Gestation-related gene expression and protein localization in endometrial tissue of Suffolk and Cheviot ewes at gestation Day 19, after transfer of Suffolk or Cheviot embryos

Theriogenology 86 (2016) 1557–1565

Contents lists available at ScienceDirect

Theriogenology journal homepage: www.theriojournal.com

Gestation-related gene expression and protein localization in endometrial tissue of Suffolk and Cheviot ewes at gestation Day 19, after transfer of Suffolk or Cheviot embryos M. Sequeira a, S.J. Pain b, V. de Brun a, A. Meikle a, *, P.R. Kenyon b, H.T. Blair b a b

Laboratory of Nuclear Techniques, Veterinary Faculty, University of the Republic of Uruguay, Montevideo, Uruguay International Sheep Research Centre, Massey University, Palmerston North, New Zealand

a r t i c l e i n f o

a b s t r a c t

Article history: Received 19 November 2015 Received in revised form 16 May 2016 Accepted 17 May 2016

The objective of this study was to investigate the gene expression of progesterone and estrogen receptor a (PR, ERa), insulin-like growth factor (IGF) 1, IGF-2, their receptor (IGFR1), IGF-binding proteins (BP) 1 to 6, insulin receptor, adiponectin receptors (AdipoR1/2), cyclooxygenase 2 (PTGS2), mucin 1 and to localize PR, ERa, IGF-1, IGFR1, PTGS2, and proliferating cellular nuclear antigen (PCNA) in the endometrium of pregnant (Day 19) Suffolk and Cheviot ewes carrying Suffolk and Cheviot embryos transferred within and reciprocally between breeds. Gene expression was determined by real-time quantitative polymerase chain reaction (RT-qPCR), and antigen determination was measured by immunohistochemistry in the luminal epithelium (LE), superficial and deep glands (SG, DG, respectively) and superficial and deep stroma. Gene expression of PR, IGF-1, IGFBP2, and IGFBP5 was higher in Suffolk than that in Cheviot ewes (P < 0.05). Greater abundance of IGF-2 and IGBP3 expression was found in Cheviot ewes carrying Cheviot embryos than Cheviot ewes carrying Suffolk embryos (P < 0.05). No staining for PR and ERa was observed in the LE, very scarce staining in SG and DG, whereas positive staining was observed in both superficial and deep stroma. No differences were found for PR staining, but Cheviot ewes had higher ERa staining intensity than Suffolk ewes (P < 0.05). Positive staining for IGF-1 was observed in all cell types except DG, and staining of IGFR1 was observed in all cell types. No differences among groups in staining were found for IGF-1 or IGFR1 in any cell type. Positive staining of PTGS2 was observed in LE and SG in all groups. An interaction between ewe and embryo breed affected PTGS2 staining (P < 0.05), whereby Cheviot ewes carrying Suffolk embryos had a lower PTGS2 staining than Suffolk ewes carrying Suffolk embryos. Positive staining of PCNA was found in LE and SG. Suffolk ewes carrying Suffolk embryos showed lower PCNA immunostaining than Cheviot ewes carrying Suffolk embryos (P < 0.05), whereas no differences were observed in ewes carrying Cheviot embryos. This study showed that gestation-related protein expression in the endometrium of Suffolk and Cheviot ewes is affected by both ewe and embryo breed at Day 19 of pregnancy. Ó 2016 Elsevier Inc. All rights reserved.

Keywords: Embryo growth Endometrium Gene expression Growth factors Sheep

1. Introduction

* Corresponding author. Tel.: þ538 26223106; fax: þ598 26223106. E-mail address: [email protected] (A. Meikle). 0093-691X/$ – see front matter Ó 2016 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.theriogenology.2016.05.015

Successful embryo growth requires synchronized molecular and cellular signaling that leads to an appropriate conceptus-ewe communication [1]. The maternal uterine

1558

M. Sequeira et al. / Theriogenology 86 (2016) 1557–1565

environment can regulate embryo growth very early in gestation, even when uterine capacity is not a limiting factor [2]. Progesterone (P4), the pregnancy hormone, action on the uterus depends on the presence and quantity of its nuclear receptor (progesterone receptor, PR; [3]). During early pregnancy, the embryo is dependent on the histotroph, which includes IGF-1 and IGF-2 that simulate embryo and endometrial development [4,5]. Growth factors act with high affinity via their specific receptor (insulin-like growth factor receptor; IGFR1) and their bioavailability is regulated by IGF binding proteins (BPs) [4].In addition, prostaglandins derived from the cyclooxygenase-2 enzyme (PTGS2) regulate conceptus elongation and implantation via effects on the endometrium and/or conceptus [6]. Moreover, adiponectin (AdipoQ) from a paracrine and/or an endocrine source may play an important role in embryo development [7] via its receptors, AdipoR1/2, because their expression is increased during the window of implantation [8].In addition, mucin-1 (MUC-1) expression has been reported to determine future embryo implantation, as is an antiadhesive component of the luminal epithelium, limiting trophectoderm accessibility [9]. Finally, proliferating cellular nuclear antigen (PCNA) provides a marker of the balance between cell proliferation and death, which is crucial for embryo implantation [10]. Thus, the aim of this study was to investigate endometrial gene expression of PR, estrogen receptor alpha (ERa), insulin receptor (INSR), IGF-1, IGF-2, IGF1R, IGFBPs, AdipoR1/2, MUC-1, and PTGS2 in pregnant (Day 19) Suffolk and Cheviot ewes carrying Suffolk and Cheviot embryos transferred within and reciprocally between breeds. Protein immunostaining of PR, ERa, IGF-1, IGF1R, PTGS2, and PCNA was also performed to describe protein distribution within the endometrium. 2. Materials and methods This experiment was approved by the Massey University Animal Ethics Committee. The animals used in this study were maintained under commercial pastoral farming conditions at Massey University Keeble Farm, Palmerston North, New Zealand. 2.1. Experimental design and animals Cheviot (C) and Suffolk (S) sheep breeds were used to provide different genotypes according to their mature body size, consistent with previously established protocols for modifying the uterine environment [2,11]. All donors ewes were 4 years of age (nine Suffolk and 13 Cheviot ewes were used), the recipient ewes (58 Suffolk and 52 Cheviot) were of mixed ages (3- to 6-year old) and parities (all multiparous). Pure breed embryos were transferred using standard commercial embryo transfer procedures within and reciprocally between breeds of sheep to create four treatment groups: SinS (Suffolk embryo in Suffolk ewe–large genotype control), SinC (Suffolk embryo in Cheviot ewe–large genotype embryo in small ewe genotype), CinS (Cheviot embryo in Suffolk ewe–small genotype embryo in large ewe genotype), and CinC (Cheviot embryo in Cheviot ewe– small genotype control). On Day 19 of gestation, recipient ewes (n ¼ 9 per treatment group) were sacrificed, and

endometrial samples from the middle third of the uterine horn ipsilateral to CL were fixed in 4% paraformaldehyde and embedded in paraffin for immunohistochemical investigation. Other sections were snap frozen in liquid N2 and stored at 80  C for polymerase chain reaction (PCR) analysis. Day 19 of gestation was chosen because it allowed us to select ewes that maintained pregnancy after embryo transfer and did not return to estrous, and it was also the desired stage for research on uterine functionality (e.g., after maternal recognition of pregnancy but before complete implantation). 2.2. RNA isolation, reverse transcription, and quantitative real-time PCR Total RNA from endometrium tissue collected from Suffolk and Cheviot ewes was extracted using Trizol (Invitrogen, Carlsbad, CA, USA) followed by precipitation with lithium chloride and DNase-treatment with DNAFreeTM 180 Kit (Ambion, Austin, TX, USA). Concentration of RNA was determined by measuring absorbance at 260 nm, the purity of all RNA isolates was assessed from 260 to 280 absorbance ratio and the integrity by electrophoresis (1% agarose gel). For each sample, complementary DNA (cDNA) was synthesized by reverse transcription using the SuperScript III transcriptase (Invitrogen) with oligo-dT primers, and 1 mg total RNA added as a template. Sequences and the expected product lengths of primers to amplify cDNA of the target genes PR, ERa, IGF-1, IGF-2, IGFBP 1 to 6, IGFR1, Adipor1/R2, INSR, PTGS2, MUC-1 and of the endogenous controls, hypoxanthine guanine phosphoribosyl-transferase (HPRT), ribosomal protein L19 (RPL19), and b-actin are presented in Table 1. Real-time PCR reactions were performed using 7.5 mL SYBER Green master-mix (Quantimix EASY SYG kit, Biotools B&M Labs, Madrid, Spain), equimolar amounts of forward and reverse primers (200 nM, Operon Biotechnologies GmbH, Cologne, Germany), and 3 mL diluted cDNA (1:7.5 in RNase/DNase free water) in a final volume of 15 mL. Samples were analyzed in duplicate in a 72-disk Rotor-GeneTM 197 6000 (Corbett Life Sciences, Sydney, Australia). Standard amplification conditions were 3 minutes at 95  C and 40 cycles of 15 seconds at 95  C, 40 seconds at 60  C, and 10 seconds at 72  C. At the end of each run, dissociation curves were analyzed to ensure that the desired amplicon was being detected and to discard contaminating DNA or primer dimers. Samples of cDNA from eight ewes (two from each group) were pooled to provide an exogenous control, and five dilutions (from 100 to 6.25 ng/tube) of this pool were used to perform linear regressions for each gene. The efficiency (E) of the assays was calculated according to the formula E¼ (101/slope 2061; Table 1) [19]. Gene expression was measured by relative quantification [20] to the exogenous control and normalized to the geometric mean expression of the endogenous control genes (HPRT and RPL19), taking into account the respective efficiencies [20]. 2.3. Immunohistochemistry Immunoreactivity of the proteins of interest was visualized in transverse 5-mm sections from uterine tissue

M. Sequeira et al. / Theriogenology 86 (2016) 1557–1565

1559

Table 1 Primer sequences, expected amplicon sizes, and efficiency of the quantitative polymerase chain reaction progesterone receptor (PR), estrogen receptor alpha (ERa), insulin-like growth factor 1 and 2 (IGF-1, IGF-2), IGF receptor 1 (IGFR1), insulin receptor (INSR), insulin-like growth factor binding proteins 1 to 6 (IGFBP1–6), adiponectin receptors 1 and 2 (AdipoR1, AdipoR2), cyclooxygenase 2 (PTGS2), mucin 1 (MUC-1), ribosomal protein L19 (RPL19), hypoxanthine guanine phosphoribosyl-transferase (HPRT), and beta actin (b-actin). Gene

Accession number

Primer sequences

PR

Z66555

ERa

AYO33393

IGF1

NM_001009774.3

IGF1R

NM_001244612.1

IGF2

NM_001009311.1

IGFBP1

NM_174554.3

IGFBP2

NM_174555.1

IGFBP3

AF305199.1

IGFBP4

S77394.1

IGFBP5

NM_001129733.1

IGFBP6

AY197339

ADIPOR1

NM_001034055.1

ADIPOR2

NM_001040499.2

INSR

XM_004008038.1

PTGS2

X9233D04/5

MUC-1

XM_012107297.1

RPL19

NM_001040516.1

HPRT

XM_580802

b-actin

U08283

F: GACAGCACTTTCTAGGCGATAT R: TGTGCTGGAAGAAACGATTGC F: AGGGAAGCTCCTATTTGCTCC R: CGGTGGATGTGGTCCTTCTCT F: TTGCACTTCAGAAGCAATGG R: ACTGGAGAGCATCCACCAAC F: GACCATCAAAGCTGGGAAAA R: TTATGTCCCCTTTGCTCTGG F: ACCCTCCAGTTTGTCTGTGG R: GGGGTATGCTGTGAAGTCGT F: TCAAGAAGTGGAAGGAGCCCT R: AATCCATTCTTGTTGCAGTTT F: ATGCGCCTTCCGGATGA R: GTTGTACAGGCCATGCTTGTCA F: AGCACAGACACCCAGAACTTCT R: TTCAGCGTGTCTCCATTTCC F: ATGTGCCTGATGGAGAAAGG R: AAGGCAGAGCCACAGACAGT F: GGTTTGCCTGAACGAAAAGA R: CTGGGTCAGCTTCTTTCTGC F: GGAGAGAATCCCAAGGAGAGTAA R: GAGTGGTAGAGGTCCCCGAGT F: GGCTCTACTACTCTTTCTAC R: ACACCCCTGCTCTTGTCTG F: GGCAACATCTGGACACATC R: CTGGAGACCCCTTCTGAG F: TGGCTCCTACAGCTGGACAGT R: TCAGCACCCAGGATGGTT F: CCAGGGCACAAATCTGATGTT R: TGGTCCTCGTTCAAAATCTGTCT F: ATGCCCAGTTTCCTTCCTCT R: TGTCCAGCTGCTCACATTTC F: CCCCAATGAGACCAATGAAATC R: CAGCCCATCTTTGATCAGCTT F: TGGAGAAGGTGTTTATTCCTCATG R: CACAGAGGGCCACAATGTGA F: CGAGCACGATGAAGATC R: CCTCCGATCCACACCGAGTA

Length, (pb)

Efficiency

References

79

1.10

Sosa et al., 2009 [12]

234

1.15

Sosa et al., 2009 [12]

209

0.99

de Brun et al., 2015 [13]

116

1.01

de Brun et al., 2015 [13]

210

1.05

de Brun et al., 2015 [13]

127

1.15

Fenwick et al., 2008 [14]

74

1.11

Astessiano et al., 2012 [15]

86

1.11

Wu et al., 2004 [16]

98

0.49

de Brun et al., 2015 [13]

193

1.04

de Brun et al., 2015 [13]

100

0.69

Fenwick et al., 2008 [14]

154

1.20

de Brun et al., 2015 [13]

203

1.15

de Brun et al., 2015 [13]

86

1.16

de Brun et al., 2015 [13]

82

0.80

Sosa et al., 2009 [12]

159

1.01

This paper

119

1.20

Chen et al., 2006 [17]

105

0.84

Carriquiry et al., 2009 [18]

64

1.03

Chen et al., 2006 [17]

Abbreviations: F, forward; R, reverse.

ipsilateral to the CL using an adivin-biotin-peroxidase immunohistochemical technique [21]. Tissue sections were dewaxed and rehydrated in decreasing concentrations of ethanol. The sections were then placed in sodium citrate 0.01 M (pH 6.0) and microwaved for 4.5 minutes to improve antigen exposure. The remainder of the procedure was performed at room temperature. After washing with PBS (0.01 M, pH 7.5), the nonspecific activity of endogenous peroxidases was blocked with hydrogen peroxide 3% in methanol for 10 minutes. After washing with PBS for 10 minutes, the samples were incubated with normal horse serum (Vector laboratories, Burlingame, CA, USA) for 60 minutes in a humid chamber. They were then incubated for 1 hour with the primary antibody, mouse monoclonal anti-ERa (Santa Cruz, Los Angeles, CA, USA), anti-PCNA (Santa Cruz Biotechnology), anti-PR (Zymed, San Francisco south, CA, USA), goat polyclonal anti-IGF-1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), rabbit polyclonal antiIGF-1R (Abcam, England, United Kingdom) and anti-PTGS2 (Cayman Chemical Company, MI, USA) diluted 1:25, 1:75, 1:100, 1:50, 1:100, and 1:200 in PBS, respectively. The

negative controls were generated by replacing the primary antibody with a homologous nonimmune immunoglobulin G (IgG) at an equivalent concentration (Santa Cruz). After primary antibody binding, sections were incubated with a biotinylated secondary antibody (Vector laboratories, Burlingame, CA, USA) anti-mouse, (ERa, PCNA, and PR), antigoat (IGF-1) or anti-rabbit IgG (IGFR1, PTGS2) diluted 1:200 in normal horse or goat serum. The Vectastain ABC kit (Vector Laboratories) was used for protein detection. The location of the bound enzyme was visualized by 3, 3-diaminobenzidine in H2O2 (DAB kit; Vector Laboratories), and then sections were counterstained with hematoxylin and dehydrated before they were mounted. 2.4. Image analysis Receptor staining intensity was evaluated immunohistochemically in five endometrial compartments; the luminal epithelium (LE), glandular epithelium (arbitrarily divided in two portions; the superficial glandular (SG) epithelium next to the uterine lumen, and the deep

1560

M. Sequeira et al. / Theriogenology 86 (2016) 1557–1565

glandular (DG) epithelium next to the myometrium), and the intercaruncular stroma (also divided into superficial [SS] and deep [DS] regions using the same criteria as that used to divide the glandular epithelium). The amount of immunoreactive protein in the different cell types was estimated subjectively by two independent observers who were blinded to the treatment groups. Ten fields were analyzed for each cell type at a magnification of  1000 for all ewes. The staining of the nuclei was scored as negative (), faint (þ), moderate (þþ), or intense (þþþ), and the extent of staining of each cell type was expressed over a scale of 0 to 10 [22], where 0 is the absence of staining and 10 is the maximum staining intensity. The average staining intensity was calculated as (1  n1) þ (2  n2) þ (3  n3), where n is the number of cells in each field exhibiting faint (n1), moderate (n2), and intense (n3) staining [23]. 2.5. Statistical analysis For PCR, all variables were subjected to analysis of variance using a mixed procedure, SAS (SAS Institute, Cary, NC, USA) that included in the model, embryo breed (Cheviot vs. Suffolk), ewe breed (Cheviot vs. Suffolk) and their interaction as fixed effects, and PCR plate as a random effect. The average staining intensity of the 10 fields was subjected to an analysis of variance using a mixed procedure in the statistical program SAS, including in the statistical model ewe breed, embryo breed, cell types (luminal epithelium, superficial and deep glandular epithelium, and superficial and deep stroma), and their interactions as fixed effects. Tukey–Kramer tests were conducted to analyze differences between fixed effects and their interaction. Pearson correlation coefficients were used to describe relationships between variables. Data are presented as least square means  pooled standard errors. The level of significance was considered to be P < 0.05. 3. Results 3.1. Endometrial gene expression Progesterone receptor (PR) expression was affected by ewe breed, with Suffolk ewes having greater abundance expression than Cheviot ewes (0.66  0.38 vs. 0.39  0.29, P ¼ 0.04, Fig. 1). Embryo breed did not affect PR gene expression, and no interaction was found. A similar pattern was also found for IGF-1, IGFBP2, and IGFBP5 with gene expression being higher in Suffolk ewes (1.23  0.23 vs. 0.62  0.29, P < 0.05; 1.04  0.29 vs. 0.57  0.33, P < 0.05; and 0.77  0.21 vs. 0.41  0.24, P < 0.05, respectively), without other significant effects. An interaction was observed for IGF2 (P < 0.05; Fig. 1B), whereby Cheviot ewes carrying Cheviot embryos had higher IGF2 messenger RNA (mRNA) expression than Cheviot ewes carrying Suffolk embryos, whereas no differences were found among Suffolk ewes. Differences of Tukey–Kramer tests showed that Cheviot ewes carrying Cheviot embryos had greater IGFBP3, abundance than Cheviot ewes carrying Suffolk embryos (P < 0.05; Fig. 1D). No differences were found for IGFR1 mRNA expression (Fig. 1F). Expression of PTGS2 was higher in Cheviot ewes

carrying Cheviot embryos than Suffolk ewes carrying Suffolk embryos (P < 0.05, Fig. 1H). There were no differences among groups observed for ERa, INSR, IGFBP1, IGFBP4, IGFBP6, AdipoR1, AdipoR2, and MUC-1 (Table 2). 3.2. Immunohistochemistry Progesterone receptor, ERa, and PCNA were localized in the nuclei of the endometrial cells, whereas PTGS2, IGF-1, and IGFR1 were observed in the cytoplasm of the cells (Fig. 2). When specific antibodies were substituted with a nonimmune IgG, the absence of staining confirmed a high specificity of immunostaining. No staining for PR and ERa was observed in LE, and very scarce staining was observed in superficial and deep glands (SG and DG), whereas positive staining was observed in both the superficial and deep stroma (SS and DS). Estrogen receptor a was affected by ewe breed, as Cheviot ewes had more staining than Suffolk ewes (0.70  0.11 vs. 0.33  0.13, P < 0.05, Table 3); no other effects for ERa were found. No positive staining for IGF-1 was observed in DG, and the staining in LE and both SS and DS was at least two- to three-fold staining than in SG (P < 0.05, Table 3). Staining of IGFR1 was observed in all cell types, but it was more noticeable in SG, DG, and LE (P < 0.05, Table 3). No other differences for IGFR1 were found. Positive staining of PTGS2 was observed in LE and SG in all groups. Suffolk ewes carrying Cheviot embryos also showed PTGS2 staining in SS, whereas this was not observed in the other groups (data not shown). An interaction between ewe and embryo breed affected PTGS2 immunostaining (P < 0.05), as Cheviot ewes carrying Suffolk embryos had lower PTGS2 immunostaining in LE than Suffolk ewes carrying Suffolk embryos (P < 0.05), and no differences for PTGS2 were found for ewes carrying Cheviot embryos. Positive staining of PCNA was found in LE and SG, whereas it was weak in the DG, DS, and SS. Proliferating cellular nuclear antigen staining was affected by an interaction between embryo and ewe breed (P < 0.05, Table 3), as Suffolk ewes carrying Suffolk embryos showed lower PCNA immunostaining in SG than Cheviot ewes carrying Suffolk embryos (P < 0.05), whereas no differences were observed in ewes carrying Cheviot embryos. 4. Discussion To the best of our knowledge, this is the first report on endometrial gene and protein expression in different breeds of pregnant ewes when embryos are transferred within and reciprocally between breeds. Suffolk ewes had a higher endometrial PR gene expression than Cheviot ewes, and in a previous study, Suffolk ewes presented lower plasma P4 concentrations than Cheviot ewes from Days 6 to 21 of gestation [24]. However, circulating P4 concentrations may not reflect actual P4 concentrations in the uterus [25]. Indeed, receptors concentrate the hormone in the tissue [3]; thus Suffolk ewes may have had higher P4 retention in uterine tissue due to higher PR concentrations (e.g., higher PR mRNA). Higher P4

M. Sequeira et al. / Theriogenology 86 (2016) 1557–1565

2,0 2.0

A

2,0 2.0

Cheviot Embryo

1561

B a

Suffolk Embryo

a

1,0 1.0

ab

IGF-2

PR

a ab

1,0 1.0

b

b 0.0 0,0

0.0 0,0 2,0 2.0

ab

2,0 2.0

C

a

D

b

1.0 1,0

IGFBP3

IGF-1

ab b

ab

ab

b

0.0 0,0

0.0 0,0 2,0 2.0

a

1.0 1,0

E

F

2,0 2.0

ab ab

1.0 1,0

IGF1R

IGFBP2

a

b

0.0 0,0

0.0 0,0 2,0 2.0

G

H a ab

1,0 1.0

b

b

PTGS2

IGFBP5

2,0 2.0

1,0 1.0

1,0 1.0

a ab

ab b

0.0 0,0

0,0 0.0

Cheviot Dam

Suffolk Dam

Cheviot Dam

Suffolk Dam

Fig. 1. Relative endometrial messenger RNA expression values for PR (A), IGF-2 (B), IGF-1 (C), IGFBP3 (D), IGFBP2 (E), IGFR1(F), IGFBP5 (G), and PTGS2(H) in Cheviot and Suffolk ewes carrying Suffolk or Cheviot embryos. Different superscripts indicate significant differences (P < 0.05). IGF-1, IGF-2, insulin-like growth factor 1 and 2; IGF1R, IGF 1 receptor; IGFBP-2, 3 and 5, insulin-like growth factor binding proteins 2, 3, and 5; PTGS2, cyclooxygenase 2; MUC-1, mucin 1; PR, progesterone receptor.

endometrial concentrations due to greater content of PR have been reported previously [25–27]. The expression of PR mRNA in the uterus was consistent with IGF-1 mRNA expression because it was also higher in Suffolk ewes, and IGF-1 endometrial expression is regulated by P4 on the uterine endometrium [28]. Data are consistent with embryo in vitro studies that have shown higher pregnancy rates when treated with IGF-1 at the

blastocyst stage [29]. Moreover, pregnant cows presented higher IGF-1 mRNA endometrial expression than cows that were found to be nonpregnant at Day 17 [30]. In addition, both IGFBP2 and IGFBP5 endometrial expression were also higher in Suffolk ewes. The greatest abundance of IGFBP2 is seen during late preimplantation [31] and implies a role for IGFBP2 in implantation events, whereas it is known that IGFBP5 stimulates IGF-1 action [32].

1562

M. Sequeira et al. / Theriogenology 86 (2016) 1557–1565

Table 2 Endometrial gene expression at Day 19 of pregnancy in Cheviot ewes carrying Cheviot and Suffolk embryos (CinC and SinC, respectively) and Suffolk ewes carrying Cheviot and Suffolk embryos (CinS and SinS, respectively). Gene

ERa INSR IGFBP1 IGFBP4 IGFBP6 AdipoR1 AdipoR2 MUC-1

Group CinC

SinC

SinS

CinS

SEM

0.44 0.71 0.06 0.64 0.99 0.15 0.78 0.04

0.35 0.64 0.07 0.67 0.76 0.11 0.58 0.05

0.40 0.82 0.05 0.99 1.23 0.18 0.56 0.07

0.53 0.81 0.05 0.75 1.04 0.17 0.67 0.04

0.13 0.13 0.02 0.18 0.15 0.05 0.08 0.01

No significant differences (P < 0.05) between Suffolk and Cheviot ewes carrying Suffolk or Cheviot embryos were found. Presented data are means and pooled standard error of the mean (SEM). Abbreviations: AdipoR1 and 2, adiponectin receptor 1 and 2; ERa, estrogen receptor alpha; IGFBP1, 4 and 6, insulin-like growth factor binding proteins 1, 4, and 6; INSR, insulin receptor; MUC-1, mucin 1.

Cheviot ewes carrying Suffolk embryos presented lower expression of IGF-2 and IGFBP3 than Cheviot ewes carrying Cheviot embryos, whereas no differences were observed in Suffolk ewes. Geisert et al. [33] reported increases in IGF-2 mRNA expression in bovine endometrium on Days 15 to 18 of pregnancy, which in turn stimulated embryonic growth and production of IFN-t [4]. Moreover, Geisert et al. [33] suggested that IGF-2 expression was regulated by the conceptus. In agreement with the latter hypothesis, Cheviot ewes carrying Suffolk embryos had a lower IGF-2 mRNA expression, suggesting that very early in gestation, the Suffolk embryo differentially regulates endometrial expression of IGF-2 according to ewe breed (e.g., Suffolk ewes carrying Suffolk embryos had a higher IGF-2 mRNA expression) and/or that the uterine environment senses a different breed embryo. The IGFBP3 mRNA expression reflected that of IGFBP2, and in endometrial stromal cells, it has been suggested that IGFBP3 is more responsive to embryonic signals [34] indicating that it may be important in early implantation. Again, IGFBP3 was lower in Cheviot ewes carrying Suffolk embryos, which may account for the reduced embryo growth of Suffolk embryos from Cheviot ewes observed by Sharma et al. [2]. The expression of IGFBP1, IGFBP4, and IGFBP6 was not affected by ewe or embryo breed; IGFBP1 is believed to play an important role during the period of maternal recognition of pregnancy because its expression increases in the luminal epithelium from Days 12 to 16 of the estrus cycle and is higher in pregnancy on Day 16 [32]. As this study reports findings only from Day 19 of pregnancy, it could be postulated that the transitory increase of this IGFBP1 has already occurred. No staining for PR and ERa was observed in the luminal epithelium and very low staining was observed in the superficial and deep glands. This downregulation has been shown in previous reports [35] and appears to be a prerequisite for uterine receptivity to implantation [35,36]. The loss of PR expression in the luminal epithelium is directly related to the loss of antiadhesive proteins such as MUC-1 that inhibit blastocyst implantation [36]. No differences were observed in MUC-1 mRNA expression,

which is consistent with the phase of mother and/or embryo interaction at Day 19 of gestation (e.g., adhesion has already occurred; [35]). A higher ERa immunostaining was observed in the stroma of Cheviot ewes, and we have no obvious explanation for this finding. As previously discussed, mRNA expression in Suffolk endometrium suggested a better environment for embryo development, and ERa has been considered a luteolytic factor [35]. Moreover, overexpression of ERa has been shown to result in a higher number of apoptotic cells in the endometrial epithelium and a decreased number of implantation sites in women [37]. Precise regulation of endometrial proliferation is critical for the establishment of endometrial receptivity for embryo implantation. Higher PCNA staining was seen in Cheviot ewes carrying Suffolk embryos compared to Suffolk ewes carrying Suffolk embryos, whereas no differences were observed in ewes carrying Cheviot embryos. This may reflect an increased proliferation rate which would likely result in further uncoupling of endometrial and embryo development as has been previously postulated [38], as PCNA expression was elevated in the endometrium of rodents whose embryos had not reached maturity or successfully implantation [38]. This PCNA data are consistent with embryo size data reported by Sharma et al. [2] and here, Suffolk embryos in Cheviot dams were smaller than Suffolk embryos in Suffolk ewes. No effect of ewe or embryo breed was found in IGFR1 or IGF1 immunostaining. IGF1R was highly expressed in glandular and luminal epithelium, as reported before [32]. Although IGF-1 mRNA is mainly localized in the stroma underlying the luminal epithelium [32], the present study showed IGF-1 localization in the luminal epithelium, consistent with IGFR1 expression and its proposed action of stimulating the proliferation and/or differentiation of the luminal epithelium and/or embryo [32]. Moreover, taking into account that in the present study, PR was localized in stromal cells, where IGF-1 mRNA is mainly synthesized [32] and that both PR and IGF-1 expression were higher in Suffolk ewes, data suggest that the functionality of the epithelium is mediated by a P4-PR mechanism in the underlying stroma that acts on the epithelial cells, as has been demonstrated previously [39]. This idea is reinforced by the greater content of IGFR1 observed in the luminal and glandular epithelium. Indeed, uterine responses to embryo signals that result in successful implantation will be the combined product of responses from all the various cells types in the uterus. Differential expression may lead to distinct differential embryo growth. Cyclooxygenase 2 immunostaining was observed in the luminal epithelium and superficial glandular epithelium, which is consistent with previous reports in ruminants [14]. Cheviot ewes carrying Suffolk embryos had a lower PTGS2 staining in the LE than Suffolk ewes carrying Suffolk embryos. Moreover, Suffolk ewes carrying Cheviot embryos showed PTGS2 positive immunostaining in the superficial stroma that was not observed in the other groups. Prostaglandins are believed to be involved in the adhesion of the ovine trophoblast to the endometrium and are necessary for increased vascular permeability at the site of implantation [40]. The lower PTGS2 staining in the LE of Cheviot

M. Sequeira et al. / Theriogenology 86 (2016) 1557–1565

1563

Fig. 2. Examples of immunohistochemical localization of (A) progesterone receptor (PR) and negative control; (B) estrogen receptor alpha (ERa); (C) insulin-like growth factor 1 (IGF-1); (D) IGF receptor type 1 (IGFR1); (E) cyclooxygenase 2 (PTGS2); (F) proliferating cellular nuclear antigen (PCNA) on Day 19 of gestation. The negative showed no staining because specific antibodies were substituted with a nonimmune immunoglobulin G (A). No staining for PR and ERa (A, B) was observed in the luminal epithelium (LE), very scarce staining in superficial and deep glands (SG and DG), whereas positive staining was observed in both the superficial and deep stroma (SS and DS). Strong IGF-1 staining was observed in LE, SS, and DS, weak staining was observed in SG, and no positive staining was observed in DG (C). Staining of IGFR1 was observed in all cell types (D). Positive staining of PTGS2 was observed only in LE and SG (E). Positive staining of PCNA was observed mainly in LE and SG (E).

ewes carrying Suffolk embryos (when compared to Suffolk ewes carrying Suffolk embryos) is consistent with the diminished growth of Suffolk embryos from Cheviot ewes as reported by Sharma et al. [2].In addition, it has been suggested that AdipoQ signaling may play an important role in uterine receptivity and decidualization through the PTGS2 pathway in other tissues [41]. AdipoQ receptor mRNA expression was not affected by ewe or embryo breed. To the best of our knowledge, this is the first report on AdipoR1 and AdipoR2 mRNA expression during early pregnancy in sheep. Unfortunately, no cycling ewes were included in this experiment to address the role of this

hormone in implantation, but it has been suggested that AdipoQ plays an important role in embryo development during preimplantation and implantation in other species [8,9]. In support of findings reported by Sharma et al. [2] that embryos developed in Suffolk ewes were of greater size than those developed in Cheviot ewes, data related to PR and members of the IGF family are consistent with an endometrial environment that may provide increased stimulation of embryo growth, elongation, and implantation in Suffolk ewes (higher PR, IGF1, IGFBP2, and IGFBP5). In addition, the IGF system influences uterine histotroph composition

1564

M. Sequeira et al. / Theriogenology 86 (2016) 1557–1565

Table 3 Staining intensity of progesterone receptor (PR), estrogen receptor alpha (ERa), insulin like growth factor 1 (IGF-1), IGF receptor type 1 (IGFR1), cyclooxigenase 2 (PTGS2), and proliferating cellular nuclear antigen (PCNA) in superficial and deep intercaruncular stroma (SS and DS), luminal epithelium (LE) and superficial glands (SG) on Day 19 of pregnancy from Cheviot ewes carrying Cheviot and Suffolk embryos (CinC and SinC, respectively) and Suffolk ewes carrying Cheviot and Suffolk embryos (CinS and SinS, respectively). Protein

PR ERa IGF-1

IGFR1

PTGS2 PCNA

Cell type

SS DS SS DS LE SS DS SG LE SS DS SG DG LE SG LE SG

Group CinC

SinC

CinS

SinS

0.73 0.76 0.55 0.86 1.12 1.15 1.14 0.41 1.02 0.92 0.81 1.41 1.24 1.14ab 1.04 1.44 1.12ab

0.93 0.93 0.53 0.86 1.39 1.34 1.17 0.55 0.90 0.87 0.53 1.46 1.14 0.89b 0.78 1.39 1.40b

0.90 0.49 0.15 0.31 1.24 1.14 1.14 0.39 1.29 0.67 0.80 1.19 1.22 1.17ab 0.86 1.53 1.67b

0.80 0.81 0.50 0.40 1.05 0.93 1.01 0.36 0.95 0.74 0.71 1.37 0.88 1.60a 0.88 1.25 0.63a

SEM

Embryo

Ewe

Embryo  Ewe

0.08 0.08 0.13 0.12 0.14 0.15 0.16 0.17 0.14 0.14 0.14 0.14 0.14 0.13 0.12 0.16 0.16

NS

NS

NS

NS

0.04

NS

NS

NS

NS

NS

NS

NS

NS

NS

0.01

NS

NS

0.04

Different superscripts indicate significant differences (P < 0.05). Fixed effects were the embryo and ewe breed, cell type and interactions. In all cases, cell type was significant. Presented data are means and pooled standard error of the mean (SEM).

during the preimplantation period of conceptus development [4], and the lower IGF-2 and IGFBP3 expression found in Cheviot ewes carrying Suffolk embryos may support observations by Sharma et al. [2] that Suffolk embryos transferred to Cheviot ewes were smaller than both Suffolk embryos transferred to Suffolk ewes and Cheviot embryos transferred to Cheviot ewes. In conclusion, this study showed that gestation-related gene and protein expression in the endometrium of Suffolk and Cheviot ewes is affected by both ewe and embryo breed, showing that uterine-conceptus communication is influenced by breed as early as Day 19 of gestation.

Acknowledgments The authors would like to acknowledge Massey University and Gravida: National Centre for Growth and Development, for funding this research.

References [1] Harvey MB, Leco KJ, Arcellana-Panlilio MI, Zhang X, Edward DR, Schultz GA. Role of growth factors during peri-implantation. Mol Hum Reprod 1995;10:712–8. [2] Sharma RK, Parkinson TJ, Kenyon PR, Jenkinson CMC, Blair HT. Uterine environment and early embryonic development in sheep. Small Rum Res 2013;115:67–70. [3] Clark JH, Schrader WT, O’Malley BW. Mechanisms of action of steroid hormones. Williams textbook of endocrinology. 8th ed. Philadelphia: W. B. Saunders Comp; 1992. p. 35–90. [4] Wathes DC, Reynolds TS, Robinson RS, Stevenson KR. Role of the insulin-like growth factor system in uterine function and placental development in ruminants. J Dairy Sci 1998;81(Suppl. 6):1778–89. [5] Satterfield MC, Gao H, Li X, Wu G, Johnson GA, Spencer TE, et al. Select nutrients and their associated transporters are increased in the ovine uterus following early progesterone administration. Biol Reprod 2010;82:224–31.

[6] Dorniak P, Bazer FW, Spencer TE. Physiology and endocrinology symposium: biological role of interferon tau in endometrial function and conceptus elongation. J Anim Sci 2013;91:1627–38. [7] Kim ST, Marquard K, Stephens S, Louden E, Allsworth J, Moley KH. Adiponectin and adiponectin receptors in the mouse preimplantation embryo and uterus. Hum Reprod 2011;26:82–95. [8] Mirkin S, Arslan M, Churikov D, Corica A, Diaz JI, Williams S, et al. In search of candidate genes critically expressed in the human endometrium during the window of implantation. Hum Reprod 2005;20: 2104–17. [9] Burghardt RC, Johnson GA, Jaeger LA, Ka H, Garlow JE, Spencer TE, et al. Integrins and extracellular matrix proteins at the maternalfetal interface in domestic animals. Cells Tissues Organs 2002;171: 202–17. [10] Öner H, Öner J, Demir R. Distributions of PCNA and Cas-3 in rat uterus during early pregnancy. Folia Histochem Cytobiol 2010;48: 71–7. [11] Sharma RK, Blair HT, Jenkinson CMC, Kenyon PR, Cockrem JF, Parkinson TJ. Uterine environment as a regulator of birth weight and body dimensions of newborn lambs. J Anim Sci 2012;90: 1338–48. [12] Sosa CJ, Abecia A, Carriquiry M, Forcada F, Martin GB, Palacin I, et al. Early pregnancy alters the metabolic responses to restricted nutrition in sheep. Domest Anim Endocrinol 2009;36:13–23. [13] de Brun V, Carriquiry M, Meikle A, Forcada F, Casal A, Sosa C, et al. Periconceptional undernutrition modifies endocrine profiles and hepatic gene expression in sheep. J Anim Physiol Anim Nutr 2015; 99(Suppl. 4):710–8. [14] Fenwick MA, Fitzpatrick R, Kenny DA, Diskin MG, Patton J, Murphy JJ, et al. Interrelationships between negative energy balance (NEB) and IGF regulation in liver of lactating dairy cows. Domest Anim Endocrinol 2008;34:31–44. [15] Astessiano AL, Pérez-Clariget R, Quintans G, Soca P, Carriquiry M. Effects of a short-term increase in the nutritional plane before the mating period on metabolic and endocrine parameters, hepatic gene expression and reproduction in primiparous beef cows on grazing conditions. J Anim Physiol Anim Nutr 2012;96:535–44. [16] Wu SH, Weber WJ, Chester-Jones H, Hansen LB, Crooker BA. Effects of intake, selection for milk yield, and bST administration on hepatic expression of insulin receptors and components of the somatotropic axis in growing Holstein heifers. J Dairy Sci 2004;87:364. Abstract W205. [17] Chen Y, Green JA, Antoniou E, Ealy AD, Mathialagan N, Walker AM, et al. Effect of interferon-tau administration on endometrium of nonpregnant ewes: a comparison with pregnant ewes. Endocrinol 2006;147:2127–37.

M. Sequeira et al. / Theriogenology 86 (2016) 1557–1565 [18] Carriquiry M, Weber WJ, Fahrenkrug SC, Crooker BA. Hepatic gene expression in multiparous Holstein cows treated with bovine somatotropin and fed n-3 fatty acids in early lactation. J Dairy Sci 2009;92:4889–900. [19] Rutledge RG, Cote C. Mathematics of quantitative kinetic PCR and the application of standard curves. Nucleic Acids Res 2003;31:e93. [20] Pflaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2009;29:e45. [21] Meikle A, Bielli A, Masironi B, Pedrana G, Wang H, Forsberg M, et al. An immunohistochemical study on the regulation of estrogen receptor alpha by estradiol in the endometrium of the immature ewe. Reprod Nut Dev 2000;40(Suppl. 6):587–96. [22] Thatcher WW, Guzeloglu A, Meikle A, Kamimura S, Bilby T, Kowalski AA, et al. Regulation of embryo survival in cattle. Reproduction 2003;61:253–66. [23] Boos A, Meyer W, Schwarz R, Grunert E. Immunohistochemical assessment of estrogen receptor and progesterone receptor distribution in biopsy samples of the bovine endometrium collected throughout the estrus cycle. Anim Reprod Sci 1996;44:11–21. [24] Meikle A, Sequeira M, Fermin LM, Pain P, Kenyon PR, Blair HT. Endocrine profiles during early gestation are affected by the breed: Suffolk vs Cheviot dams. Adsa-asas Joint Annual Meeting 2015; Abstract #64879. [25] Lozano JM, Abecia JA, Forcada F, Zarazaga L, Alfaro B. Effect of undernutrition on the distribution of progesterone in the uterus of ewes during the luteal phase of the estrous cycle. Theriogenology 1998;49:539–46. [26] Sosa C, Lozano J, Viñoles C, Acuña S, Abecia J, Forcada F, et al. Effect of plane of nutrition on endometrial sex steroid receptor expression in ewes. Anim Reprod Sci 2004;84:337–48. [27] Sosa C, Abecia JA, Forcada F, Viñoles C, Tasende JA, Valares JA, et al. Effect of undernutrition on uterine progesterone and estrogen receptors and on endocrine profiles during the ovine oestrous cycle. Reprod Fertil Dev 2006;18:447–58. [28] Simmen RC, Simmen FA, Hofig A, Farmer SJ, Bazer FW. Hormonal regulation of insulin-like growth factor gene expression in pig uterus. Endocrinol 1990;127:2166–74. [29] Block J, Hansen PJ. Interaction between season and culture with insulin-like growth factor-1 on survival of in vitro produced embryos following transfer to lactating dairy cows. Theriogenology 2007;67:1518–29. [30] Kirby CJ, Thatcher WW, Collier RJ, Simmen FA, Lucy MC. Effects of growth hormone and pregnancy on expression of growth hormone receptor, insulin like growth factor-I, and insulin-like growth factor

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

1565

binding protein-2 and -3 genes in bovine uterus, ovary, and oviduct. Biol Reprod 1996;55:996–1002. Simmen RC, Michel FJ, Fliss MS. Ontogeny, immunocytochemical localization, and biochemical properties of the pregnancyassociated uterine elastase/cathepsin-G protease inhibitor, antileukoproteinase (ALP): monospecific antibodies to a synthetic peptide recognize native ALP. Endocrinol 1992;130:1957–65. Robinson RS, Fray MD, Wathes DC, Lamming GE, Mann GE. In vivo expression of interferon tau mRNA by the embryonic trophoblast and uterine concentrations of interferon tau protein during early pregnancy in the cow. Mol Reprod Dev 2006;73:470–4. Geisert RD, Lee DY, Simmen FA, Zavy MT, Fliss AE, Bazer FW, et al. Expression of messenger RNAs encoding insulin-like growth factorI, -II, and insulin-like growth factor binding protein-2 in bovine endometrium during the estrous cycle and early pregnancy. Biol Reprod 1991;45:975–83. Liu HC, Mele C, Catz D, Noyes N, Rosenwaks Z. Production of insulinlike growth factor binding proteins (IGFBPs) by human endometrial stromal cell is stimulated by the presence of embryos. J Assist Reprod Genet 1995;12:78–87. Bazer FW, Gu W, Spencer TE, Johnson GA, Burghardt RC, Bayless K. Novel pathways for implantation and maintenance of pregnancy in mammals. Mol Hum Reprod 2010;16:135–52. Dharmaraj N, Wang P, Carson DD. Cytokine and progesterone receptor interplay in the regulation of MUC1 gene expression. Mol Endocrinol 2010;24:2253–66. Tomic D, Frech MS, Babus JK, Symonds D, Furth PA, Koos RD, et al. Effect of ERa overexpression on female reproduction in mice. Reprod Toxicol 2007;23:317–25. Martin JR, Lieber SB, McGrath J, Shanabrugh M, Horvath TL, Taylor HS. Maternal ghrelin deficiency compromises reproduction in female progeny through altered uterine developmental programming. Endocrinol 2011;152:2060–6. Cook PS, Buchanan DL, Yound P, Setiawan T, Brody J, Korach KS, et al. Stromal estrogen receptors mediate mitogenic effects of estradiol on uterine epithelium. Proc Nat Acad Sci USA 1997;94: 6535–40. Kennedy TG. Prostaglandins and the endometrial vascular permeability changes preceding blastocyst implantation and decidualization. Prog Reprod Biol 1980;7:234–43. Shibata R, Sato K, Pimentel DR, Takemura Y, Kihara S, Ohashi K, et al. Adiponectin protects against myocardial ischemia reperfusion injury through AMPK- and COX-2-dependent mechanisms. Nat Med 2005;11:1096–103.