- Email: [email protected]
Genotyping of hepatitis C virus by Taqman real-time PCR
Journal of Clinical Virology 34 (2005) 108–114
Genotyping of hepatitis C virus by Taqman real-time PCR Magnus Lindh ∗ , Charles Hannoun Department of Clinical Virology, Guldhedsgatan 10 B, 413 46 G¨oteborg, Sweden Received 14 June 2004; received in revised form 6 January 2005; accepted 3 February 2005
Abstract Background: Genotype of hepatitis C virus (HCV) is of major importance for the outcome of treatment. The response rate is considerably lower for genotype 1, the predominant genotype in western countries. Objectives: To develop and evaluate a new, simple method for genotyping of HCV based on real-time polymerase chain reaction (PCR) and Taqman probes targeting the 5 non-coding region. Study design: The method was compared with Innolipa on 220 serum samples representing genotypes 1–4, and was applied on a further 614 clinical samples. Results: Taqman typing of the 220 samples showed genotype 1 in 69, genotype 2 in 58, genotype 3 in 57 and genotype 4 in 19, while 17 were non-reactive. There was a complete concordance with Innolipa with the exception of seven samples, which were of genotype 1 by Taqman, but genotype 4 by Innolipa. Sequencing of these samples showed a subtype 4 variant which differed at two positions compared with subtypes 4b/c/d, which are targeted by the probe. By adding a modified probe, these genotype 4 variants could also be identified. Out of 614 consecutive clinical samples, 524 could be typed by the Taqman assay; 45.2% were genotype 1, 19.3% genotype 2, 33.8% genotype 3 and 1.7%, genotype 4. Conclusion: The method was overall accurate and provides an attractive alternative for genotyping because processing time and costs are significantly reduced. Inclusion of probes targeting genotypes 5 and 6 is required for the method to be useful in areas where these genotypes are present. © 2005 Elsevier B.V. All rights reserved. Keywords: HCV; Genotype; Real-time; PCR; 5 Non-coding region
1. Introduction Chronic hepatitis C virus (HCV) infection is a major cause of severe liver disease including liver cirrhosis and hepatocellular carcinoma. Evolution has created six genetic groups of HCV, so-called genotypes (Simmonds et al., 1993a,b) and a number of subtypes. The six known genotypes differ by more than 30% of the nucleotide (nt) sequence and have uneven geographic distributions. Genotype 1 is the predominating genotype in many geographic regions, including Europe and North America, where it accounts for 50–90% of the cases. Genotypes 2 and 3 are also widely distributed. Genotype 2 is relatively common in Europe, North America and Japan.
∗
Abbreviations: HCV, hepatitis C virus; PCR, polymerase chain reaction Corresponding author. Fax: +46 31 827032. E-mail address: [email protected] (M. Lindh).
1386-6532/$ – see front matter © 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2005.02.002
Genotype 3 is common in Southeast Asia, Australia, South America and northern Europe, in particular in intravenous drug users. Genotype 4 is found mainly in Egypt, the Middle East and central Africa, genotype 5 in southern Africa and genotype 6 in southeast Asia. Despite the fact that they differ from each other by more than 30% of the RNA sequence, pathogenic differences between genotypes have not been demonstrated, except for steatosis associated with genotype 3a. However, because the genotype dictates the chance of therapeutic response and duration of treatment genotyping has become fundamental in the clinical assessment of patients with hepatitis C. Genotypes 2 and 3 respond favourably (75% sustained response, SR) on 24 weeks of treatment with pegylated interferon and ribavirin, while genotype 1 responds worse (50% SR) even after 48 weeks of treatment. The suitable treatment regimen for genotypes 4–6 are not yet established (Manns et al., 2001).
M. Lindh, C. Hannoun / Journal of Clinical Virology 34 (2005) 108–114
The reference method for genotyping is sequencing and phylogenetic analysis (Choo et al., 1991). Although, sequencing may be rationalized (Germer et al., 1999; Ross et al., 2000; Halfon et al., 2001), simplified methods are preferable in clinical routine and for epidemiology studies. Such methods include genotype-specific polymerase chain reaction (PCR) (Okamoto et al., 1992), restriction fragment length polymorphism, RFLP (McOmish et al., 1994), serotyping (Bhattacherjee et al., 1995; Dixit et al., 1995) and line probe hybridization after PCR (Innolipa) (Stuyver et al., 1993, 1996). Overall, there is an acceptable concordance between these methods (Lau et al., 1995; Forns et al., 1996; Schroter et al., 2001). However, most of these methods are still quite cumbersome or expensive. Recently, real-time PCR on the LightCycler instrument using hybridisation probes has been applied for HCV genotyping (Bullock et al., 2002; Schroter et al., 2002). This report describes an alternative real-time PCR technique for simple and fast genotyping of HCV. This method utilizes Taqman probes which have been widely used for identifying mutations in the human genome, and which have also been applied for quantification (Morris et al., 1996; Martell et al., 1999), but to our knowledge not for typing of HCV infections.
2. Methods 2.1. Samples Two hundred and six serum samples that had previously been analysed by Innolipa HCV (Innogenetics, Gent, the Netherlands) in the clinical diagnostic unit at the Virological laboratory, Sahlgrenska University Hospital, were included. Of these, 68 were genotype 1, 61 genotype 2, 62 genotype 3 and 15 genotype 4 according to Innolipa. An additional, 14 samples (kindly provided by Dr. Jan Albert, Stockholm) classified as genotype 4 by NS5 sequencing, were also studied. In a second part of the study, the method was applied on 614 clinical samples that were sent to our laboratory during the period march 2003–2004 with a request for HCV RNA analysis.
109
Table 1 Primers and probes used for Taqman real-time PCR detection of HCV genotypes Oligo
Sequence
Tm (◦ C)
PrimF Gt1probe Gt2probe Gt3probe Gt4probe PrimR PrimF modified Gt4probe modified PrimR gt1/3/ 4 modified
CTGCGGAACCGGTGAGTACA ACCCGGTCGTCCTGGCAATTCC AAGGACCCAGTCTTYCCGGYAATTC ACCCGGTCACCCCAGCGATTCC CCCGGTCATCCCGGCGATTC TGCACGGTCTACGAGACCTCC TGCGGAACCGGTGAGTACAC CCCGGTCGTCCTGGCGATTCC CGACCCAACACTACTCGGCTA
60.7 68.9 68.7 70.7 69.4 61.2 60.5 70.5 58.9
All probes were labeled with 6-carboxyfluorescein (FAM) at 5 and 6carboxytetramethyl-rhodamine (TAMRA) at 3 end. The probes are aligned to show critical positions (mismatches vs. the genotype 1 probe are underlined). Tm , melting point, as estimated by the Primer Express software.
2.3. Taqman genotyping A 193 nucleotide long fragment of the 5 non-coding region (NCR) was amplified in an ABI 7000 genetic analyzer (Applied Biosystems, Foster City, CA). After reverse transcription at 48 ◦ C for 30 min followed by 10 min of denaturation at 95 ◦ C, polymerase chain reaction was run for 45 cycles of 95 ◦ C for 15 s and 60 ◦ C for 60 s. The PCR was run in a 96-well plate in 50 L reaction volume (including 10 L of sample preparation and 25 L of RT-PCR mastermix, Applied Biosystems). The primers and Taqman probes are described in Table 1. The primers were located to a conserved part of 5 non-coding region (NCR), while the probes were designed to bind to a short region characterized by genotype-specific differences described in Fig. 1. The probes were designed to match genotypes 1–4, and more specifically to target subtypes 1a/b, 2a/b/c, 3a and 4b/c/d, which cause the vast majority of HCV infections in our region (Westin et al., 1999). The probes all had a 6-carboxyfluorescein (FAM) reporter at the 5 end and a 6-carboxytetramethyl-rhodamine (TAMRA) quencher at the 3 end. By the use of the Primer Express software (Ap-
2.2. Sample preparation RNA extraction was done by a Magnapure LC robot (Roche Applied Science, Mannheim, Germany), using the total nucleic acid protocol. In each preparation, 200 L of serum was used and RNA was then eluted in 100 L of elution buffer. After RNA extraction, each sample was dispensed to four adjacent positions on a 96-well PCR plate by the use of the Magnapure post-elution function. Prior to addition of samples, the 96-well plate was preloaded with PCR reagents representing the four genotype-specific mastermixes by the use of an eight-channel pipette.
Fig. 1. Representative sequences of the short segment of the 5 non-coding region that is targeted by the Taqman probes. For genotypes 2–4 only positions differing from the genotype 1 sequence are shown. The bottom line shows the sequence of a genotype 4 variant, which was observed in seven samples.
110
M. Lindh, C. Hannoun / Journal of Clinical Virology 34 (2005) 108–114
Fig. 2. Schematic view of the three steps of Taqman genotyping of HCV. A 32-well plate was loaded manually with 24 serum samples (represented by parts 1–24). After Magnapure extraction, 4 × 10 l were transferred by the robot to a 96-well PCR plate preloaded with four mastermixes (genotypes (Gt) 1–4). The sample data were entered in an Excel spreadsheet from which they were imported to the Magnapure and the ABI 7000 runs, respectively.
plied Biosystems) they were designed to have a, Tm , 8–10 ◦ C higher than the primers, i.e., around 68–70 ◦ C when binding to the matching genotype. During PCR, bound probes are digested by the exonuclease activity of Taq polymerase. Therefore, fluorescence from the FAM reporter increases exponentially during PCR in parallel with consumption of the matching probe. In wells with mismatching probes, the same amplicon is produced, but due to the lower Tm of the probes they are unlikely to bind the amplicon and release fluorescence. Each sample was amplified by primers PrimF and PrimR in four adjacent wells, with probes matching genotypes 1, 2, 3 or 4, respectively, and thus, 24 samples could be typed in each run. For each sample, fluorescence was expected to be detected in either one of the four wells. The whole process with RNA extraction, pipetting, PCR and interpretation of real-time PCR curves was semi-automated and could be finished within 4 h as described in Fig. 2. 2.4. Sensitivity The sensitivity of the Taqman PCR was evaluated by analysing a serial dilutions of samples of genotypes 1–4, that had been quantified to close to 1 million IU/mL by Cobas Amplicor (Roche Diagnostics, Branchburg, NJ). These samples were serially diluted in 1:3 steps down to 200 IU/mL and each step was analysed in triplicate. 2.5. Genotype mixtures Different combinations and proportions of genotypes 1–4 were analysed by mixing samples of genotypes 1–4 in dif-
ferent proportions and dilutions (1:1, 1:10, 1:100). The concentrations of these samples (before mixing) were assessed by Cobas Amplicor. 2.6. Modifications In an additional part of the study, a modified assay was evaluated. In this version, an extra probe was used for detection of a variant of genotype 4. Moreover, the primers, in particular the reverse primer, were changed in order to increase sensitivity. These revised primers and probe are described in the lower part of Table 1. 2.7. Sequencing and phylogenetic analysis Direct sequencing was carried out on five of seven samples that produced discordant results (genotype 4 by Innolipa or NS5 sequencing, genotype 1 by Taqman). A nested PCR was done using a first round with primers NCR 46F (TGTGAGGAACTACTGTCTTCACGC) and oka186R (ATGTACCCCATGAGGTCGGC), and a second round with NCR 56F (ACGCAGAAAGCGTCTAGCCAT) and oka186R. After cycle sequencing using NCR 56F and oka186R, the sequence was detected using an ABI 310 (Applied Biosystems) automated sequence reader. Phylogenetic analysis was done by distance matrix and neighbour joining comparison of a 364 nt segment of 5 NCR and core regions (between nt −249 and 115) after bootstrapping to 100 replicates, using the Mega2 software.
M. Lindh, C. Hannoun / Journal of Clinical Virology 34 (2005) 108–114
111
Table 2 Results of Taqman genotyping in 220 serum samples previously genotyped by Innolipa (n = 106) or NS5 sequencing (n = 14) Innolipa
TaqMan genotyping Genotype 1
Genotype 1 (n = 68) Genotype 2 (n = 61) Genotype 3 (n = 62) Genotype 4 (n = 29)
62
Total
69
Negative Genotype 2
Genotype 3
Genotype 4
19
6 3 5 3
19
17
58 57 7 58
3. Results There was a complete agreement with Innolipa for all the genotypes 1–3 samples (Table 2). However, 17 samples (8%) that were typable by Innolipa were negative by Taqman and could not be typed. For genotype 4, Taqman correctly identified 19 out of 29 samples, while 7 were typed as genotypes 1 and 3 were PCR negative. Sequencing of the 5 NCR and part of core region of five of these seven samples showed that they were indeed genotype 4 (Fig. 3), and that they all had sequence in the Taqman probe region previously reported for subtype 4a (Fig. 1). This sequence differs from genotype 1 at one position only, explaining why they were classified as genotype 1 by Taqman. The geographical origin was known for three of these
57
seven patients. They were from Somalia, Eritrea and Myanmar (Burma) and by Innolipa their isolates were typed as 4e, 4e and 4h, respectively. The other three samples were typed as 4a by NS5 sequencing and had unknown geographic origin. For the majority of samples, reactivity (i.e., an amplification curve) was observed in only one of the four wells. However, for some of the genotype 3 samples there was a weak signal also with genotype 4 probe, observed as a flat curve appearing approximately 10 cycles later than the curve produced by the genotype 3 probe. Besides this, there were no cross-reactions or signs of dual genotype infection. In a second part of the study, a positive Taqman PCR reaction was found in 524 out of 614 clinical samples with a
Fig. 3. Phylogenetic tree based on distance matrix and neighbor joining comparison of a 364 nt segment of 5 NCR and core regions (nt −249 and −115) after bootstrapping to 100 replicates.
112
M. Lindh, C. Hannoun / Journal of Clinical Virology 34 (2005) 108–114
Table 3 Genotype distribution in G¨oteborg, Sweden, as measured by Innolipa or Taqman Genotype
Innolipa (1999–2001) n = 680 (%)
Taqman genotypinga (2003–2004) n = 524 (%)
1 2 3 4
317 (47) 120 (18) 225 (33) 18 (3)
237 (45.2) 101 (19.3) 177 (33.8) 9 (1.7)
a Not including 90 samples that were negative by Taqman PCR (of which 44 were positive by Cobas Amplicor).
request for HCV RNA testing. The genotype distribution of these samples is shown in Table 3. Out of the 90 samples that were negative by Taqman PCR, 89 were tested also by Cobas Amplicor and then 44 of them were HCV RNA positive. Thus, out of 568 samples with detectable HCV RNA, 524 (92.3%) could be detected and genotyped by the Taqman assay. The mean Ct values for the clinical samples analysed were 2–3 cycles higher for genotype 1 than for genotypes 2 or 3 (Ct mean 30.6 for genotype 1 versus 28.2 and 27.9 for genotypes 2 and 3, respectively), indicating a higher sensitivity for genotypes 2 and 3 than for genotype 1. 3.1. Genotype mixtures Mixtures of HCV genotypes were correctly detected when appearing at similar concentrations, or when the minor genotype was present at a proportion of 5–10% or more. However, analysis of genotype mixtures showed a reduced sensitivity (0.5–1 log) for the minor strain. 3.2. Revised genotyping and sensitivity In additional experiments, we evaluated a probe specifically designed to identify the genotype 4 variant that was erroneously typed as genotype 1. When using this probe in combination with the original genotype 4 probe, the genotype 4 variants were identified. However, they also produced a signal with the genotype 1 probe, and hence these variants gave a dual signal (genotypes 1 and 4) with similar Ct values. We also evaluated several new primer combinations, resulting in a modified set where the forward primer was moved one position downstream, the reverse primer (for genotypes 1, 3 and 4) 69 positions upstream. We thus managed to increase sensitivity by 1–1.5 logs for genotypes 1 and 4, and by 0.8 logs for genotype 3. Consequently, we achieved a sensitivity of 5000 IU/mL for all the genotypes.
4. Discussion The aim of the present study was to develop and evaluate a simple genotyping method that identifies genotypes 1–4. The
background was the fact that during the period 1999–2001 genotyping by Innolipa of 680 clinical samples in our laboratory had identified genotypes 1–4 in 317 (47%), 120 (18%), 225 (33%) and 18 (3%) samples, respectively. Because no cases of genotypes 5 or 6 had been observed, the genotyping method described here was not designed or evaluated for identifying these types. Overall, the Taqman method was accurate and correctly identified all samples belonging to genotypes 1–3. A proportion of genotype 4 samples (7/26) were misinterpreted as genotype 1. Sequencing of these samples revealed a sequence previously found in a subtype 4a variant, which has two mismatches (nt −163 and −159) versus the genotype 4 probe used in the Taqman assay. Because this subtype 4 variant has only one mismatch (nt −167) to the genotype 1 probe (Fig. 1), such samples were erroneously typed as genotype 1. This 4a subtype has previously been observed in samples from and Zaire (M84848 (Bukh et al., 1992)), Belgium (L29586 (Stuyver et al., 1994)), Burundi (L08150, L08155 (Simmonds et al., 1993a,b)) and Argentina (AY172639 (Quarleri et al., 2003)). Subtype 4a has also been frequently reported from Egypt, represented by strain ED43 (accession no. Y11604, complete genome) (Chamberlain et al., 1997), which however is identical to subtypes 4b/c/d in the Taqman probe region. Conversely, three of our samples (originating from Somalia, Eritrea and Myanmar) with the genotype 4 variant (i.e., with −163/A and −159/C) were not 4a by Innolipa but 4e or 4h. Apparently, the genotype 4 variant is not confined to subtype 4a or to central parts of Africa. This observation may have impact on the interpretation of Innolipa subtyping, and calls for further study of the genotype 4 variability in the 5 NCR. We evaluated a revised protocol with an additional probe in the genotype 4 mastermix. The samples with the genotype 4 variant could then be identified, although they also produced a positive reaction by the genotype 1 mastermix. For samples with such dual reactivity, additional testing by Innolipa or sequencing is recommended to confirm the genotype. Conversely, because the additional probe only has one mismatch to genotype 1, there was some degree of cross-reaction. However, genotype 1 samples could always be correctly identified because the signal by the genotype 1 probe was stronger and had Ct value that was 5 cycles lower. Although a majority (>90%) of clinical samples could be genotyped, the moderate sensitivity is drawback with the method. The overall sensitivity was 10,000–20,000 IU/mL and even lower for genotype 1, as also indicated by higher Ct values for genotype 1 when testing clinical samples. Accordingly, using a revised protocol increased sensitivity relatively more for genotype 1 (around 1 log). This revised protocol increased sensitivity for genotypes 1, 3 and 4 by 0.8–1.5 log, mainly by changing the reverse primer and gave an overall sensitivity of 5000 IU/mL. The approach of using Taqman probes for typing of HCV was successful and promising. Taqman probes have
M. Lindh, C. Hannoun / Journal of Clinical Virology 34 (2005) 108–114
previously been widely used for identifying mutations in the human genome, and may even detect single nucleotide differences. The major advantage with the assay is that the genotype is identified directly without further processing (Fig. 2). The Innolipa test is also based on PCR and hybridisation of the 5 NCR (Stuyver et al., 1994, 1996). However, in this test, a PCR is first run (in our laboratory using the Cobas Amplicor (Roche) assay) and then further processing, including incubating PCR products with nylon strips, is required. Compared with Innolipa and sequencing, the Taqman typing is faster and much less cumbersome and expensive. A potential disadvantage is that subtypes are not identified; however, at the moment there are no major clinical implications of subtyping. To our knowledge this is the first report of Taqman typing of HCV. Real-time PCR genotyping of HCV on the LightCycler instrument using hybridization FRET probes has however been described previously (Bullock et al., 2002; Schroter et al., 2002). Detection using such probes may utilize melting curve for typing because the probes are not consumed during PCR, but the larger hybridisation segment is a potential disadvantage because irrelevant variability may disturb the analysis. In summary, the use of Taqman hybridisation proved useful for genotyping of HCV. Because the genotype is obtained directly from PCR at a significantly lower cost this technique should be an attractive alternative to previously used methods, including Innolipa. Current work in our laboratory aims at refining the method in order to further improve detection of genotype 4 and to include probes for genotypes 5 and 6.
Acknowledgments I thank Katarina Lindstr¨om Johansson and Lena Toll´en for technical expertise. The project was supported by grants from the Swedish Medical Research council and the Magn. Bergwall foundation.
References Bhattacherjee V, Prescott LE, Pike I, Rodgers B, Bell H, El-Zayadi AR, et al. Use of NS-4 peptides to identify type-specific antibody to hepatitis C virus genotypes 1, 2, 3, 4, 5 and 6. J Gen Virol 1995;76:1737– 48. Bukh J, Purcell RH, Miller RH, et al. Sequence analysis of the 5 noncoding region of hepatitis C virus. Proc Natl Acad Sci USA 1992;89:4942–6. Bullock GC, Bruns DE, Haverstick DM, et al. Hepatitis C genotype determination by melting curve analysis with a single set of fluorescence resonance energy transfer probes. Clin Chem 2002;48:2147– 54. Chamberlain RW, Adams N, Saeed AA, Simmonds P, Elliott RM, et al. Complete nucleotide sequence of a type 4 hepatitis C virus variant, the predominant genotype in the Middle East. J Gen Virol 1997;78:1341–7.
113
Choo QL, Richman KH, Han JH, Berger K, Lee C, Dong C, et al. Genetic organization and diversity of the hepatitis C virus. Proc Natl Acad Sci USA 1991;88:2451–5. Dixit V, Quan S, Martin P, Larson D, Brezina M, DiNello R, et al. Evaluation of a novel serotyping system for hepatitis C virus: strong correlation with standard genotyping methodologies. J Clin Microbiol 1995;33:2978–83. Forns X, Maluenda MD, Lopez-Labrador FX, Ampurdanes S, Olmedo E, Costa J, et al. Comparative study of three methods for genotyping hepatitis C virus strains in samples from Spanish patients. J Clin Microbiol 1996;34:2516–21. Germer JJ, Rys PN, Thorvilson JN, Persing DH, et al. Determination of hepatitis C virus genotype by direct sequence analysis of products generated with the Amplicor HCV test. J Clin Microbiol 1999;37:2625–30. Halfon P, Trimoulet P, Bourliere M, Khiri H, de Ledinghen V, Couzigou P, et al. Hepatitis C virus genotyping based on 5 noncoding sequence analysis (Trugene). J Clin Microbiol 2001;39:1771–3. Lau JY, Mizokami M, Kolberg JA, Davis GL, Prescott LE, Ohno T, et al. Application of six hepatitis C virus genotyping systems to sera from chronic hepatitis C patients in the United States. J Infect Dis 1995;171:281–9. Manns MP, McHutchison JG, Gordon SC, Rustgi VK, Shiffman M, Reindollar R, et al. Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomised trial. Lancet 2001;358:958–65. Martell M, Gomez J, Esteban JI, Sauleda S, Quer J, Cabot B, et al. High-throughput real-time reverse transcription-PCR quantitation of hepatitis C virus RNA. J Clin Microbiol 1999;37:327–32. McOmish F, Yap PL, Dow BC, Follett EA, Seed C, Keller AJ, et al. Geographical distribution of hepatitis C virus genotypes in blood donors: an international collaborative survey. J Clin Microbiol 1994;32:884–92. Morris T, Robertson B, Gallagher M, et al. Rapid reverse transcriptionPCR detection of hepatitis C virus RNA in serum by using the TaqMan fluorogenic detection system. J Clin Microbiol 1996;34: 2933–6. Okamoto H, Sugiyama Y, Okada S, Kurai K, Akahane Y, Sugai Y, et al. Typing hepatitis C virus by polymerase chain reaction with typespecific primers: application to clinical surveys and tracing infectious sources. J Gen Virol 1992;73(Pt 3):673–9. Quarleri JF, Bussy MV, Mathet VL, Ruiz V, Iacono R, Lu L, et al. In vitro detection of dissimilar amounts of hepatitis C virus (HCV) subtype-specific RNA genomes in mixes prepared from sera of persons infected with a single HCV genotype. J Clin Microbiol 2003;41:2727–33. Ross RS, Viazov SO, Holtzer CD, Beyou A, Monnet A, Mazure C, et al. Genotyping of hepatitis C virus isolates using CLIP sequencing. J Clin Microbiol 2000;38:3581–4. Schroter M, Zollner B, Schafer P, Landt O, Lass U, Laufs R, et al. Genotyping of hepatitis C virus types 1, 2, 3, and 4 by a one-step LightCycler method using three different pairs of hybridization probes. J Clin Microbiol 2002;40:2046–50. Schroter M, Zollner B, Schafer P, Laufs R, Feucht HH, et al. Comparison of three HCV genotyping assays: a serological method as a reliable and inexpensive alternative to PCR based assays. J Clin Virol 2001;23:57–63. Simmonds P, Holmes EC, Cha TA, Chan SW, McOmish F, Irvine B, et al. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region. J Gen Virol 1993a;74:2391–9. Simmonds P, McOmish F, Yap PL, Chan SW, Lin CK, Dusheiko G, et al. Sequence variability in the 5 non-coding region of hepatitis C virus: identification of a new virus type and restrictions on sequence diversity. J Gen Virol 1993b;74:661–8. Stuyver L, Rossau R, Wyseur A, Duhamel M, Vanderborght B, Van Heuverswyn H, et al. Typing of hepatitis C virus isolates and char-
114
M. Lindh, C. Hannoun / Journal of Clinical Virology 34 (2005) 108–114
acterization of new subtypes using a line probe assay. J Gen Virol 1993;74:1093–102. Stuyver L, van Arnhem W, Wyseur A, Hernandez F, Delaporte E, Maertens G, et al. Classification of hepatitis C viruses based on phylogenetic analysis of the envelope 1 and nonstructural 5B regions and identification of five additional subtypes. Proc Natl Acad Sci USA 1994;91:10134–8.
Stuyver L, Wyseur A, van Arnhem W, Hernandez F, Maertens G, et al. Second-generation line probe assay for hepatitis C virus genotyping. J Clin Microbiol 1996;34:2259–66. Westin J, Lindh M, Lagging LM, Norkrans G, Wejstal R, et al. Chronic hepatitis C in Sweden: genotype distribution over time in different epidemiological settings. Scand J Infect Dis 1999;31:355– 8.
Genotyping of hepatitis C virus by Taqman real-time PCR Magnus Lindh ∗ , Charles Hannoun Department of Clinical Virology, Guldhedsgatan 10 B, 413 46 G¨oteborg, Sweden Received 14 June 2004; received in revised form 6 January 2005; accepted 3 February 2005
Abstract Background: Genotype of hepatitis C virus (HCV) is of major importance for the outcome of treatment. The response rate is considerably lower for genotype 1, the predominant genotype in western countries. Objectives: To develop and evaluate a new, simple method for genotyping of HCV based on real-time polymerase chain reaction (PCR) and Taqman probes targeting the 5 non-coding region. Study design: The method was compared with Innolipa on 220 serum samples representing genotypes 1–4, and was applied on a further 614 clinical samples. Results: Taqman typing of the 220 samples showed genotype 1 in 69, genotype 2 in 58, genotype 3 in 57 and genotype 4 in 19, while 17 were non-reactive. There was a complete concordance with Innolipa with the exception of seven samples, which were of genotype 1 by Taqman, but genotype 4 by Innolipa. Sequencing of these samples showed a subtype 4 variant which differed at two positions compared with subtypes 4b/c/d, which are targeted by the probe. By adding a modified probe, these genotype 4 variants could also be identified. Out of 614 consecutive clinical samples, 524 could be typed by the Taqman assay; 45.2% were genotype 1, 19.3% genotype 2, 33.8% genotype 3 and 1.7%, genotype 4. Conclusion: The method was overall accurate and provides an attractive alternative for genotyping because processing time and costs are significantly reduced. Inclusion of probes targeting genotypes 5 and 6 is required for the method to be useful in areas where these genotypes are present. © 2005 Elsevier B.V. All rights reserved. Keywords: HCV; Genotype; Real-time; PCR; 5 Non-coding region
1. Introduction Chronic hepatitis C virus (HCV) infection is a major cause of severe liver disease including liver cirrhosis and hepatocellular carcinoma. Evolution has created six genetic groups of HCV, so-called genotypes (Simmonds et al., 1993a,b) and a number of subtypes. The six known genotypes differ by more than 30% of the nucleotide (nt) sequence and have uneven geographic distributions. Genotype 1 is the predominating genotype in many geographic regions, including Europe and North America, where it accounts for 50–90% of the cases. Genotypes 2 and 3 are also widely distributed. Genotype 2 is relatively common in Europe, North America and Japan.
∗
Abbreviations: HCV, hepatitis C virus; PCR, polymerase chain reaction Corresponding author. Fax: +46 31 827032. E-mail address: [email protected] (M. Lindh).
1386-6532/$ – see front matter © 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2005.02.002
Genotype 3 is common in Southeast Asia, Australia, South America and northern Europe, in particular in intravenous drug users. Genotype 4 is found mainly in Egypt, the Middle East and central Africa, genotype 5 in southern Africa and genotype 6 in southeast Asia. Despite the fact that they differ from each other by more than 30% of the RNA sequence, pathogenic differences between genotypes have not been demonstrated, except for steatosis associated with genotype 3a. However, because the genotype dictates the chance of therapeutic response and duration of treatment genotyping has become fundamental in the clinical assessment of patients with hepatitis C. Genotypes 2 and 3 respond favourably (75% sustained response, SR) on 24 weeks of treatment with pegylated interferon and ribavirin, while genotype 1 responds worse (50% SR) even after 48 weeks of treatment. The suitable treatment regimen for genotypes 4–6 are not yet established (Manns et al., 2001).
M. Lindh, C. Hannoun / Journal of Clinical Virology 34 (2005) 108–114
The reference method for genotyping is sequencing and phylogenetic analysis (Choo et al., 1991). Although, sequencing may be rationalized (Germer et al., 1999; Ross et al., 2000; Halfon et al., 2001), simplified methods are preferable in clinical routine and for epidemiology studies. Such methods include genotype-specific polymerase chain reaction (PCR) (Okamoto et al., 1992), restriction fragment length polymorphism, RFLP (McOmish et al., 1994), serotyping (Bhattacherjee et al., 1995; Dixit et al., 1995) and line probe hybridization after PCR (Innolipa) (Stuyver et al., 1993, 1996). Overall, there is an acceptable concordance between these methods (Lau et al., 1995; Forns et al., 1996; Schroter et al., 2001). However, most of these methods are still quite cumbersome or expensive. Recently, real-time PCR on the LightCycler instrument using hybridisation probes has been applied for HCV genotyping (Bullock et al., 2002; Schroter et al., 2002). This report describes an alternative real-time PCR technique for simple and fast genotyping of HCV. This method utilizes Taqman probes which have been widely used for identifying mutations in the human genome, and which have also been applied for quantification (Morris et al., 1996; Martell et al., 1999), but to our knowledge not for typing of HCV infections.
2. Methods 2.1. Samples Two hundred and six serum samples that had previously been analysed by Innolipa HCV (Innogenetics, Gent, the Netherlands) in the clinical diagnostic unit at the Virological laboratory, Sahlgrenska University Hospital, were included. Of these, 68 were genotype 1, 61 genotype 2, 62 genotype 3 and 15 genotype 4 according to Innolipa. An additional, 14 samples (kindly provided by Dr. Jan Albert, Stockholm) classified as genotype 4 by NS5 sequencing, were also studied. In a second part of the study, the method was applied on 614 clinical samples that were sent to our laboratory during the period march 2003–2004 with a request for HCV RNA analysis.
109
Table 1 Primers and probes used for Taqman real-time PCR detection of HCV genotypes Oligo
Sequence
Tm (◦ C)
PrimF Gt1probe Gt2probe Gt3probe Gt4probe PrimR PrimF modified Gt4probe modified PrimR gt1/3/ 4 modified
CTGCGGAACCGGTGAGTACA ACCCGGTCGTCCTGGCAATTCC AAGGACCCAGTCTTYCCGGYAATTC ACCCGGTCACCCCAGCGATTCC CCCGGTCATCCCGGCGATTC TGCACGGTCTACGAGACCTCC TGCGGAACCGGTGAGTACAC CCCGGTCGTCCTGGCGATTCC CGACCCAACACTACTCGGCTA
60.7 68.9 68.7 70.7 69.4 61.2 60.5 70.5 58.9
All probes were labeled with 6-carboxyfluorescein (FAM) at 5 and 6carboxytetramethyl-rhodamine (TAMRA) at 3 end. The probes are aligned to show critical positions (mismatches vs. the genotype 1 probe are underlined). Tm , melting point, as estimated by the Primer Express software.
2.3. Taqman genotyping A 193 nucleotide long fragment of the 5 non-coding region (NCR) was amplified in an ABI 7000 genetic analyzer (Applied Biosystems, Foster City, CA). After reverse transcription at 48 ◦ C for 30 min followed by 10 min of denaturation at 95 ◦ C, polymerase chain reaction was run for 45 cycles of 95 ◦ C for 15 s and 60 ◦ C for 60 s. The PCR was run in a 96-well plate in 50 L reaction volume (including 10 L of sample preparation and 25 L of RT-PCR mastermix, Applied Biosystems). The primers and Taqman probes are described in Table 1. The primers were located to a conserved part of 5 non-coding region (NCR), while the probes were designed to bind to a short region characterized by genotype-specific differences described in Fig. 1. The probes were designed to match genotypes 1–4, and more specifically to target subtypes 1a/b, 2a/b/c, 3a and 4b/c/d, which cause the vast majority of HCV infections in our region (Westin et al., 1999). The probes all had a 6-carboxyfluorescein (FAM) reporter at the 5 end and a 6-carboxytetramethyl-rhodamine (TAMRA) quencher at the 3 end. By the use of the Primer Express software (Ap-
2.2. Sample preparation RNA extraction was done by a Magnapure LC robot (Roche Applied Science, Mannheim, Germany), using the total nucleic acid protocol. In each preparation, 200 L of serum was used and RNA was then eluted in 100 L of elution buffer. After RNA extraction, each sample was dispensed to four adjacent positions on a 96-well PCR plate by the use of the Magnapure post-elution function. Prior to addition of samples, the 96-well plate was preloaded with PCR reagents representing the four genotype-specific mastermixes by the use of an eight-channel pipette.
Fig. 1. Representative sequences of the short segment of the 5 non-coding region that is targeted by the Taqman probes. For genotypes 2–4 only positions differing from the genotype 1 sequence are shown. The bottom line shows the sequence of a genotype 4 variant, which was observed in seven samples.
110
M. Lindh, C. Hannoun / Journal of Clinical Virology 34 (2005) 108–114
Fig. 2. Schematic view of the three steps of Taqman genotyping of HCV. A 32-well plate was loaded manually with 24 serum samples (represented by parts 1–24). After Magnapure extraction, 4 × 10 l were transferred by the robot to a 96-well PCR plate preloaded with four mastermixes (genotypes (Gt) 1–4). The sample data were entered in an Excel spreadsheet from which they were imported to the Magnapure and the ABI 7000 runs, respectively.
plied Biosystems) they were designed to have a, Tm , 8–10 ◦ C higher than the primers, i.e., around 68–70 ◦ C when binding to the matching genotype. During PCR, bound probes are digested by the exonuclease activity of Taq polymerase. Therefore, fluorescence from the FAM reporter increases exponentially during PCR in parallel with consumption of the matching probe. In wells with mismatching probes, the same amplicon is produced, but due to the lower Tm of the probes they are unlikely to bind the amplicon and release fluorescence. Each sample was amplified by primers PrimF and PrimR in four adjacent wells, with probes matching genotypes 1, 2, 3 or 4, respectively, and thus, 24 samples could be typed in each run. For each sample, fluorescence was expected to be detected in either one of the four wells. The whole process with RNA extraction, pipetting, PCR and interpretation of real-time PCR curves was semi-automated and could be finished within 4 h as described in Fig. 2. 2.4. Sensitivity The sensitivity of the Taqman PCR was evaluated by analysing a serial dilutions of samples of genotypes 1–4, that had been quantified to close to 1 million IU/mL by Cobas Amplicor (Roche Diagnostics, Branchburg, NJ). These samples were serially diluted in 1:3 steps down to 200 IU/mL and each step was analysed in triplicate. 2.5. Genotype mixtures Different combinations and proportions of genotypes 1–4 were analysed by mixing samples of genotypes 1–4 in dif-
ferent proportions and dilutions (1:1, 1:10, 1:100). The concentrations of these samples (before mixing) were assessed by Cobas Amplicor. 2.6. Modifications In an additional part of the study, a modified assay was evaluated. In this version, an extra probe was used for detection of a variant of genotype 4. Moreover, the primers, in particular the reverse primer, were changed in order to increase sensitivity. These revised primers and probe are described in the lower part of Table 1. 2.7. Sequencing and phylogenetic analysis Direct sequencing was carried out on five of seven samples that produced discordant results (genotype 4 by Innolipa or NS5 sequencing, genotype 1 by Taqman). A nested PCR was done using a first round with primers NCR 46F (TGTGAGGAACTACTGTCTTCACGC) and oka186R (ATGTACCCCATGAGGTCGGC), and a second round with NCR 56F (ACGCAGAAAGCGTCTAGCCAT) and oka186R. After cycle sequencing using NCR 56F and oka186R, the sequence was detected using an ABI 310 (Applied Biosystems) automated sequence reader. Phylogenetic analysis was done by distance matrix and neighbour joining comparison of a 364 nt segment of 5 NCR and core regions (between nt −249 and 115) after bootstrapping to 100 replicates, using the Mega2 software.
M. Lindh, C. Hannoun / Journal of Clinical Virology 34 (2005) 108–114
111
Table 2 Results of Taqman genotyping in 220 serum samples previously genotyped by Innolipa (n = 106) or NS5 sequencing (n = 14) Innolipa
TaqMan genotyping Genotype 1
Genotype 1 (n = 68) Genotype 2 (n = 61) Genotype 3 (n = 62) Genotype 4 (n = 29)
62
Total
69
Negative Genotype 2
Genotype 3
Genotype 4
19
6 3 5 3
19
17
58 57 7 58
3. Results There was a complete agreement with Innolipa for all the genotypes 1–3 samples (Table 2). However, 17 samples (8%) that were typable by Innolipa were negative by Taqman and could not be typed. For genotype 4, Taqman correctly identified 19 out of 29 samples, while 7 were typed as genotypes 1 and 3 were PCR negative. Sequencing of the 5 NCR and part of core region of five of these seven samples showed that they were indeed genotype 4 (Fig. 3), and that they all had sequence in the Taqman probe region previously reported for subtype 4a (Fig. 1). This sequence differs from genotype 1 at one position only, explaining why they were classified as genotype 1 by Taqman. The geographical origin was known for three of these
57
seven patients. They were from Somalia, Eritrea and Myanmar (Burma) and by Innolipa their isolates were typed as 4e, 4e and 4h, respectively. The other three samples were typed as 4a by NS5 sequencing and had unknown geographic origin. For the majority of samples, reactivity (i.e., an amplification curve) was observed in only one of the four wells. However, for some of the genotype 3 samples there was a weak signal also with genotype 4 probe, observed as a flat curve appearing approximately 10 cycles later than the curve produced by the genotype 3 probe. Besides this, there were no cross-reactions or signs of dual genotype infection. In a second part of the study, a positive Taqman PCR reaction was found in 524 out of 614 clinical samples with a
Fig. 3. Phylogenetic tree based on distance matrix and neighbor joining comparison of a 364 nt segment of 5 NCR and core regions (nt −249 and −115) after bootstrapping to 100 replicates.
112
M. Lindh, C. Hannoun / Journal of Clinical Virology 34 (2005) 108–114
Table 3 Genotype distribution in G¨oteborg, Sweden, as measured by Innolipa or Taqman Genotype
Innolipa (1999–2001) n = 680 (%)
Taqman genotypinga (2003–2004) n = 524 (%)
1 2 3 4
317 (47) 120 (18) 225 (33) 18 (3)
237 (45.2) 101 (19.3) 177 (33.8) 9 (1.7)
a Not including 90 samples that were negative by Taqman PCR (of which 44 were positive by Cobas Amplicor).
request for HCV RNA testing. The genotype distribution of these samples is shown in Table 3. Out of the 90 samples that were negative by Taqman PCR, 89 were tested also by Cobas Amplicor and then 44 of them were HCV RNA positive. Thus, out of 568 samples with detectable HCV RNA, 524 (92.3%) could be detected and genotyped by the Taqman assay. The mean Ct values for the clinical samples analysed were 2–3 cycles higher for genotype 1 than for genotypes 2 or 3 (Ct mean 30.6 for genotype 1 versus 28.2 and 27.9 for genotypes 2 and 3, respectively), indicating a higher sensitivity for genotypes 2 and 3 than for genotype 1. 3.1. Genotype mixtures Mixtures of HCV genotypes were correctly detected when appearing at similar concentrations, or when the minor genotype was present at a proportion of 5–10% or more. However, analysis of genotype mixtures showed a reduced sensitivity (0.5–1 log) for the minor strain. 3.2. Revised genotyping and sensitivity In additional experiments, we evaluated a probe specifically designed to identify the genotype 4 variant that was erroneously typed as genotype 1. When using this probe in combination with the original genotype 4 probe, the genotype 4 variants were identified. However, they also produced a signal with the genotype 1 probe, and hence these variants gave a dual signal (genotypes 1 and 4) with similar Ct values. We also evaluated several new primer combinations, resulting in a modified set where the forward primer was moved one position downstream, the reverse primer (for genotypes 1, 3 and 4) 69 positions upstream. We thus managed to increase sensitivity by 1–1.5 logs for genotypes 1 and 4, and by 0.8 logs for genotype 3. Consequently, we achieved a sensitivity of 5000 IU/mL for all the genotypes.
4. Discussion The aim of the present study was to develop and evaluate a simple genotyping method that identifies genotypes 1–4. The
background was the fact that during the period 1999–2001 genotyping by Innolipa of 680 clinical samples in our laboratory had identified genotypes 1–4 in 317 (47%), 120 (18%), 225 (33%) and 18 (3%) samples, respectively. Because no cases of genotypes 5 or 6 had been observed, the genotyping method described here was not designed or evaluated for identifying these types. Overall, the Taqman method was accurate and correctly identified all samples belonging to genotypes 1–3. A proportion of genotype 4 samples (7/26) were misinterpreted as genotype 1. Sequencing of these samples revealed a sequence previously found in a subtype 4a variant, which has two mismatches (nt −163 and −159) versus the genotype 4 probe used in the Taqman assay. Because this subtype 4 variant has only one mismatch (nt −167) to the genotype 1 probe (Fig. 1), such samples were erroneously typed as genotype 1. This 4a subtype has previously been observed in samples from and Zaire (M84848 (Bukh et al., 1992)), Belgium (L29586 (Stuyver et al., 1994)), Burundi (L08150, L08155 (Simmonds et al., 1993a,b)) and Argentina (AY172639 (Quarleri et al., 2003)). Subtype 4a has also been frequently reported from Egypt, represented by strain ED43 (accession no. Y11604, complete genome) (Chamberlain et al., 1997), which however is identical to subtypes 4b/c/d in the Taqman probe region. Conversely, three of our samples (originating from Somalia, Eritrea and Myanmar) with the genotype 4 variant (i.e., with −163/A and −159/C) were not 4a by Innolipa but 4e or 4h. Apparently, the genotype 4 variant is not confined to subtype 4a or to central parts of Africa. This observation may have impact on the interpretation of Innolipa subtyping, and calls for further study of the genotype 4 variability in the 5 NCR. We evaluated a revised protocol with an additional probe in the genotype 4 mastermix. The samples with the genotype 4 variant could then be identified, although they also produced a positive reaction by the genotype 1 mastermix. For samples with such dual reactivity, additional testing by Innolipa or sequencing is recommended to confirm the genotype. Conversely, because the additional probe only has one mismatch to genotype 1, there was some degree of cross-reaction. However, genotype 1 samples could always be correctly identified because the signal by the genotype 1 probe was stronger and had Ct value that was 5 cycles lower. Although a majority (>90%) of clinical samples could be genotyped, the moderate sensitivity is drawback with the method. The overall sensitivity was 10,000–20,000 IU/mL and even lower for genotype 1, as also indicated by higher Ct values for genotype 1 when testing clinical samples. Accordingly, using a revised protocol increased sensitivity relatively more for genotype 1 (around 1 log). This revised protocol increased sensitivity for genotypes 1, 3 and 4 by 0.8–1.5 log, mainly by changing the reverse primer and gave an overall sensitivity of 5000 IU/mL. The approach of using Taqman probes for typing of HCV was successful and promising. Taqman probes have
M. Lindh, C. Hannoun / Journal of Clinical Virology 34 (2005) 108–114
previously been widely used for identifying mutations in the human genome, and may even detect single nucleotide differences. The major advantage with the assay is that the genotype is identified directly without further processing (Fig. 2). The Innolipa test is also based on PCR and hybridisation of the 5 NCR (Stuyver et al., 1994, 1996). However, in this test, a PCR is first run (in our laboratory using the Cobas Amplicor (Roche) assay) and then further processing, including incubating PCR products with nylon strips, is required. Compared with Innolipa and sequencing, the Taqman typing is faster and much less cumbersome and expensive. A potential disadvantage is that subtypes are not identified; however, at the moment there are no major clinical implications of subtyping. To our knowledge this is the first report of Taqman typing of HCV. Real-time PCR genotyping of HCV on the LightCycler instrument using hybridization FRET probes has however been described previously (Bullock et al., 2002; Schroter et al., 2002). Detection using such probes may utilize melting curve for typing because the probes are not consumed during PCR, but the larger hybridisation segment is a potential disadvantage because irrelevant variability may disturb the analysis. In summary, the use of Taqman hybridisation proved useful for genotyping of HCV. Because the genotype is obtained directly from PCR at a significantly lower cost this technique should be an attractive alternative to previously used methods, including Innolipa. Current work in our laboratory aims at refining the method in order to further improve detection of genotype 4 and to include probes for genotypes 5 and 6.
Acknowledgments I thank Katarina Lindstr¨om Johansson and Lena Toll´en for technical expertise. The project was supported by grants from the Swedish Medical Research council and the Magn. Bergwall foundation.
References Bhattacherjee V, Prescott LE, Pike I, Rodgers B, Bell H, El-Zayadi AR, et al. Use of NS-4 peptides to identify type-specific antibody to hepatitis C virus genotypes 1, 2, 3, 4, 5 and 6. J Gen Virol 1995;76:1737– 48. Bukh J, Purcell RH, Miller RH, et al. Sequence analysis of the 5 noncoding region of hepatitis C virus. Proc Natl Acad Sci USA 1992;89:4942–6. Bullock GC, Bruns DE, Haverstick DM, et al. Hepatitis C genotype determination by melting curve analysis with a single set of fluorescence resonance energy transfer probes. Clin Chem 2002;48:2147– 54. Chamberlain RW, Adams N, Saeed AA, Simmonds P, Elliott RM, et al. Complete nucleotide sequence of a type 4 hepatitis C virus variant, the predominant genotype in the Middle East. J Gen Virol 1997;78:1341–7.
113
Choo QL, Richman KH, Han JH, Berger K, Lee C, Dong C, et al. Genetic organization and diversity of the hepatitis C virus. Proc Natl Acad Sci USA 1991;88:2451–5. Dixit V, Quan S, Martin P, Larson D, Brezina M, DiNello R, et al. Evaluation of a novel serotyping system for hepatitis C virus: strong correlation with standard genotyping methodologies. J Clin Microbiol 1995;33:2978–83. Forns X, Maluenda MD, Lopez-Labrador FX, Ampurdanes S, Olmedo E, Costa J, et al. Comparative study of three methods for genotyping hepatitis C virus strains in samples from Spanish patients. J Clin Microbiol 1996;34:2516–21. Germer JJ, Rys PN, Thorvilson JN, Persing DH, et al. Determination of hepatitis C virus genotype by direct sequence analysis of products generated with the Amplicor HCV test. J Clin Microbiol 1999;37:2625–30. Halfon P, Trimoulet P, Bourliere M, Khiri H, de Ledinghen V, Couzigou P, et al. Hepatitis C virus genotyping based on 5 noncoding sequence analysis (Trugene). J Clin Microbiol 2001;39:1771–3. Lau JY, Mizokami M, Kolberg JA, Davis GL, Prescott LE, Ohno T, et al. Application of six hepatitis C virus genotyping systems to sera from chronic hepatitis C patients in the United States. J Infect Dis 1995;171:281–9. Manns MP, McHutchison JG, Gordon SC, Rustgi VK, Shiffman M, Reindollar R, et al. Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomised trial. Lancet 2001;358:958–65. Martell M, Gomez J, Esteban JI, Sauleda S, Quer J, Cabot B, et al. High-throughput real-time reverse transcription-PCR quantitation of hepatitis C virus RNA. J Clin Microbiol 1999;37:327–32. McOmish F, Yap PL, Dow BC, Follett EA, Seed C, Keller AJ, et al. Geographical distribution of hepatitis C virus genotypes in blood donors: an international collaborative survey. J Clin Microbiol 1994;32:884–92. Morris T, Robertson B, Gallagher M, et al. Rapid reverse transcriptionPCR detection of hepatitis C virus RNA in serum by using the TaqMan fluorogenic detection system. J Clin Microbiol 1996;34: 2933–6. Okamoto H, Sugiyama Y, Okada S, Kurai K, Akahane Y, Sugai Y, et al. Typing hepatitis C virus by polymerase chain reaction with typespecific primers: application to clinical surveys and tracing infectious sources. J Gen Virol 1992;73(Pt 3):673–9. Quarleri JF, Bussy MV, Mathet VL, Ruiz V, Iacono R, Lu L, et al. In vitro detection of dissimilar amounts of hepatitis C virus (HCV) subtype-specific RNA genomes in mixes prepared from sera of persons infected with a single HCV genotype. J Clin Microbiol 2003;41:2727–33. Ross RS, Viazov SO, Holtzer CD, Beyou A, Monnet A, Mazure C, et al. Genotyping of hepatitis C virus isolates using CLIP sequencing. J Clin Microbiol 2000;38:3581–4. Schroter M, Zollner B, Schafer P, Landt O, Lass U, Laufs R, et al. Genotyping of hepatitis C virus types 1, 2, 3, and 4 by a one-step LightCycler method using three different pairs of hybridization probes. J Clin Microbiol 2002;40:2046–50. Schroter M, Zollner B, Schafer P, Laufs R, Feucht HH, et al. Comparison of three HCV genotyping assays: a serological method as a reliable and inexpensive alternative to PCR based assays. J Clin Virol 2001;23:57–63. Simmonds P, Holmes EC, Cha TA, Chan SW, McOmish F, Irvine B, et al. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region. J Gen Virol 1993a;74:2391–9. Simmonds P, McOmish F, Yap PL, Chan SW, Lin CK, Dusheiko G, et al. Sequence variability in the 5 non-coding region of hepatitis C virus: identification of a new virus type and restrictions on sequence diversity. J Gen Virol 1993b;74:661–8. Stuyver L, Rossau R, Wyseur A, Duhamel M, Vanderborght B, Van Heuverswyn H, et al. Typing of hepatitis C virus isolates and char-
114
M. Lindh, C. Hannoun / Journal of Clinical Virology 34 (2005) 108–114
acterization of new subtypes using a line probe assay. J Gen Virol 1993;74:1093–102. Stuyver L, van Arnhem W, Wyseur A, Hernandez F, Delaporte E, Maertens G, et al. Classification of hepatitis C viruses based on phylogenetic analysis of the envelope 1 and nonstructural 5B regions and identification of five additional subtypes. Proc Natl Acad Sci USA 1994;91:10134–8.
Stuyver L, Wyseur A, van Arnhem W, Hernandez F, Maertens G, et al. Second-generation line probe assay for hepatitis C virus genotyping. J Clin Microbiol 1996;34:2259–66. Westin J, Lindh M, Lagging LM, Norkrans G, Wejstal R, et al. Chronic hepatitis C in Sweden: genotype distribution over time in different epidemiological settings. Scand J Infect Dis 1999;31:355– 8.