- Email: [email protected]
Genotyping of human cytomegalovirus using non-radioactive single-strand conformation polymorphism (SSCP) analysis
Journal of Virological Methods 110 (2003) 25 /28 www.elsevier.com/locate/jviromet
Genotyping of human cytomegalovirus using non-radioactive singlestrand conformation polymorphism (SSCP) analysis Dulcine´ia Martins de Albuquerque a,*, Sandra Cecı´lia Botelho Costa b a
Department of Pharmacology, College of Medicine, State University of Campinas, Distrito de Bara˜o Geraldo, Campinas SP 13083-970, Brazil b Department of Clinical Medicine, College of Medicine, State University of Campinas, Campinas SP, Brazil Received 23 August 2002; received in revised form 26 February 2003; accepted 27 February 2003
Abstract Genetic variation in the glycoprotein B (gB) gene may play a role in human cytomegaloviruses (HCMVs) pathogenesis. Using restriction analysis of the gB gene product (PCR-RFLP), amplified by the nested polymerase chain reaction, the HCMV strains can be compared and classified into at least four HCMV groups. PCR single-strand conformation polymorphism (PCR-SSCP) is one of the techniques used to identify a mutant sequence or a polymorphism in a known gene. SSCP analysis has the advantage over RFLP analysis on detection of DNA polymorphisms and point mutations at a variety of positions in DNA fragments. However, the original SSCP protocols using the incorporation of radioactive label and polyacrylamide gel electrophoresis for detection are labour intensive and time-consuming. A simplified SSCP protocol is described to identify HCMV strains and the gB genotype, allowing the detection of sequence variations not residing in the endonuclease recognition sites. # 2003 Elsevier Science B.V. All rights reserved. Keywords: Human cytomegalovirus; Glycoprotein B; Strains/variants; PCR-restriction fragment length polymorphism; PCR-single-strand conformation polymorphism
Human cytomegalovirus (HCMV) disease is a common infectious complication and remains a major cause of morbidity and mortality in immunocompromised patients. In these patients, early diagnosis of HCMV infection is important since the development of HCMV disease may be prevented (Darlington et al., 1991; Lehner et al., 1991; Navarro et al., 1997). Genetic variability of functionally important genes among different virus strains may influence clinical manifestations of HCMV infections (Vogelberg et al., 1996; Rasmussen et al., 1997; Hebart et al., 1997). These variabilities, mainly of the glycoprotein B (gB) gene of the viral envelope, appear to be of clinical relevance because they are assumed to play an essential role in the induction of immune response and in viral entry into host cells, and it has considered as a potential marker for viral virulence. Based on the restriction analysis of PCR products (PCR-RFLP), the HCMV genotypes
* Corresponding author. Tel.: /55-19-3788-7095; fax: /55-193289-1089. E-mail address: [email protected] (D.M. de Albuquerque).
were determined previously, and it may possibly be helpful in predicting the clinical outcome of HCMV infection (Chou, 1990; Chou and Dennison, 1991; Fries et al., 1994; Torok-Storb et al., 1997; Wada et al., 1997). Single-strand conformation polymorphism (SSCP) analysis is a genetic screening technique that allows rapid detection of single nucleotide substitutions in fragments of PCR-amplified genomic DNA (Lin et al., 1993; Fujioka et al., 1995). The principle of this technique is that the double stranded DNA, when denatured partially, migrates as two single stranded DNA (ssDNA) bands in non-denaturing polyacrylamide gel electrophoresis. Small variations in the target sequence may alter the conformation of the ssDNA and consequently its electrophoretic profile (Palacio and Duran-Vila, 1999). The original SSCP protocols using the incorporation of radioactive labelling and polyacrylamide gel electrophoresis for detection are labour intensive and timeconsuming (Sentinelli et al., 2000). The temperaturecontrol and semi-automation provided by automated SSCP analysis and staining simplify and speed-up the
0166-0934/03/$ - see front matter # 2003 Elsevier Science B.V. All rights reserved. doi:10.1016/S0166-0934(03)00094-6
D.M. de Albuquerque, S.C.B. Costa / Journal of Virological Methods 110 (2003) 25 /28
26
detection step and eliminates the use of radioactivity (Phastsystem protocols). The aim of this study was to verify the suitability of a non-radioactive SSCP analysis as a tool for screening HCMV isolates and the standardization of a simple and reproducible protocol allowing the routine analysis of viral genetic variability.
Grand Island, NY) containing ethidium bromide, and the gel was photographed under UV illumination. The AD169 strain was used as a positive control, uninfected DNA as the negative control and reaction without DNA as a white control (water).
3. RFLP analysis 1. Study population The laboratory strain, AD169, was propagated in human foreskin fibroblasts and used as positive control. Twenty-six HCMV-positive clinical samples from bone marrow transplant recipients were obtained from peripheral blood leukocytes of patients attending in the Hemocentro/UNICAMP during routine screening and the DNA was extracted by phenol/chloroform extraction and ethanol precipitation. The patients who are HCMV-positive by nested PCR for the major immediately early gene and immediately early gene of HCMV were selected for the genotyping.
2. Amplification of the gB gene by nested PCR The oligonucleotide primers used for PCR amplification were chosen in a region of high sequence variability in the HCMV gB gene as previously published and were synthesized commercially (Invitrogen, Life Technologies, SP, Brazil). Primers are listed in Table 1. The first and the second rounds of amplification were carried out in a total volume of 50 ml using 200 ng DNA extract (1st) and 1 ml PCR product (2nd) and 49 ml PCR mix (10 mM Tris pH 8.3, 50 mM KCl, 2 mM MgCl2, 200 mM of each dNTPs, 1.25 U of recombinant Taq DNA polymerase and 0.4 mM of each primer, Invitrogen, Life Technologies). After amplification, 5 ml of the amplified product were electrophoresed on a 2% agarose gel (Gibco-BRL,
Approximately 10 ml of nested PCR product were digested at 37 8C overnight, using 1 U of the restriction enzymes, Rsa I and Hinf I (Gibco-BRL). Products were analysed on a 2% Agarose 1000 gel (Gibco-BRL). The four types of gB were distinguished by their different patterns of fragment lengths as described (Chou and Dennison, 1991).
4. SSCP analysis For SSCP analysis, 1 ml of the nested PCR product were mixed with 3 ml of loading buffer containing: 95% formamide, 0.1% bromophenol blue, 0.1% xylene cyanol and 10 mM EDTA pH 8. The samples were denatured for 5 min at 94 8C, placed on ice to stabilize single strands and then 1 ml of mixture was electrophoresed onto a 43 mm /50 mm /0.45 mm 20% polyacrylamide gel in an automatic system PhastSystemTM (Pharmacia Biotech, Piscataway, NJ). Electrophoresis was performed using native buffer strips and the separation method shown in Table 2. The products were visualized by silver staining using an automatic program.
5. Analysis of gB variation by nested PCR-RFLP Nested PCR amplification and restriction enzyme digestion of the HCMV gene were performed in 26 clinical samples of bone marrow transplant recipients and resulted in differentiation of four digestion patterns,
Table 1 gB Primers sequences and PCR conditions Round Primer sequences
PCR product
PCR conditionsa
/355 bp
30 cycles: 94 8C-30ƒ 65 8C-45ƒ, 72 8C-1?
Forward
Reverse
1st
gB 1319: 5? TGGAACTGGAACGTTTGGC 3? (Chou and Dennison, 1991)
gB 1659: 5? GCACCTTGACGCTGGTTTGG 3? (Vogelberg et al., 1996)
2nd
gB 1319: 5? TGGAACTGGAACGTTTGGC 3? (Chou and Dennison, 1991)
gB 1604: 5? GAAACGCGCGGCAATCGG 299 /305 bp 30 cycles: 94 8C-30ƒ, 65 8C-30ƒ, 3? 72 8C-1? (Chou and Dennison, 1991) /15 cycles: 94 8C-30ƒ, 55 8C-30ƒ, 72 8C-1?
Note: All sequences are based on the AD169 sequence (GenBank Accession No. X04606). a Both cycle rounds were preceded by an initial denaturation for 5 min at 94 8C and followed by final extension for 7 min at 72 8C.
D.M. de Albuquerque, S.C.B. Costa / Journal of Virological Methods 110 (2003) 25 /28
27
Fig. 1. Ethidium bromide stained 2% agarose 1000 gel (Gibco-BRL) showing patterns of RFLP analysis for the HCMV gB gene (gB1 /gB4) using the restriction endonuclease Rsa I (r) and Hinf I (h). M: 100 bp Ladder (Gibco-BRL); the numbers indicate fragment sizes (bp) characteristic of each gB group.
as previously demonstrated (Chou and Dennison, 1991) (Fig. 1). The genotypes were distributed: four patients (15.4%) were compatible with the gB1 genotype, 15 (57.7%) were gB2 (AD169), six patients (23.0%) were gB3 and one (3.9%) were gB4.
6. Genotyping by PCR-SSCP All samples genotyped by RFLP analysis were submitted to SSCP analysis to characterize virus strains and the procedure allowed the determination of the four gB types identified previously, shown in Fig. 2 as four patterns of shift in mobility due to conformational changes of DNA sequences. In the population studied each viral subtype demonstrates a specific electrophoretic pattern for SSCP analysis. HCMV is one of the most common opportunistic pathogens in immunocompromised patients (Darlington et al., 1991; Lehner et al., 1991). gB in the viral envelope plays an important role in virus infectivity. The gene coding for gB is highly variable and the use of RFLP after amplification of a fragment determined at least four gB genotypes (Vogelberg et al., 1996; Chou and Dennison, 1991). HCMV subtyping by molecular characterization is important as it may provide information for epidemio-
logical purposes and for investigations into pathogenesis and disease progression. Our data demonstrated that SSCP analysis can be used as a tool for virus genotyping since it allows the detection of sequence variation not residing in the endonuclease recognition sites, and, in addition, it can detect DNA polymorphisms and point mutations at a variety of positions in DNA fragments (Orita et al., 1989; Lin et al., 1993; Palacio and Duran-Vila, 1999; Arens, 1999; Binder et al., 1999). The data indicate that SSCP is a non-radioactive, fast and simple technique, reproducible and highly sensitive,
Fig. 2. Silver stained 20% polyacrylamide gel (Phastgels† -Pharmacia Biotech, Piscataway, NJ) of an SSCP analysis of the amplicon of the glycoprotein B region. Lane 1, AD169 (gB2); lane 2, gB1; lane 3, gB2; lane 4, gB3; lane 5, gB4.
Table 2 PhastSystemTM separation methods used on PhastGel† Prerun Sample application Run
150 V 500 V 340 V
10.0 mA 10.0 mA 10.0 mA
5.0 W 5.0 W 5.0 W
15 8C 15 8C 15 8C
10 V/h 2 V/h 650 V/h
28
D.M. de Albuquerque, S.C.B. Costa / Journal of Virological Methods 110 (2003) 25 /28
and they suggest that the SSCP analysis for HCMV gB genotyping can be applied easily to a larger number of samples to examine the clinical relevance of different strains.
Acknowledgements The authors would like to thank Lu´cia Helena Siqueira for help in SSCP standardization and Fernando Ferreira Costa for his helpful comments in several aspects of this work. This research was supported by FAPESP.
References Arens, M., 1999. Methods for subtyping and molecular comparison of human viral genomes. Clinical Microbiology Reviews 12 (4), 612 / 626. Binder, T., Siegert, W., Kruse, A., Oettle, H., Wilborn, F., Peng, R., Timm, H., Neuhaus, P., Schmidt, C.A., 1999. Identification of human cytomegalovirus variants by analysis of single-strand conformation polymorphism and DNA sequencing of the envelope glycoprotein B gene region-distribution frequency in liver transplant recipients. Journal of Virological Methods 78 (1 /2), 153 / 162. Chou, S., 1990. Differentiation of cytomegalovirus strains by restriction analysis of DNA sequences amplified from clinical specimens. Journal of Infectious Diseases 162, 738 /742. Chou, S., Dennison, K.M., 1991. Analysis of interstrain variation in cytomegalovirus glycoprotein B sequences encoding neutralizationrelated epitopes. Journal of Infectious Diseases 163, 1229 /1234. Darlington, J., Super, M., Patel, K., Grundy, J.E., Griffiths, P.D., Emery, V.C., 1991. Use of the polymerase chain reaction to analyse sequence variation within a major neutralizing epitope of glycoprotein B (gp58) in clinical isolates of human cytomegalovirus. Journal of General Virology 72, 1985 /1989. Fries, B.C., Chou, S., Boeckh, M., Torok-Storb, B., 1994. Frequency distribution of cytomegalovirus envelope glycoprotein genotypes in bone marrow transplant recipients. Journal of Infectious Diseases 169, 769 /774.
Fujioka, S., Koide, H., Kitaura, Y., Duguchi, H., Kawamura, K., 1995. Analysis of enterovirus genotypes using single-strand conformation polymorphisms of polymerase chain reaction products. Journal of Virological Methods 51, 253 /258. Hebart, H., Greif, M., Krause, H., Kanz, L., Jahn, G., Mu¨ller, C.A., Einsele, H., 1997. Interstrain variation of immediate early DNA sequences and glycoprotein B genotypes in cytomegalovirus clinical isolates. Medical Microbiology and Immunology 186, 135 /138. Lehner, R., Stamminger, T., Mach, M., 1991. Comparative sequence analysis of human cytomegalovirus strains. Journal of Clinical Microbiology 29, 2494 /2502. Lin, J.C., Kumar, B., Lin, S.C., 1993. Rapid and sensitive genotyping of Epstein-Barr virus using single-strand conformation polymorphism analysis of polymerase chain reaction products. Journal of Virological Methods 43, 233 /246. Navarro, D., Lennette, E., Tugizov, S., Pereira, L., 1997. Humoral immune response to functional regions of human cytomegalovirus glycoprotein B. Journal of Medical Virology 52, 451 /459. Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K., Sekiya, T., 1989. Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc. Natl. Acad. Sci. USA 86 (8), 2766 /2770. Palacio, A., Duran-Vila, N., 1999. Single-strand conformation polymorphism (SSCP) analysis as a tool for viroid characterisation. Journal of Virological Methods 77, 27 /36. Rasmussen, L., Hong, C., Zipeto, D., Morris, S., Sherman, D., Chou, S., Miner, R., Drew, W.L., Wolitz, R., Dowling, A., Warford, A., Merigan, T.C., 1997. Cytomegalovirus gB genotype distribution differs in human immunodeficiency virus-infected patients and immunocompromised allograft recipients. Journal of Infectious Diseases 175, 179 /184. Sentinelli, F., Lovari, S., Vitale, M., Giorgi, G., Di Mario, U., Baroni, M.G., 2000. A simple method for non-radioactive PCR-SSCP using MDETM gel solution and a midi gel format: application for the detection of variants in the GLUT1 and CTLA-4 genes. Journal of Biotechnology 78 (2), 201 /204. Torok-Storb, B., Boeckh, M., Hoy, C., Leisenring, W., Myerson, D., Gooley, T., 1997. Association of specific cytomegalovirus genotypes with death from myelosuppression after marrow transplantation. Blood 90 (5), 2097 /2102. Vogelberg, C., Meyer-Ko¨nig, U., Hufert, F.T., Kirste, G., Von Laer, D., 1996. Human cytomegalovirus glycoprotein B genotypes in renal transplant recipients. Journal of Medical Virology 50, 31 /34. Wada, K., Mizuno, S., Kato, K., Kamiya, T., Ozawa, K., 1997. Cytomegalovirus glycoprotein B sequence variation among Japanese bone marrow transplant recipients. Intervirology 40, 215 /219.
Genotyping of human cytomegalovirus using non-radioactive singlestrand conformation polymorphism (SSCP) analysis Dulcine´ia Martins de Albuquerque a,*, Sandra Cecı´lia Botelho Costa b a
Department of Pharmacology, College of Medicine, State University of Campinas, Distrito de Bara˜o Geraldo, Campinas SP 13083-970, Brazil b Department of Clinical Medicine, College of Medicine, State University of Campinas, Campinas SP, Brazil Received 23 August 2002; received in revised form 26 February 2003; accepted 27 February 2003
Abstract Genetic variation in the glycoprotein B (gB) gene may play a role in human cytomegaloviruses (HCMVs) pathogenesis. Using restriction analysis of the gB gene product (PCR-RFLP), amplified by the nested polymerase chain reaction, the HCMV strains can be compared and classified into at least four HCMV groups. PCR single-strand conformation polymorphism (PCR-SSCP) is one of the techniques used to identify a mutant sequence or a polymorphism in a known gene. SSCP analysis has the advantage over RFLP analysis on detection of DNA polymorphisms and point mutations at a variety of positions in DNA fragments. However, the original SSCP protocols using the incorporation of radioactive label and polyacrylamide gel electrophoresis for detection are labour intensive and time-consuming. A simplified SSCP protocol is described to identify HCMV strains and the gB genotype, allowing the detection of sequence variations not residing in the endonuclease recognition sites. # 2003 Elsevier Science B.V. All rights reserved. Keywords: Human cytomegalovirus; Glycoprotein B; Strains/variants; PCR-restriction fragment length polymorphism; PCR-single-strand conformation polymorphism
Human cytomegalovirus (HCMV) disease is a common infectious complication and remains a major cause of morbidity and mortality in immunocompromised patients. In these patients, early diagnosis of HCMV infection is important since the development of HCMV disease may be prevented (Darlington et al., 1991; Lehner et al., 1991; Navarro et al., 1997). Genetic variability of functionally important genes among different virus strains may influence clinical manifestations of HCMV infections (Vogelberg et al., 1996; Rasmussen et al., 1997; Hebart et al., 1997). These variabilities, mainly of the glycoprotein B (gB) gene of the viral envelope, appear to be of clinical relevance because they are assumed to play an essential role in the induction of immune response and in viral entry into host cells, and it has considered as a potential marker for viral virulence. Based on the restriction analysis of PCR products (PCR-RFLP), the HCMV genotypes
* Corresponding author. Tel.: /55-19-3788-7095; fax: /55-193289-1089. E-mail address: [email protected] (D.M. de Albuquerque).
were determined previously, and it may possibly be helpful in predicting the clinical outcome of HCMV infection (Chou, 1990; Chou and Dennison, 1991; Fries et al., 1994; Torok-Storb et al., 1997; Wada et al., 1997). Single-strand conformation polymorphism (SSCP) analysis is a genetic screening technique that allows rapid detection of single nucleotide substitutions in fragments of PCR-amplified genomic DNA (Lin et al., 1993; Fujioka et al., 1995). The principle of this technique is that the double stranded DNA, when denatured partially, migrates as two single stranded DNA (ssDNA) bands in non-denaturing polyacrylamide gel electrophoresis. Small variations in the target sequence may alter the conformation of the ssDNA and consequently its electrophoretic profile (Palacio and Duran-Vila, 1999). The original SSCP protocols using the incorporation of radioactive labelling and polyacrylamide gel electrophoresis for detection are labour intensive and timeconsuming (Sentinelli et al., 2000). The temperaturecontrol and semi-automation provided by automated SSCP analysis and staining simplify and speed-up the
0166-0934/03/$ - see front matter # 2003 Elsevier Science B.V. All rights reserved. doi:10.1016/S0166-0934(03)00094-6
D.M. de Albuquerque, S.C.B. Costa / Journal of Virological Methods 110 (2003) 25 /28
26
detection step and eliminates the use of radioactivity (Phastsystem protocols). The aim of this study was to verify the suitability of a non-radioactive SSCP analysis as a tool for screening HCMV isolates and the standardization of a simple and reproducible protocol allowing the routine analysis of viral genetic variability.
Grand Island, NY) containing ethidium bromide, and the gel was photographed under UV illumination. The AD169 strain was used as a positive control, uninfected DNA as the negative control and reaction without DNA as a white control (water).
3. RFLP analysis 1. Study population The laboratory strain, AD169, was propagated in human foreskin fibroblasts and used as positive control. Twenty-six HCMV-positive clinical samples from bone marrow transplant recipients were obtained from peripheral blood leukocytes of patients attending in the Hemocentro/UNICAMP during routine screening and the DNA was extracted by phenol/chloroform extraction and ethanol precipitation. The patients who are HCMV-positive by nested PCR for the major immediately early gene and immediately early gene of HCMV were selected for the genotyping.
2. Amplification of the gB gene by nested PCR The oligonucleotide primers used for PCR amplification were chosen in a region of high sequence variability in the HCMV gB gene as previously published and were synthesized commercially (Invitrogen, Life Technologies, SP, Brazil). Primers are listed in Table 1. The first and the second rounds of amplification were carried out in a total volume of 50 ml using 200 ng DNA extract (1st) and 1 ml PCR product (2nd) and 49 ml PCR mix (10 mM Tris pH 8.3, 50 mM KCl, 2 mM MgCl2, 200 mM of each dNTPs, 1.25 U of recombinant Taq DNA polymerase and 0.4 mM of each primer, Invitrogen, Life Technologies). After amplification, 5 ml of the amplified product were electrophoresed on a 2% agarose gel (Gibco-BRL,
Approximately 10 ml of nested PCR product were digested at 37 8C overnight, using 1 U of the restriction enzymes, Rsa I and Hinf I (Gibco-BRL). Products were analysed on a 2% Agarose 1000 gel (Gibco-BRL). The four types of gB were distinguished by their different patterns of fragment lengths as described (Chou and Dennison, 1991).
4. SSCP analysis For SSCP analysis, 1 ml of the nested PCR product were mixed with 3 ml of loading buffer containing: 95% formamide, 0.1% bromophenol blue, 0.1% xylene cyanol and 10 mM EDTA pH 8. The samples were denatured for 5 min at 94 8C, placed on ice to stabilize single strands and then 1 ml of mixture was electrophoresed onto a 43 mm /50 mm /0.45 mm 20% polyacrylamide gel in an automatic system PhastSystemTM (Pharmacia Biotech, Piscataway, NJ). Electrophoresis was performed using native buffer strips and the separation method shown in Table 2. The products were visualized by silver staining using an automatic program.
5. Analysis of gB variation by nested PCR-RFLP Nested PCR amplification and restriction enzyme digestion of the HCMV gene were performed in 26 clinical samples of bone marrow transplant recipients and resulted in differentiation of four digestion patterns,
Table 1 gB Primers sequences and PCR conditions Round Primer sequences
PCR product
PCR conditionsa
/355 bp
30 cycles: 94 8C-30ƒ 65 8C-45ƒ, 72 8C-1?
Forward
Reverse
1st
gB 1319: 5? TGGAACTGGAACGTTTGGC 3? (Chou and Dennison, 1991)
gB 1659: 5? GCACCTTGACGCTGGTTTGG 3? (Vogelberg et al., 1996)
2nd
gB 1319: 5? TGGAACTGGAACGTTTGGC 3? (Chou and Dennison, 1991)
gB 1604: 5? GAAACGCGCGGCAATCGG 299 /305 bp 30 cycles: 94 8C-30ƒ, 65 8C-30ƒ, 3? 72 8C-1? (Chou and Dennison, 1991) /15 cycles: 94 8C-30ƒ, 55 8C-30ƒ, 72 8C-1?
Note: All sequences are based on the AD169 sequence (GenBank Accession No. X04606). a Both cycle rounds were preceded by an initial denaturation for 5 min at 94 8C and followed by final extension for 7 min at 72 8C.
D.M. de Albuquerque, S.C.B. Costa / Journal of Virological Methods 110 (2003) 25 /28
27
Fig. 1. Ethidium bromide stained 2% agarose 1000 gel (Gibco-BRL) showing patterns of RFLP analysis for the HCMV gB gene (gB1 /gB4) using the restriction endonuclease Rsa I (r) and Hinf I (h). M: 100 bp Ladder (Gibco-BRL); the numbers indicate fragment sizes (bp) characteristic of each gB group.
as previously demonstrated (Chou and Dennison, 1991) (Fig. 1). The genotypes were distributed: four patients (15.4%) were compatible with the gB1 genotype, 15 (57.7%) were gB2 (AD169), six patients (23.0%) were gB3 and one (3.9%) were gB4.
6. Genotyping by PCR-SSCP All samples genotyped by RFLP analysis were submitted to SSCP analysis to characterize virus strains and the procedure allowed the determination of the four gB types identified previously, shown in Fig. 2 as four patterns of shift in mobility due to conformational changes of DNA sequences. In the population studied each viral subtype demonstrates a specific electrophoretic pattern for SSCP analysis. HCMV is one of the most common opportunistic pathogens in immunocompromised patients (Darlington et al., 1991; Lehner et al., 1991). gB in the viral envelope plays an important role in virus infectivity. The gene coding for gB is highly variable and the use of RFLP after amplification of a fragment determined at least four gB genotypes (Vogelberg et al., 1996; Chou and Dennison, 1991). HCMV subtyping by molecular characterization is important as it may provide information for epidemio-
logical purposes and for investigations into pathogenesis and disease progression. Our data demonstrated that SSCP analysis can be used as a tool for virus genotyping since it allows the detection of sequence variation not residing in the endonuclease recognition sites, and, in addition, it can detect DNA polymorphisms and point mutations at a variety of positions in DNA fragments (Orita et al., 1989; Lin et al., 1993; Palacio and Duran-Vila, 1999; Arens, 1999; Binder et al., 1999). The data indicate that SSCP is a non-radioactive, fast and simple technique, reproducible and highly sensitive,
Fig. 2. Silver stained 20% polyacrylamide gel (Phastgels† -Pharmacia Biotech, Piscataway, NJ) of an SSCP analysis of the amplicon of the glycoprotein B region. Lane 1, AD169 (gB2); lane 2, gB1; lane 3, gB2; lane 4, gB3; lane 5, gB4.
Table 2 PhastSystemTM separation methods used on PhastGel† Prerun Sample application Run
150 V 500 V 340 V
10.0 mA 10.0 mA 10.0 mA
5.0 W 5.0 W 5.0 W
15 8C 15 8C 15 8C
10 V/h 2 V/h 650 V/h
28
D.M. de Albuquerque, S.C.B. Costa / Journal of Virological Methods 110 (2003) 25 /28
and they suggest that the SSCP analysis for HCMV gB genotyping can be applied easily to a larger number of samples to examine the clinical relevance of different strains.
Acknowledgements The authors would like to thank Lu´cia Helena Siqueira for help in SSCP standardization and Fernando Ferreira Costa for his helpful comments in several aspects of this work. This research was supported by FAPESP.
References Arens, M., 1999. Methods for subtyping and molecular comparison of human viral genomes. Clinical Microbiology Reviews 12 (4), 612 / 626. Binder, T., Siegert, W., Kruse, A., Oettle, H., Wilborn, F., Peng, R., Timm, H., Neuhaus, P., Schmidt, C.A., 1999. Identification of human cytomegalovirus variants by analysis of single-strand conformation polymorphism and DNA sequencing of the envelope glycoprotein B gene region-distribution frequency in liver transplant recipients. Journal of Virological Methods 78 (1 /2), 153 / 162. Chou, S., 1990. Differentiation of cytomegalovirus strains by restriction analysis of DNA sequences amplified from clinical specimens. Journal of Infectious Diseases 162, 738 /742. Chou, S., Dennison, K.M., 1991. Analysis of interstrain variation in cytomegalovirus glycoprotein B sequences encoding neutralizationrelated epitopes. Journal of Infectious Diseases 163, 1229 /1234. Darlington, J., Super, M., Patel, K., Grundy, J.E., Griffiths, P.D., Emery, V.C., 1991. Use of the polymerase chain reaction to analyse sequence variation within a major neutralizing epitope of glycoprotein B (gp58) in clinical isolates of human cytomegalovirus. Journal of General Virology 72, 1985 /1989. Fries, B.C., Chou, S., Boeckh, M., Torok-Storb, B., 1994. Frequency distribution of cytomegalovirus envelope glycoprotein genotypes in bone marrow transplant recipients. Journal of Infectious Diseases 169, 769 /774.
Fujioka, S., Koide, H., Kitaura, Y., Duguchi, H., Kawamura, K., 1995. Analysis of enterovirus genotypes using single-strand conformation polymorphisms of polymerase chain reaction products. Journal of Virological Methods 51, 253 /258. Hebart, H., Greif, M., Krause, H., Kanz, L., Jahn, G., Mu¨ller, C.A., Einsele, H., 1997. Interstrain variation of immediate early DNA sequences and glycoprotein B genotypes in cytomegalovirus clinical isolates. Medical Microbiology and Immunology 186, 135 /138. Lehner, R., Stamminger, T., Mach, M., 1991. Comparative sequence analysis of human cytomegalovirus strains. Journal of Clinical Microbiology 29, 2494 /2502. Lin, J.C., Kumar, B., Lin, S.C., 1993. Rapid and sensitive genotyping of Epstein-Barr virus using single-strand conformation polymorphism analysis of polymerase chain reaction products. Journal of Virological Methods 43, 233 /246. Navarro, D., Lennette, E., Tugizov, S., Pereira, L., 1997. Humoral immune response to functional regions of human cytomegalovirus glycoprotein B. Journal of Medical Virology 52, 451 /459. Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K., Sekiya, T., 1989. Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc. Natl. Acad. Sci. USA 86 (8), 2766 /2770. Palacio, A., Duran-Vila, N., 1999. Single-strand conformation polymorphism (SSCP) analysis as a tool for viroid characterisation. Journal of Virological Methods 77, 27 /36. Rasmussen, L., Hong, C., Zipeto, D., Morris, S., Sherman, D., Chou, S., Miner, R., Drew, W.L., Wolitz, R., Dowling, A., Warford, A., Merigan, T.C., 1997. Cytomegalovirus gB genotype distribution differs in human immunodeficiency virus-infected patients and immunocompromised allograft recipients. Journal of Infectious Diseases 175, 179 /184. Sentinelli, F., Lovari, S., Vitale, M., Giorgi, G., Di Mario, U., Baroni, M.G., 2000. A simple method for non-radioactive PCR-SSCP using MDETM gel solution and a midi gel format: application for the detection of variants in the GLUT1 and CTLA-4 genes. Journal of Biotechnology 78 (2), 201 /204. Torok-Storb, B., Boeckh, M., Hoy, C., Leisenring, W., Myerson, D., Gooley, T., 1997. Association of specific cytomegalovirus genotypes with death from myelosuppression after marrow transplantation. Blood 90 (5), 2097 /2102. Vogelberg, C., Meyer-Ko¨nig, U., Hufert, F.T., Kirste, G., Von Laer, D., 1996. Human cytomegalovirus glycoprotein B genotypes in renal transplant recipients. Journal of Medical Virology 50, 31 /34. Wada, K., Mizuno, S., Kato, K., Kamiya, T., Ozawa, K., 1997. Cytomegalovirus glycoprotein B sequence variation among Japanese bone marrow transplant recipients. Intervirology 40, 215 /219.