliments et de nutrition, Université Laval, QC, Canada G1V 0A6
a r t i c l e
i n f o
Article history: Received 17 August 2011 Received in revised form 4 October 2011 Accepted 4 October 2011 Available online 12 October 2011
a b s t r a c t A multilocus variable number of tandem repeat analysis (MLVA) scheme was developed and 44 isolates of Bifidobacterium longum subsp. longum were typed, including 5 isolates recovered during a clinical trial. The MLVA scheme generated 19 profiles and proved to be a fast, reliable and relatively cheap typing method. © 2011 Elsevier B.V. All rights reserved.
Keywords: MLVA Bifidobacterium longum subsp. longum Typing
Bacteria belonging to the Bifidobacterium genus are naturally present in large amounts in the gastrointestinal tract of healthy humans (Vaughan et al., 2002). The Bifidobacterium longum subsp. longum species has recently attracted attention for its potential as a probiotic (Oberreuther-Moschner et al., 2004; Puccio et al., 2007). Considering the rapidly increasing number of commercial and technological strains, there is an urgent need for an efficient typing method, especially when most probiotics have strain-dependent effects. Traditional typing methods such as pulse-field gel electrophoresis (PFGE) (Roy et al., 1996) use gel-based DNA restriction fingerprinting. In addition, genebased typing methods have been developed for bifidobacteria, such as random amplified polymorphic DNA (RAPD) (Vincent et al., 1998) and multilocus sequence typing (MLST) schemes (Deletoile et al., 2010; Ventura et al., 2006). Another PCR-based typing method called multilocus variable-number tandem repeat (VNTR) analysis (MLVA) has recently gained attention. Tandem repeats are repeated DNA sequences present in the bacterial genome for which the number of units at a given locus may vary among strains of the same species. The multiple VNTR loci are amplified across the genome, and the number of repeats in each targeted region is subsequently determined by gel or capillary electrophoresis (van Belkum, 2007). The number of repeats in each locus can be expressed as a numerical code, and each unique combination of numbers represents a profile. In the present study, a MLVA scheme was specifically designed for the typing of B. longum subsp. longum strains including isolates from human feces recovered during a clinical study (Savard et al., 2011). ⁎ Corresponding author at: Institut des nutraceutiques et des aliments fonctionnels, (INAF), Université Laval, 2440, Boul. Hochelaga, QC, Canada G1V 0A6. Fax: + 1 418 656 5877. E-mail address: [email protected] (D. Roy). 0167-7012/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.mimet.2011.10.005
A total of 44 B. longum subsp. longum were included in this study (Table 1). RW- and CUETM-strains were isolated during previous studies (Bahaka et al., 1993; Roy et al., 1996). Reference strains were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ Braunschweig, Germany). Bifidobacterium isolates were cultivated under anaerobic conditions (AnaeroPack, Mitsubishi Gas Chemical, Tokyo, Japan) for 24 to 48 h in cysteine-supplemented MRS medium: 52.2 g/l MRS (Sigma-Aldrich, St-Louis, MO, USA), 0.2 g/l Na2CO3 (Sigma-Aldrich), 0.1 g/l CaCl2 (Fisher Scientific, Waltham, MA, USA), and 0.5 g/l cysteine (Sigma-Aldrich), with pH adjusted to 6.8 before sterilization. DNA was extracted from fully grown cultures using a combination of Vincent et al.'s (1998) method for the enzymatic digestion of the cell membranes and the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany) for the DNA purification. For the design of the MLVA scheme, tandem repeats (TR) were identified in the B. longum subsp. longum NCC2705 and DJO10A genomes using the microorganism tandem repeat database (http:// minisatellites.u-psud.fr/GPMS/, Denoeud and Vergnaud, 2004). Search parameters were a minimum repeat size of 9 bp, a minimum percentage match of 60%, and a maximum % GC of 60%. Primers were designed in the satellite flanking regions using Geneious Pro and Primer3. Characteristics of the five best loci and sequences of the corresponding primers are given in Table 2. Fluorescently labeled primers for use in capillary electrophoresis were obtained from Integrated DNA Technologies (IDT, Coralville, IA, USA) and Applied Biosystems (Foster City, CA, USA). When possible, the fluorescently labeled primers had no G at their 5′ extremity (three residues). The five VNTR loci were amplified in a single multiplex PCR. Reactions were performed in a total volume of 25 μl containing 1× PCR buffer, 1 μg ml−1 DNA, 0.12 to 0.2 μmol l−1 of each primer (Table 2),
S. Matamoros et al. / Journal of Microbiological Methods 87 (2011) 378–380 Table 1 Origin and typing of studied Bifidobacterium longum subsp. longum strains. Strain
Origin
ATCC 15707 BiF 1 RW-002 ATCC 15708 RW-020 RW-026 ATCC 51870 ATCC 55817 DSM 20097 RBL8 RW-001 RW-022 RW-025 RW-027 CUETM 186 CUETM 245 CUETM 259 CUETM 260 CUETM 263 PRO-42-1 PRO-42-2 PRO-42-8 PRO-42-10 CUETM 247 RW-009 RW-019 RW-023 RW-024 CUETM 287 CUETM 290 RW-008 RW-028 CUETM 268 CUETM 239 CUETM 257 CUETM 267 CUETM 276 NCC 2705 CUETM 172 PRO-16-10 CUETM 193 CUETM 171 CUETM 177 CUETM 281
Adult intestine Commercial preparation Commercial preparation Child feces Commercial preparation Commercial preparation Child feces Child feces Calf feces NA Commercial preparation Commercial preparation Commercial preparation Commercial preparation Child feces Child feces Child feces Child feces Child feces Adult feces Adult feces Adult feces Adult feces Child feces Commercial preparation Commercial preparation Commercial preparation Commercial preparation Child feces Child feces Commercial preparation Commercial preparation Child feces Child feces Child feces Child feces Child feces Nestlé NA Adult feces Child feces Child feces Child feces Child feces
MP
1 1 1 2 3 3 4 4 5 1 8 8 8 8 9 9 9 9 9 16 16 16 16 10 2 2 2 2 11 12 7 7 10 14 14 14 14 6 13 15 17 18 19 14
379
Table 3 Characteristics of the variable number of tandem repeat loci.
VNTR 12
21
23
25
26
1 1 1 4 1 1 4 4 2.5 1 3 3 3 3 1 1 1 1 1 1 1 1 1 4 4 4 4 4 3 3 2.5 2.5 4 3 3 3 3 4 5 5.5 4 4 4 3
3 3 3 3 2 2 3 3 3 3 4 4 4 4 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 2 2 3 3 3 3 3 3 2 2 3 3 2 3
4 4 4 2 2 2 2 2 2 4 2 2 2 2 2 2 2 2 2 1 1 1 1 4 2 2 2 2 1 2 3 3 4 4 4 4 4 7 2 4 2 2 2 4
14 14 14 14 15 15 16 16 14 14 12 12 12 12 14 14 14 14 14 14 14 14 14 14 14 14 14 14 12 16 13 13 14 14 14 14 14 16 14 13 14 14 14 14
2 2 2 3 2 2 3 3 4 2 3 3 3 3 2 2 2 2 2 3 3 3 3 10 3 3 3 3 3 4 3 3 10 2 2 2 2 4 4 2 4 2 2 2
Abbreviations: MP: MLVA profile; VNTR: variable number of tandem repeat; NA: not available.
0.15 mmol l−1 (each) dNTP, and 1 U Taq DNA polymerase. A touchdown program was used: a total of 35 cycles consisting of a 60 s denaturation step at 94 °C, a 30 s annealing step, and a 60 s extension step at 72 °C. The annealing step temperature was decreased by 1 °C at each of the first 10 cycles, starting at 65 °C and ending at 56 °C. The annealing temperature of the next 25 cycles was 55 °C. The first cycle was preceded by denaturation for 5 min at 94 °C, and a final 5 min extension was performed at 72 °C. PCR products were purified using a Qiagen PCR
VNTR locus VNTR VNTR VNTR VNTR VNTR
12 21 23 25 26
TR sizea
Number of repeats Minimun
Maximum
14 9 10 12 10
1 1 1 12 2
5.5 4 7 16 10
Number of alleles
TR consensus sequence
6 3 5 5 4
TCGTGGGTAGCAAC AGCCGAATC CTGATATTCG CACAACCTGTTT AGCCATATCA
Abbreviations: VNTR: variable number of tandem repeat. TR: tandem repeat. a In bp.
purification kit and 5–6 ng of purified DNA was mixed with 9.5 μl of Hi-Di formamide (Applied Biosystems) and 0.5 μl of GS600LIZ size standard (Applied Biosystems). Capillary electrophoresis of the fragments was performed on an ABI 3130 DNA analyzer (Applied Biosystems). Resulting raw data were acquired and treated using GeneMapper 3.7 (Applied Biosystems). After calculations, the number of TRs was rounded up or down to the nearest whole number except for VNTR 12, for which 2 exact half TRs were observed (2.5 and 5.5). Profile determination was performed using START2 (Jolley et al., 2001). Each different allele was sequenced with an ABI 3130 DNA analyzer using the BigDye Terminator v3.1 sequencing method (Applied Biosystems) according to manufacturer's recommendations using MLVA non-labeled primers to verify the number of repeats. A MLVA profile is a unique combination of numbers of tandem repeats (TR) for multiple loci determined by the sizing of the corresponding PCR fragments (Lindstedt, 2005). Thirty different regions were investigated for TRs in the B. longum subsp. longum NCC2705 and DJO10A genomes. Several regions were excluded because the size variations of the satellite were shorter than expected or monomorphic for all tested strains, or because the cause of the size variations was not the targeted tandem repeat. Six VNTR loci were originally selected for the MLVA scheme, which were sufficient to obtain good discriminatory power: VNTR12, 15, 21, 23, 25 and 26. However, one of the loci (VNTR15) added no discriminatory power and was discarded from the analysis. VNTR loci characteristics are summarized in Table 3. The number of alleles ranged from 3 (VNTR21) to 6 (VNTR12). Sequencing of the different alleles confirmed that the size variation was due to repetitions of the target region. One set of primers had to be redesigned after sequencing revealed that two very close VNTR loci were present in the same region (VNTR 26). The forward primer is hence located between the two VNTR in order to target the more polymorphic of the two loci. Nineteen unique MLVA profiles (MP) were identified for the 44 tested strains (Table 1). Cluster size for the five selected VNTR regions ranged from 1 to 5 strains. MLVA using a multiplex PCR allowed discriminating five isolates recovered from the feces of human patients during the clinical evaluation of a probiotic product (isolates PRO-42-1, PRO-42-2, PRO-42-8, PRO-4210, and PRO-16-10), showing that it quickly and efficiently identifies specific strains. To our knowledge, only one other MLVA schemes has been developed for a bacterial species with industrial potential, namely
Table 2 Characteristics of MLST and MLVA primers. Gene/locus
Forward primer
Reverse primer
Tm
Amplicon sizea
Fluorescent dye
PCR mix concentrationb
VNTR VNTR VNTR VNTR VNTR
AGGTATTCGGGGATGTTCGC GCCTGTCATTCGCCGTTCTG TCGATCTTGAACTCGCACACC AATCGTGATTCCAGGTGCGG ACTGCATGTTCCGCAATACCC
GTATGGCGACGGCACATTCC ATCACCCAGCGTGTTTCGG TGCTTGACCTGCCATTCACC CGTCGCATTCATACGGTCGG ATGTCGGCGGCTTTGTAGTG
TD TD TD TD TD
436–500 374–392 313–373 365–414 252–332
6-FAM VIC NED PET 6-FAM
0.2 0.12 0.12 0.2 0.16
12 21 23 25 26
Abbreviations: VNTR: variable number of tandem repeats; TD: touchdown. a Base pair. b μmol l− 1.
380
S. Matamoros et al. / Journal of Microbiological Methods 87 (2011) 378–380
Lactobacillus casei, which was based on nine VNTR loci (Diancourt et al., 2007). With five useful loci, the B. longum MLVA scheme is similar to those developed for Enterococcus faecium (six loci) (Top et al., 2004), Staphylococcus aureus (seven loci) (Sabat et al., 2003), and Clostridium difficile (six loci) (Marsh et al., 2010). Most of the studied isolates had two main origins: RW-strains (13 of 44) were isolated from commercial preparations (Roy et al., 1996), and CUETM-strains (18 out of 44) were isolated from child feces (Bahaka et al., 1993) (Table 1). It has been reported that probiotic characteristics such as antioxidative potential are strongly strain-dependent (Annuk et al., 2003). When searching for these characteristics among a collection of strains, it is important to avoid testing redundant isolates as they are very likely to have the same phenotype. MLVA quickly differentiate isolates from a collection of potentially probiotic strains, and could allow for a more efficient screening of useful characteristics. Five isolates of B. longum ssp. longum were recovered from two different healthy adults during a clinical trial (Savard et al., 2011) and were typed with the MLVA protocol. Four isolates from the same subject had a similar MLVA profile and form a distinct cluster from other studied isolates: PRO-42-1; PRO-42-2; PRO-42-8 and PRO-42-10. These isolates are probably clones of the same strain. On the other hand, isolate PRO-16-10's MP is unique, suggesting that this strain is different from all other types in this study. All reference strains were differentiated by MLVA, except ATCC 51870 and ATCC 55817, which shared the same MP. The differentiation of these isolates as two different strains should either be confirmed by other methods or reconsidered as the same strain. The method showed good discriminatory power when considering the number of sequence types that contained only one isolate or the consistency of results compared to PFGE data (Roy et al., 1996). In conclusion, MLVA is well adapted to differentiate isolates and identify new strains with original types of B. longum subsp. longum, thus increasing the chances of finding new potentially interesting phenotypes. MLVA is a faster and cheaper technique than MLST due to the absence of a sequencing step. The method and results are easy to handle, especially when performed in a single multiplex PCR References Annuk, H., Shchepetova, J., Kullisaar, T., Songisepp, E., Zilmer, M., Mikelsaar, M., 2003. Characterization of intestinal lactobacilli as putative probiotic candidates. J. Appl. Microbiol. 94, 403–412.
Bahaka, D., Neut, C., Khattabi, A., Monget, D., Gavini, F., 1993. Phenotypic and genomic analyses of human strains belonging or related to Bifidobacterium longum, Bifidobacterium infantis, and Bifidobacterium breve. Int. J. Syst. Bacteriol. 43, 565–573. Deletoile, A., Passet, V., Aires, J., Chambaud, I., Butel, M.J., Smokvina, T., Brisse, S., 2010. Species delineation and clonal diversity in four Bifidobacterium species as revealed by multilocus sequencing. Res. Microbiol. 161, 82–90. Denoeud, F., Vergnaud, G., 2004. Identification of polymorphic tandem repeats by direct comparison of genome sequence from different bacterial strains: a webbased resource. BMC Bioinforma. 5, 4. Diancourt, L., Passet, V., Chervaux, C., Garault, P., Smokvina, T., Brisse, S., 2007. Multilocus sequence typing of Lactobacillus casei reveals a clonal population structure with low levels of homologous recombination. Appl. Environ. Microbiol. 73, 6601–6611. Jolley, K.A., Feil, E.J., Chan, M.S., Maiden, M.C., 2001. Sequence type analysis and recombinational tests (START). Bioinformatics 17, 1230–1231. Lindstedt, B.A., 2005. Multiple-locus variable number tandem repeats analysis for genetic fingerprinting of pathogenic bacteria. Electrophoresis 26, 2567–2582. Marsh, J.W., O'Leary, M.M., Shutt, K.A., Sambol, S.P., Johnson, S., Gerding, D.N., Harrison, L.H., 2010. Multilocus variable-number tandem-repeat analysis and multilocus sequence typing reveal genetic relationships among Clostridium difficile isolates genotyped by restriction endonuclease analysis. J. Clin. Microbiol. 48, 412–418. Oberreuther-Moschner, D.L., Jahreis, G., Rechkemmer, G., Pool-Zobel, B.L., 2004. Dietary intervention with the probiotics Lactobacillus acidophilus 145 and Bifidobacterium longum 913 modulates the potential of human faecal water to induce damage in HT29clone19A cells. Br. J. Nutr. 91, 925–932. Puccio, G., Cajozzo, C., Meli, F., Rochat, F., Grathwohl, D., Steenhout, P., 2007. Clinical evaluation of a new starter formula for infants containing live Bifidobacterium longum BL999 and prebiotics. Nutrition 23, 1–8. Roy, D., Ward, P., Champagne, G., 1996. Differentiation of bifidobacteria by use of pulsed-field gel electrophoresis and polymerase chain reaction. Int. J. Food Microbiol. 29, 11–29. Sabat, A., Krzyszton-Russjan, J., Strzalka, W., Filipek, R., Kosowska, K., Hryniewicz, W., Travis, J., Potempa, J., 2003. New method for typing Staphylococcus aureus strains: multiple-locus variable-number tandem repeat analysis of polymorphism and genetic relationships of clinical isolates. J. Clin. Microbiol. 41, 1801–1804. Savard, P., Lamarche, B., Paradis, M.E., Thiboutot, H., Laurin, E., Roy, D., 2011. Impact of Bifidobacterium animalis subsp. lactis BB-12 and, Lactobacillus acidophilus LA-5containing yoghurt, on fecal bacterial counts of healthy adults. Int. J. Food Microbiol. 149, 50–57. Top, J., Schouls, L.M., Bonten, M.J., Willems, R.J., 2004. Multiple-locus variable-number tandem repeat analysis, a novel typing scheme to study the genetic relatedness and epidemiology of Enterococcus faecium isolates. J. Clin. Microbiol. 42, 4503–4511. van Belkum, A., 2007. Tracing isolates of bacterial species by multilocus variable number of tandem repeat analysis (MLVA). FEMS Immunol. Med. Microbiol. 49, 22–27. Vaughan, E.E., de Vries, M.C., Zoetendal, E.G., Ben-Amor, K., Akkermans, A.D., de Vos, W.M., 2002. The intestinal LABs. Antonie Van Leeuwenhoek 82, 341–352. Ventura, M., Canchaya, C., Del Casale, A., Dellaglio, F., Neviani, E., Fitzgerald, G.F., van Sinderen, D., 2006. Analysis of bifidobacterial evolution using a multilocus approach. Int. J. Syst. Evol. Microbiol. 56, 2783–2792. Vincent, D., Roy, D., Mondou, F., Dery, C., 1998. Characterization of bifidobacteria by random DNA amplification. Int. J. Food Microbiol. 43, 185–193.
Contents lists available at SciVerse ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Note
Genotyping of Bifidobacterium longum subsp. longum strains by multilocus variable number of tandem repeat analysis Sébastien Matamoros, Patricia Savard, Denis Roy ⁎ Institut des nutraceutiques et aliments fonctionnels (INAF), Département des Sciences des aliments et de nutrition, Université Laval, QC, Canada G1V 0A6
a r t i c l e
i n f o
Article history: Received 17 August 2011 Received in revised form 4 October 2011 Accepted 4 October 2011 Available online 12 October 2011
a b s t r a c t A multilocus variable number of tandem repeat analysis (MLVA) scheme was developed and 44 isolates of Bifidobacterium longum subsp. longum were typed, including 5 isolates recovered during a clinical trial. The MLVA scheme generated 19 profiles and proved to be a fast, reliable and relatively cheap typing method. © 2011 Elsevier B.V. All rights reserved.
Keywords: MLVA Bifidobacterium longum subsp. longum Typing
Bacteria belonging to the Bifidobacterium genus are naturally present in large amounts in the gastrointestinal tract of healthy humans (Vaughan et al., 2002). The Bifidobacterium longum subsp. longum species has recently attracted attention for its potential as a probiotic (Oberreuther-Moschner et al., 2004; Puccio et al., 2007). Considering the rapidly increasing number of commercial and technological strains, there is an urgent need for an efficient typing method, especially when most probiotics have strain-dependent effects. Traditional typing methods such as pulse-field gel electrophoresis (PFGE) (Roy et al., 1996) use gel-based DNA restriction fingerprinting. In addition, genebased typing methods have been developed for bifidobacteria, such as random amplified polymorphic DNA (RAPD) (Vincent et al., 1998) and multilocus sequence typing (MLST) schemes (Deletoile et al., 2010; Ventura et al., 2006). Another PCR-based typing method called multilocus variable-number tandem repeat (VNTR) analysis (MLVA) has recently gained attention. Tandem repeats are repeated DNA sequences present in the bacterial genome for which the number of units at a given locus may vary among strains of the same species. The multiple VNTR loci are amplified across the genome, and the number of repeats in each targeted region is subsequently determined by gel or capillary electrophoresis (van Belkum, 2007). The number of repeats in each locus can be expressed as a numerical code, and each unique combination of numbers represents a profile. In the present study, a MLVA scheme was specifically designed for the typing of B. longum subsp. longum strains including isolates from human feces recovered during a clinical study (Savard et al., 2011). ⁎ Corresponding author at: Institut des nutraceutiques et des aliments fonctionnels, (INAF), Université Laval, 2440, Boul. Hochelaga, QC, Canada G1V 0A6. Fax: + 1 418 656 5877. E-mail address: [email protected] (D. Roy). 0167-7012/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.mimet.2011.10.005
A total of 44 B. longum subsp. longum were included in this study (Table 1). RW- and CUETM-strains were isolated during previous studies (Bahaka et al., 1993; Roy et al., 1996). Reference strains were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ Braunschweig, Germany). Bifidobacterium isolates were cultivated under anaerobic conditions (AnaeroPack, Mitsubishi Gas Chemical, Tokyo, Japan) for 24 to 48 h in cysteine-supplemented MRS medium: 52.2 g/l MRS (Sigma-Aldrich, St-Louis, MO, USA), 0.2 g/l Na2CO3 (Sigma-Aldrich), 0.1 g/l CaCl2 (Fisher Scientific, Waltham, MA, USA), and 0.5 g/l cysteine (Sigma-Aldrich), with pH adjusted to 6.8 before sterilization. DNA was extracted from fully grown cultures using a combination of Vincent et al.'s (1998) method for the enzymatic digestion of the cell membranes and the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany) for the DNA purification. For the design of the MLVA scheme, tandem repeats (TR) were identified in the B. longum subsp. longum NCC2705 and DJO10A genomes using the microorganism tandem repeat database (http:// minisatellites.u-psud.fr/GPMS/, Denoeud and Vergnaud, 2004). Search parameters were a minimum repeat size of 9 bp, a minimum percentage match of 60%, and a maximum % GC of 60%. Primers were designed in the satellite flanking regions using Geneious Pro and Primer3. Characteristics of the five best loci and sequences of the corresponding primers are given in Table 2. Fluorescently labeled primers for use in capillary electrophoresis were obtained from Integrated DNA Technologies (IDT, Coralville, IA, USA) and Applied Biosystems (Foster City, CA, USA). When possible, the fluorescently labeled primers had no G at their 5′ extremity (three residues). The five VNTR loci were amplified in a single multiplex PCR. Reactions were performed in a total volume of 25 μl containing 1× PCR buffer, 1 μg ml−1 DNA, 0.12 to 0.2 μmol l−1 of each primer (Table 2),
S. Matamoros et al. / Journal of Microbiological Methods 87 (2011) 378–380 Table 1 Origin and typing of studied Bifidobacterium longum subsp. longum strains. Strain
Origin
ATCC 15707 BiF 1 RW-002 ATCC 15708 RW-020 RW-026 ATCC 51870 ATCC 55817 DSM 20097 RBL8 RW-001 RW-022 RW-025 RW-027 CUETM 186 CUETM 245 CUETM 259 CUETM 260 CUETM 263 PRO-42-1 PRO-42-2 PRO-42-8 PRO-42-10 CUETM 247 RW-009 RW-019 RW-023 RW-024 CUETM 287 CUETM 290 RW-008 RW-028 CUETM 268 CUETM 239 CUETM 257 CUETM 267 CUETM 276 NCC 2705 CUETM 172 PRO-16-10 CUETM 193 CUETM 171 CUETM 177 CUETM 281
Adult intestine Commercial preparation Commercial preparation Child feces Commercial preparation Commercial preparation Child feces Child feces Calf feces NA Commercial preparation Commercial preparation Commercial preparation Commercial preparation Child feces Child feces Child feces Child feces Child feces Adult feces Adult feces Adult feces Adult feces Child feces Commercial preparation Commercial preparation Commercial preparation Commercial preparation Child feces Child feces Commercial preparation Commercial preparation Child feces Child feces Child feces Child feces Child feces Nestlé NA Adult feces Child feces Child feces Child feces Child feces
MP
1 1 1 2 3 3 4 4 5 1 8 8 8 8 9 9 9 9 9 16 16 16 16 10 2 2 2 2 11 12 7 7 10 14 14 14 14 6 13 15 17 18 19 14
379
Table 3 Characteristics of the variable number of tandem repeat loci.
VNTR 12
21
23
25
26
1 1 1 4 1 1 4 4 2.5 1 3 3 3 3 1 1 1 1 1 1 1 1 1 4 4 4 4 4 3 3 2.5 2.5 4 3 3 3 3 4 5 5.5 4 4 4 3
3 3 3 3 2 2 3 3 3 3 4 4 4 4 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 2 2 3 3 3 3 3 3 2 2 3 3 2 3
4 4 4 2 2 2 2 2 2 4 2 2 2 2 2 2 2 2 2 1 1 1 1 4 2 2 2 2 1 2 3 3 4 4 4 4 4 7 2 4 2 2 2 4
14 14 14 14 15 15 16 16 14 14 12 12 12 12 14 14 14 14 14 14 14 14 14 14 14 14 14 14 12 16 13 13 14 14 14 14 14 16 14 13 14 14 14 14
2 2 2 3 2 2 3 3 4 2 3 3 3 3 2 2 2 2 2 3 3 3 3 10 3 3 3 3 3 4 3 3 10 2 2 2 2 4 4 2 4 2 2 2
Abbreviations: MP: MLVA profile; VNTR: variable number of tandem repeat; NA: not available.
0.15 mmol l−1 (each) dNTP, and 1 U Taq DNA polymerase. A touchdown program was used: a total of 35 cycles consisting of a 60 s denaturation step at 94 °C, a 30 s annealing step, and a 60 s extension step at 72 °C. The annealing step temperature was decreased by 1 °C at each of the first 10 cycles, starting at 65 °C and ending at 56 °C. The annealing temperature of the next 25 cycles was 55 °C. The first cycle was preceded by denaturation for 5 min at 94 °C, and a final 5 min extension was performed at 72 °C. PCR products were purified using a Qiagen PCR
VNTR locus VNTR VNTR VNTR VNTR VNTR
12 21 23 25 26
TR sizea
Number of repeats Minimun
Maximum
14 9 10 12 10
1 1 1 12 2
5.5 4 7 16 10
Number of alleles
TR consensus sequence
6 3 5 5 4
TCGTGGGTAGCAAC AGCCGAATC CTGATATTCG CACAACCTGTTT AGCCATATCA
Abbreviations: VNTR: variable number of tandem repeat. TR: tandem repeat. a In bp.
purification kit and 5–6 ng of purified DNA was mixed with 9.5 μl of Hi-Di formamide (Applied Biosystems) and 0.5 μl of GS600LIZ size standard (Applied Biosystems). Capillary electrophoresis of the fragments was performed on an ABI 3130 DNA analyzer (Applied Biosystems). Resulting raw data were acquired and treated using GeneMapper 3.7 (Applied Biosystems). After calculations, the number of TRs was rounded up or down to the nearest whole number except for VNTR 12, for which 2 exact half TRs were observed (2.5 and 5.5). Profile determination was performed using START2 (Jolley et al., 2001). Each different allele was sequenced with an ABI 3130 DNA analyzer using the BigDye Terminator v3.1 sequencing method (Applied Biosystems) according to manufacturer's recommendations using MLVA non-labeled primers to verify the number of repeats. A MLVA profile is a unique combination of numbers of tandem repeats (TR) for multiple loci determined by the sizing of the corresponding PCR fragments (Lindstedt, 2005). Thirty different regions were investigated for TRs in the B. longum subsp. longum NCC2705 and DJO10A genomes. Several regions were excluded because the size variations of the satellite were shorter than expected or monomorphic for all tested strains, or because the cause of the size variations was not the targeted tandem repeat. Six VNTR loci were originally selected for the MLVA scheme, which were sufficient to obtain good discriminatory power: VNTR12, 15, 21, 23, 25 and 26. However, one of the loci (VNTR15) added no discriminatory power and was discarded from the analysis. VNTR loci characteristics are summarized in Table 3. The number of alleles ranged from 3 (VNTR21) to 6 (VNTR12). Sequencing of the different alleles confirmed that the size variation was due to repetitions of the target region. One set of primers had to be redesigned after sequencing revealed that two very close VNTR loci were present in the same region (VNTR 26). The forward primer is hence located between the two VNTR in order to target the more polymorphic of the two loci. Nineteen unique MLVA profiles (MP) were identified for the 44 tested strains (Table 1). Cluster size for the five selected VNTR regions ranged from 1 to 5 strains. MLVA using a multiplex PCR allowed discriminating five isolates recovered from the feces of human patients during the clinical evaluation of a probiotic product (isolates PRO-42-1, PRO-42-2, PRO-42-8, PRO-4210, and PRO-16-10), showing that it quickly and efficiently identifies specific strains. To our knowledge, only one other MLVA schemes has been developed for a bacterial species with industrial potential, namely
Table 2 Characteristics of MLST and MLVA primers. Gene/locus
Forward primer
Reverse primer
Tm
Amplicon sizea
Fluorescent dye
PCR mix concentrationb
VNTR VNTR VNTR VNTR VNTR
AGGTATTCGGGGATGTTCGC GCCTGTCATTCGCCGTTCTG TCGATCTTGAACTCGCACACC AATCGTGATTCCAGGTGCGG ACTGCATGTTCCGCAATACCC
GTATGGCGACGGCACATTCC ATCACCCAGCGTGTTTCGG TGCTTGACCTGCCATTCACC CGTCGCATTCATACGGTCGG ATGTCGGCGGCTTTGTAGTG
TD TD TD TD TD
436–500 374–392 313–373 365–414 252–332
6-FAM VIC NED PET 6-FAM
0.2 0.12 0.12 0.2 0.16
12 21 23 25 26
Abbreviations: VNTR: variable number of tandem repeats; TD: touchdown. a Base pair. b μmol l− 1.
380
S. Matamoros et al. / Journal of Microbiological Methods 87 (2011) 378–380
Lactobacillus casei, which was based on nine VNTR loci (Diancourt et al., 2007). With five useful loci, the B. longum MLVA scheme is similar to those developed for Enterococcus faecium (six loci) (Top et al., 2004), Staphylococcus aureus (seven loci) (Sabat et al., 2003), and Clostridium difficile (six loci) (Marsh et al., 2010). Most of the studied isolates had two main origins: RW-strains (13 of 44) were isolated from commercial preparations (Roy et al., 1996), and CUETM-strains (18 out of 44) were isolated from child feces (Bahaka et al., 1993) (Table 1). It has been reported that probiotic characteristics such as antioxidative potential are strongly strain-dependent (Annuk et al., 2003). When searching for these characteristics among a collection of strains, it is important to avoid testing redundant isolates as they are very likely to have the same phenotype. MLVA quickly differentiate isolates from a collection of potentially probiotic strains, and could allow for a more efficient screening of useful characteristics. Five isolates of B. longum ssp. longum were recovered from two different healthy adults during a clinical trial (Savard et al., 2011) and were typed with the MLVA protocol. Four isolates from the same subject had a similar MLVA profile and form a distinct cluster from other studied isolates: PRO-42-1; PRO-42-2; PRO-42-8 and PRO-42-10. These isolates are probably clones of the same strain. On the other hand, isolate PRO-16-10's MP is unique, suggesting that this strain is different from all other types in this study. All reference strains were differentiated by MLVA, except ATCC 51870 and ATCC 55817, which shared the same MP. The differentiation of these isolates as two different strains should either be confirmed by other methods or reconsidered as the same strain. The method showed good discriminatory power when considering the number of sequence types that contained only one isolate or the consistency of results compared to PFGE data (Roy et al., 1996). In conclusion, MLVA is well adapted to differentiate isolates and identify new strains with original types of B. longum subsp. longum, thus increasing the chances of finding new potentially interesting phenotypes. MLVA is a faster and cheaper technique than MLST due to the absence of a sequencing step. The method and results are easy to handle, especially when performed in a single multiplex PCR References Annuk, H., Shchepetova, J., Kullisaar, T., Songisepp, E., Zilmer, M., Mikelsaar, M., 2003. Characterization of intestinal lactobacilli as putative probiotic candidates. J. Appl. Microbiol. 94, 403–412.
Bahaka, D., Neut, C., Khattabi, A., Monget, D., Gavini, F., 1993. Phenotypic and genomic analyses of human strains belonging or related to Bifidobacterium longum, Bifidobacterium infantis, and Bifidobacterium breve. Int. J. Syst. Bacteriol. 43, 565–573. Deletoile, A., Passet, V., Aires, J., Chambaud, I., Butel, M.J., Smokvina, T., Brisse, S., 2010. Species delineation and clonal diversity in four Bifidobacterium species as revealed by multilocus sequencing. Res. Microbiol. 161, 82–90. Denoeud, F., Vergnaud, G., 2004. Identification of polymorphic tandem repeats by direct comparison of genome sequence from different bacterial strains: a webbased resource. BMC Bioinforma. 5, 4. Diancourt, L., Passet, V., Chervaux, C., Garault, P., Smokvina, T., Brisse, S., 2007. Multilocus sequence typing of Lactobacillus casei reveals a clonal population structure with low levels of homologous recombination. Appl. Environ. Microbiol. 73, 6601–6611. Jolley, K.A., Feil, E.J., Chan, M.S., Maiden, M.C., 2001. Sequence type analysis and recombinational tests (START). Bioinformatics 17, 1230–1231. Lindstedt, B.A., 2005. Multiple-locus variable number tandem repeats analysis for genetic fingerprinting of pathogenic bacteria. Electrophoresis 26, 2567–2582. Marsh, J.W., O'Leary, M.M., Shutt, K.A., Sambol, S.P., Johnson, S., Gerding, D.N., Harrison, L.H., 2010. Multilocus variable-number tandem-repeat analysis and multilocus sequence typing reveal genetic relationships among Clostridium difficile isolates genotyped by restriction endonuclease analysis. J. Clin. Microbiol. 48, 412–418. Oberreuther-Moschner, D.L., Jahreis, G., Rechkemmer, G., Pool-Zobel, B.L., 2004. Dietary intervention with the probiotics Lactobacillus acidophilus 145 and Bifidobacterium longum 913 modulates the potential of human faecal water to induce damage in HT29clone19A cells. Br. J. Nutr. 91, 925–932. Puccio, G., Cajozzo, C., Meli, F., Rochat, F., Grathwohl, D., Steenhout, P., 2007. Clinical evaluation of a new starter formula for infants containing live Bifidobacterium longum BL999 and prebiotics. Nutrition 23, 1–8. Roy, D., Ward, P., Champagne, G., 1996. Differentiation of bifidobacteria by use of pulsed-field gel electrophoresis and polymerase chain reaction. Int. J. Food Microbiol. 29, 11–29. Sabat, A., Krzyszton-Russjan, J., Strzalka, W., Filipek, R., Kosowska, K., Hryniewicz, W., Travis, J., Potempa, J., 2003. New method for typing Staphylococcus aureus strains: multiple-locus variable-number tandem repeat analysis of polymorphism and genetic relationships of clinical isolates. J. Clin. Microbiol. 41, 1801–1804. Savard, P., Lamarche, B., Paradis, M.E., Thiboutot, H., Laurin, E., Roy, D., 2011. Impact of Bifidobacterium animalis subsp. lactis BB-12 and, Lactobacillus acidophilus LA-5containing yoghurt, on fecal bacterial counts of healthy adults. Int. J. Food Microbiol. 149, 50–57. Top, J., Schouls, L.M., Bonten, M.J., Willems, R.J., 2004. Multiple-locus variable-number tandem repeat analysis, a novel typing scheme to study the genetic relatedness and epidemiology of Enterococcus faecium isolates. J. Clin. Microbiol. 42, 4503–4511. van Belkum, A., 2007. Tracing isolates of bacterial species by multilocus variable number of tandem repeat analysis (MLVA). FEMS Immunol. Med. Microbiol. 49, 22–27. Vaughan, E.E., de Vries, M.C., Zoetendal, E.G., Ben-Amor, K., Akkermans, A.D., de Vos, W.M., 2002. The intestinal LABs. Antonie Van Leeuwenhoek 82, 341–352. Ventura, M., Canchaya, C., Del Casale, A., Dellaglio, F., Neviani, E., Fitzgerald, G.F., van Sinderen, D., 2006. Analysis of bifidobacterial evolution using a multilocus approach. Int. J. Syst. Evol. Microbiol. 56, 2783–2792. Vincent, D., Roy, D., Mondou, F., Dery, C., 1998. Characterization of bifidobacteria by random DNA amplification. Int. J. Food Microbiol. 43, 185–193.