- Email: [email protected]
Geraniol protects against lipopolysaccharide and D-galactosamine-induced fulminant hepatic failure by activating PPARγ
Microbial Pathogenesis 128 (2019) 7–12
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Geraniol protects against lipopolysaccharide and D-galactosamine-induced fulminant hepatic failure by activating PPARγ
T
Yi Lia,∗, Nian Wangb, Yongfang Jianga,∗∗ a b
Department of Infectious Diseases, The Second Xiangya Hospital of Central South University, Changsha, Hunan, 410011, China Department of Pathophysiology, School of Basic Medical Science Central South University, Changsha, Hunan, 410083, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Geraniol Lipopolysaccharide D-galactosamine Fulminant hepatic failure NF-κB PPARγ
Geraniol (GOH), a natural component of plant essential oils, exhibits potent antioxidant and anti-inflammatory properties. The aim of this study was to assess the protective effects and mechanisms of GOH on lipopolysaccharide (LPS)/D-galactosamine (D-GalN)-induced fulminant hepatic failure (FHF). Mice were treated with GOH (12.5, 25, and 50 μg/kg) 1 h before challenging LPS (60 mg/kg) and D-GalN (800 mg/kg). 8 h later LPS/DGlaN treatment, mice were sacrificed and the serum and the liver tissues were collected for testing. The liver pathological changes were assessed by H & E staining. MPO activity, MDA level in liver tissues, and AST, ALT levels in serum were detected by specific detection kits. The levels of TNF-α and IL-1β were detected by ELISA. The expression of NF-κB and PPARγ were detected by western blot analysis and qRT-PCR. The results showed that GOH had a protective effect on LPS/D-GalN-induced FHF, as evidence by the attenuation of liver pathological injury, MPO activity, MDA level, and serum AST and ALT levels. GOH reduced liver TNF-α and IL-1β levels through inhibiting NF-κB signaling pathway activation. Furthermore, GOH increased PPARγ expression in FHF induced by LPS/D-GalN. In conclusion, the present study proved that GOH protects against LPS/D-GalNinduced FHF through inhibiting inflammatory response and increasing PPARγ expression.
1. Introduction Fulminant hepatic failure (FHF) is a severe clinical syndrome that results from severely impaired liver function. The predisposing factor of FHF is multitudinous, such as bacteria, viral hepatitis, alcohol and some hepatotoxic drugs [1]. Except liver transplantation, there are still lacks of benefit treatment for FHF. However, the rapidity of progression and the variable course of FHF limited the success rate in liver transplantation. In addition, the effective resource is limited [2,3]. Evidences indicated that approximately 80–90% FHF patients were died due to did not receive liver transplantation [4]. Thus, specific and effective treatment of FHF is necessary. Lipopolysaccharide (LPS) in combination with D-galactosamine (D-GalN) induced experimental liver injury is a wildly used experimental model for researching acute liver failure in clinical [5–8]. Stimulation of LPS leads to severe inflammatory response, including numbers of pro-inflammatory cytokines production, and inflammatory cells infiltration into the infected tissues [9,10]. DGalN is a hepatotoxic agent that can abrogate the biosynthesis of macro-molecules in liver. Injection of LPS accompanied by D-GalN can induce specific liver injury rather than other organs [11].
∗
Geraniol (GOH) is an acyclic monoterpene alcohol isolated from the essential oils of lemon, rose, ginger, or orange [12,13]. GOH proved to have anti-inflammatory, anti-apoptotic, cytoprotective, and antioxidant properties [14–19]. Studies proved that GOH have a protective effect against traumatic spinal cord injury by inhibiting inflammatory cytokines production, oxidative stress and apoptosis, as well as NF-κB and p38 MAPK signaling pathway activation [20]. GOH treatment inhibited inflammatory response and apoptosis in the lung, and this effect might be through inhibiting the activation of TLR4-mediated NF-κB and Bcl2/Bax signaling pathways [19]. Recently reports have been proved that GOH treatment reduced the oxidative and toxic damage in the liver induced by acetate [21]. However, whether GOH exerts the protective effects on LPS/D-GalN-induced FHF have not been reported. Thus, in the present study, we assessed the protective effects and molecular mechanisms of GOH on LPS/D-GalN-induced FHF.
Corresponding author. Department of Infectious Diseases, the Second Xiangya Hospital of Central South University, Changsha, Hunan, 410011, China. Corresponding author. E-mail addresses: [email protected] (Y. Li), [email protected] (Y. Jiang).
∗∗
https://doi.org/10.1016/j.micpath.2018.11.054 Received 13 July 2018; Received in revised form 16 November 2018; Accepted 30 November 2018 Available online 11 December 2018 0882-4010/ © 2018 Published by Elsevier Ltd.
Microbial Pathogenesis 128 (2019) 7–12
Y. Li et al.
2. Materials and methods
collected after LPS/D-GalN treatment. The liver samples were homogenized and centrifuged. The supernatants were used to assess the levels of TNF-α and IL-1β according to the instruction.
2.1. Materials Geraniol (purity > 98%), LPS (Escherichia coli, O55:B5), and DGalN were purchased from Sigma (St, Louis, MO, USA). Alanine aminotransferase (ALT), aspartate aminotransferase (AST), malondiadehyde (MDA), and myeloperoxidase (MPO) activity detection kits were purchased from Jiancheng Bioengineering Institute (Nanjing, China). The enzyme-linked immunosorbent assay (ELISA) kits for TNFα and IL-1β were purchased from Biolegend (CA, USA). NF-κB p65, peNFeκB p65, IκBα, p-IκBα, β-actin, and PPARγ antibodies were purchased from Cell Signaling Technology Inc (Beverly, MA). All other chemicals were of reagent grade.
2.8. Western blot assay To test peNFeκB p65, NF-κB p65, p-IκBα, IκBα, and PPARγ proteins expression, 40 μg of soluble protein from liver homogenate was used. Equal amount of proteins were loaded on 10% SDS-PAGE and electrotransferred to PVDF membranes. Transferred membranes were washed with TBST and blocked for 2 h at room temperature with 5% skimmed milk. The membranes were then incubated overnight at 4 °C with specific primary antibodies. After washing three times for 10 min each in TBST, the membranes were incubated with secondary antibodies for 1 h at room temperature, followed by detection using an ECL detection system.
2.2. Animals Male C57BL/6 mice (approximately 8 weeks, 20–25 g), were purchased from Experimental Animal Center of Baiqiuen Medical College of Jilin University. The mice were fed under specific pathogen-free conditions. The experiments were performed in accordance with the use and care of laboratory animal manual published by the US National Institutes of Health.
2.9. Quantitative real time PCR Total RNA from liver tissues were extracted by TRIzol (Sangong Biotech, Shanghai, China). Then, RNA was transcribed to cDNA using the kit purchased from Invitrogen (CA, USA). Real time PCR was performed in a 7500 Fast Real-Time PCR System (Applied Biosystems). The primers are listed in Table 1 β-Actin was reference gene.
2.3. Animal treatment
2.10. Statistical assay
Forty male mice were randomly divided into six groups: control group, LPS/D-GalN group, LPS/D-GalN + GOH (12.5, 25, and 50 mg/ kg) groups, LPS + GOH (50 mg/kg) + GW9662 group. Mice from LPS/ D-GalN group received an intraperitoneal injection with LPS (60 mg/ kg) and D-GalN (800 mg/kg) dissolved in PBS. GOH (12.5, 25, and 50 mg/kg) were intraperitoneally treated 1 h before the LPS/D-GalN challenge. The dose of GOH used in the study was referenced to previous studies [19,22]. The mice of LPS + GOH (50 mg/kg) + GW9662 group were injected with GW9662 (5 mg/kg body weight, i.p.) 1 h before GOH treatment and then given LPS and D-GalN. The control group was injected with the same volume of PBS. 8 h later, the mice were sacrificed and the blood and the liver tissues were collected for assessing.
All the data were analyzed by SPSS 21.0 software (IBM Corp, Armonk, NY, USA). Measurement data were expressed as the mean ± SD. Statistical significance was analyzed using one-way analysis of variance (ANOVA). p < 0.05 was considered statistically significantly. 3. Results 3.1. GOH alleviated liver pathological damage induced by LPS/D-GalN The liver pathological changes were assessed by H & E staining. The results showed that liver sections of control group showed no any pathological damages. Liver sections of LPS/D-GalN group showed significantly pathological damages, including a large number of inflammatory cells infiltration, cellular necrosis, obviously morphological disruption, including extensive vacuolization with the disappearance of nuclei, and the loss of hepatic architecture. However, these pathological changes were markedly attenuated by GOH (Fig. 1).
2.4. Histopathological assay Liver tissues were collected at 8 h after LPS/D-GalN challenge and were fixed in 10% formalin. The samples were imbedded in paraffin and sliced into 4 μm sections. The samples were stained with hematoxylin and eosin (H & E) and pathological changes of liver tissues were detected under a light microscope.
3.2. GOH inhibited serum AST, and ALT levels induced by LPS/D-GalN
2.5. Liver enzymes assay
Liver enzyme AST and ALT are the major indicator of liver injury. As showed in Fig. 2, serum AST, and ALT levels were significantly increased in the LPS/D-GalN group compared with the control group. However, significantly attenuation in the levels of ALT and AST were found in the GOH + LPS/D-GalN groups. However, the levels of ALT
To further assess the protective effects of GOH on LPS/D-GalN-induced liver tissue damage, serum enzyme activities of ALT and AST were tested by detection kits according to the manufacturer's instruction (Jiancheng Bioengineering Institute of Nanjing, Nanjing, China).
Table 1 Primers for RT-PCR.
2.6. MPO and MDA levels assay MPO activity was wildly used to assess the level of neutrophil. MDA is an indicator of lipid peroxidation in the liver. Liver tissues were collected after LPS/D-GalN injection and the content MPO and MDA were detected by specific detection kits according to the instruction (Jiancheng Bioengineering Institute of Nanjing, Nanjing, China).
Gene
Primer
Sequence 5’ > 3′
Size (bp)
p65
Sense Anti-sense Sense Anti-sence Sense Anti-sence Sense Anti-sence
CCAGAAGAGGAGAGGAGGGTAT GGGATTTAGAGAAAAGGGGACTA TACCCCTCTACATCTTGCCTGT GTGTCATAGCTCTCCTCATCCTC ACAGGAAAGACAACGGACAAATC TTCTACGGATCGAAACTGGCAC TAAAACGCAGCTCAGTAACAGTCGG TGCAATCCTGTGGCATCCATGAAAC
111
IκBα PPARγ
2.7. ELISA assay
β-actin
The liver tissues for pro-inflammatory cytokines detection were 8
238 203 182
Microbial Pathogenesis 128 (2019) 7–12
Y. Li et al.
Fig. 1. Histopathologic sections of the livers (H&E, × 400). (A) Control group treated with PBS. (B) Group treated with LPS/D-gal. (C) Group pretreated with 12.5 mg/kg GOH 1 h before LPS/D-gal administration. (D) Group pretreated with 25 mg/kg GOH 1 h before LPS/D-gal administration. (E) Group pretreated with 50 mg/kg GOH 1 h before LPS/D-gal administration. (F) Group injected with GW9662 (5 mg/kg body weight, i.p.) 1 h before GOH treatment and then given LPS and D-GalN.
Fig. 3. Effects of GOH on MPO activity in LPS/D-gal induced mice. Mice were given an intraperitoneal injection of GOH 1 h before LPS/D-gal administration. The values presented are the mean ± SD. p# < 0.01 vs. control group, p* < 0.05, p** < 0.01 vs. LPS/D-gal group.
MPO activity in the LPS + GOH (50 mg/kg) + GW9662 group was increased when compared to the LPS/D-GalN + GOH (50 mg/kg) group. The results suggested PPARγ inhibitor GW9662 could reverse the inhibition of GOH on LPS/D-GalN-induced MPO activity. 3.4. GOH inhibited liver MDA level induced by LPS/D-GalN
Fig. 2. Effects of GOH on ALT and AST activities in mice after LPS/D-gal treatment. The values presented are the mean ± SD. p# < 0.01 vs. control group, p* < 0.05, p** < 0.01 vs. LPS/D-gal group.
MDA is a marker of oxidative stress. To assay the protective effect of GOH on LPS/D-GalN-induced liver oxidative damage, the MDA level was tested in the present study. As shown in Fig. 4, liver MDA level was significantly increased in LPS/D-GalN treated mice. However, GOH dose-dependently reversed LPS/D-GalN-induced up-regulation of liver MDA level. However, the level of MDA in the LPS + GOH (50 mg/ kg) + GW9662 group was increased when compared to the LPS/DGalN + GOH (50 mg/kg) group. The results suggested PPARγ inhibitor GW9662 could reverse the inhibition of GOH on LPS/D-GalN-induced MDA level.
and AST in the LPS + GOH (50 mg/kg) + GW9662 group were increased when compared to the LPS/D-GalN + GOH (50 mg/kg) group. The results suggested PPARγ inhibitor GW9662 could reverse the inhibition of GOH on ALT and AST production. 3.3. GOH inhibited liver MPO activity induced by LPS/D-GalN MPO activity is often used as a marker for neutrophil infiltration. The increased of MPO activity could lead to severe oxidative stress and oxidative tissue damages. As shown in Fig. 3, MPO activity in the LPS/ D-GalN group was markedly higher than that of controls group. However, the higher MPO activity were significantly reduced by treatment with GOH, and in a dose-dependently manner. However, the level of
3.5. GOH inhibited pro-inflammatory cytokines production induced by LPS/D-GalN Pro-inflammatory cytokines TNF-α and IL-1β levels were tested to 9
Microbial Pathogenesis 128 (2019) 7–12
Y. Li et al.
3.6. GOH inhibited NF-κB signaling pathway activation induced by LPS/DGalN NF-κB signaling pathway plays an important role in inflammatory response. In the present study, the effects of GOH on NF-κB signaling pathway proteins expression were tested by western blot. As shown in Fig. 6, LPS/D-GalN treated increased the mRNA and protein expression of peNFeκB p65, and p-IκBα. However, GOH significantly inhibited LPS/D-GalN-induced peNFeκB p65, and p-IκBα m RNA and protein expression. 3.7. GOH increased liver PPARγ expression PPARγ is a member of the nuclear hormone receptor superfamily. Many reports demonstrated that PPARγ play an important role in the inflammatory response. In the present study, we tested the effects of GOH on PPARγ mRNA and protein expression. The results showed that LPS/D-GalN treatment inhibited the expression of PPARγ both in mRNA and protein (Fig. 7) levels. However, treatment of GOH increased the mRNA and protein expression of PPARγ, and in a dose dependent manner.
Fig. 4. Effects of GOH on MDA content in LPS/D-gal induced mice. Mice were given an intraperitoneal injection of GOH 1 h before LPS/D-gal administration. The values presented are the mean ± SD. p# < 0.01 vs. control group, p* < 0.05, p** < 0.01 vs. LPS/D-gal group.
4. Discussion Fulminant hepatic failure (FHF) is a severe clinical syndrome with high mortality due to lack of effective therapies [23]. The combination of LPS and D-GalN was often used as an experimental model of FHF to investigate the mechanisms of clinical liver injury and explore the efficiency of hepatoprotective agents [24,25]. Treatment of LPS and DGalN into mice can cause dramatic hepatic injury, and even lead to rapid death [6,26]. In the present study, we tested the protective effects and mechanisms of GOH on LPS/D-GalN-induced FHF. LPS/D-GalN leads to severe liver pathological damage, increased TNF-α and IL-1β levels, MPO activity, as well as MDA level. However, GOH significantly inhibited these changes induced by LPS/D-GalN. Further research suggested that GOH protected mice against LPS/D-GlaN-induced FHF through regulating the expression of NF-κB and PPARγ. Serum ALT and AST are wildly used as indicator of liver injury [27,28]. The higher levels of serum ALT and AST often indicate the pathological condition of severe liver injury [29]. Our results showed that the increased levels of serum ALT and AST from the LPS/D-GalN group were observed when compared to the control group. However, treatment of GOH reduced the serum AST and ALT levels induced by LPS/D-GalN. MPO activity is often used as a marker of tissue neutrophil infiltration. Up-regulation of MPO activity can cause oxidative tissue damages, and MDA is wildly used as a marker of oxidative tissue damage. Thus, the liver MPO activity and MDA level were tested in the present study. The results showed that LPS/D-GalN-induced up-regulation of MPO activity and MDA level were dose-dependently inhibited by GOH. Pro-inflammatory cytokines, TNF-α and IL-1β, play an important role in the development of FHF. TNF-α can induce an inflammatory cascade that lead to produce other pro-inflammatory cytokines, such as IL-1β [30]. Studies has been proved that over-production of TNF-α is associated with the development of hepatitis [31]. And inhibition of TNF-α production was an efficient method to prevent LPS/D-GalN-induced liver injury [32,33]. IL-1β is a pro-inflammatory cytokine that participated in the pathogenesis of LPS/D-GalN-induced FHF, evidence by over-production of IL-1β is associated with the liver damage and apoptosis, and depleted of IL-1β completely rescued the phenotype [34]. In the present study, we assessed the effect of GOH on TNF-α and IL-1β production during LPS/D-GalN-induced FHF. The results showed that GOH significantly inhibited LPS/D-GalN-induced TNF-α and IL-1β production in a dose-dependent manner. Pro-inflammatory cytokines expression is required for the activation of NF-κB signaling pathway. Under normal circumstances, NF-κB is
Fig. 5. Effects of GOH on hepatic TNF-α and IL-1β levels in LPS/D-gal induced mice. The values presented are the mean ± SD. p# < 0.01 vs. control group, p* < 0.05, p** < 0.01 vs. LPS/D-gal group.
assess the anti-inflammatory effect of GOH on LPS/D-GalN-induced liver inflammatory response in the present study. As shown in Fig. 5, there was a significantly increase in liver TNF-α and IL-1β levels in LPS/D-GalN group mice compared with the control group mice. However, GOH inhibited TNF-α, and IL-1β production in LPS/D-GalN treated mice in a dose-dependent manner. However, the levels of TNFα, and IL-1β in the LPS + GOH (50 mg/kg) + GW9662 group were increased when compared to the LPS/D-GalN + GOH (50 mg/kg) group. The results suggested PPARγ inhibitor GW9662 could reverse the inhibition of GOH on LPS/D-GalN-induced TNF-α, and IL-1β levels.
10
Microbial Pathogenesis 128 (2019) 7–12
Y. Li et al.
Fig. 6. Effects of GOH on LPS/D-gal induced NF-κB activation in mice. β-Actin was used as a control. The values presented are the mean ± SD. p# < 0.01 vs. control group, p* < 0.05, p** < 0.01 vs. LPS/D-gal group.
inhibiting NF-κB signaling pathway activation [35]. Others also suggested that GOH prevented the altherogenic diet induced fibrosis in experimental hamsters by regulating NF-κB signaling pathway [36]. In the present study, whether GOH protected against LPS/D-GalN-induced liver inflammatory response through regulating NF-κB activation has been assessed. The results showed that pretreatment with GOH dosedependently inhibited LPS/D-GalN-induced NF-κB signaling pathway activation. PPARγ, belongs to the nuclear receptor superfamily, is ligand-dependent transcription factor. PPARγ plays a critical role in the regulation of a range of inflammatory gene expression and it can serve as a target of the efficient drugs for the treatment of inflammation and immune responses [37–40]. A previous study showed that rosiglitazone, a PPARγ agonist, significantly inhibited inflammatory mediator production through regulating NF-κB signaling pathway in LPS/DGalN-induced acute liver injury [41]. Studies also reported that depletion of PPARγ aggravated liver injury induced by CCL4. These data proved the protective role of PPARγ on liver injury [42]. Thus, we tested the effects of GOH on the expression of PPARγ in the present study. The results showed that GOH significantly increased the expression of PPARγ during LPS/D-GalN-induced FHF. It showed that GOH might act as an agonist of PPARγ to inhibit inflammatory response induced by LPS/D-GalN. In conclusion, the current study has proved the protective effect of GOH on LPS/D-GalN-induced FHF, the mechanisms of this property might by inhibiting inflammatory response through increasing the expression of PPARγ. GOH might be a potential agent for treating FHF. Conflicts of interest All authors declare that they have no conflict of interest. References [1] T. Nakama, S. Hirono, A. Moriuchi, S. Hasuike, K. Nagata, T. Hori, et al., Etoposide prevents apoptosis in mouse liver with D-galactosamine/lipopolysaccharide-induced fulminant hepatic failure resulting in reduction of lethality, Hepatology 33 (2001) 1441–1450. [2] W.M. Lee, R.H. Squires, S.L. Nyberg, E. Doo, J.H. Hoofnagle, Acute liver failure: summary of a workshop, Hepatology 47 (2008) 1401–1415. [3] Z. Ben Ari, O. Avlas, O. Pappo, V. Zilbermints, Y. Cheporko, L. Bachmetov, et al., Reduced hepatic injury in Toll-like receptor 4-deficient mice following D-galactosamine/lipopolysaccharide-induced fulminant hepatic failure, Cell. Physiol. Biochem. : Int. J. Exp. Cell. Physiol., Biochem., Pharmacol. 29 (2012) 41–50. [4] W. Lauchart, R. Viebahn, H. de Groot, Acute liver failure, Zentralblatt fur Chirurgie 119 (1994) 285–286. [5] T.M. Rahman, H.J.F. Hodgson, Animal models of acute hepatic failure, Int. J. Exp. Pathol. 81 (2000) 145–157. [6] C. Galanos, M.A. Freudenberg, W. Reutter, Galactosamine-induced sensitization to the lethal effects of endotoxin, Proc. Natl. Acad. Sci. U. S. A 76 (1979) 5939–5943.
Fig. 7. Effects of GOH on PPAR-γ mRNA and protein expression in mice. βActin was used as a control. The values presented are the mean ± SD. p# < 0.01 vs. control group, p* < 0.05, p** < 0.01 vs. LPS/D-gal group.
bound to its inhibitory protein IκBα that in an inactive form in the cytoplasm. Once stimulated by its agonist, NF-κB is rapidly phosphorylated and ultimately degradated from IκBα protein that lead to NF-κB p65 translocation into the nucleus and activates the transcription of the pro-inflammatory cytokines genes. Previous study reported that GOH protected against DSS-induced ulcerative colitis through
11
Microbial Pathogenesis 128 (2019) 7–12
Y. Li et al.
[7] T. Nakama, S. Hirono, A. Moriuchi, S. Hasuike, K. Nagata, T. Hori, et al., Etoposide prevents apoptosis in mouse liver with D-galactosamine/lipopolysaccharide-induced fulminant hepatic failure resulting in reduction of lethality, Hepatology 33 (2001) 1441–1450. [8] H. Wang, Y. Li, Protective effect of bicyclol on acute hepatic failure induced by lipopolysaccharide and D-galactosamine in mice, Eur. J. Pharmacol. 534 (2006) 194–201. [9] C. Fiuza, A.F. Suffredini, Human models of innate immunity: local and systemic inflammatory responses, J. Endotoxin Res. 7 (2001) 385–388. [10] J.W. Kang, D.W. Kim, J.S. Choi, Y.S. Kim, S.M. Lee, Scoparone attenuates D-galactosamine/lipopolysaccharide-induced fulminant hepatic failure through inhibition of toll-like receptor 4 signaling in mice, Food Chem. Toxicol. :Int. J. Publ. Br. Indus. Biol. Res. Assoc. 57 (2013) 132–139. [11] L. Ma, X. Gong, G. Kuang, R. Jiang, R. Chen, J. Wan, Sesamin ameliorates lipopolysaccharide/d-galactosamine-induced fulminant hepatic failure by suppression of Toll-like receptor 4 signaling in mice, Biochem. Biophys. Res. Commun. 461 (2015) 230–236. [12] V. Vinothkumar, S. Manoharan, G. Sindhu, M.R. Nirmal, V. Vetrichelvi, Geraniol modulates cell proliferation, apoptosis, inflammation, and angiogenesis during 7,12-dimethylbenz[a]anthracene-induced hamster buccal pouch carcinogenesis, Mol. Cell. Biochem. 369 (2012) 17–25. [13] K.F. Jiang, T. Zhang, N.N. Yin, X.F. Ma, G. Zhao, H.C. Wu, et al., Geraniol alleviates LPS-induced acute lung injury in mice via inhibiting inflammation and apoptosis, Oncotarget 8 (2017) 71038–71053. [14] M. Tiwari, P. Kakkar, Plant derived antioxidants - geraniol and camphene protect rat alveolar macrophages against t-BHP induced oxidative stress, Toxicol. Vitro : an Int. J. Publ. Assoc. BIBRA 23 (2009) 295–301. [15] V. Vinothkumar, S. Manoharan, G. Sindhu, M.R. Nirmal, V. Vetrichelvi, Geraniol modulates cell proliferation, apoptosis, inflammation, and angiogenesis during 7,12-dimethylbenz[a]anthracene-induced hamster buccal pouch carcinogenesis, Mol. Cell. Biochem. 369 (2012) 17–25. [16] R. de Cassia da Silveira e Sa, L.N. Andrade, D.P. de Sousa, A review on anti-inflammatory activity of monoterpenes, Molecules 18 (2013) 1227–1254. [17] S.C. Chaudhary, M.S. Siddiqui, M. Athar, M.S. Alam, Geraniol inhibits murine skin tumorigenesis by modulating COX-2 expression, Ras-ERK1/2 signaling pathway and apoptosis, J. Appl. Toxicol. : JAT 33 (2013) 828–837. [18] S. Carnesecchi, Y. Schneider, J. Ceraline, B. Duranton, F. Gosse, N. Seiler, et al., Geraniol, a component of plant essential oils, inhibits growth and polyamine biosynthesis in human colon cancer cells, J. Pharmacol. Exp. Therapeut. 298 (2001) 197–200. [19] K. Jiang, T. Zhang, N. Yin, X. Ma, G. Zhao, H. Wu, et al., Geraniol alleviates LPSinduced acute lung injury in mice via inhibiting inflammation and apoptosis, Oncotarget 8 (2017) 71038–71053. [20] J. Wang, B. Su, H. Zhu, C. Chen, G. Zhao, Protective effect of geraniol inhibits inflammatory response, oxidative stress and apoptosis in traumatic injury of the spinal cord through modulation of NF-kappaB and p38 MAPK, Exp Ther Med 12 (2016) 3607–3613. [21] A. Ozkaya, Z. Sahin, M. Kuzu, Y.S. Saglam, M. Ozkaraca, M. Uckun, et al., Role of geraniol against lead acetate-mediated hepatic damage and their interaction with liver carboxylesterase activity in rats, Arch. Physiol. Biochem. 124 (2018) 80–87. [22] V. La Rocca, D.V. da Fonseca, K.S. Silva-Alves, F.W. Ferreira-da-Silva, D.P. de Sousa, P.L. Santos, et al., Geraniol induces antinociceptive effect in mice evaluated in behavioural and electrophysiological models, Basic Clin. Pharmacol. Toxicol. 120 (2017) 22–29. [23] F.V. Schiodt, W.M. Lee, Fulminant liver disease, Clin. Liver Dis. 7 (2003) 331–349 (vi). [24] J.Y. Wan, X. Gong, L. Zhang, H.Z. Li, Y.F. Zhou, Q.X. Zhou, Protective effect of
[25]
[26] [27]
[28] [29]
[30]
[31]
[32]
[33] [34]
[35]
[36]
[37] [38]
[39]
[40]
[41]
[42]
12
baicalin against lipopolysaccharide/D-galactosamine-induced liver injury in mice by up-regulation of heme oxygenase-1, Eur. J. Pharmacol. 587 (2008) 302–308. X. Gong, L. Zhang, R. Jiang, C.D. Wang, X.R. Yin, J.Y. Wan, Hepatoprotective effects of syringin on fulminant hepatic failure induced by D-galactosamine and lipopolysaccharide in mice, J. Appl. Toxicol. : JAT 34 (2014) 265–271. R. Silverstein, D-galactosamine lethality model: scope and limitations, J. Endotoxin Res. 10 (2004) 147–162. H. Nyblom, U. Berggren, J. Balldin, R. Olsson, High AST/ALT ratio may indicate advanced alcoholic liver disease rather than heavy drinking, Alcohol Alcohol 39 (2004) 336–339. E. Bjornsson, R. Olsson, Outcome and prognostic markers in severe drug-induced liver disease, Hepatology 42 (2005) 481–489. J. Smith, S. Rao, B. Jovanovic, S.L. Flamm, AST : ALT ratio > 1 predicts increased fibrosis stage but is not an accurate predictor of advanced fibrosis/cirrhosis in patients with chronic hepatitis C virus (HCV) infection, Gastroenterology 118 (2000) A974–A975. R.H. Sayed, W.K.B. Khalil, H.A. Salem, S.A. Kenawy, B.M. El-Sayeh, Sulforaphane increases the survival rate in rats with fulminant hepatic failure induced by D-galactosamine and lipopolysaccharide, Nutr. Res. (N.Y.) 34 (2014) 982–989. A. Pathil, A. Warth, W. Chamulitrat, W. Stremmel, The synthetic bile acid-phospholipid conjugate ursodeoxycholyl lysophosphatidylethanolamide suppresses TNF alpha-induced liver injury, J. Hepatol. 54 (2011) 674–684. W.C. Lee, J.K. Kim, J.W. Kang, W.Y. Oh, J.Y. Jung, Y.S. Kim, et al., Palmatine attenuates D-galactosamine/lipopolysaccharide-induced fulminant hepatic failure in mice, Food Chem. Toxicol. 48 (2010) 222–228. J.H. Park, K.H. Kim, W.R. Lee, S.M. Han, K.K. Park, Protective effect of melittin on inflammation and apoptosis in acute liver failure, Apoptosis 17 (2012) 61–69. M. Sultan, Z. Ben-Ari, R. Masoud, O. Pappo, D. Harats, Y. Kamari, et al., Interleukin1alpha and Interleukin-1beta play a central role in the pathogenesis of fulminant hepatic failure in mice, PLoS One 12 (2017) e0184084. K. Medicherla, B.D. Sahu, M. Kuncha, J.M. Kumar, G. Sudhakar, R. Sistla, Oral administration of geraniol ameliorates acute experimental murine colitis by inhibiting pro-inflammatory cytokines and NF-kappaB signaling, Food & function 6 (2015) 2984–2995. M. Jayachandran, B. Chandrasekaran, N. Namasivayam, Geraniol attenuates fibrosis and exerts anti-inflammatory effects on diet induced atherogenesis by NFkappaB signaling pathway, Eur. J. Pharmacol. 762 (2015) 102–111. S.J. Bensinger, P. Tontonoz, Integration of metabolism and inflammation by lipidactivated nuclear receptors, Nature 454 (2008) 470–477. S.A. Kliewer, H.E. Xu, M.H. Lambert, T.M. Willson, Peroxisome proliferator-activated receptors: from genes to physiology, Recent Prog. Horm. Res. 56 (2001) 239–263. P. Tontonoz, L. Nagy, J.G. Alvarez, V.A. Thomazy, R.M. Evans, PPARgamma promotes monocyte/macrophage differentiation and uptake of oxidized LDL, Cell 93 (1998) 241–252. T. Roszer, M.P. Menendez-Gutierrez, M.I. Lefterova, D. Alameda, V. Nunez, M.A. Lazar, et al., Autoimmune kidney disease and impaired engulfment of apoptotic cells in mice with macrophage peroxisome proliferator-activated receptor gamma or retinoid X receptor alpha deficiency, J. Immunol. 186 (2011) 621–631. W. Chen, Y.J. Lin, X.Y. Zhou, H. Chen, Y. Jin, Rosiglitazone protects rat liver against acute liver injury associated with the NF-kappa B signaling pathway, Can. J. Physiol. Pharmacol. 94 (2016) 28–34. E. Moran-Salvador, E. Titos, B. Rius, A. Gonzalez-Periz, V. Garcia-Alonso, C. LopezVicario, et al., Cell-specific PPAR gamma deficiency establishes anti-inflammatory and anti-fibrogenic properties for this nuclear receptor in non-parenchymal liver cells, J. Hepatol. 59 (2013) 1045–1053.
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Geraniol protects against lipopolysaccharide and D-galactosamine-induced fulminant hepatic failure by activating PPARγ
T
Yi Lia,∗, Nian Wangb, Yongfang Jianga,∗∗ a b
Department of Infectious Diseases, The Second Xiangya Hospital of Central South University, Changsha, Hunan, 410011, China Department of Pathophysiology, School of Basic Medical Science Central South University, Changsha, Hunan, 410083, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Geraniol Lipopolysaccharide D-galactosamine Fulminant hepatic failure NF-κB PPARγ
Geraniol (GOH), a natural component of plant essential oils, exhibits potent antioxidant and anti-inflammatory properties. The aim of this study was to assess the protective effects and mechanisms of GOH on lipopolysaccharide (LPS)/D-galactosamine (D-GalN)-induced fulminant hepatic failure (FHF). Mice were treated with GOH (12.5, 25, and 50 μg/kg) 1 h before challenging LPS (60 mg/kg) and D-GalN (800 mg/kg). 8 h later LPS/DGlaN treatment, mice were sacrificed and the serum and the liver tissues were collected for testing. The liver pathological changes were assessed by H & E staining. MPO activity, MDA level in liver tissues, and AST, ALT levels in serum were detected by specific detection kits. The levels of TNF-α and IL-1β were detected by ELISA. The expression of NF-κB and PPARγ were detected by western blot analysis and qRT-PCR. The results showed that GOH had a protective effect on LPS/D-GalN-induced FHF, as evidence by the attenuation of liver pathological injury, MPO activity, MDA level, and serum AST and ALT levels. GOH reduced liver TNF-α and IL-1β levels through inhibiting NF-κB signaling pathway activation. Furthermore, GOH increased PPARγ expression in FHF induced by LPS/D-GalN. In conclusion, the present study proved that GOH protects against LPS/D-GalNinduced FHF through inhibiting inflammatory response and increasing PPARγ expression.
1. Introduction Fulminant hepatic failure (FHF) is a severe clinical syndrome that results from severely impaired liver function. The predisposing factor of FHF is multitudinous, such as bacteria, viral hepatitis, alcohol and some hepatotoxic drugs [1]. Except liver transplantation, there are still lacks of benefit treatment for FHF. However, the rapidity of progression and the variable course of FHF limited the success rate in liver transplantation. In addition, the effective resource is limited [2,3]. Evidences indicated that approximately 80–90% FHF patients were died due to did not receive liver transplantation [4]. Thus, specific and effective treatment of FHF is necessary. Lipopolysaccharide (LPS) in combination with D-galactosamine (D-GalN) induced experimental liver injury is a wildly used experimental model for researching acute liver failure in clinical [5–8]. Stimulation of LPS leads to severe inflammatory response, including numbers of pro-inflammatory cytokines production, and inflammatory cells infiltration into the infected tissues [9,10]. DGalN is a hepatotoxic agent that can abrogate the biosynthesis of macro-molecules in liver. Injection of LPS accompanied by D-GalN can induce specific liver injury rather than other organs [11].
∗
Geraniol (GOH) is an acyclic monoterpene alcohol isolated from the essential oils of lemon, rose, ginger, or orange [12,13]. GOH proved to have anti-inflammatory, anti-apoptotic, cytoprotective, and antioxidant properties [14–19]. Studies proved that GOH have a protective effect against traumatic spinal cord injury by inhibiting inflammatory cytokines production, oxidative stress and apoptosis, as well as NF-κB and p38 MAPK signaling pathway activation [20]. GOH treatment inhibited inflammatory response and apoptosis in the lung, and this effect might be through inhibiting the activation of TLR4-mediated NF-κB and Bcl2/Bax signaling pathways [19]. Recently reports have been proved that GOH treatment reduced the oxidative and toxic damage in the liver induced by acetate [21]. However, whether GOH exerts the protective effects on LPS/D-GalN-induced FHF have not been reported. Thus, in the present study, we assessed the protective effects and molecular mechanisms of GOH on LPS/D-GalN-induced FHF.
Corresponding author. Department of Infectious Diseases, the Second Xiangya Hospital of Central South University, Changsha, Hunan, 410011, China. Corresponding author. E-mail addresses: [email protected] (Y. Li), [email protected] (Y. Jiang).
∗∗
https://doi.org/10.1016/j.micpath.2018.11.054 Received 13 July 2018; Received in revised form 16 November 2018; Accepted 30 November 2018 Available online 11 December 2018 0882-4010/ © 2018 Published by Elsevier Ltd.
Microbial Pathogenesis 128 (2019) 7–12
Y. Li et al.
2. Materials and methods
collected after LPS/D-GalN treatment. The liver samples were homogenized and centrifuged. The supernatants were used to assess the levels of TNF-α and IL-1β according to the instruction.
2.1. Materials Geraniol (purity > 98%), LPS (Escherichia coli, O55:B5), and DGalN were purchased from Sigma (St, Louis, MO, USA). Alanine aminotransferase (ALT), aspartate aminotransferase (AST), malondiadehyde (MDA), and myeloperoxidase (MPO) activity detection kits were purchased from Jiancheng Bioengineering Institute (Nanjing, China). The enzyme-linked immunosorbent assay (ELISA) kits for TNFα and IL-1β were purchased from Biolegend (CA, USA). NF-κB p65, peNFeκB p65, IκBα, p-IκBα, β-actin, and PPARγ antibodies were purchased from Cell Signaling Technology Inc (Beverly, MA). All other chemicals were of reagent grade.
2.8. Western blot assay To test peNFeκB p65, NF-κB p65, p-IκBα, IκBα, and PPARγ proteins expression, 40 μg of soluble protein from liver homogenate was used. Equal amount of proteins were loaded on 10% SDS-PAGE and electrotransferred to PVDF membranes. Transferred membranes were washed with TBST and blocked for 2 h at room temperature with 5% skimmed milk. The membranes were then incubated overnight at 4 °C with specific primary antibodies. After washing three times for 10 min each in TBST, the membranes were incubated with secondary antibodies for 1 h at room temperature, followed by detection using an ECL detection system.
2.2. Animals Male C57BL/6 mice (approximately 8 weeks, 20–25 g), were purchased from Experimental Animal Center of Baiqiuen Medical College of Jilin University. The mice were fed under specific pathogen-free conditions. The experiments were performed in accordance with the use and care of laboratory animal manual published by the US National Institutes of Health.
2.9. Quantitative real time PCR Total RNA from liver tissues were extracted by TRIzol (Sangong Biotech, Shanghai, China). Then, RNA was transcribed to cDNA using the kit purchased from Invitrogen (CA, USA). Real time PCR was performed in a 7500 Fast Real-Time PCR System (Applied Biosystems). The primers are listed in Table 1 β-Actin was reference gene.
2.3. Animal treatment
2.10. Statistical assay
Forty male mice were randomly divided into six groups: control group, LPS/D-GalN group, LPS/D-GalN + GOH (12.5, 25, and 50 mg/ kg) groups, LPS + GOH (50 mg/kg) + GW9662 group. Mice from LPS/ D-GalN group received an intraperitoneal injection with LPS (60 mg/ kg) and D-GalN (800 mg/kg) dissolved in PBS. GOH (12.5, 25, and 50 mg/kg) were intraperitoneally treated 1 h before the LPS/D-GalN challenge. The dose of GOH used in the study was referenced to previous studies [19,22]. The mice of LPS + GOH (50 mg/kg) + GW9662 group were injected with GW9662 (5 mg/kg body weight, i.p.) 1 h before GOH treatment and then given LPS and D-GalN. The control group was injected with the same volume of PBS. 8 h later, the mice were sacrificed and the blood and the liver tissues were collected for assessing.
All the data were analyzed by SPSS 21.0 software (IBM Corp, Armonk, NY, USA). Measurement data were expressed as the mean ± SD. Statistical significance was analyzed using one-way analysis of variance (ANOVA). p < 0.05 was considered statistically significantly. 3. Results 3.1. GOH alleviated liver pathological damage induced by LPS/D-GalN The liver pathological changes were assessed by H & E staining. The results showed that liver sections of control group showed no any pathological damages. Liver sections of LPS/D-GalN group showed significantly pathological damages, including a large number of inflammatory cells infiltration, cellular necrosis, obviously morphological disruption, including extensive vacuolization with the disappearance of nuclei, and the loss of hepatic architecture. However, these pathological changes were markedly attenuated by GOH (Fig. 1).
2.4. Histopathological assay Liver tissues were collected at 8 h after LPS/D-GalN challenge and were fixed in 10% formalin. The samples were imbedded in paraffin and sliced into 4 μm sections. The samples were stained with hematoxylin and eosin (H & E) and pathological changes of liver tissues were detected under a light microscope.
3.2. GOH inhibited serum AST, and ALT levels induced by LPS/D-GalN
2.5. Liver enzymes assay
Liver enzyme AST and ALT are the major indicator of liver injury. As showed in Fig. 2, serum AST, and ALT levels were significantly increased in the LPS/D-GalN group compared with the control group. However, significantly attenuation in the levels of ALT and AST were found in the GOH + LPS/D-GalN groups. However, the levels of ALT
To further assess the protective effects of GOH on LPS/D-GalN-induced liver tissue damage, serum enzyme activities of ALT and AST were tested by detection kits according to the manufacturer's instruction (Jiancheng Bioengineering Institute of Nanjing, Nanjing, China).
Table 1 Primers for RT-PCR.
2.6. MPO and MDA levels assay MPO activity was wildly used to assess the level of neutrophil. MDA is an indicator of lipid peroxidation in the liver. Liver tissues were collected after LPS/D-GalN injection and the content MPO and MDA were detected by specific detection kits according to the instruction (Jiancheng Bioengineering Institute of Nanjing, Nanjing, China).
Gene
Primer
Sequence 5’ > 3′
Size (bp)
p65
Sense Anti-sense Sense Anti-sence Sense Anti-sence Sense Anti-sence
CCAGAAGAGGAGAGGAGGGTAT GGGATTTAGAGAAAAGGGGACTA TACCCCTCTACATCTTGCCTGT GTGTCATAGCTCTCCTCATCCTC ACAGGAAAGACAACGGACAAATC TTCTACGGATCGAAACTGGCAC TAAAACGCAGCTCAGTAACAGTCGG TGCAATCCTGTGGCATCCATGAAAC
111
IκBα PPARγ
2.7. ELISA assay
β-actin
The liver tissues for pro-inflammatory cytokines detection were 8
238 203 182
Microbial Pathogenesis 128 (2019) 7–12
Y. Li et al.
Fig. 1. Histopathologic sections of the livers (H&E, × 400). (A) Control group treated with PBS. (B) Group treated with LPS/D-gal. (C) Group pretreated with 12.5 mg/kg GOH 1 h before LPS/D-gal administration. (D) Group pretreated with 25 mg/kg GOH 1 h before LPS/D-gal administration. (E) Group pretreated with 50 mg/kg GOH 1 h before LPS/D-gal administration. (F) Group injected with GW9662 (5 mg/kg body weight, i.p.) 1 h before GOH treatment and then given LPS and D-GalN.
Fig. 3. Effects of GOH on MPO activity in LPS/D-gal induced mice. Mice were given an intraperitoneal injection of GOH 1 h before LPS/D-gal administration. The values presented are the mean ± SD. p# < 0.01 vs. control group, p* < 0.05, p** < 0.01 vs. LPS/D-gal group.
MPO activity in the LPS + GOH (50 mg/kg) + GW9662 group was increased when compared to the LPS/D-GalN + GOH (50 mg/kg) group. The results suggested PPARγ inhibitor GW9662 could reverse the inhibition of GOH on LPS/D-GalN-induced MPO activity. 3.4. GOH inhibited liver MDA level induced by LPS/D-GalN
Fig. 2. Effects of GOH on ALT and AST activities in mice after LPS/D-gal treatment. The values presented are the mean ± SD. p# < 0.01 vs. control group, p* < 0.05, p** < 0.01 vs. LPS/D-gal group.
MDA is a marker of oxidative stress. To assay the protective effect of GOH on LPS/D-GalN-induced liver oxidative damage, the MDA level was tested in the present study. As shown in Fig. 4, liver MDA level was significantly increased in LPS/D-GalN treated mice. However, GOH dose-dependently reversed LPS/D-GalN-induced up-regulation of liver MDA level. However, the level of MDA in the LPS + GOH (50 mg/ kg) + GW9662 group was increased when compared to the LPS/DGalN + GOH (50 mg/kg) group. The results suggested PPARγ inhibitor GW9662 could reverse the inhibition of GOH on LPS/D-GalN-induced MDA level.
and AST in the LPS + GOH (50 mg/kg) + GW9662 group were increased when compared to the LPS/D-GalN + GOH (50 mg/kg) group. The results suggested PPARγ inhibitor GW9662 could reverse the inhibition of GOH on ALT and AST production. 3.3. GOH inhibited liver MPO activity induced by LPS/D-GalN MPO activity is often used as a marker for neutrophil infiltration. The increased of MPO activity could lead to severe oxidative stress and oxidative tissue damages. As shown in Fig. 3, MPO activity in the LPS/ D-GalN group was markedly higher than that of controls group. However, the higher MPO activity were significantly reduced by treatment with GOH, and in a dose-dependently manner. However, the level of
3.5. GOH inhibited pro-inflammatory cytokines production induced by LPS/D-GalN Pro-inflammatory cytokines TNF-α and IL-1β levels were tested to 9
Microbial Pathogenesis 128 (2019) 7–12
Y. Li et al.
3.6. GOH inhibited NF-κB signaling pathway activation induced by LPS/DGalN NF-κB signaling pathway plays an important role in inflammatory response. In the present study, the effects of GOH on NF-κB signaling pathway proteins expression were tested by western blot. As shown in Fig. 6, LPS/D-GalN treated increased the mRNA and protein expression of peNFeκB p65, and p-IκBα. However, GOH significantly inhibited LPS/D-GalN-induced peNFeκB p65, and p-IκBα m RNA and protein expression. 3.7. GOH increased liver PPARγ expression PPARγ is a member of the nuclear hormone receptor superfamily. Many reports demonstrated that PPARγ play an important role in the inflammatory response. In the present study, we tested the effects of GOH on PPARγ mRNA and protein expression. The results showed that LPS/D-GalN treatment inhibited the expression of PPARγ both in mRNA and protein (Fig. 7) levels. However, treatment of GOH increased the mRNA and protein expression of PPARγ, and in a dose dependent manner.
Fig. 4. Effects of GOH on MDA content in LPS/D-gal induced mice. Mice were given an intraperitoneal injection of GOH 1 h before LPS/D-gal administration. The values presented are the mean ± SD. p# < 0.01 vs. control group, p* < 0.05, p** < 0.01 vs. LPS/D-gal group.
4. Discussion Fulminant hepatic failure (FHF) is a severe clinical syndrome with high mortality due to lack of effective therapies [23]. The combination of LPS and D-GalN was often used as an experimental model of FHF to investigate the mechanisms of clinical liver injury and explore the efficiency of hepatoprotective agents [24,25]. Treatment of LPS and DGalN into mice can cause dramatic hepatic injury, and even lead to rapid death [6,26]. In the present study, we tested the protective effects and mechanisms of GOH on LPS/D-GalN-induced FHF. LPS/D-GalN leads to severe liver pathological damage, increased TNF-α and IL-1β levels, MPO activity, as well as MDA level. However, GOH significantly inhibited these changes induced by LPS/D-GalN. Further research suggested that GOH protected mice against LPS/D-GlaN-induced FHF through regulating the expression of NF-κB and PPARγ. Serum ALT and AST are wildly used as indicator of liver injury [27,28]. The higher levels of serum ALT and AST often indicate the pathological condition of severe liver injury [29]. Our results showed that the increased levels of serum ALT and AST from the LPS/D-GalN group were observed when compared to the control group. However, treatment of GOH reduced the serum AST and ALT levels induced by LPS/D-GalN. MPO activity is often used as a marker of tissue neutrophil infiltration. Up-regulation of MPO activity can cause oxidative tissue damages, and MDA is wildly used as a marker of oxidative tissue damage. Thus, the liver MPO activity and MDA level were tested in the present study. The results showed that LPS/D-GalN-induced up-regulation of MPO activity and MDA level were dose-dependently inhibited by GOH. Pro-inflammatory cytokines, TNF-α and IL-1β, play an important role in the development of FHF. TNF-α can induce an inflammatory cascade that lead to produce other pro-inflammatory cytokines, such as IL-1β [30]. Studies has been proved that over-production of TNF-α is associated with the development of hepatitis [31]. And inhibition of TNF-α production was an efficient method to prevent LPS/D-GalN-induced liver injury [32,33]. IL-1β is a pro-inflammatory cytokine that participated in the pathogenesis of LPS/D-GalN-induced FHF, evidence by over-production of IL-1β is associated with the liver damage and apoptosis, and depleted of IL-1β completely rescued the phenotype [34]. In the present study, we assessed the effect of GOH on TNF-α and IL-1β production during LPS/D-GalN-induced FHF. The results showed that GOH significantly inhibited LPS/D-GalN-induced TNF-α and IL-1β production in a dose-dependent manner. Pro-inflammatory cytokines expression is required for the activation of NF-κB signaling pathway. Under normal circumstances, NF-κB is
Fig. 5. Effects of GOH on hepatic TNF-α and IL-1β levels in LPS/D-gal induced mice. The values presented are the mean ± SD. p# < 0.01 vs. control group, p* < 0.05, p** < 0.01 vs. LPS/D-gal group.
assess the anti-inflammatory effect of GOH on LPS/D-GalN-induced liver inflammatory response in the present study. As shown in Fig. 5, there was a significantly increase in liver TNF-α and IL-1β levels in LPS/D-GalN group mice compared with the control group mice. However, GOH inhibited TNF-α, and IL-1β production in LPS/D-GalN treated mice in a dose-dependent manner. However, the levels of TNFα, and IL-1β in the LPS + GOH (50 mg/kg) + GW9662 group were increased when compared to the LPS/D-GalN + GOH (50 mg/kg) group. The results suggested PPARγ inhibitor GW9662 could reverse the inhibition of GOH on LPS/D-GalN-induced TNF-α, and IL-1β levels.
10
Microbial Pathogenesis 128 (2019) 7–12
Y. Li et al.
Fig. 6. Effects of GOH on LPS/D-gal induced NF-κB activation in mice. β-Actin was used as a control. The values presented are the mean ± SD. p# < 0.01 vs. control group, p* < 0.05, p** < 0.01 vs. LPS/D-gal group.
inhibiting NF-κB signaling pathway activation [35]. Others also suggested that GOH prevented the altherogenic diet induced fibrosis in experimental hamsters by regulating NF-κB signaling pathway [36]. In the present study, whether GOH protected against LPS/D-GalN-induced liver inflammatory response through regulating NF-κB activation has been assessed. The results showed that pretreatment with GOH dosedependently inhibited LPS/D-GalN-induced NF-κB signaling pathway activation. PPARγ, belongs to the nuclear receptor superfamily, is ligand-dependent transcription factor. PPARγ plays a critical role in the regulation of a range of inflammatory gene expression and it can serve as a target of the efficient drugs for the treatment of inflammation and immune responses [37–40]. A previous study showed that rosiglitazone, a PPARγ agonist, significantly inhibited inflammatory mediator production through regulating NF-κB signaling pathway in LPS/DGalN-induced acute liver injury [41]. Studies also reported that depletion of PPARγ aggravated liver injury induced by CCL4. These data proved the protective role of PPARγ on liver injury [42]. Thus, we tested the effects of GOH on the expression of PPARγ in the present study. The results showed that GOH significantly increased the expression of PPARγ during LPS/D-GalN-induced FHF. It showed that GOH might act as an agonist of PPARγ to inhibit inflammatory response induced by LPS/D-GalN. In conclusion, the current study has proved the protective effect of GOH on LPS/D-GalN-induced FHF, the mechanisms of this property might by inhibiting inflammatory response through increasing the expression of PPARγ. GOH might be a potential agent for treating FHF. Conflicts of interest All authors declare that they have no conflict of interest. References [1] T. Nakama, S. Hirono, A. Moriuchi, S. Hasuike, K. Nagata, T. Hori, et al., Etoposide prevents apoptosis in mouse liver with D-galactosamine/lipopolysaccharide-induced fulminant hepatic failure resulting in reduction of lethality, Hepatology 33 (2001) 1441–1450. [2] W.M. Lee, R.H. Squires, S.L. Nyberg, E. Doo, J.H. Hoofnagle, Acute liver failure: summary of a workshop, Hepatology 47 (2008) 1401–1415. [3] Z. Ben Ari, O. Avlas, O. Pappo, V. Zilbermints, Y. Cheporko, L. Bachmetov, et al., Reduced hepatic injury in Toll-like receptor 4-deficient mice following D-galactosamine/lipopolysaccharide-induced fulminant hepatic failure, Cell. Physiol. Biochem. : Int. J. Exp. Cell. Physiol., Biochem., Pharmacol. 29 (2012) 41–50. [4] W. Lauchart, R. Viebahn, H. de Groot, Acute liver failure, Zentralblatt fur Chirurgie 119 (1994) 285–286. [5] T.M. Rahman, H.J.F. Hodgson, Animal models of acute hepatic failure, Int. J. Exp. Pathol. 81 (2000) 145–157. [6] C. Galanos, M.A. Freudenberg, W. Reutter, Galactosamine-induced sensitization to the lethal effects of endotoxin, Proc. Natl. Acad. Sci. U. S. A 76 (1979) 5939–5943.
Fig. 7. Effects of GOH on PPAR-γ mRNA and protein expression in mice. βActin was used as a control. The values presented are the mean ± SD. p# < 0.01 vs. control group, p* < 0.05, p** < 0.01 vs. LPS/D-gal group.
bound to its inhibitory protein IκBα that in an inactive form in the cytoplasm. Once stimulated by its agonist, NF-κB is rapidly phosphorylated and ultimately degradated from IκBα protein that lead to NF-κB p65 translocation into the nucleus and activates the transcription of the pro-inflammatory cytokines genes. Previous study reported that GOH protected against DSS-induced ulcerative colitis through
11
Microbial Pathogenesis 128 (2019) 7–12
Y. Li et al.
[7] T. Nakama, S. Hirono, A. Moriuchi, S. Hasuike, K. Nagata, T. Hori, et al., Etoposide prevents apoptosis in mouse liver with D-galactosamine/lipopolysaccharide-induced fulminant hepatic failure resulting in reduction of lethality, Hepatology 33 (2001) 1441–1450. [8] H. Wang, Y. Li, Protective effect of bicyclol on acute hepatic failure induced by lipopolysaccharide and D-galactosamine in mice, Eur. J. Pharmacol. 534 (2006) 194–201. [9] C. Fiuza, A.F. Suffredini, Human models of innate immunity: local and systemic inflammatory responses, J. Endotoxin Res. 7 (2001) 385–388. [10] J.W. Kang, D.W. Kim, J.S. Choi, Y.S. Kim, S.M. Lee, Scoparone attenuates D-galactosamine/lipopolysaccharide-induced fulminant hepatic failure through inhibition of toll-like receptor 4 signaling in mice, Food Chem. Toxicol. :Int. J. Publ. Br. Indus. Biol. Res. Assoc. 57 (2013) 132–139. [11] L. Ma, X. Gong, G. Kuang, R. Jiang, R. Chen, J. Wan, Sesamin ameliorates lipopolysaccharide/d-galactosamine-induced fulminant hepatic failure by suppression of Toll-like receptor 4 signaling in mice, Biochem. Biophys. Res. Commun. 461 (2015) 230–236. [12] V. Vinothkumar, S. Manoharan, G. Sindhu, M.R. Nirmal, V. Vetrichelvi, Geraniol modulates cell proliferation, apoptosis, inflammation, and angiogenesis during 7,12-dimethylbenz[a]anthracene-induced hamster buccal pouch carcinogenesis, Mol. Cell. Biochem. 369 (2012) 17–25. [13] K.F. Jiang, T. Zhang, N.N. Yin, X.F. Ma, G. Zhao, H.C. Wu, et al., Geraniol alleviates LPS-induced acute lung injury in mice via inhibiting inflammation and apoptosis, Oncotarget 8 (2017) 71038–71053. [14] M. Tiwari, P. Kakkar, Plant derived antioxidants - geraniol and camphene protect rat alveolar macrophages against t-BHP induced oxidative stress, Toxicol. Vitro : an Int. J. Publ. Assoc. BIBRA 23 (2009) 295–301. [15] V. Vinothkumar, S. Manoharan, G. Sindhu, M.R. Nirmal, V. Vetrichelvi, Geraniol modulates cell proliferation, apoptosis, inflammation, and angiogenesis during 7,12-dimethylbenz[a]anthracene-induced hamster buccal pouch carcinogenesis, Mol. Cell. Biochem. 369 (2012) 17–25. [16] R. de Cassia da Silveira e Sa, L.N. Andrade, D.P. de Sousa, A review on anti-inflammatory activity of monoterpenes, Molecules 18 (2013) 1227–1254. [17] S.C. Chaudhary, M.S. Siddiqui, M. Athar, M.S. Alam, Geraniol inhibits murine skin tumorigenesis by modulating COX-2 expression, Ras-ERK1/2 signaling pathway and apoptosis, J. Appl. Toxicol. : JAT 33 (2013) 828–837. [18] S. Carnesecchi, Y. Schneider, J. Ceraline, B. Duranton, F. Gosse, N. Seiler, et al., Geraniol, a component of plant essential oils, inhibits growth and polyamine biosynthesis in human colon cancer cells, J. Pharmacol. Exp. Therapeut. 298 (2001) 197–200. [19] K. Jiang, T. Zhang, N. Yin, X. Ma, G. Zhao, H. Wu, et al., Geraniol alleviates LPSinduced acute lung injury in mice via inhibiting inflammation and apoptosis, Oncotarget 8 (2017) 71038–71053. [20] J. Wang, B. Su, H. Zhu, C. Chen, G. Zhao, Protective effect of geraniol inhibits inflammatory response, oxidative stress and apoptosis in traumatic injury of the spinal cord through modulation of NF-kappaB and p38 MAPK, Exp Ther Med 12 (2016) 3607–3613. [21] A. Ozkaya, Z. Sahin, M. Kuzu, Y.S. Saglam, M. Ozkaraca, M. Uckun, et al., Role of geraniol against lead acetate-mediated hepatic damage and their interaction with liver carboxylesterase activity in rats, Arch. Physiol. Biochem. 124 (2018) 80–87. [22] V. La Rocca, D.V. da Fonseca, K.S. Silva-Alves, F.W. Ferreira-da-Silva, D.P. de Sousa, P.L. Santos, et al., Geraniol induces antinociceptive effect in mice evaluated in behavioural and electrophysiological models, Basic Clin. Pharmacol. Toxicol. 120 (2017) 22–29. [23] F.V. Schiodt, W.M. Lee, Fulminant liver disease, Clin. Liver Dis. 7 (2003) 331–349 (vi). [24] J.Y. Wan, X. Gong, L. Zhang, H.Z. Li, Y.F. Zhou, Q.X. Zhou, Protective effect of
[25]
[26] [27]
[28] [29]
[30]
[31]
[32]
[33] [34]
[35]
[36]
[37] [38]
[39]
[40]
[41]
[42]
12
baicalin against lipopolysaccharide/D-galactosamine-induced liver injury in mice by up-regulation of heme oxygenase-1, Eur. J. Pharmacol. 587 (2008) 302–308. X. Gong, L. Zhang, R. Jiang, C.D. Wang, X.R. Yin, J.Y. Wan, Hepatoprotective effects of syringin on fulminant hepatic failure induced by D-galactosamine and lipopolysaccharide in mice, J. Appl. Toxicol. : JAT 34 (2014) 265–271. R. Silverstein, D-galactosamine lethality model: scope and limitations, J. Endotoxin Res. 10 (2004) 147–162. H. Nyblom, U. Berggren, J. Balldin, R. Olsson, High AST/ALT ratio may indicate advanced alcoholic liver disease rather than heavy drinking, Alcohol Alcohol 39 (2004) 336–339. E. Bjornsson, R. Olsson, Outcome and prognostic markers in severe drug-induced liver disease, Hepatology 42 (2005) 481–489. J. Smith, S. Rao, B. Jovanovic, S.L. Flamm, AST : ALT ratio > 1 predicts increased fibrosis stage but is not an accurate predictor of advanced fibrosis/cirrhosis in patients with chronic hepatitis C virus (HCV) infection, Gastroenterology 118 (2000) A974–A975. R.H. Sayed, W.K.B. Khalil, H.A. Salem, S.A. Kenawy, B.M. El-Sayeh, Sulforaphane increases the survival rate in rats with fulminant hepatic failure induced by D-galactosamine and lipopolysaccharide, Nutr. Res. (N.Y.) 34 (2014) 982–989. A. Pathil, A. Warth, W. Chamulitrat, W. Stremmel, The synthetic bile acid-phospholipid conjugate ursodeoxycholyl lysophosphatidylethanolamide suppresses TNF alpha-induced liver injury, J. Hepatol. 54 (2011) 674–684. W.C. Lee, J.K. Kim, J.W. Kang, W.Y. Oh, J.Y. Jung, Y.S. Kim, et al., Palmatine attenuates D-galactosamine/lipopolysaccharide-induced fulminant hepatic failure in mice, Food Chem. Toxicol. 48 (2010) 222–228. J.H. Park, K.H. Kim, W.R. Lee, S.M. Han, K.K. Park, Protective effect of melittin on inflammation and apoptosis in acute liver failure, Apoptosis 17 (2012) 61–69. M. Sultan, Z. Ben-Ari, R. Masoud, O. Pappo, D. Harats, Y. Kamari, et al., Interleukin1alpha and Interleukin-1beta play a central role in the pathogenesis of fulminant hepatic failure in mice, PLoS One 12 (2017) e0184084. K. Medicherla, B.D. Sahu, M. Kuncha, J.M. Kumar, G. Sudhakar, R. Sistla, Oral administration of geraniol ameliorates acute experimental murine colitis by inhibiting pro-inflammatory cytokines and NF-kappaB signaling, Food & function 6 (2015) 2984–2995. M. Jayachandran, B. Chandrasekaran, N. Namasivayam, Geraniol attenuates fibrosis and exerts anti-inflammatory effects on diet induced atherogenesis by NFkappaB signaling pathway, Eur. J. Pharmacol. 762 (2015) 102–111. S.J. Bensinger, P. Tontonoz, Integration of metabolism and inflammation by lipidactivated nuclear receptors, Nature 454 (2008) 470–477. S.A. Kliewer, H.E. Xu, M.H. Lambert, T.M. Willson, Peroxisome proliferator-activated receptors: from genes to physiology, Recent Prog. Horm. Res. 56 (2001) 239–263. P. Tontonoz, L. Nagy, J.G. Alvarez, V.A. Thomazy, R.M. Evans, PPARgamma promotes monocyte/macrophage differentiation and uptake of oxidized LDL, Cell 93 (1998) 241–252. T. Roszer, M.P. Menendez-Gutierrez, M.I. Lefterova, D. Alameda, V. Nunez, M.A. Lazar, et al., Autoimmune kidney disease and impaired engulfment of apoptotic cells in mice with macrophage peroxisome proliferator-activated receptor gamma or retinoid X receptor alpha deficiency, J. Immunol. 186 (2011) 621–631. W. Chen, Y.J. Lin, X.Y. Zhou, H. Chen, Y. Jin, Rosiglitazone protects rat liver against acute liver injury associated with the NF-kappa B signaling pathway, Can. J. Physiol. Pharmacol. 94 (2016) 28–34. E. Moran-Salvador, E. Titos, B. Rius, A. Gonzalez-Periz, V. Garcia-Alonso, C. LopezVicario, et al., Cell-specific PPAR gamma deficiency establishes anti-inflammatory and anti-fibrogenic properties for this nuclear receptor in non-parenchymal liver cells, J. Hepatol. 59 (2013) 1045–1053.