- Email: [email protected]
4-AP-1 signaling
Free Radical Biology and Medicine 147 (2020) 159–166
Contents lists available at ScienceDirect
Free Radical Biology and Medicine journal homepage: www.elsevier.com/locate/freeradbiomed
Original article
Geranylgeranyl diphosphate synthase 1 knockout ameliorates ventilatorinduced lung injury via regulation of TLR2/4-AP-1 signaling
T
Bing Wana,1, Wu-jian Xub,1, Mei-zi Chenc, Shuang-shuang Suna, Jia-jia Jina, Yan-ling Lvb, Ping Zhanb, Su-hua Zhub, Xiao-xia Wangb, Tang-Feng Lvb,∗, Yong Songb,∗∗ a
Department of Respiratory and Critical Care Medicine, The Affiliated Jiangning Hospital of Nanjing Medical University, Nanjing, 210002, China Department of Respiratory and Critical Medicine, Jinling Hospital, Nanjing Clinical School of Southern Medical University, Nanjing, 210002, China c Department of General Internal Medicine, The First People's Hospital of Chenzhou, Chenzhou, 423000, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Ventilator-induced lung injury GGPPS1 Inflammation TLR2/4
Objective: To investigate the role of geranylgeranyl diphosphate synthase 1 (GGPPS1) in ventilator-induced lung injury along with the underlying mechanism. Methods: A murine VILI model was induced by high-tidal volume ventilation in both wild-type and GGPPS1 knockout mice. GGPPS1 expression was detected in the bronchoalveolar lavage fluid (BALF) supernatants of acute respiratory distress syndrome (ARDS) patients and healthy volunteers, as well as in lung tissues and BALF supernatants of the VILI mice using enzyme-linked immunosorbent assay (ELISA), quantitative reverse transcription polymerase chain reaction (qRT-PCR), western bolt and immunohistochemical (IHC). The wet/dry ratio, total BALF proteins, and lung injury score were analyzed. The percentage of neutrophils was detected by flow cytometry and IHC. Inflammatory cytokine levels were measured by ELISA and qRT-PCR. The related expression of Toll-like receptor (TLR)2/4 and its downstream proteins was evaluated by western blot. Results: GGPPS1 in BALF supernatants was upregulated in ARDS patients and the VILI mice. Depletion of GGPPS1 significantly alleviated the severity of ventilator induced lung injury in mice. Total cell count, neutrophils and inflammatory cytokines (interleukin [IL]-6, IL-1β, IL-18 and tumor necrosis factor-α) levels in BALF were reduced after GGPPS1 depletion. Moreover, addition of exogenous GGPP in GGPPS-deficient mice significantly exacerbated the severity of ventilator induced lung injury as compared to the PBS treated controls. Mechanistically, the expression of TLR2/4, as well as downstream proteins including activator protein-1 (AP-1) was suppressed in lung tissues of GGPPS1-deficient mice. Conclusion: GGPPS1 promoted the pathogenesis of VILI by modulating the TLR2/4–AP-1 signaling pathway, and GGPPS1 knockout significantly alleviated the lung injury and inflammation in the VILI mice.
1. Introduction Mechanical ventilation (MV) is one of the most important life-saving therapies in patients with pulmonary dysfunction or injury, especially those with acute respiratory distress syndrome (ARDS) [1,2]. However, improper MV itself is an important source of secondary lung injury, resulting in increased morbidity and mortality [3,4]. Such injury has been termed ventilator-induced lung injury (VILI), which is pathologically characterized by marked increase in pulmonary alveolar–vascular permeability, inflammatory cell infiltration, lung edema and bleeding [5,6]. The current high incidence of VILI worsens the quality of life of
patients with respiratory failure [7,8]. Three main integrated mechanisms of injury have been established: alveolar overdistention, cyclic atelectasis, and inflammatory cell activation [2,9]. These cells then produce high levels of proinflammatory cytokines (e.g., interleukin [IL]-1β, IL-6 and tumor necrosis factor alpha [TNF-α]) and inflammatory-related factors (arachinoid acid, ceramide, sphingolipids), which further aggravated the injury of lung [10–13]. Protein isoprenylation is essential for cell survival and membranerelated cellular biological functions, including cell growth, differentiation, proliferation and protein transport [14]. It is necessary for GTP-binding proteins, such as Ras and Rho, to be able to signal to their
∗
Corresponding author. Division of Respiratory Medicine, Jinling Hospital, Nanjing University School of Medicine, Nanjing, 210002, China. Corresponding author. Department of Respiratory and Critical Medicine, Jinling Hospital, Nanjing Clinical School of Southern Medical University, 305 Zhongshan Road, Nanjing, 210002, China. E-mail addresses: [email protected] (T.-F. Lv), [email protected] (Y. Song). 1 B. Wan and WJ. Xu contributed equally to this study. ∗∗
https://doi.org/10.1016/j.freeradbiomed.2019.12.024 Received 24 September 2019; Received in revised form 19 December 2019; Accepted 20 December 2019 Available online 24 December 2019 0891-5849/ © 2019 Elsevier Inc. All rights reserved.
Free Radical Biology and Medicine 147 (2020) 159–166
B. Wan, et al.
endotracheal intubation was performed using an 18G vein Teflon catheter. Mice in the model groups were then mechanically ventilated with a small animal ventilator (ALC-V8, Alcott Biotech Co., Ltd., Shanghai, China) for 4 h with a tidal volume of 28 mL/kg, a respiratory rate of 60 breaths/min, an inspiratory–expiratory ratio (I:E) of 1: 1, a fraction of inspiration O2 (FiO2) of 0.21, and a positive end-expiratory pressure (PEEP) of 0 cm H2O. After 4 h, the mice wereeuthanized, then, lung tissues and BALF were harvested for further analysis.
downstream effectors and promote vital cellular functions [15,16]. Farnesyl pyrophosphate (FPP) and geranylgeranyl pyrophosphate (GGPP) are the two main isoprenoids and are synthesized via the mevalonate (MVA) pathway [17]. Geranylgeranyl pyrophosphate synthase large subunit 1 (GGPPS1), a key enzyme responsible for synthesis of GGPP from FPP, also plays a crucial role in the biological functions of cells and pathogenesis of diseases, such as infertility [18], liver fibrosis [19]. Our previous work indicates that GGPPS1 may play a role in the pathogenesis of inflammation-related diseases, such as lipopolysaccharide-induced acute lung injury and idiopathic pulmonary fibrosis [20,21]. In the present study, we hypothesized that GGPPS1 may play a role in the pathophysiology of VILI. To test this hypothesis, we measured GGPPS1 expression in ARDS patients and a mouse model of VILI. To further investigate the underlying mechanisms, we determined the effects of GGPPS1 knockout in mice with and without VILI.
2.4. BALF analysis Bronchoalveolar lavage of mouse was performed using three aliquots of 0.8 ml of pre-cooled sterile phosphate-buffered saline (PBS) as previously described [22]. The bronchoalveolar lavage steps from ARDS patients are as follows: on the basis of mechanical ventilation, the BALF of right middle lung is rapidly collected through the endotracheal intubation. 20 ml aseptic saline is injected into the right middle lung for three times, and about 30 ml BALF is recovered and filtered by sterile gauze. After centrifugation at 1000g for 10 min, 1.2 ml supernatant of mouse or 20 ml supernatant of ARDS patients was collected and stored at −80 °C for measurement of GGPPS1, total protein and cytokine concentrations. . The total protein in BALF was detected using a bicinchoninic acid (BCA) kit (KeyGen Biotech, Nanjing, China) according to the manufacturer's protocol. Briefly, the kit working solution as added to samples for incubation at 37 °C for 30 min. The absorbance at 562 nm of each sample was measured by a microplate reader (Bio-Tek, Instruments Inc., Winooski, VT, USA), and the protein concentrations were calculated in reference to the standard concentration curve. The concentrations of GGPPS1 in BALF supernatants of ARDS patients and the concentrations of GGPPS1, IL-6, IL-1β, IL-18 and TNF-α in BALF supernatants of mice were measured by enzyme-linked immunosorbent assay (ELISA) (Human GGPPS1, Cusabio, China; Mouse GGPPS1,HLE98085,Shanghai, China; IL-6, IL-1β, IL-18 and TNF-α, eBioscience, San Diego, CA,respectively) following the manufacturer's protocol. Briefly, samples were added to an enzyme-labeled coating plate, and then the enzyme labeling reagent was added. After reaction at 37 °C for 30 min, the developer and stop solution were added successively. Finally, the optical density value at 450 nm for each well was determined using a microplate reader.
2. Materials and methods 2.1. Patients Bronchoalveolar lavage fluid (BALF) samples were collected from eight patients diagnosed with ARDS in the general surgery intensive care unit or the respiratory intensive care unit of Jinling Hospital, and eight healthy volunteers underwent bronchoscopy. This study protocol was approved by Jinling Hospital's Institutional Review Committee on Human Research. Written informed consent was obtained from all patients, and healthy control-group patients involved in this study before BALF sampling was performed. The general characteristics of the patients are presented in Table 1. 2.2. Animals Ten-week-old male C57BL/6 mice weighing 20–25 g were purchased from Model Animal Research Center of Nanjing University. Primary C57BL/6 mice with lung specific GGPPS1 knockout (GGPPS1spc-rtTA-teTO-cre-floxP/floxP, GGPPS1−/−) were a gift from the Laboratory of Prof. Li Chaojun (Model Animal Research Center and the Medical School of Nanjing University). All animals were kept in a specific pathogen-free environment with a 12/12 h light/dark cycle and controlled temperature of 22–24 °C with free access to food and water. All animal experiments were approved by the Animal Care and Use Committee of Southern Medical University and the China Council on Animal Care.
2.5. Lung histopathology and immunohistochemistry Hematoxylin and eosin (H&E) staining was applied to observe the severity of microscopic lung injury and grade lung injury score. First, lung tissues were fixed with 10% neutral formalin for 1 week. Then they were dehydrated, embedded, and sliced into 4-μm-thick sections. After deparaffinization in xylene and hydration through a graded series of ethanol solutions, sections were stained with hematoxylin for 5 min and eosin for 2 min. Finally, sections were washed with gradient ethanol, and a neutral gel was used for sealing. The alveolar morphology was observed under a light microscope (Nikon, Japan), and the lung injury score was determined as reported previously [23]. For immunohistochemical (IHC) staining, paraffin sections were deparaffnized and rehydrated as described as above. After heat-induced antigen retrieval through incubation in Tris-EDTA buffer at 98 °C for 30 min, sections were immersed in 3% H2O2 for 25 min to block endogenous peroxidase activity. The sections were then incubated with primary antibodies including anti-GGPPS (Proteintech, Wuhan, China) at 4 °C overnight. After two rinses in PBS, sections were incubated in goat anti-mouse horseradish peroxidase (HRP)-conjugated secondary antibodies (Proteintech) for 50 min. Sections were then washed and incubated with diaminobenzidine (DAB) for 5 min. After rinsing with tap water, the sections were counterstained with hematoxylin. Each slide was photographed under a light microscope (Nikon, Japan). HSCORE (histochemistry score) is a histological scoring method for
2.3. Mouse model of VILI Mice were weighed and anesthetized with an intraperitoneal injection of 5% chloral hydrate (500 mg/kg) and pentobarbitone (90 mg/ kg). The mice were then fixed in a supine position and the neck skin was cut and blunt dissected to expose the trachea. Subsequently, Table 1 Characteristics of ARDS patients and healthy volunteers. Index
ARDS patients (n = 8)
Control individuals (n = 8)
P
Age (years) Gender (M/F) ARDS classification Mild Moderate Severe Cause of admission Severe pneumonia Pancreatitis
38.75 ± 16.04 4/4
44.88 ± 15.22 6/2
0.446 0.302
0 2 6 4 4
160
Free Radical Biology and Medicine 147 (2020) 159–166
B. Wan, et al.
dealing with immunohistochemical results, which converts the number of positive cells and their staining intensity in each section into corresponding values to achieve the purpose of semi-quantitative tissue staining. H-SCORE = ∑（PI × I） = （percentage of cells of weak intensity × 1) + (percentage of cells of moderate intensity × 2) + percentage of cells of strong intensity × 3), in the general formula, PI represents the percentage of positive cells in the total number of cells in the section, and I represents the staining intensity [24,25].
Table 2 Primer sequences for GGPPS1, IL-6, IL-1β, IL-18, TNF-α and GAPDH. Target (mouse)
Forward primer (5′-3′)
Reverse primer (5′-3′)
GGPPS1 IL-6 IL-1β IL-18 TNF-α GAPDH
TTCACCAACACCTGTAACTC TAGTCCTTCCTACCCCAATTTCC GCAACTGTTCCTGAACTCAACT GACAGCCTGTGTT CGAGGAT CCCTCACACTCAGATCATCTTCT AGGTCATCCC AGAGCTGAACG
TTATTGACAAGCCCAGAGC TTGGTCCTTAGCCACTCCTTC ATCTTTTGGGGTCCGTCAACT TGGATCCATTTCCTCAAAGG GCTACGACGTGGGCTACAG CACCCTGTTGCTGTAGCCGTAT
2.6. Transmission electron microscopy weighed again to obtain the dry lung weight. The lung wet/dry ratio was calculated by dividing the wet lung weight by the dry lung weight.
Lung tissue samples were washed with PBS and fixed with 2% glutaraldehyde for 2 h. After post-fixation with 1% osmium tetroxide, the samples were dehydrated with a graded ethanol series and embedded in propylene oxide for cutting into ultrathin sections. The sections were then stained with uranyl acetate and lead citrate. Finally, the ultrastructure of lung tissue was examined by transmission electron microscopy (Servicebio, Wuhan, China).
2.10. Flow cytometry The percentage of neutrophils in BALF was measured through using flow cytometric analysis. First, BALF cells were collected by centrifugation and resuspended in PBS containing 10% fetal calf serum and 1% sodium azide. Subsequently, 5 × 105 cells were incubated with 10 μg/mL of anti-neutrophil antibody (Abcam) at room temperature for 30 min. Next, the cells were gathered by centrifugation and washed for three times using PBS. The cell pellet was further resuspended in the fluorescein isothiocyanate (FITC)-labeled secondary antibody (Abcam) at a dilution of 1: 1500 at room temperature in darkness. After 30 min incubation, the cells were collected and wahsed using PBS for thrice times. Finally, the fluorescence intensity of the cells was recorded and analyzed using a CytoFLEX instrument (Beckman, CA, USA).
2.7. Western blotting Protein samples from lung tissues and BALF were separated by 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes. Each PVDF membrane was sealed with 5% skimmed milk powder for 2 h and incubated with primary antibodies including antiGGPPS1(Santa Cruz Biotechnology,CA,USA), anti-Toll-like receptor 2 (TLR2, ab16894, Abcam, MA, USA), anti-TLR4(#14358,CST, MA, USA), anti-myeloid differentiation factor 88 (MyD88,ab135693, Abcam, MA, USA), anti-TNF receptor associated factor 6 (TRAF6, Abs131476, absin, Shanghai, China), anti-transforming growth factor beta-activating kinase 1 (TAK1, #4505, CST, MA, USA), anti-activator protein 1 (AP-1,Ab21981, Abcam, MA, USA) and anti-actin (Santa Cruz Biotechnology, CA, USA) overnight at 4 °C. After three washes in Trisbuffered saline containing Tween 20 (TBST), the membranes were incubated with goat anti-mouse HRP-conjugated secondary antibodies (Abcam, MA, USA) for 1 h. Finally, freshly-made enhanced chemiluminescence (ECL) solution was added for analysis of the gray values of stained bands. Actin expression was used as the control.For more detailed steps, please refer to the antibody specification and actual protocol explanation.
2.11. Statistical analyses All data are representative of three independent experiments and shown as mean ± standard deviation (SD). Differences between two groups were analyzed by t-test, and differences among groups were analyzed by analysis of variance (ANOVA) using SPSS version 19.0 (SPSS, Inc., Chicago, IL, USA) and GraphPad Prism version 7.01 software (GraphPad, Inc., San Diego, CA, USA). Values of P < 0.05 were considered statistically significant.
3. Results 2.8. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR)
3.1. GGPPS1 expression was upregulated in both ARDS patients and the VILI mouse model
The mRNA expression levels of GGPPS1, IL-6, IL-1β, IL-18 and TNFα in the lung tissues were detected by qRT-PCR. First, total RNA was extracted from lung tissues using Trizol reagent (Invitrogen, CA, USA). cDNA was synthesized at 37 °C for 15 min using a reverse transcription kit (Takara, Dalian, China), followed by a reverse transcriptase inactivation at 85 °C for 15 s mRNA expression levels were detected using the SYBR Premix Ex Taq kit (Takara) and the Mx-3000P Sequence Detection System (Agilent, CA, USA). The amplification reaction procedure was as follows: initial denaturation at 95 °C for 10 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 15 s and 72 °C for 31 s. All primers were obtained from Takara Bio, Inc. and are listed in Table 2. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the reference gene. mRNA expression levels were calculated using the 2−ΔΔcq method.
BALF samples of the right middle lung were collected from eight ARDS patients receiving mechanical ventilation and eight healthy adults for comparison. There were no significant differences in age and gender between the ARDS patients and control group (Table 1). The GGPPS1 content and total protein content of BALF in the ARDS patients was significantly higher than that in the healthy control adults. The GGPPS expression of BALF in the ARDS patients with 4 h MV was higher than that with 10 min MV after endotracheal intubation(Fig. 1A and B). However, there was no significant difference in total protein content of ARDS patients between MV for 4 h and MV for 10min. (Fig. 1B). In BALF collected from the VILI mouse model, the concentration of GGPPS1 was markedly up-regulated compared with that BALF from normal mice (Fig. 1C). GGPPS1 mRNA expression was also higher in lung tissue from the VILI mouse than in lung tissue from normal mice (Fig. 1D). Moreover, the IHC results showed high expression of GGPPS1 in lung tissues in the VILI model (Fig. 1E and F). Consistent with the IHC results, GGPPS1 protein expression, as detected by western blotting, was increased markedly in the VILI mouse model (Fig. 1G and H).
2.9. Lung wet/dry ratio To obtain the wet lung weight, the right middle lung was weighed after the surface was cleaned with absorbent paper. Then the lung specimen was placed in a 65 °C oven for drying, and after 48 h, it was 161
Free Radical Biology and Medicine 147 (2020) 159–166
B. Wan, et al.
Fig. 1. High expression of GGPPS1 in ARDS patients with MV and mouse model of VILI. GGPPS1 protein expression(A) and total protein content (B) in BALF of ARDS patients with MV(MV, 10min, ARDS group and MV, 4 h, ARDS + MV group) and control group were measured by ELISA. (C) GGPPS1 protein expression in BALF of the VILI mouse and untreated wild-type (WT) mice was measured by ELISA. (D) mRNA expression of GGPPS1 in lung tissues of the VILI mouse model and normal mice was measured by qRT-PCR. (E and F) GGPPS1 expression(red arrow) and IHC score in lung tissues of mice was detected by IHC (400×). (G and H) GGPPS1 protein expression in lung tissues of mice was detected by western blotting (n = 5 per group). Data are shown as mean ± SD. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
type II epithelial cells, vaculoated eosinophilic lamellar bodies (to varying degrees), swollen mitochondria, incomplete membranes, increased matrix electron density, and disordered or missing cristae (Fig. 2F-B1, B2). By comparison, lung tissue from the GGPPS1−/− + MV mice showed alveolar type II epithelial cells with almost normal morphology, fewer eosinophilic corpuscles, reduced vacuolization, increased electron density of the mitochondrial matrix and intact mitochondrial matrix (Fig. 2F-C1, C2).
3.2. GGPPS1 knockout alleviated VILI To investigate the role of GGPPS1 in the development of VILI, the severity of VILI symptoms was evaluated in GGPPS1−/− mice. First, IHC and western blot analyses were conducted to confirm GGPPS1 knockout in these mice. The results showed GGPPS1 expression levels in both lung tissues and alveolar epithelial cells of GGPPS1−/− mice were significantly reduced compared with those in wild-type (WT) mice (Supplementary Fig. S1). As shown in Fig. 2A,D-b, diffuse lung injury were accompanied by pulmonary edema, focal hemorrhage, destruction of alveolar structural integrity, necrosis of alveolar epithelial cells, thickening of alveolar septum, interstitial hyperemia, infiltration of inflammatory cells in the interstitium and neutrophils in the alveolar cavity in the VILI mice (WT + MV mice). The degree of injury and inflammation were significantly alleviated in the GGPPS1−/− + MV mice. The lung wet/dry weight ratio was remarkably increased in the WT + MV mice compared with WT mice, but this increase was absent in the GGPPS1−/− + MV mice (Fig. 2B). In addition, the concentration of total protein in BALF from the WT + MV mice was significantly increased than that in the GGPPS1−/− + MV mice (Fig. 2C). Moreover, in accordance with the H &E staining results, the lung injury score was lower in GGPPS1−/− + MV mice than in the WT + MV mice (Fig. 2E). Ultrastructural changes in lung tissue in the different models were observed by TEM. Compared with healthy lung tissue (Fig. 2F-A1, A2), lung tissue from the WT + MV mice presented degenerated alveolar
3.3. GGPPS1 knockout reduced the inflammatory response According to flow cytometric analyses, the total cell count and the percentage of neutrophils in BALF from the WT + MV mice was greater than that in BALF from WT mice, whereas this percentage was lower in GGPPS1 knockout mice (Fig. 3A, B and C). Consistent with these results, H&E analysis showed increased infiltration of neutrophils in lung tissue during VILI, but a significant decrease in this infiltration in GGPPS1−/− + MV mice (Fig. 2D). Moreover, the levels of IL-6, IL-1β, IL-18 and TNF-α in BALF and the mRNA expression (qRT-PCR analyses) in lung tissues were significantly greater in the WT + MV mice than in WT mice, but the levels of these proinflammatory factors were lower in GGPPS1−/− + MV mice than in WT + MV mice (Fig. 3D–G and H–K,respectively).
162
Free Radical Biology and Medicine 147 (2020) 159–166
B. Wan, et al.
Fig. 2. GGPPS1 knockout alleviated lung injury induced by MV. (A) Histopathology of lung tissue from each group (WT: normal wild type mouse without treatment; WT + MV: normal wild type mouse with MV; GGPPS1(−/−)+MV: GGPPS1 knockout mouse with MV). (B) The wet/dry ratio (W/D) of lung tissue in each group. (C) The level of total protein in BALF in each group. (D) Representative image of H&E staining in each group(red arrow, neutrophils in the alveolar cavity； green arrow，thickening of alveolar septum；black arrow, infiltration of neutrophils in the interstitium) [a: WT (400×), b: WT + MV (400×), c: GGPPS1(−/−)+MV (400×), d: GGPPS1(−/−)+GGPP + MV (400×)]. (E) The lung injury score in each group (n = 5 per group) (F) TEM images of type II alveolar epithelial cells in the lung tissue of each group [red arrow: normal lamellar body, green arrow: normal villous pattern, blue arrow: disruption of the lamellar body; A1: WT (2000×), A2: WT (5000×),B1: WT + MV (2000×), B2: WT + MV (5000×), C1: GGPPS1(−/−)+MV (2000×), C2: GGPPS1(−/−)+MV (5000×)]. Data are shown as mean ± SD. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
that in GGPPS1−/− mice (Fig. 2D–c,D-d). Also, the lung injury score was higher in GGPP-treated GGPPS1−/− mice than in PBS-treated GGPPS1−/− mice (Fig. 2E).
3.4. Supplementation of exogenous GGPP exacerbated lung injury in GGPPS1−/− mice induced by MV Based on the catalytic effect of GGPPS1 on the generation of GGPP, we examined the effects of a peritoneal injection of exogenous GGPP (G6025-5VL,Sigma-Aldrich,St.Louis, MO,USA) into GGPPS1−/− mice to further confirm the promoting role of GGPPS1 in VILI. The GGPPS1−/− mice received one peritoneal injection of GGPP (1 mg/mL in methanol:NH4OH(7:3), 2 mg/kg.weight) 30 min before the implementation of MV. The H&E staining results showed enhanced edema and bleeding in GGPPS1−/− mice that received GGPP before MV. In addition, infiltration of inflammatory cells, especially neutrophils, was increased, and alveolar wall thickening was observed compared with
3.5. GGPPS1 knockout down-regulated the expression of TLRs and downstream proteins To investigate the molecular mechanism underlying the effect of GGPPS1 in VILI, we measured the expression of TLRs and downstream proteins in the different mouse models. The expression levels of TLR2 and TLR4 in lung tissue were markedly greater in WT + MV mice compared with WT mice, but lower in GGPPS1−/− + MV mice compared with WT + MV mice (Fig. 4A–C). Moreover, downstream 163
Free Radical Biology and Medicine 147 (2020) 159–166
B. Wan, et al.
Fig. 3. GGPPS1 knockout reduced the inflammatory responses in VILI. (A, B and C) The total cell count and the percentage of neutrophils in BALF as analyzed by flow cytometry (D–G) The BALF concentrations of IL-6, IL-1β, IL-18 and TNF-α in each group. (H–K) mRNA expression levels of IL-6, IL-1β, IL-18 and TNF-α in lung tissues in each group (n = 5 per group). Data are shown as mean ± SD. *P < 0.05, **P < 0.01. (WT: normal wild type mouse without treatment; GGPPS1(−/−), normal GGPPS1 KO mouse without treatment; WT + MV: normal wild type mouse with MV; GGPPS1(−/−)+MV: GGPPS1 KO mouse with MV).
injury is classified as VILI. Therefore, it is particularly important to understand the etiologies of VILI and to develop effective preventive measures. Expression of GGPPS1, a key enzyme catalyzing the synthesis of GGPP from FPP, was found to be increased in multiple disease conditions, including lung adenocarcinoma, diabetes and cigarette smokeinduced inflammation [27–29]. In addition, a recent study reported that high expression of GGPPS1 in the fetal lung is essential for the development of airways and alveoli [30]. In the present study, we observed increased expression of GGPPS1 in BALF from ARDS patients receiving MV compared with healthy volunteers, indicating that
proteins of TLR including MyD88, TRAF6, TAK1, and AP-1 were more highly expressed in the WT + MV mice than in WT mice, but the expression levels of these proteins were lower with GGPPS1 knockout (Fig. 4D–H). 4. Discussion Although MV is the mainstay treatment for alleviating ARDS, it can induce an exaggerated inflammatory response that frequently exacerbates underlying pulmonary conditions [26]. This exacerbation or 164
Free Radical Biology and Medicine 147 (2020) 159–166
B. Wan, et al.
Fig. 4. GGPPS1 knockout suppressed the expression of TLR2/4 and its downstream proteins (MyD88, TRAF6, TAK1 and AP-1). (A–C) Relative expression levels of TLR2 and TLR4 in lung tissues in each group (WT: normal mouse without treatment; WT + MV: normal mouse with MV; GGPPS1(−/−)+MV: mouse knocked out GGPPS1 with MV). (D–H) Relative expression levels of MyD88, TRAF6, TAK1 and AP-1 of lung tissues in each group (n = 5 per group). Data are shown as mean ± SD. *P < 0.05, **P < 0.01. Supplementary Fig. S1 GGPPS1 expression of alveolar epithelial was significantly decreased in doxycycline-induced GGPPS KO(GGPPS−/−) mouse. The GGPPS knockout efficiency in overall lung tissue was about 50% in GGPPS(−/−) mice. A: GGPPS1 expression(red arrow) in lung tissue with IHC (400X); B: GGPPS1 expression of isolated alveolar epithelial cells with WB; C: GGPPS1 expression in lung tissue with WB； D:Gray score of WB. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
alleviated the symptoms of VILI. In addition, with the introduction of exogenous GGPP, an isoprenoid catalyzed by GGPPS1 from FPP, in GGPPS1−/− mice, lung damage and inflammation in response to MV was exacerbated, suggesting that GGPPS1 promotes aggravation of lung injury and inflammation by disrupting the balance of FPP and GGPP. Together, our results indicate that GGPPS1 plays a crucial role in promoting the development of VILI. TLRs are a type of pattern recognition receptors in the natural immune system that are associated with inflammation [33]. Activation of TLRs, including TLR2 and TLR4, often results in the massive release of inflammatory factors such as TNF-α, IL-1β and IL-6 [34]. Campolo et al. reported that TLR4 enhances the development of neuroinflammation by activating the transcription factor AP-1 [35]. Here, we investigated the role of TLR signaling in GGPPS1-enhanced VILI. Our data showed that in the VILI model, TLR2/4 expression was significantly up-regulated, which induced inflammation in the lung. We next detected the expression of downstream proteins of TLR2/4, including MyD88, TRAF6 and TAK1, as well as the transcription factor AP-1. Consistent with the expression of TLR2/4, the levels of MyD88, TRAF6, TAK1 and AP-1 were increased in lung tissue of the VILI model mice. These results suggest that the TLR2/4-MyD88-TRAF6-TAK1-AP-1 pathway is involved in MV-induced pulmonary inflammatory responses. However, the expression levels of TLR2/4, MyD88, TRAF6, TAK1 and AP-1 in lung tissue were suppressed upon deletion of GGPPS1, indicating that loss of GGPPS1 can suppress the pulmonary inflammation by triggering the TLR2/4-AP-1 signaling pathway. The phenomenon that needs to be pointed out is that downregulation of GGPPS1 reduced TLR4 of
GGPPS1 may be involved in the development of VILI. To explore this role of GGPPS1 and the underlying mechanisms, we generated a mouse model of VILI via MV. The expression of GGPPS1 in BALF was again found to be up-regulated in the VILI model compared with normal mice. In addition, GGPPS1 expression at both the mRNA and protein levels was weak in the lung tissue was of normal mice, but significantly increased in the VILI model. Together, these results showed that GGPPS1 is associated with MV-induced lung inflammation. Thus, GGPPS1 plays a role in the pathogenesis of VILI according to both clinical and mouse model data. We extended our studies of the potential role of GGPPS1 in VILI using GGPPS1−/− mice. Our results showed that depletion of GGPPS1 attenuated lung injury, protein exudation, lung inflammation and injury to type II alveolar epithelial cells. It is well known that overdistension of aerated lung regions induces abnormally large mechanical stretching of the epithelium, resulting in increased secretion of inflammatory cytokines and infiltration of a large number of inflammatory cells [31,32]. In the present study, we observed significant increases in the number of inflammatory cells, especially neutrophils, in both lung tissue and BALF, while GGPPS1 knockout mice exhibited reduced recruitment and generation of neutrophils. Moreover, the BALF concentrations of inflammatory cytokines including IL-6, IL-1β, IL-18 and TNF-α as well as the expression levels of these proteins in lung tissue were obviously increased in the VILI model, but GGPPS1 knockout was associated with significantly lower expression levels of these inflammatory cytokines. Thus, GGPPS1 knockout inhibited inflammatory cell recruitment and cytokine production and further 165
Free Radical Biology and Medicine 147 (2020) 159–166
B. Wan, et al.
membrane in A549 cells with LPS administration, but not with PBS administration in our previous study [21].There was no significant difference between WT control and KO control for the parameters on pathology and inflammatory factors in lung tissue. It is suggested that GGPPS1 knockout of alveolar epithelial does not cause significant differential expression of TLR4 and inflammatory cytokines in lung tissue under non-invasive condition. These phenomena indicate that the relationship between GGPPS1 and TLRs is complex in inflammation and injury, which may not be explained by the above-mentioned signal pathway alone. Much more research is needed to explore the relationship between GGPPS1 and TLRs. In conclusion, our study confirms that GGPPS1 knockout is a protective factor in VILI, the possible mechanism is due to inactivation of inflammatory cells resulting from disrupted TLR2/4-MyD88-TRAF6TAK1-AP-1 signaling. The present study revealed the important role of GGPPS1 in VILI, and thus, GGPPS1 may be a promising target for the development of a selective alternative strategy to alleviate the progression of VILI.
[8] [9] [10]
[11]
[12]
[13]
[14] [15] [16] [17]
[18]
Grants This work was supported by National Natural Science Foundation of China (grants nos.81770082), Natural Science Foundation of Jiangsu Province (grant nos. BK20191351), Jiangsu Planned Projects for Postdoctoral Research Funds (grant nos. 2019k178), Hunan Natural Science Foundation Youth Fund Project (grant nos. 2019JJ50021).
[19]
[20]
Author contributions
[21]
T.L. and Y.S. conceived and designed research; B.W.,W.X., M.C., J.J., P.Z., S.Z., Y.L. and S.S. performed experiments; B.W., drafted manuscript; B.W.,W.X., M.C., J.J., P.Z., S.Z., Y.L., S.S. T.L. and Y.S. approved final version of manuscript.
[22]
[23]
Declaration of competing interest No conflicts of interest, financial or otherwise, are declared by the authors.
[24]
Acknowledgments [25]
We thank Drs. Yunlei Zhang,Qiao Zhang, Panpan Liu and Xiuwei Zhang (Medical School of Nanjing University) for samples and technical support.
[26]
Appendix A. Supplementary data
[27]
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.freeradbiomed.2019.12.024.
[28]
References [29] [1] F. Alessandri, F. Pugliese, V.M. Ranieri, Mechanical ventilation: we have come a long way but still have a long road ahead, Lancet Respir Med 5 (12) (2017) 922–924. [2] Acute Respiratory Distress Syndrome Network, R.G. Brower, M.A. Matthay, A. Morris, D. Schoenfeld, B.T. Thompson, A. Wheeler, Ventilation with lower tidal volumes as compared with traditional tidal volumes for acute lung injury and the acute respiratory distress syndrome, N. Engl. J. Med. 342 (18) (2000) 1301–1308. [3] L.N. Tremblay, A.S. Slutsky, Ventilator-induced lung injury: from the bench to the bedside, Intensive Care Med. 32 (2006) 24–33. [4] C.C. Dos Santos, Y. Shan, A. Akram, A.S. Slutsky, J.J. Haitsma, Neuroimmune regulation of ventilator-induced lung injury, Am. J. Respir. Crit. Care Med. 183 (4) (2011) 471–482. [5] A.S. Slutsky, V.M. Ranieri, Ventilator-induced lung injury, N. Engl. J. Med. 369 (22) (2013) 2126–2136. [6] G.F. Curley, J.G. Laey, H. Zhang, A.S. Slutsky, Biotrauma and ventilator-induced lung injury, Chest 150 (2016) 1109–1117. [7] M. Unroe, J.M. Kahn, S.S. carson, J.A. Govert, T. Martinu, S.J. Sathy, A.S. clay, J. chia, A. Gray, J.A. Tulsky, cE. cox, One-year trajectories of care and resource utilization for
[30]
[31] [32] [33] [34] [35]
166
recipients of prolonged mechanical ventilation: a cohort study, Ann. Intern. Med. 153 (2010) 167–175. K.L. Hamlington, B.J. Smith, G.B. Allen, J.H. Bates, Predicting ventilator-induced lung injury using a lung injury cost function, J. Appl. Physiol. 121 (2016) 106–114. E. Fan, D.M. Needham, T.E. Stewart, Ventilatory management of acute lung injury and acute respiratory distress syndrome, J. Am. Med. Assoc. 294 (2005) 2889–2896. H. Huang, H. Feng, D. Zhuge, M1 macrophage activated by notch signal pathway contributed to ventilator-induced lung injury in chronic obstructive pulmonary disease model, J. Surg. Res. 244 (2019) 358–367. Y. Wang, C.F. Xu, Y.J. Liu, Y.F. Mao, Z. Lv, S.Y. Li, X.Y. Zhu, L. Jiang, Salidroside attenuates ventilation induced lung injury via SIRT1-dependent inhibition of NLRP3 inflammasome, Cell. Physiol. Biochem. 42 (2017) 34–43. V. Suryadevara, P. Fu, D.L. Ebenezer, E. Berdyshev, I.A. Bronova, L.S. Huang, A. Harijith, V. Natarajan, Sphingolipids in ventilator induced lung injury: role of sphingosine-1phosphate lyase, Int. J. Mol. Sci. 19 (2018), https://doi.org/10.3390/ijms19010114. T. Jaecklin, D. Engelberts, G. Otulakowski, H. O'Brodovich, M. Post, B.P. Kavanagh, Lungderived soluble mediators are pathogenic in ventilator-induced lung injury, Am. J. Physiol. Lung Cell Mol. Physiol. 300 (2011) 648–658. S. McTaggart, Isoprenylated proteins, Cell. Mol. Life Sci. 63 (2006). M. Takemoto, J.K. Liao, Pleiotropic effects of 3-hydroxy-3-methylglutaryl coenzyme a reductase inhibitors, Arterioscler. Thromb. Vasc. Biol. 21 (11) (2001) 1712–1719. J.K. Liao, U. Laufs, Pleiotropic effects of statins, Annu. Rev. Pharmacol. Toxicol. 45 (2005) 89–118. N. Xu, N. Shen, X. Wang, S. Jiang, B. Xue, C. Li, Protein prenylation and human diseases: a balance of protein farnesylation and geranylgeranylation, Sci. China Life Sci. 58 (4) (2015) 328–335. R. Zhu, J. Wang, T. Feng, X. Hu, C. Jiang, X. Wang, K. Li, Y. Sang, Y. Hua, H. Sun, B. Yao, C. Li, The alteration of RhoA geranylgeranylation and Ras farnesylation breaks the integrity of the blood-testis barrier and results in hypospermatogenesis, Cell Death Dis. 10 (2019) 450. S.S. Lai, X. Fu, Q. Cheng, Z.H. Yu, E.Z. Jiang, D.D. Zhao, D.C. Yu, Y.D. Qiu, X. Gao, H.X. Ju, W. Wang, Q. Jiang, M.S. Zhu, C.J. Li, B. Xue, HSC-specific knockdown of GGPPS alleviated CCl-induced chronic liver fibrosis through mediating RhoA/Rock pathway, Am J Transl Res 11 (2019) 2382–2392. M. Chen, B. Wan, S. Zhu, F. Zhang, J. Jin, X. Li, X. Wang, Y. Lv, C. Chen, T. Lv, Y. Song, Geranylgeranyl diphosphate synthase deficiency aggravates lung fibrosis in mice by modulating TGF-β1/BMP-4 signaling, Biol. Chem. (2019), https://doi.org/10.1515/hsz2019-0168. W.J. Xu, X.X. Wang, J.J. Jin, Q. Zou, L. Wu, T.F. Lv, B. Wan, P. Zhan, S.H. Zhu, H.B. Liu, N.W. Zhao, C.J. Li, Y. Song, Inhibition of GGPPS1 attenuated LPS-induced acute lung injury and was associated with NLRP3 inflammasome suppression, Am. J. Physiol. Lung Cell Mol. Physiol. 316 (2019) L567–L577. H. Zhang, S. Chen, M. Zeng, D. Lin, Y. Wang, X. Wen, C. Xu, L. Yang, X. Fan, Y. Gong, H. Zhang, X. Kong, Apelin-13 administration protects against LPS-induced acute lung injury by inhibiting NF-κB pathway and NLRP3 inflammasome activation, Cell. Physiol. Biochem. 49 (2018) 1918–1932. G. Matute-Bello, G. Downey, B.B. Moore, S.D. Groshong, M.A. Matthay, A.S. Slutsky, W.M. Kuebler, Acute Lung Injury in Animals Study Group. An official American Thoracic Society workshop report: features and measurements of experimental acute lung injury in animals, Am. J. Respir. Cell Mol. Biol. 44 (2011) 725–738. Winnie Yeo, L. Chan Stephen, K.F. Mo Frankie, M. Chu Cheuk, W.Y. Hui Joyce, H.M. Tong Joanne, W.H. Chan Anthony, Jane Koh, P. Hui Edwin, Loong Herbert, Kirsty Lee, Li Leung, Brigette Ma, Ka F. To, Simon C.H. Yu, Phase I/II study of temsirolimus for patients with unresectable Hepatocellular Carcinoma (HCC)- a correlative study to explore potential biomarkers for response, BMC Canc. 15 (2015) 395. A. Azim Hatem, A. Peccatori Fedro, Sylvain Brohée, Daniel Branstetter, Loi Sherene, Viale Giuseppe, Piccart Martine, C. Dougall William, Pruneri Giancarlo, Sotiriou Christos, RANK-ligand (RANKL) expression in young breast cancer patients and during pregnancy, Breast Cancer Res. 17 (2015) 24. S. Luh, C. Chiang, Acute lung injury/acute respiratory distress syndrome (ALI/ARDS): the mechanism, present strategies and future perspectives of therapies, J. Zhejiang Univ. - Sci. B 8 (1) (2007) 60–69. X. Wang, W. Xu, P. Zhan, T. Xu, J. Jin, Y. Miu, Z. Zhou, Q. Zhu, B. Wan, G. Xi, L. Ye, Y. Liu, J. Gao, H. Li, T. Lv, Y. Song, Overexpression of geranylgeranyl diphosphate synthase contributes to tumour metastasis and correlates with poor prognosis of lung adenocarcinoma, J. Cell Mol. Med. 22 (2018) 2177–2189. S. Jiang, D. Shen, W.J. Jia, X. Han, N. Shen, W. Tao, X. Gao, B. Xue, C.J. Li, GGPPSmediated Rab27A geranylgeranylation regulates β cell dysfunction during type 2 diabetes development by affecting insulin granule docked pool formation, J. Pathol. 238 (2016) 109–119. N. Shen, T. Gong, J.D. Wang, F.L. Meng, L. Qiao, R.L. Yang, B. Xue, F.Y. Pan, X.J. Zhou, H.Q. Chen, W. Ning, C.J. Li, Cigarette smoke-induced pulmonary inflammatory responses are mediated by EGR-1/GGPPS/MAPK signaling, Am. J. Pathol. 178 (2011) 110–118. W.J. Jia, S. Jiang, Q.L. Tang, D. Shen, B. Xue, W. Ning, C.J. Li, Geranylgeranyl diphosphate synthase modulates fetal lung branching morphogenesis possibly through controlling k-ras prenylation, Am. J. Pathol. 186 (2016) 1454–1465. K.J. Cavanaugh Jr., J. Oswari, S.S. Margulies, Role of stretch on tight junction structure in alveolar epithelial cells, Am. J. Respir. Cell Mol. Biol. 25 (5) (2001) 584–591. T.S. Cohen, K.J. Cavanaugh, S.S. Margulies, Frequency and peak stretch magnitude affect alveolar epithelial permeability, Eur. Respir. J. 32 (2008) 854–861. B.S. Park, J.O. Lee, Recognition of lipopolysaccharide pattern by TLR4 complexes, Exp. Mol. Med. 45 (2013) e66. P.P.C. Souza, U.H. Lerner, Finding a Toll on the route: the fate of osteoclast progenitors after toll-like receptor activation, Front. Immunol. 10 (2019) 1663–1674. M. Campolo, I. Paterniti, R. Siracusa, A. Filippone, E. Esposito, S. Cuzzocrea, TLR4 absence reduces neuroinflammation and inflammasome activation in Parkinson's diseases in vivo model, Brain Behav. Immun. 76 (2019) 236–247.
Contents lists available at ScienceDirect
Free Radical Biology and Medicine journal homepage: www.elsevier.com/locate/freeradbiomed
Original article
Geranylgeranyl diphosphate synthase 1 knockout ameliorates ventilatorinduced lung injury via regulation of TLR2/4-AP-1 signaling
T
Bing Wana,1, Wu-jian Xub,1, Mei-zi Chenc, Shuang-shuang Suna, Jia-jia Jina, Yan-ling Lvb, Ping Zhanb, Su-hua Zhub, Xiao-xia Wangb, Tang-Feng Lvb,∗, Yong Songb,∗∗ a
Department of Respiratory and Critical Care Medicine, The Affiliated Jiangning Hospital of Nanjing Medical University, Nanjing, 210002, China Department of Respiratory and Critical Medicine, Jinling Hospital, Nanjing Clinical School of Southern Medical University, Nanjing, 210002, China c Department of General Internal Medicine, The First People's Hospital of Chenzhou, Chenzhou, 423000, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Ventilator-induced lung injury GGPPS1 Inflammation TLR2/4
Objective: To investigate the role of geranylgeranyl diphosphate synthase 1 (GGPPS1) in ventilator-induced lung injury along with the underlying mechanism. Methods: A murine VILI model was induced by high-tidal volume ventilation in both wild-type and GGPPS1 knockout mice. GGPPS1 expression was detected in the bronchoalveolar lavage fluid (BALF) supernatants of acute respiratory distress syndrome (ARDS) patients and healthy volunteers, as well as in lung tissues and BALF supernatants of the VILI mice using enzyme-linked immunosorbent assay (ELISA), quantitative reverse transcription polymerase chain reaction (qRT-PCR), western bolt and immunohistochemical (IHC). The wet/dry ratio, total BALF proteins, and lung injury score were analyzed. The percentage of neutrophils was detected by flow cytometry and IHC. Inflammatory cytokine levels were measured by ELISA and qRT-PCR. The related expression of Toll-like receptor (TLR)2/4 and its downstream proteins was evaluated by western blot. Results: GGPPS1 in BALF supernatants was upregulated in ARDS patients and the VILI mice. Depletion of GGPPS1 significantly alleviated the severity of ventilator induced lung injury in mice. Total cell count, neutrophils and inflammatory cytokines (interleukin [IL]-6, IL-1β, IL-18 and tumor necrosis factor-α) levels in BALF were reduced after GGPPS1 depletion. Moreover, addition of exogenous GGPP in GGPPS-deficient mice significantly exacerbated the severity of ventilator induced lung injury as compared to the PBS treated controls. Mechanistically, the expression of TLR2/4, as well as downstream proteins including activator protein-1 (AP-1) was suppressed in lung tissues of GGPPS1-deficient mice. Conclusion: GGPPS1 promoted the pathogenesis of VILI by modulating the TLR2/4–AP-1 signaling pathway, and GGPPS1 knockout significantly alleviated the lung injury and inflammation in the VILI mice.
1. Introduction Mechanical ventilation (MV) is one of the most important life-saving therapies in patients with pulmonary dysfunction or injury, especially those with acute respiratory distress syndrome (ARDS) [1,2]. However, improper MV itself is an important source of secondary lung injury, resulting in increased morbidity and mortality [3,4]. Such injury has been termed ventilator-induced lung injury (VILI), which is pathologically characterized by marked increase in pulmonary alveolar–vascular permeability, inflammatory cell infiltration, lung edema and bleeding [5,6]. The current high incidence of VILI worsens the quality of life of
patients with respiratory failure [7,8]. Three main integrated mechanisms of injury have been established: alveolar overdistention, cyclic atelectasis, and inflammatory cell activation [2,9]. These cells then produce high levels of proinflammatory cytokines (e.g., interleukin [IL]-1β, IL-6 and tumor necrosis factor alpha [TNF-α]) and inflammatory-related factors (arachinoid acid, ceramide, sphingolipids), which further aggravated the injury of lung [10–13]. Protein isoprenylation is essential for cell survival and membranerelated cellular biological functions, including cell growth, differentiation, proliferation and protein transport [14]. It is necessary for GTP-binding proteins, such as Ras and Rho, to be able to signal to their
∗
Corresponding author. Division of Respiratory Medicine, Jinling Hospital, Nanjing University School of Medicine, Nanjing, 210002, China. Corresponding author. Department of Respiratory and Critical Medicine, Jinling Hospital, Nanjing Clinical School of Southern Medical University, 305 Zhongshan Road, Nanjing, 210002, China. E-mail addresses: [email protected] (T.-F. Lv), [email protected] (Y. Song). 1 B. Wan and WJ. Xu contributed equally to this study. ∗∗
https://doi.org/10.1016/j.freeradbiomed.2019.12.024 Received 24 September 2019; Received in revised form 19 December 2019; Accepted 20 December 2019 Available online 24 December 2019 0891-5849/ © 2019 Elsevier Inc. All rights reserved.
Free Radical Biology and Medicine 147 (2020) 159–166
B. Wan, et al.
endotracheal intubation was performed using an 18G vein Teflon catheter. Mice in the model groups were then mechanically ventilated with a small animal ventilator (ALC-V8, Alcott Biotech Co., Ltd., Shanghai, China) for 4 h with a tidal volume of 28 mL/kg, a respiratory rate of 60 breaths/min, an inspiratory–expiratory ratio (I:E) of 1: 1, a fraction of inspiration O2 (FiO2) of 0.21, and a positive end-expiratory pressure (PEEP) of 0 cm H2O. After 4 h, the mice wereeuthanized, then, lung tissues and BALF were harvested for further analysis.
downstream effectors and promote vital cellular functions [15,16]. Farnesyl pyrophosphate (FPP) and geranylgeranyl pyrophosphate (GGPP) are the two main isoprenoids and are synthesized via the mevalonate (MVA) pathway [17]. Geranylgeranyl pyrophosphate synthase large subunit 1 (GGPPS1), a key enzyme responsible for synthesis of GGPP from FPP, also plays a crucial role in the biological functions of cells and pathogenesis of diseases, such as infertility [18], liver fibrosis [19]. Our previous work indicates that GGPPS1 may play a role in the pathogenesis of inflammation-related diseases, such as lipopolysaccharide-induced acute lung injury and idiopathic pulmonary fibrosis [20,21]. In the present study, we hypothesized that GGPPS1 may play a role in the pathophysiology of VILI. To test this hypothesis, we measured GGPPS1 expression in ARDS patients and a mouse model of VILI. To further investigate the underlying mechanisms, we determined the effects of GGPPS1 knockout in mice with and without VILI.
2.4. BALF analysis Bronchoalveolar lavage of mouse was performed using three aliquots of 0.8 ml of pre-cooled sterile phosphate-buffered saline (PBS) as previously described [22]. The bronchoalveolar lavage steps from ARDS patients are as follows: on the basis of mechanical ventilation, the BALF of right middle lung is rapidly collected through the endotracheal intubation. 20 ml aseptic saline is injected into the right middle lung for three times, and about 30 ml BALF is recovered and filtered by sterile gauze. After centrifugation at 1000g for 10 min, 1.2 ml supernatant of mouse or 20 ml supernatant of ARDS patients was collected and stored at −80 °C for measurement of GGPPS1, total protein and cytokine concentrations. . The total protein in BALF was detected using a bicinchoninic acid (BCA) kit (KeyGen Biotech, Nanjing, China) according to the manufacturer's protocol. Briefly, the kit working solution as added to samples for incubation at 37 °C for 30 min. The absorbance at 562 nm of each sample was measured by a microplate reader (Bio-Tek, Instruments Inc., Winooski, VT, USA), and the protein concentrations were calculated in reference to the standard concentration curve. The concentrations of GGPPS1 in BALF supernatants of ARDS patients and the concentrations of GGPPS1, IL-6, IL-1β, IL-18 and TNF-α in BALF supernatants of mice were measured by enzyme-linked immunosorbent assay (ELISA) (Human GGPPS1, Cusabio, China; Mouse GGPPS1,HLE98085,Shanghai, China; IL-6, IL-1β, IL-18 and TNF-α, eBioscience, San Diego, CA,respectively) following the manufacturer's protocol. Briefly, samples were added to an enzyme-labeled coating plate, and then the enzyme labeling reagent was added. After reaction at 37 °C for 30 min, the developer and stop solution were added successively. Finally, the optical density value at 450 nm for each well was determined using a microplate reader.
2. Materials and methods 2.1. Patients Bronchoalveolar lavage fluid (BALF) samples were collected from eight patients diagnosed with ARDS in the general surgery intensive care unit or the respiratory intensive care unit of Jinling Hospital, and eight healthy volunteers underwent bronchoscopy. This study protocol was approved by Jinling Hospital's Institutional Review Committee on Human Research. Written informed consent was obtained from all patients, and healthy control-group patients involved in this study before BALF sampling was performed. The general characteristics of the patients are presented in Table 1. 2.2. Animals Ten-week-old male C57BL/6 mice weighing 20–25 g were purchased from Model Animal Research Center of Nanjing University. Primary C57BL/6 mice with lung specific GGPPS1 knockout (GGPPS1spc-rtTA-teTO-cre-floxP/floxP, GGPPS1−/−) were a gift from the Laboratory of Prof. Li Chaojun (Model Animal Research Center and the Medical School of Nanjing University). All animals were kept in a specific pathogen-free environment with a 12/12 h light/dark cycle and controlled temperature of 22–24 °C with free access to food and water. All animal experiments were approved by the Animal Care and Use Committee of Southern Medical University and the China Council on Animal Care.
2.5. Lung histopathology and immunohistochemistry Hematoxylin and eosin (H&E) staining was applied to observe the severity of microscopic lung injury and grade lung injury score. First, lung tissues were fixed with 10% neutral formalin for 1 week. Then they were dehydrated, embedded, and sliced into 4-μm-thick sections. After deparaffinization in xylene and hydration through a graded series of ethanol solutions, sections were stained with hematoxylin for 5 min and eosin for 2 min. Finally, sections were washed with gradient ethanol, and a neutral gel was used for sealing. The alveolar morphology was observed under a light microscope (Nikon, Japan), and the lung injury score was determined as reported previously [23]. For immunohistochemical (IHC) staining, paraffin sections were deparaffnized and rehydrated as described as above. After heat-induced antigen retrieval through incubation in Tris-EDTA buffer at 98 °C for 30 min, sections were immersed in 3% H2O2 for 25 min to block endogenous peroxidase activity. The sections were then incubated with primary antibodies including anti-GGPPS (Proteintech, Wuhan, China) at 4 °C overnight. After two rinses in PBS, sections were incubated in goat anti-mouse horseradish peroxidase (HRP)-conjugated secondary antibodies (Proteintech) for 50 min. Sections were then washed and incubated with diaminobenzidine (DAB) for 5 min. After rinsing with tap water, the sections were counterstained with hematoxylin. Each slide was photographed under a light microscope (Nikon, Japan). HSCORE (histochemistry score) is a histological scoring method for
2.3. Mouse model of VILI Mice were weighed and anesthetized with an intraperitoneal injection of 5% chloral hydrate (500 mg/kg) and pentobarbitone (90 mg/ kg). The mice were then fixed in a supine position and the neck skin was cut and blunt dissected to expose the trachea. Subsequently, Table 1 Characteristics of ARDS patients and healthy volunteers. Index
ARDS patients (n = 8)
Control individuals (n = 8)
P
Age (years) Gender (M/F) ARDS classification Mild Moderate Severe Cause of admission Severe pneumonia Pancreatitis
38.75 ± 16.04 4/4
44.88 ± 15.22 6/2
0.446 0.302
0 2 6 4 4
160
Free Radical Biology and Medicine 147 (2020) 159–166
B. Wan, et al.
dealing with immunohistochemical results, which converts the number of positive cells and their staining intensity in each section into corresponding values to achieve the purpose of semi-quantitative tissue staining. H-SCORE = ∑（PI × I） = （percentage of cells of weak intensity × 1) + (percentage of cells of moderate intensity × 2) + percentage of cells of strong intensity × 3), in the general formula, PI represents the percentage of positive cells in the total number of cells in the section, and I represents the staining intensity [24,25].
Table 2 Primer sequences for GGPPS1, IL-6, IL-1β, IL-18, TNF-α and GAPDH. Target (mouse)
Forward primer (5′-3′)
Reverse primer (5′-3′)
GGPPS1 IL-6 IL-1β IL-18 TNF-α GAPDH
TTCACCAACACCTGTAACTC TAGTCCTTCCTACCCCAATTTCC GCAACTGTTCCTGAACTCAACT GACAGCCTGTGTT CGAGGAT CCCTCACACTCAGATCATCTTCT AGGTCATCCC AGAGCTGAACG
TTATTGACAAGCCCAGAGC TTGGTCCTTAGCCACTCCTTC ATCTTTTGGGGTCCGTCAACT TGGATCCATTTCCTCAAAGG GCTACGACGTGGGCTACAG CACCCTGTTGCTGTAGCCGTAT
2.6. Transmission electron microscopy weighed again to obtain the dry lung weight. The lung wet/dry ratio was calculated by dividing the wet lung weight by the dry lung weight.
Lung tissue samples were washed with PBS and fixed with 2% glutaraldehyde for 2 h. After post-fixation with 1% osmium tetroxide, the samples were dehydrated with a graded ethanol series and embedded in propylene oxide for cutting into ultrathin sections. The sections were then stained with uranyl acetate and lead citrate. Finally, the ultrastructure of lung tissue was examined by transmission electron microscopy (Servicebio, Wuhan, China).
2.10. Flow cytometry The percentage of neutrophils in BALF was measured through using flow cytometric analysis. First, BALF cells were collected by centrifugation and resuspended in PBS containing 10% fetal calf serum and 1% sodium azide. Subsequently, 5 × 105 cells were incubated with 10 μg/mL of anti-neutrophil antibody (Abcam) at room temperature for 30 min. Next, the cells were gathered by centrifugation and washed for three times using PBS. The cell pellet was further resuspended in the fluorescein isothiocyanate (FITC)-labeled secondary antibody (Abcam) at a dilution of 1: 1500 at room temperature in darkness. After 30 min incubation, the cells were collected and wahsed using PBS for thrice times. Finally, the fluorescence intensity of the cells was recorded and analyzed using a CytoFLEX instrument (Beckman, CA, USA).
2.7. Western blotting Protein samples from lung tissues and BALF were separated by 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes. Each PVDF membrane was sealed with 5% skimmed milk powder for 2 h and incubated with primary antibodies including antiGGPPS1(Santa Cruz Biotechnology,CA,USA), anti-Toll-like receptor 2 (TLR2, ab16894, Abcam, MA, USA), anti-TLR4(#14358,CST, MA, USA), anti-myeloid differentiation factor 88 (MyD88,ab135693, Abcam, MA, USA), anti-TNF receptor associated factor 6 (TRAF6, Abs131476, absin, Shanghai, China), anti-transforming growth factor beta-activating kinase 1 (TAK1, #4505, CST, MA, USA), anti-activator protein 1 (AP-1,Ab21981, Abcam, MA, USA) and anti-actin (Santa Cruz Biotechnology, CA, USA) overnight at 4 °C. After three washes in Trisbuffered saline containing Tween 20 (TBST), the membranes were incubated with goat anti-mouse HRP-conjugated secondary antibodies (Abcam, MA, USA) for 1 h. Finally, freshly-made enhanced chemiluminescence (ECL) solution was added for analysis of the gray values of stained bands. Actin expression was used as the control.For more detailed steps, please refer to the antibody specification and actual protocol explanation.
2.11. Statistical analyses All data are representative of three independent experiments and shown as mean ± standard deviation (SD). Differences between two groups were analyzed by t-test, and differences among groups were analyzed by analysis of variance (ANOVA) using SPSS version 19.0 (SPSS, Inc., Chicago, IL, USA) and GraphPad Prism version 7.01 software (GraphPad, Inc., San Diego, CA, USA). Values of P < 0.05 were considered statistically significant.
3. Results 2.8. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR)
3.1. GGPPS1 expression was upregulated in both ARDS patients and the VILI mouse model
The mRNA expression levels of GGPPS1, IL-6, IL-1β, IL-18 and TNFα in the lung tissues were detected by qRT-PCR. First, total RNA was extracted from lung tissues using Trizol reagent (Invitrogen, CA, USA). cDNA was synthesized at 37 °C for 15 min using a reverse transcription kit (Takara, Dalian, China), followed by a reverse transcriptase inactivation at 85 °C for 15 s mRNA expression levels were detected using the SYBR Premix Ex Taq kit (Takara) and the Mx-3000P Sequence Detection System (Agilent, CA, USA). The amplification reaction procedure was as follows: initial denaturation at 95 °C for 10 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 15 s and 72 °C for 31 s. All primers were obtained from Takara Bio, Inc. and are listed in Table 2. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the reference gene. mRNA expression levels were calculated using the 2−ΔΔcq method.
BALF samples of the right middle lung were collected from eight ARDS patients receiving mechanical ventilation and eight healthy adults for comparison. There were no significant differences in age and gender between the ARDS patients and control group (Table 1). The GGPPS1 content and total protein content of BALF in the ARDS patients was significantly higher than that in the healthy control adults. The GGPPS expression of BALF in the ARDS patients with 4 h MV was higher than that with 10 min MV after endotracheal intubation(Fig. 1A and B). However, there was no significant difference in total protein content of ARDS patients between MV for 4 h and MV for 10min. (Fig. 1B). In BALF collected from the VILI mouse model, the concentration of GGPPS1 was markedly up-regulated compared with that BALF from normal mice (Fig. 1C). GGPPS1 mRNA expression was also higher in lung tissue from the VILI mouse than in lung tissue from normal mice (Fig. 1D). Moreover, the IHC results showed high expression of GGPPS1 in lung tissues in the VILI model (Fig. 1E and F). Consistent with the IHC results, GGPPS1 protein expression, as detected by western blotting, was increased markedly in the VILI mouse model (Fig. 1G and H).
2.9. Lung wet/dry ratio To obtain the wet lung weight, the right middle lung was weighed after the surface was cleaned with absorbent paper. Then the lung specimen was placed in a 65 °C oven for drying, and after 48 h, it was 161
Free Radical Biology and Medicine 147 (2020) 159–166
B. Wan, et al.
Fig. 1. High expression of GGPPS1 in ARDS patients with MV and mouse model of VILI. GGPPS1 protein expression(A) and total protein content (B) in BALF of ARDS patients with MV(MV, 10min, ARDS group and MV, 4 h, ARDS + MV group) and control group were measured by ELISA. (C) GGPPS1 protein expression in BALF of the VILI mouse and untreated wild-type (WT) mice was measured by ELISA. (D) mRNA expression of GGPPS1 in lung tissues of the VILI mouse model and normal mice was measured by qRT-PCR. (E and F) GGPPS1 expression(red arrow) and IHC score in lung tissues of mice was detected by IHC (400×). (G and H) GGPPS1 protein expression in lung tissues of mice was detected by western blotting (n = 5 per group). Data are shown as mean ± SD. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
type II epithelial cells, vaculoated eosinophilic lamellar bodies (to varying degrees), swollen mitochondria, incomplete membranes, increased matrix electron density, and disordered or missing cristae (Fig. 2F-B1, B2). By comparison, lung tissue from the GGPPS1−/− + MV mice showed alveolar type II epithelial cells with almost normal morphology, fewer eosinophilic corpuscles, reduced vacuolization, increased electron density of the mitochondrial matrix and intact mitochondrial matrix (Fig. 2F-C1, C2).
3.2. GGPPS1 knockout alleviated VILI To investigate the role of GGPPS1 in the development of VILI, the severity of VILI symptoms was evaluated in GGPPS1−/− mice. First, IHC and western blot analyses were conducted to confirm GGPPS1 knockout in these mice. The results showed GGPPS1 expression levels in both lung tissues and alveolar epithelial cells of GGPPS1−/− mice were significantly reduced compared with those in wild-type (WT) mice (Supplementary Fig. S1). As shown in Fig. 2A,D-b, diffuse lung injury were accompanied by pulmonary edema, focal hemorrhage, destruction of alveolar structural integrity, necrosis of alveolar epithelial cells, thickening of alveolar septum, interstitial hyperemia, infiltration of inflammatory cells in the interstitium and neutrophils in the alveolar cavity in the VILI mice (WT + MV mice). The degree of injury and inflammation were significantly alleviated in the GGPPS1−/− + MV mice. The lung wet/dry weight ratio was remarkably increased in the WT + MV mice compared with WT mice, but this increase was absent in the GGPPS1−/− + MV mice (Fig. 2B). In addition, the concentration of total protein in BALF from the WT + MV mice was significantly increased than that in the GGPPS1−/− + MV mice (Fig. 2C). Moreover, in accordance with the H &E staining results, the lung injury score was lower in GGPPS1−/− + MV mice than in the WT + MV mice (Fig. 2E). Ultrastructural changes in lung tissue in the different models were observed by TEM. Compared with healthy lung tissue (Fig. 2F-A1, A2), lung tissue from the WT + MV mice presented degenerated alveolar
3.3. GGPPS1 knockout reduced the inflammatory response According to flow cytometric analyses, the total cell count and the percentage of neutrophils in BALF from the WT + MV mice was greater than that in BALF from WT mice, whereas this percentage was lower in GGPPS1 knockout mice (Fig. 3A, B and C). Consistent with these results, H&E analysis showed increased infiltration of neutrophils in lung tissue during VILI, but a significant decrease in this infiltration in GGPPS1−/− + MV mice (Fig. 2D). Moreover, the levels of IL-6, IL-1β, IL-18 and TNF-α in BALF and the mRNA expression (qRT-PCR analyses) in lung tissues were significantly greater in the WT + MV mice than in WT mice, but the levels of these proinflammatory factors were lower in GGPPS1−/− + MV mice than in WT + MV mice (Fig. 3D–G and H–K,respectively).
162
Free Radical Biology and Medicine 147 (2020) 159–166
B. Wan, et al.
Fig. 2. GGPPS1 knockout alleviated lung injury induced by MV. (A) Histopathology of lung tissue from each group (WT: normal wild type mouse without treatment; WT + MV: normal wild type mouse with MV; GGPPS1(−/−)+MV: GGPPS1 knockout mouse with MV). (B) The wet/dry ratio (W/D) of lung tissue in each group. (C) The level of total protein in BALF in each group. (D) Representative image of H&E staining in each group(red arrow, neutrophils in the alveolar cavity； green arrow，thickening of alveolar septum；black arrow, infiltration of neutrophils in the interstitium) [a: WT (400×), b: WT + MV (400×), c: GGPPS1(−/−)+MV (400×), d: GGPPS1(−/−)+GGPP + MV (400×)]. (E) The lung injury score in each group (n = 5 per group) (F) TEM images of type II alveolar epithelial cells in the lung tissue of each group [red arrow: normal lamellar body, green arrow: normal villous pattern, blue arrow: disruption of the lamellar body; A1: WT (2000×), A2: WT (5000×),B1: WT + MV (2000×), B2: WT + MV (5000×), C1: GGPPS1(−/−)+MV (2000×), C2: GGPPS1(−/−)+MV (5000×)]. Data are shown as mean ± SD. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
that in GGPPS1−/− mice (Fig. 2D–c,D-d). Also, the lung injury score was higher in GGPP-treated GGPPS1−/− mice than in PBS-treated GGPPS1−/− mice (Fig. 2E).
3.4. Supplementation of exogenous GGPP exacerbated lung injury in GGPPS1−/− mice induced by MV Based on the catalytic effect of GGPPS1 on the generation of GGPP, we examined the effects of a peritoneal injection of exogenous GGPP (G6025-5VL,Sigma-Aldrich,St.Louis, MO,USA) into GGPPS1−/− mice to further confirm the promoting role of GGPPS1 in VILI. The GGPPS1−/− mice received one peritoneal injection of GGPP (1 mg/mL in methanol:NH4OH(7:3), 2 mg/kg.weight) 30 min before the implementation of MV. The H&E staining results showed enhanced edema and bleeding in GGPPS1−/− mice that received GGPP before MV. In addition, infiltration of inflammatory cells, especially neutrophils, was increased, and alveolar wall thickening was observed compared with
3.5. GGPPS1 knockout down-regulated the expression of TLRs and downstream proteins To investigate the molecular mechanism underlying the effect of GGPPS1 in VILI, we measured the expression of TLRs and downstream proteins in the different mouse models. The expression levels of TLR2 and TLR4 in lung tissue were markedly greater in WT + MV mice compared with WT mice, but lower in GGPPS1−/− + MV mice compared with WT + MV mice (Fig. 4A–C). Moreover, downstream 163
Free Radical Biology and Medicine 147 (2020) 159–166
B. Wan, et al.
Fig. 3. GGPPS1 knockout reduced the inflammatory responses in VILI. (A, B and C) The total cell count and the percentage of neutrophils in BALF as analyzed by flow cytometry (D–G) The BALF concentrations of IL-6, IL-1β, IL-18 and TNF-α in each group. (H–K) mRNA expression levels of IL-6, IL-1β, IL-18 and TNF-α in lung tissues in each group (n = 5 per group). Data are shown as mean ± SD. *P < 0.05, **P < 0.01. (WT: normal wild type mouse without treatment; GGPPS1(−/−), normal GGPPS1 KO mouse without treatment; WT + MV: normal wild type mouse with MV; GGPPS1(−/−)+MV: GGPPS1 KO mouse with MV).
injury is classified as VILI. Therefore, it is particularly important to understand the etiologies of VILI and to develop effective preventive measures. Expression of GGPPS1, a key enzyme catalyzing the synthesis of GGPP from FPP, was found to be increased in multiple disease conditions, including lung adenocarcinoma, diabetes and cigarette smokeinduced inflammation [27–29]. In addition, a recent study reported that high expression of GGPPS1 in the fetal lung is essential for the development of airways and alveoli [30]. In the present study, we observed increased expression of GGPPS1 in BALF from ARDS patients receiving MV compared with healthy volunteers, indicating that
proteins of TLR including MyD88, TRAF6, TAK1, and AP-1 were more highly expressed in the WT + MV mice than in WT mice, but the expression levels of these proteins were lower with GGPPS1 knockout (Fig. 4D–H). 4. Discussion Although MV is the mainstay treatment for alleviating ARDS, it can induce an exaggerated inflammatory response that frequently exacerbates underlying pulmonary conditions [26]. This exacerbation or 164
Free Radical Biology and Medicine 147 (2020) 159–166
B. Wan, et al.
Fig. 4. GGPPS1 knockout suppressed the expression of TLR2/4 and its downstream proteins (MyD88, TRAF6, TAK1 and AP-1). (A–C) Relative expression levels of TLR2 and TLR4 in lung tissues in each group (WT: normal mouse without treatment; WT + MV: normal mouse with MV; GGPPS1(−/−)+MV: mouse knocked out GGPPS1 with MV). (D–H) Relative expression levels of MyD88, TRAF6, TAK1 and AP-1 of lung tissues in each group (n = 5 per group). Data are shown as mean ± SD. *P < 0.05, **P < 0.01. Supplementary Fig. S1 GGPPS1 expression of alveolar epithelial was significantly decreased in doxycycline-induced GGPPS KO(GGPPS−/−) mouse. The GGPPS knockout efficiency in overall lung tissue was about 50% in GGPPS(−/−) mice. A: GGPPS1 expression(red arrow) in lung tissue with IHC (400X); B: GGPPS1 expression of isolated alveolar epithelial cells with WB; C: GGPPS1 expression in lung tissue with WB； D:Gray score of WB. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
alleviated the symptoms of VILI. In addition, with the introduction of exogenous GGPP, an isoprenoid catalyzed by GGPPS1 from FPP, in GGPPS1−/− mice, lung damage and inflammation in response to MV was exacerbated, suggesting that GGPPS1 promotes aggravation of lung injury and inflammation by disrupting the balance of FPP and GGPP. Together, our results indicate that GGPPS1 plays a crucial role in promoting the development of VILI. TLRs are a type of pattern recognition receptors in the natural immune system that are associated with inflammation [33]. Activation of TLRs, including TLR2 and TLR4, often results in the massive release of inflammatory factors such as TNF-α, IL-1β and IL-6 [34]. Campolo et al. reported that TLR4 enhances the development of neuroinflammation by activating the transcription factor AP-1 [35]. Here, we investigated the role of TLR signaling in GGPPS1-enhanced VILI. Our data showed that in the VILI model, TLR2/4 expression was significantly up-regulated, which induced inflammation in the lung. We next detected the expression of downstream proteins of TLR2/4, including MyD88, TRAF6 and TAK1, as well as the transcription factor AP-1. Consistent with the expression of TLR2/4, the levels of MyD88, TRAF6, TAK1 and AP-1 were increased in lung tissue of the VILI model mice. These results suggest that the TLR2/4-MyD88-TRAF6-TAK1-AP-1 pathway is involved in MV-induced pulmonary inflammatory responses. However, the expression levels of TLR2/4, MyD88, TRAF6, TAK1 and AP-1 in lung tissue were suppressed upon deletion of GGPPS1, indicating that loss of GGPPS1 can suppress the pulmonary inflammation by triggering the TLR2/4-AP-1 signaling pathway. The phenomenon that needs to be pointed out is that downregulation of GGPPS1 reduced TLR4 of
GGPPS1 may be involved in the development of VILI. To explore this role of GGPPS1 and the underlying mechanisms, we generated a mouse model of VILI via MV. The expression of GGPPS1 in BALF was again found to be up-regulated in the VILI model compared with normal mice. In addition, GGPPS1 expression at both the mRNA and protein levels was weak in the lung tissue was of normal mice, but significantly increased in the VILI model. Together, these results showed that GGPPS1 is associated with MV-induced lung inflammation. Thus, GGPPS1 plays a role in the pathogenesis of VILI according to both clinical and mouse model data. We extended our studies of the potential role of GGPPS1 in VILI using GGPPS1−/− mice. Our results showed that depletion of GGPPS1 attenuated lung injury, protein exudation, lung inflammation and injury to type II alveolar epithelial cells. It is well known that overdistension of aerated lung regions induces abnormally large mechanical stretching of the epithelium, resulting in increased secretion of inflammatory cytokines and infiltration of a large number of inflammatory cells [31,32]. In the present study, we observed significant increases in the number of inflammatory cells, especially neutrophils, in both lung tissue and BALF, while GGPPS1 knockout mice exhibited reduced recruitment and generation of neutrophils. Moreover, the BALF concentrations of inflammatory cytokines including IL-6, IL-1β, IL-18 and TNF-α as well as the expression levels of these proteins in lung tissue were obviously increased in the VILI model, but GGPPS1 knockout was associated with significantly lower expression levels of these inflammatory cytokines. Thus, GGPPS1 knockout inhibited inflammatory cell recruitment and cytokine production and further 165
Free Radical Biology and Medicine 147 (2020) 159–166
B. Wan, et al.
membrane in A549 cells with LPS administration, but not with PBS administration in our previous study [21].There was no significant difference between WT control and KO control for the parameters on pathology and inflammatory factors in lung tissue. It is suggested that GGPPS1 knockout of alveolar epithelial does not cause significant differential expression of TLR4 and inflammatory cytokines in lung tissue under non-invasive condition. These phenomena indicate that the relationship between GGPPS1 and TLRs is complex in inflammation and injury, which may not be explained by the above-mentioned signal pathway alone. Much more research is needed to explore the relationship between GGPPS1 and TLRs. In conclusion, our study confirms that GGPPS1 knockout is a protective factor in VILI, the possible mechanism is due to inactivation of inflammatory cells resulting from disrupted TLR2/4-MyD88-TRAF6TAK1-AP-1 signaling. The present study revealed the important role of GGPPS1 in VILI, and thus, GGPPS1 may be a promising target for the development of a selective alternative strategy to alleviate the progression of VILI.
[8] [9] [10]
[11]
[12]
[13]
[14] [15] [16] [17]
[18]
Grants This work was supported by National Natural Science Foundation of China (grants nos.81770082), Natural Science Foundation of Jiangsu Province (grant nos. BK20191351), Jiangsu Planned Projects for Postdoctoral Research Funds (grant nos. 2019k178), Hunan Natural Science Foundation Youth Fund Project (grant nos. 2019JJ50021).
[19]
[20]
Author contributions
[21]
T.L. and Y.S. conceived and designed research; B.W.,W.X., M.C., J.J., P.Z., S.Z., Y.L. and S.S. performed experiments; B.W., drafted manuscript; B.W.,W.X., M.C., J.J., P.Z., S.Z., Y.L., S.S. T.L. and Y.S. approved final version of manuscript.
[22]
[23]
Declaration of competing interest No conflicts of interest, financial or otherwise, are declared by the authors.
[24]
Acknowledgments [25]
We thank Drs. Yunlei Zhang,Qiao Zhang, Panpan Liu and Xiuwei Zhang (Medical School of Nanjing University) for samples and technical support.
[26]
Appendix A. Supplementary data
[27]
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.freeradbiomed.2019.12.024.
[28]
References [29] [1] F. Alessandri, F. Pugliese, V.M. Ranieri, Mechanical ventilation: we have come a long way but still have a long road ahead, Lancet Respir Med 5 (12) (2017) 922–924. [2] Acute Respiratory Distress Syndrome Network, R.G. Brower, M.A. Matthay, A. Morris, D. Schoenfeld, B.T. Thompson, A. Wheeler, Ventilation with lower tidal volumes as compared with traditional tidal volumes for acute lung injury and the acute respiratory distress syndrome, N. Engl. J. Med. 342 (18) (2000) 1301–1308. [3] L.N. Tremblay, A.S. Slutsky, Ventilator-induced lung injury: from the bench to the bedside, Intensive Care Med. 32 (2006) 24–33. [4] C.C. Dos Santos, Y. Shan, A. Akram, A.S. Slutsky, J.J. Haitsma, Neuroimmune regulation of ventilator-induced lung injury, Am. J. Respir. Crit. Care Med. 183 (4) (2011) 471–482. [5] A.S. Slutsky, V.M. Ranieri, Ventilator-induced lung injury, N. Engl. J. Med. 369 (22) (2013) 2126–2136. [6] G.F. Curley, J.G. Laey, H. Zhang, A.S. Slutsky, Biotrauma and ventilator-induced lung injury, Chest 150 (2016) 1109–1117. [7] M. Unroe, J.M. Kahn, S.S. carson, J.A. Govert, T. Martinu, S.J. Sathy, A.S. clay, J. chia, A. Gray, J.A. Tulsky, cE. cox, One-year trajectories of care and resource utilization for
[30]
[31] [32] [33] [34] [35]
166
recipients of prolonged mechanical ventilation: a cohort study, Ann. Intern. Med. 153 (2010) 167–175. K.L. Hamlington, B.J. Smith, G.B. Allen, J.H. Bates, Predicting ventilator-induced lung injury using a lung injury cost function, J. Appl. Physiol. 121 (2016) 106–114. E. Fan, D.M. Needham, T.E. Stewart, Ventilatory management of acute lung injury and acute respiratory distress syndrome, J. Am. Med. Assoc. 294 (2005) 2889–2896. H. Huang, H. Feng, D. Zhuge, M1 macrophage activated by notch signal pathway contributed to ventilator-induced lung injury in chronic obstructive pulmonary disease model, J. Surg. Res. 244 (2019) 358–367. Y. Wang, C.F. Xu, Y.J. Liu, Y.F. Mao, Z. Lv, S.Y. Li, X.Y. Zhu, L. Jiang, Salidroside attenuates ventilation induced lung injury via SIRT1-dependent inhibition of NLRP3 inflammasome, Cell. Physiol. Biochem. 42 (2017) 34–43. V. Suryadevara, P. Fu, D.L. Ebenezer, E. Berdyshev, I.A. Bronova, L.S. Huang, A. Harijith, V. Natarajan, Sphingolipids in ventilator induced lung injury: role of sphingosine-1phosphate lyase, Int. J. Mol. Sci. 19 (2018), https://doi.org/10.3390/ijms19010114. T. Jaecklin, D. Engelberts, G. Otulakowski, H. O'Brodovich, M. Post, B.P. Kavanagh, Lungderived soluble mediators are pathogenic in ventilator-induced lung injury, Am. J. Physiol. Lung Cell Mol. Physiol. 300 (2011) 648–658. S. McTaggart, Isoprenylated proteins, Cell. Mol. Life Sci. 63 (2006). M. Takemoto, J.K. Liao, Pleiotropic effects of 3-hydroxy-3-methylglutaryl coenzyme a reductase inhibitors, Arterioscler. Thromb. Vasc. Biol. 21 (11) (2001) 1712–1719. J.K. Liao, U. Laufs, Pleiotropic effects of statins, Annu. Rev. Pharmacol. Toxicol. 45 (2005) 89–118. N. Xu, N. Shen, X. Wang, S. Jiang, B. Xue, C. Li, Protein prenylation and human diseases: a balance of protein farnesylation and geranylgeranylation, Sci. China Life Sci. 58 (4) (2015) 328–335. R. Zhu, J. Wang, T. Feng, X. Hu, C. Jiang, X. Wang, K. Li, Y. Sang, Y. Hua, H. Sun, B. Yao, C. Li, The alteration of RhoA geranylgeranylation and Ras farnesylation breaks the integrity of the blood-testis barrier and results in hypospermatogenesis, Cell Death Dis. 10 (2019) 450. S.S. Lai, X. Fu, Q. Cheng, Z.H. Yu, E.Z. Jiang, D.D. Zhao, D.C. Yu, Y.D. Qiu, X. Gao, H.X. Ju, W. Wang, Q. Jiang, M.S. Zhu, C.J. Li, B. Xue, HSC-specific knockdown of GGPPS alleviated CCl-induced chronic liver fibrosis through mediating RhoA/Rock pathway, Am J Transl Res 11 (2019) 2382–2392. M. Chen, B. Wan, S. Zhu, F. Zhang, J. Jin, X. Li, X. Wang, Y. Lv, C. Chen, T. Lv, Y. Song, Geranylgeranyl diphosphate synthase deficiency aggravates lung fibrosis in mice by modulating TGF-β1/BMP-4 signaling, Biol. Chem. (2019), https://doi.org/10.1515/hsz2019-0168. W.J. Xu, X.X. Wang, J.J. Jin, Q. Zou, L. Wu, T.F. Lv, B. Wan, P. Zhan, S.H. Zhu, H.B. Liu, N.W. Zhao, C.J. Li, Y. Song, Inhibition of GGPPS1 attenuated LPS-induced acute lung injury and was associated with NLRP3 inflammasome suppression, Am. J. Physiol. Lung Cell Mol. Physiol. 316 (2019) L567–L577. H. Zhang, S. Chen, M. Zeng, D. Lin, Y. Wang, X. Wen, C. Xu, L. Yang, X. Fan, Y. Gong, H. Zhang, X. Kong, Apelin-13 administration protects against LPS-induced acute lung injury by inhibiting NF-κB pathway and NLRP3 inflammasome activation, Cell. Physiol. Biochem. 49 (2018) 1918–1932. G. Matute-Bello, G. Downey, B.B. Moore, S.D. Groshong, M.A. Matthay, A.S. Slutsky, W.M. Kuebler, Acute Lung Injury in Animals Study Group. An official American Thoracic Society workshop report: features and measurements of experimental acute lung injury in animals, Am. J. Respir. Cell Mol. Biol. 44 (2011) 725–738. Winnie Yeo, L. Chan Stephen, K.F. Mo Frankie, M. Chu Cheuk, W.Y. Hui Joyce, H.M. Tong Joanne, W.H. Chan Anthony, Jane Koh, P. Hui Edwin, Loong Herbert, Kirsty Lee, Li Leung, Brigette Ma, Ka F. To, Simon C.H. Yu, Phase I/II study of temsirolimus for patients with unresectable Hepatocellular Carcinoma (HCC)- a correlative study to explore potential biomarkers for response, BMC Canc. 15 (2015) 395. A. Azim Hatem, A. Peccatori Fedro, Sylvain Brohée, Daniel Branstetter, Loi Sherene, Viale Giuseppe, Piccart Martine, C. Dougall William, Pruneri Giancarlo, Sotiriou Christos, RANK-ligand (RANKL) expression in young breast cancer patients and during pregnancy, Breast Cancer Res. 17 (2015) 24. S. Luh, C. Chiang, Acute lung injury/acute respiratory distress syndrome (ALI/ARDS): the mechanism, present strategies and future perspectives of therapies, J. Zhejiang Univ. - Sci. B 8 (1) (2007) 60–69. X. Wang, W. Xu, P. Zhan, T. Xu, J. Jin, Y. Miu, Z. Zhou, Q. Zhu, B. Wan, G. Xi, L. Ye, Y. Liu, J. Gao, H. Li, T. Lv, Y. Song, Overexpression of geranylgeranyl diphosphate synthase contributes to tumour metastasis and correlates with poor prognosis of lung adenocarcinoma, J. Cell Mol. Med. 22 (2018) 2177–2189. S. Jiang, D. Shen, W.J. Jia, X. Han, N. Shen, W. Tao, X. Gao, B. Xue, C.J. Li, GGPPSmediated Rab27A geranylgeranylation regulates β cell dysfunction during type 2 diabetes development by affecting insulin granule docked pool formation, J. Pathol. 238 (2016) 109–119. N. Shen, T. Gong, J.D. Wang, F.L. Meng, L. Qiao, R.L. Yang, B. Xue, F.Y. Pan, X.J. Zhou, H.Q. Chen, W. Ning, C.J. Li, Cigarette smoke-induced pulmonary inflammatory responses are mediated by EGR-1/GGPPS/MAPK signaling, Am. J. Pathol. 178 (2011) 110–118. W.J. Jia, S. Jiang, Q.L. Tang, D. Shen, B. Xue, W. Ning, C.J. Li, Geranylgeranyl diphosphate synthase modulates fetal lung branching morphogenesis possibly through controlling k-ras prenylation, Am. J. Pathol. 186 (2016) 1454–1465. K.J. Cavanaugh Jr., J. Oswari, S.S. Margulies, Role of stretch on tight junction structure in alveolar epithelial cells, Am. J. Respir. Cell Mol. Biol. 25 (5) (2001) 584–591. T.S. Cohen, K.J. Cavanaugh, S.S. Margulies, Frequency and peak stretch magnitude affect alveolar epithelial permeability, Eur. Respir. J. 32 (2008) 854–861. B.S. Park, J.O. Lee, Recognition of lipopolysaccharide pattern by TLR4 complexes, Exp. Mol. Med. 45 (2013) e66. P.P.C. Souza, U.H. Lerner, Finding a Toll on the route: the fate of osteoclast progenitors after toll-like receptor activation, Front. Immunol. 10 (2019) 1663–1674. M. Campolo, I. Paterniti, R. Siracusa, A. Filippone, E. Esposito, S. Cuzzocrea, TLR4 absence reduces neuroinflammation and inflammasome activation in Parkinson's diseases in vivo model, Brain Behav. Immun. 76 (2019) 236–247.