GH directly stimulates UCP3 expression

Growth Hormone & IGF Research xxx (xxxx) xxx–xxx

Contents lists available at ScienceDirect

Growth Hormone & IGF Research journal homepage: www.elsevier.com/locate/ghir

GH directly stimulates UCP3 expression Misa Hayashia,1, Kumi Futawakaa,1, Midori Matsushitaa, Rie Koyamaa, Yue Funa, Yuki Fukudaa, ⁎ Ayaka Nushidaa, Syoko Nezua, Tetsuya Tagamib, Kenji Moriyamaa,b, a b

Medicine & Clinical Science, Faculty of Pharmaceutical Sciences, Mukogawa Women's University, Hyogo 663-8179, Japan Clinical Research Institute for Endocrine and Metabolic Diseases, National Hospital Organization Kyoto Medical Center, Kyoto 612-8555, Japan

A R T I C L E I N F O

A B S T R A C T

Keywords: Energy metabolism Signal transduction Muscle specific gene

Objective: We evaluated the direct action of GH signaling in energy homeostasis in myocytes. Design: We investigated the GH-induced expression of UCP3 in human embryonic kidney 293 cells, human HEMC-SS chondrosarcoma cells, murine C2C12 skeletal muscle myoblasts, and rat L6 skeletal muscle cells, as well as its direct effect on the GHR/JAK/STAT5 pathway using a combination of a reporter assay, real-time quantitative polymerase chain reaction, and western blotting. Results: We demonstrated that the regulation of energy metabolism by GH involves UCP3 via activated STAT5, a signal transducer downstream of GH. UCP3 expression increased with STAT5 in a dose-dependent manner and was higher than that of UCP2. We confirmed the functional STAT5 binding site consensus sequences at −861 and −507 bp in the UCP3 promoter region. Conclusion: The results suggest that GH stimulates UCP3 directly and that UCP2 and that UCP3 participate in the signal transduction pathway that functions downstream of the GHR/JAK/STAT.

1. Introduction

adipose tissue [7]. GH exerts a diverse range of physiological actions [6]. GH levels, secreted by the pituitary somatotropes, rise in response to nutrient deprivation and fall in states of nutrient excess [6]. GH acts upon a cell by binding its cognate receptor at the cell membrane. Subsequently, the activation of GHR upon GH binding activates Janus-activated kinase (JAK) 2 and other pathways. Activated JAK2 then phosphorylates other tyrosine residues of the cytoplasmic domain of GHR. The well characterized targets of JAK phosphorylation are members of the Stat family of transcription factors [8]. Signal transducer and activator of transcription (STAT) proteins are phosphorylated at the tyrosine residues and form dimers with other phosphorylated STAT proteins. Then, the complex translocates to the nucleus where they bind to a specific consensus sequence (TTCnnnGA) and influence gene transcription [9,10]. STAT protein mediates a variety physiological processes, including development, energy homeostasis, and promoting the production of IGF-1 in the liver [8,11]. Indeed, STATs 1, 3, 5A, and 5B are all phosphorylated by GH, however, STAT5B is regarded as the major mediator of GH action [8,10].

Growth hormone (GH) or somatotropin is indispensable for promoting body development until puberty in human and animals [1,2]. The effect of GH after puberty on phenotypic expressions becomes more ambiguous, and its physiological significance seems to be underestimated [2]. Recent studies have highlighted the GH effects in metabolism as an important anabolic mediator [3]. GH has several physiological functions, including increasing protein synthesis, reducing proteolysis, and lipids mobilization and oxidation [4]. Studies on GH have focused on its impact on insulin-like growth factor 1 (IGF-1)/somatomedin C secretion and subsequent actions of IGF-1 on peripheral tissue. A classic summary of physiological actions of the GH are induced secondarily via IGF-1 [5]. Recent studies have shown that multiple effects of GH in the body can also exert directly via GH receptors (GHRs), which are ubiquitously expressed [6]. So, GHRs are involved in maturation and fuel metabolism through their effect on cells such as myocytes and adipocytes [7]. Lipid oxidation occurs in post-absorptive and fasting conditions, possibly due to the direct action of GH on the

Abbreviations: aSTAT5B, constitutively active STAT5B; ANOVA, analysis of variance; BLAST, Basic Local Alignment Search Tool; DMEM, Dulbecco's Modified Eagle's Medium; GAS, interferon-gamma activated sequence; GH, growth hormone; GHR, growth hormone receptor; IGF-1, insulin-like growth factor-1; JAK, Janus-activated kinase; qRT-PCR, quantitative reverse-transcription polymerase chain reaction; SD, standard deviation; STAT, signal transduction and activator of transcription; UCP, uncoupled protein ⁎ Corresponding author at: Department of Medicine & Clinical Science, Faculty of Pharmaceutical Sciences, Mukogawa Women's University, 11-68, Koshian Kyuban-cho, Nishinomiya, Hyogo 663-8179, Japan. E-mail address: [email protected] (K. Moriyama). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.ghir.2018.01.002 Received 23 April 2017; Received in revised form 27 December 2017; Accepted 18 January 2018 1096-6374/ © 2018 Published by Elsevier Ltd.

Please cite this article as: Hayashi, M., Growth Hormone & IGF Research (2018), https://doi.org/10.1016/j.ghir.2018.01.002

Growth Hormone & IGF Research xxx (xxxx) xxx–xxx

M. Hayashi et al.

the promoter region of human UCP3 (hUCP3) by constructing various deletion mutants of hUCP3 promoter. Polymerase chain reaction (PCR) analysis was performed using human genomic DNA as the template. PCR primers were constructed such that the XhoI and HindIII sites overhang the oligonucleotides used as sense and antisense primers, respectively. PCR products were subcloned between the XhoI and HindIII sites of the pGL4.10 vector (Promega, Madison, WI). The constructed plasmids were verified by sequencing. In addition, the constitutively active STAT5B (pMX-STAT5B1*6) (aSTAT5B) expression plasmid previously described was used [10].

In the previous study, we reported two STAT5 consensus sequences likely to be functional in the promoter region of the mitochondria uncoupling protein 2 (UCP2) gene using an electrophoretic mobility shift assay [10]. While UCP2 is expressed widely throughout the body, UCP1 is a brown adipose tissue specific protein and UCP3 is expressed preferentially in skeletal muscle. UCPs catalyzes a regulated proton leak, converting energy stored within the mitochondrial proton electrochemical potential gradient to heat and are essential for non-shivering thermogenesis in response to cold exposure [12]. It also has been demonstrated that UCPs regulate fatty acid oxidation and control reactive oxygen production by mitochondria [13,14]. GH effects lipid metabolism in liver through multiple mechanisms. For instance, the GHR/JAK/STAT pathway analysis revealed that a key physiological role of GH is triglyceride secretion in the liver [15]. Alterations of GH signaling in the liver revealed changes of lipid and choline metabolism with increased fat deposition [15]. In addition, GH had been shown to induce phosphorylation of sterol regulatory element-binding protein-1a, a transcription factor that directs lipid and cholesterol synthesis [16,17] and to increase hepatic fatty acid oxidation [18]. On the contrary, GH therapy for adult GH deficiency significantly increased the lean body mass and decreased percent body fat. Total and low-density lipoprotein cholesterol levels decreased and highdensity lipoprotein cholesterol level increased in patients with GH deficiency [19]. Growth hormone administration in human and mice was reported to increase the mRNA expression of genes encoding UCPs in the adipose and muscle tissues [14,20]. As a consequence, UCP activation enhances thermogenesis and energy consumption. These results demonstrated that GH regulates UCPs expression through a given signaling pathway. However, whether the mechanisms controlling UCPs gene expression are directly through the action of GH or indirectly via IGF-1 is questionable. In this report, we described the novel findings of molecular mechanism that STAT5, the transcription factor of downstream of GH/ GHR/JAK pathway, can bind to the consensus sequences of UCP3 gene promoter and stimulates UCP3 expression. We demonstrated that GH upregulates UCP3 expression directly and selectively in myocytes and may participate in energy homeostasis through STAT5.

2.3. Transient expression assays In reporter gene assays, we confirmed that binding sequences are essential for the action of GH on UCP3 transactivation. We, therefore, aimed to identify the transcription factors that bind to the promoter region of UCP3 and convey STAT5B-mediated regulation of UCP3 gene expression. TSA201 cells were co-transfected with aSTAT5B plasmid along with the constructed hUCP3 promoter-luciferase (Luc) or hUCP2 promoter-Luc plasmid using the calcium phosphate method [10]. The total amount of expression plasmids was kept constant in different experimental groups with the addition of empty vehicle plasmids. Following 6 h, DMEM without phenol red (Wako Pure Chemical Industries, Osaka, Japan) supplemented with 10% charcoal-stripped fetal bovine serum was added. Cells were harvested after 20 h and the luciferase activity measured according to the manufacturer's instructions (Dual–Luciferase® Reporter Assay System; Promega, Madison, WI). Transfection efficiency was monitored using an internal control. 2.4. Small interfering RNA transfection The predesigned small interfering RNAs (siRNA) against IGF-1 were purchased from Thermo Fisher Scientific Inc. (Thermo Fisher Scientific Inc. Waltham, MA). The siRNA (150 pmol) was transfected into 1 × 106 of cells by using Lipofectamine® 3000 reagent (Thermo Fisher Scientific, Waltham, MA). After 24 h, cells were harvested, and lysed in a buffer containing 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% Triton X-100 and 1 mM phenylmethylsulfonyl fluoride. The resulting lysates were used for further experiments. The plasmid for mouse UCP3 mRNA interference was generously gifted by Prof. Wolfgang F. Graier (Institute of Molecular Biology & Biochemistry, Center of Molecular Medicine Medical University of Graz, Austria).

2. Materials and methods 2.1. Cell culture Mouse C2C12 muscle cells (C2C12), rat L6 muscle cells (L6), HEMC-SS chondrosarcoma cells, and human embryonic kidney cells (HEK293) were purchased from JCRB Cell Bank (National Institute of Biomedical Innovation, Tokyo, Japan). TSA201 cells, which are clones of human embryonic kidney 293 cells [10,21], Cells were grown in Dulbecco's Modified Eagle's Medium (DMEM) (Nissui Pharmaceutical, Tokyo, Japan) supplemented with 10% fetal bovine serum (HyClone laboratories Inc., UT), penicillin (100 U/mL), streptomycin (100 μg/ mL), and L-glutamine (2 mM). C2C12 cells and L6 cells were induced to differentiate at 80% confluency in DMEM supplemented with 2% horse serum for 10 days. Differentiated L6 cells were starved for 16 h in presence of 25 mM HEPES and 0.2% bovine serum albumin, followed by GH (1.0 μg/mL) stimulation. H-EMC-SS cells were grown in minimal essential medium α (Wako Pure Chemical Industries, Osaka, Japan). The appropriate GH dose was determined based on a previous report [22]. All cells were maintained at 37 °C in a humidified atmosphere containing 5% CO2.

2.5. Expression analysis by quantitative reverse-transcription PCR (qRTPCR) We used recombinant human GH (Wako Pure Chemical Industries, Japan) for GH-induced phosphorylation of the STAT5 and endogenous UCP3 expression in three cell lines according to the previous report [10]. Total RNA from those cells was isolated using the RiboZol™ kit (AMRESCO, Solon, OH) and cDNA synthesized from 1 μg RNA by reverse transcription using iScript™ RT Supermix (BioRad, Hercules, CA). qPCR was performed in a CFX Connect™ Real-Time PCR Detection System (BioRad, Hercules, CA) using iTaq™ Universal SYBR® Green Supermix (BioRad, Hercules, CA). Gene-specific primer pairs used are listed in Table 1. PCR product quality was monitored by post-PCR melting curve analysis. 2.6. Western blotting Western blotting was performed as described earlier with some modifications [10]. Briefly, whole-cell extracts from the three transfected cell lines were prepared in the cell lysis solution [10] and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on 10% acrylamide gels. Protein bands were transferred onto a nylon membrane and the membrane was probed with antibodies against

2.2. Plasmid construction The human UCP3 promoter was generously gifted by Dr. Jean A. Boutin (Biotechnologie, Pharmacologie Moléculaire et Cellulaire, Institut de Recherches SERVIER, France). We analyzed the function of 2

Growth Hormone & IGF Research xxx (xxxx) xxx–xxx

M. Hayashi et al.

Table 1 Primer sequenses used in qPCR. Gene

Sense primer(5′ – 3′)

Antisense primer(5′ – 3′)

Rat UCP3 Rat β-actin Mouse UCP3 Mouse IGF1 Mouse β-actin Human UCP3 Human β-actin

GCCTTTGGAGCTGGTTTCTG CCCGCGAGTACAACCTTCTT CTGGAGGAGAGAGGAAATACAGAG GTCTTGGGCATGTCAGTGTG CTTTGCAGCTCCTTCGTTGC CGTGGTGATGTTCGTAACCTATG CACTCTTCCAGCCTTCCTTCC

TTCATGTATCGGGTCTTTACCACA CCCACGATGGAGGGGAAGAC TGGCATTTCTTGTGATGTTGGGCC TGGATGCTCTTGAGTTCGTG ACGATGGAGGGGAATACAGC CGGTGATTCCCGTAACATCTG CGGACTCGTCATACTCCTGCTT

Growth hormone regulates the expression of UCP3

***

10

***

50ng 8

200ng 400ng

RLU

6

**

4

***

*** ** 2

***

***

**

*** 0

reporter only

***

reporter only iSTAT5B 50~400ng

aSTAT5B 50~400ng

iSTAT5B 50~400ng

UCP2pro-Luc

aSTAT5B 50~400ng

UCP3pro-Luc *, p<0.05; **, p<0.01; ***, p<0.001

Fig. 1. The effects of different amounts of pMX-aSTAT5B on the transcriptional activity of uncoupled protein (UCP) 2 and 3. The data are presented as the mean ± SD from three transfections performed in triplicate. RLU, relative luciferase unit; iSTAT5B, inactive form of STAT5B; *: p < 0.05; **: p < 0.01; ***: p < 0.001 vs. reporter only, or UCP2 vs UCP3 at comparable dose of the aSTAT5.

phosphorylated-STAT5 (Phosph-STAT5 (Tyr694), Cell Signaling Technology Japan, Tokyo, Japan) or UCP3 (Cell Signaling Technology Japan, Tokyo, Japan). Immune complexes were detected with Clarity Western ECL Substrate (BioRad, Hercules, CA) and Amersham HybondP PVDF Membrane (GE Healthcare/Amersham Biosciences, Piscataway, NJ). Signals were quantified densitometrically with an ATTO WSE-6200 LuminoGraph II (ATTO, Tokyo, Japan).

transcriptional activity of hUCP3 promoter-Luc alone for each plasmid dose (50, 200, and 400 ng) was 1.14- to 3.08-fold, respectively, when aSTAT5B was transfected (Fig. 1). These results suggest that the proximal region of hUCP3 promoter was more potent activator than hUCP2promoter-Luc.

2.7. Statistical analysis

The existence of STAT5 consensus sequences (TTCnnnGA) on hUCP3 promoter has been previously reported. We performed an extensive search for responsive elements with high homology with Basic Local Alignment Search Tool (BLAST) and investigated the role of the identified elements by generating cutting model constructs of hUCP3 promoter-Luc [10]. Fig. 2A shows the list of the candidate STAT5 responsive elements found in the constructed hUCP3 promoter-Luc. The cutting model schemas of hUCP3 promoter-Luc with predicted position of STAT5 binding sites are shown in Fig. 2B. We investigated the transcriptional activity of these constructs after the transfection of aSTAT5B protein expression plasmid and found that the transcriptional induction of −388/+138 hUCP3-Luc was almost completely diminished. It seemed to be that STAT5 regulates hUCP3 transcription by binding to three candidates of responsive element (I, J, K) between −1406 and +138 on the hUCP3 promoter (Fig. 2). As the transfection of aSTAT5B significantly decreased in the activity of -388hUCP3-Luc, the sequences I, J, and/or K were thought to be important for STAT5

3.2. Deletion analysis of the human UCP3 gene promoter

Data are presented as the mean ± standard deviation (SD). Statistical analyses were performed with the unpaired t-test or one-way analysis of variance (ANOVA) followed by Bonferroni correction. Differences were considered statistically significant at p < 0.05. 3. Results 3.1. Dose dependent UCP3 transcription mediated by STAT5 We examined whether STAT5 induces UCP3 activation. The transcriptional induction of hUCP3 promoter-Luc (100 ng) was examined by the aSTAT5B [10], (50, 200, and 400 ng). We also examined hUCP2 promoter-Luc (100 ng) under similar conditions to compare the magnitude of activation. The result revealed that aSTAT5B increased the expression of UCP3 in a dose dependent escalation. The increase in 3

Growth Hormone & IGF Research xxx (xxxx) xxx–xxx

M. Hayashi et al.

Fig. 2. The effects of active form of STAT5B (aSTAT5) proteins on the transcriptional activity of the UCP3 promoters with deleted STAT5 consensus sequences. (A) Putative signal transduction and activator of transcription (STAT5) consensus sequences on the constructed hUCP3 promoter-Luc. (B) The squares indicate the predicted STAT5 consensus sequences A–L. The data are represented as relative values that indicate the basal transcriptional activity of each reporter plasmid. (C) The white squares indicate existing consensus sequences, while the black squares indicate deleted consensus sequences. ΔI-hUCP3-Luc, ΔJ-hUCP3-Luc, ΔK-hUCP3-Luc and ΔL-hUCP3-Luc denote the deletion of consensus sequences I, J, K and L, respectively. TSA201 cells were cotransfected with aSTAT5 expression plasmids (pMX-aSTAT5B) or mock, the indicated deletion hUCP3 promoter-Luc constructs as reporter plasmids, and the internal control plasmid pGL4.70. The data represent relative values that indicate the basal transcriptional activity of each reporter plasmid. The data are presented as the mean ± SD from at least three transfections performed in triplicate. RLU, relative luciferase unit; *, p < 0.05; **, p < 0.01; ***, p < 0.001 vs. reporter only.

A STAT5 consensus sequence I J K L

Estimated STAT5 consensus sequences on the hUCP3 promoter

TTCnnnGA (the interferon gammaactivated sequence (GAS) motif) TTCnnnGA TTCnnnGA TTCnnGA TTCnnnnnGA

B TSS : +1

-2809/+138UCP3pro-Luc C D

E F G H

I

J K

L

Luc

I

J K

L

Luc

I

J K

L

Luc

I

J K

L

Luc

*

A B

C D

E F G H

***

-2525/+138UCP3pro-Luc

-2136/+138UCP3pro-Luc

**

E F G H

***

-1406/+138UCP3pro-Luc

reprter only mock STAT5B1*6 aSTAT5B

-388/+138UCP3pro-Luc L

Luc

0

20

*, p<0.05; **, p<0.01; ***, p<0.001

40

60

RLU

C -1406/+138UCP3pro-Luc

 I-hUCP3pro-Luc

J

K

L

Luc

L

Luc

***

I

TSS : +1

 J-hUCP3pro-Luc

I

J

K

 K-hUCP3pro-Luc

I

J

K

L

Luc

L

Luc

reporter only mock aSTAT5B

L-hUCP3pro-Luc

J

K

**

I

0

0.5

1 RLU

**, p<0.01; ***, p<0.001 4

1.5

2

Growth Hormone & IGF Research xxx (xxxx) xxx–xxx

M. Hayashi et al.

A

30

***

Relative mRNA expression (UCP3/ -actin)

iSTAT5B 25

aSTAT5B 20

15

10

**

5

0

mock

16h

24h

B

**, p<0.01*; ***, p<0.001 30

30 Relative mRNA expression (UCPs/ -actin)

(after aSTAT5B introduction)

** 20

20

10

10

** 4 3 2 01 0

0

mock

aSTAT5B

mock

UCP2

aSTAT5B

UCP3 **, p<0.01

Fig. 3. UCP2 and UCP3 mRNA expressions in differentiated L6 transfected with pMX-aSTAT5B respectively. The aSTAT5B-induced time-dependent activation of the UCP3 in L6 cells (Fig. 3A). L6 cells were treated with 200 ng of aSTAT5B for different times (16–24 h), and the expression level of UCP3 was evaluated. Both UCP2 and UCP3 mRNA expressions in differentiated L6 transfected with aSTAT5B were also evaluated at 24 h respectively (Fig. 3B). The data are presented as the mean ± SD from three independent experiments performed in triplicate. iSTAT5B, inactive form of STAT5B; **: p < 0.01 vs. mock, ***: p < 0.001 vs. mock,

3.3. UCP3 gene expression mediated by the activated STAT5

function. We investigated the transcriptional activity of constructs for which the STAT5B responsive elements within −1406/+138 were removed (Fig. 2C). The transcriptional activity of both ΔJ-hUCP3-Luc and ΔKhUCP3-Luc was lost with STAT5B introduction, while that of ΔI-hUCP3Luc and ΔL-hUCP3-Luc was recovered. These findings suggest that the predicted consensus sequences J and K are likely to function as the STAT5B consensus sequences for the hUCP3 promoter region.

We examined at transcriptional level whether the expression of UCP3 are directly activated by the aSTAT5B in L6 cells. L6 cells were differentiated from muscles cells, followed by their transfection with the aSTAT5B (200 ng) plasmid with Lipofectamine® 3000 reagent. The mRNAs were extracted after 16–24 h. The culture medium was not replaced after gene transfection. UCP3 mRNA was evident at 16-h and peaked at about 24 h (Fig. 3A). In comparison to the control cells (mock insertion), 23.61-fold increase in the expression of UCP3 mRNA at 24 h after aSTAT5B introduction (Fig. 3B, right panel). The expression of 5

Growth Hormone & IGF Research xxx (xxxx) xxx–xxx

M. Hayashi et al.

Fig. 4. GH-induced phosphorylation of the STAT5 in C2C12 cells. Cells were treated with 2 μg/well of GH for 3 min, and then the phosphorylation of STAT5 was determined by western blotting using anti-phosphorylated (p-) STAT5 antibody. Blots represent prototypical examples of experiments replicated at least three times. Quantitative data (OD, optical density) are shown in the Fig. 4.

Densitometry units normalized to -actin expression

18

*

16 14 12 10 8 6 4 2

0

0 min

3 min

p-STAT5 -actin

*, p<0.05 3.7. GH induced UCP3 protein expression in three myocyte cell lines

UCP2 mRNA, on the other hand, increased by 3.58-fold following aSTAT5B transfection as compared to that in the control at the same time (Fig. 3B, left panel).

We evaluated UCP3 protein expression induced by human GH. Following 48-h treatment with GH, proteins were extracted from each cell line. Western blot analysis revealed a significant increase of 1.32-, 2.61-, and 1.94-fold in UCP3 expression in C2C12 (Fig. 7A), L6 (Fig. 7B), and H-EMC-SS cells (Fig. 7C), respectively. The expression of GHRs in all three myocyte cell lines were confied by using qRT-PCR (data not shown).

3.4. GH-induced phosphorylation of the STAT5 We investigated the GH-induced phosphorylation of the STAT5 in C2C12 cells with human recombinant GH. C2C12 cells were treated with 2 μg of GH/well for 0 and 3 min, and the phosphorylation of STAT5 was evaluated. Western blotting revealed a transient phosphorylation following GH stimulation (Fig. 4).

4. Discussion

3.5. GH induced UCP3 mRNA expression

In this study, we investigated the direct effect of GH on the GHR/ JAK/STAT5/UCP3 signal transduction pathway and identified the STAT5 binding site in consensus sequences of UCP3 promoter region essential for the regulation of UCP3 gene expression. To our knowledge, this is the first study to report the direct action of GH on UCP3 at molecular level. The binding of GH to its receptor (GHR) activates JAK2, which in turn activates STAT5 by phosphorylation [23,24]. Phosphorylated STAT5 enters the nucleus and binds to the interferon-gamma activated sequence (GAS) motifs in the promoter and enhancer regions of target genes (Fig. 2A). STAT5 is an essential mediator of GH actions and mediates the transcription of IGF-1 [25,26]. GH is known to induce IGF1 secretion, and much of its action on target tissues was thought to occur indirectly via IGF-1. However, recent studies have highlighted the direct effect of GH mediated via GHRs expressed throughout the body. In our previous study, we identified two STAT5 consensus sequences located in the promoter region of UCP2 gene [10]. Using reporter gene assays, we confirmed that both −823 and −358 are essential for the action of STAT5 on UCP2 transactivation. We demonstrated that the regulation of energy metabolism by GH is carried out with UCP2 via STAT5, a transcription factor of downstream of GH [10]. Recent studies have illustrated that while IGF-1 is indeed GH-dependent and produced predominantly in the liver as a humoral factor, it is additionally

We investigated the GH-induced variation in UCP3 mRNA expression. Following from 24-h treatment with GH, mRNA was extracted. qRT-PCR analysis revealed a significant increase of 2.94-fold in UCP3 mRNA expression following GH stimulation (Fig. 5A). On the other hand, GH induced mRNA expression was abolished completely by introduction of UCP3 siRNA at 24-h treatment with GH (Fig. 5B). 3.6. UCP3 mRNA expression was induced by GH not via IGF-1 expression We asked whether IGF-1 are involved in activating UCP3 directly in the presence of GH (Fig. 6). C2C12 cells were treated with 2 μg of GH/ well for different times (0–48 \h). GH induced IGF-1 mRNA expression peaked at about 48 h (Fig. 6A). Following 24-hour treatment with/ without IGF-1 siRNA, mRNA was extracted. qRT-PCR analysis revealed that IGF-1 mRNA expression was significantly downregulated by 33% following GH stimulation though there were no differences between control cells and cells were transfected by IGF-1 siRNA in UCP3 mRNA expression (Fig. 6B). At 16 h after GH stimulation, there were no difference between the control cells and the IGF-1 siRNA transfected cells in expression level of both IGF-1 and UCP3 mRNA due to relative low level expression (data not shown). 6

Growth Hormone & IGF Research xxx (xxxx) xxx–xxx

M. Hayashi et al.

A

Fig. 5. UCP3 mRNA expression in differentiated L6 stimulated by GH (Fig. 5A). The data are presented as the mean ± SD from three independent experiments performed in triplicate. The siRNAs against UCP3 diminished expression of the respective transcript (Fig. 5B). **: p < 0.01 vs. vehicle.

5

Relative mRNA expression (UCP3/ -actin)

** 4

3

2

1

0

Relative mRNA expression (UCP3/ -actin)

B

5

vehicle

GH **, p<0.01

UCP3 siRNA

4

3

2

1

0

vehicle

GH via IGF-1 at the later due to auto- and/or paracrine (data not shown, manuscript in preparation). GH exerts complex multi-system effects on skeletal muscle function, which is partly mediated by the IGF system [11,20,29]. GH is known to enhance muscle performance in sports and muscle function, as evident from its anabolic properties [29]. It increases muscle strength by enhancing muscle mass without affecting contractile force or the composition of muscle fiber [27]. In addition, GH stimulates protein synthesis in muscles and extra-muscular sites. As the energy required to perform muscle functions is derived from a continuum of anaerobic and aerobic sources, GH stimulates the anaerobic energy system and suppresses the aerobic energy system. GH exerts lipolytic effect in muscles and adipose tissues of mice and humans [30]. However, the role of GH/GHR/JAK/STAT5 pathway in lipid and glucose metabolism needs to be elucidated. A study with muscle-specific STAT5-knockout (STAT5 MKO) mice [31] showed dysregulated lipid and glucose metabolism in the skeletal muscle of STAT5 MKO fed with a high-fat diet. The dysregulated metabolism induced hepatic fat accumulation characterized by an increase in levels of circulating free fatty acids, triglycerides, and glucose. As a consequence, increased intramyocellular lipid accumulation was observed in the quadriceps of these mice. Thus, muscle-specific STAT5 signaling

produced in all cells and tissues, where it plays auto- and paracrine roles [27,28]. Both hepatic and local IGF-1 cooperate to promote growth in auto- and paracrine manners, while the relationship between GH and IGF-I mainly consists of GH inducing hepatic IGF-I transcription which, in turns, negatively controls pituitary GH secretion [15–17]. Gustafsson et al. reported that IGF-1 increased the UCP3 mRNA levels 2.5-fold in human neuroblastoma [27,28]. Following growth factorstarved SH-SY5Y cells were treated with 10 nM IGF-1, IGF-1-dependent increase in expression of UCP3 mRNA peaked at 8 h. However, there has not been any evidence of UCP3 expression in myocytes as a direct response to GH or indirect response via IGF-1 induction. We showed that GH induced IGF-1 mRNA expression peaked at about 48 h or later (Fig. 6A). On the other hand, we also presented that GH and/or aSTAT5B induced UCP3 mRNA peaked within 24 h after GH or aSTAT5B stimulation. IGF-1 siRNA experiment showed that GH induced UCP3 expressions were not affected within 24 h. Although the expression level of both IGF-1 and UCP3 mRNA were also examined at 16 h after GH stimulation, there were no differences between control cells and IGF-1 siRNA introduced cells in expression level of both IGF-1 and UCP3 mRNA due to relative low level expression (data not shown). Those results suggested that GH activates directly at the earlier phase of UCP3 expression in myocytes, though GH stimulates UCP3 expression

7

Growth Hormone & IGF Research xxx (xxxx) xxx–xxx

M. Hayashi et al.

A

Relative mRNA expression (IGF-1/ -actin)

***

***

(hours after GH stimulation)

0

16

24

48

GH ***, p<0.005

B

Relative mRNA expression (target/ -actin)

1.6

1.4

Control IGF-1 siRNA

1.2

***

N.S.

1.0 0.8 0.6

0.4 0.2 0

IGF-1

UCP3 GH ***, p<0.005; N.S., not statistically significant

Fig. 6. siRNA knockdown of IGF-1 did not affect GH-induced UCP3 expression at the earlier time. We investigated the GH-induced IGF-1 mRNA expression in C2C12 cells with human recombinant GH. C2C12 cells were treated with 2 μg of GH/well for different times (0–48 h). GH induced IGF-1 mRNA expression peaked at about 48 h. Whether IGF-1 mediated UCP3 transcription, IGF-1 was knocked down in C2C12 by siRNA at 24 h (Fig. 6B). The IGF-1-knocked down C2C12 showed the lower expression of IGF-1 than the original C2C12, though there was no difference between control cells and cells transfected with IGF-1-siRNA in the expression of UCP3 mRNA. Data are shown represent means ± S.D. (n = 3). ***, p < 0.005, treated versus control; N.S., not statistically significant.

8

Growth Hormone & IGF Research xxx (xxxx) xxx–xxx

M. Hayashi et al.

is important for balancing lipid and glucose metabolism in peripheral tissues, including muscle and liver. Mitochondria uncoupling proteins belong to a family of mitochondrial carrier proteins that dissipate trans-mitochondrial electrochemical gradient stored energy as heat and have been implicated in the regulation of energy metabolism [10,14]. UCP2 and UCP3 are members of the UCP family and may play common roles in energy homeostasis. UCP2 and UCP3 are known to express in several human tissues, including white adipose tissue and skeletal muscle [32–34]. UCP3 is selectively and abundantly expressed in human skeletal muscle, a major regulator of energy expenditure, particularly while resting. Treatment of L6 myocyte cells with triiodothyronine, oleic acid, alpha-bromopalmitate, carbacyclin (a non-selective ligand of peroxisome proliferator-activated receptors), and 9-cis retinoic acid (a ligand of retinoid X receptor) increased the expression of UCP3 mRNA [35]. In vivo studies have reported that fatty acids induce UCP3 gene expression in skeletal muscle [36,37]. Starvation, characterized by increase in the blood level of free fatty acids [38], is one of the most potent stimuli for UCP3 gene expression in skeletal muscle [39,40]. Severe fasting associated with reduced energy expenditure results in increased UCP2 and UCP3 gene expression in adipose tissue and skeletal muscle of rodents [41,42] and humans [43]. The enhanced expression of both UCPs is suggested to be mediated by the accompanying increase in circulating free fatty acids during fasting [36]. Fatty acids are reported to be important regulators of gene expression and functions of UCP3 [44]. However, there is no evidence for the regulation of UCP3 expression in myocytes by GH and STAT5 at molecular level. The physiological role of UCP3 is still debatable [14]. Previous reports have suggested its role in fatty acid metabolism. UCP3 overexpression has been shown to increase fatty acid transport and oxidation [45]. Jaburek et al., reported that fatty acids may play an important role in the generation of UCP3-mediated proton flux [46]. Although not a fatty acid transporter, UCP3 abrogates mitochondrial oxidative stress, and therefore, is deemed important for the fasting-induced enhancement of fatty acid oxidation rate and capacity [47]. Other reports have suggested an association between UCP3 and cellular fatty acid metabolism. The highest level of UCP3 expression has been found in type 2 muscle fibers, which are also known as glycolytic muscle fibers, and fasting and high-fat diets upregulate UCP3 expression [45]. This escalation in UCP3 expression is noticeable in muscles with a low fat oxidative capacity. Reduction in the oxidative capacity of fats by blockade of carnitine palmitoyltransferase 1 rapidly induces the expression of UCP3. Furthermore, high-fat diets increase the mitochondrial supply of fatty acids and are known to upregulate UCP3 expression. However, an intake of similar amount of medium-chain fatty acids, which can be oxidized inside the mitochondrial matrix and therefore need not be exported from the matrix, shows no effect on UCP3 protein levels. In addition, UCP3 is increased in patients with defective beta-oxidation and restoration of the oxidative capacity reduces the level of UCP3 [48]. Studies suggest that fatty acids that cannot be oxidized from the mitochondrial matrix are thought to be exported by UCP3, thereby preventing fatty acid accumulation inside the matrix. Thus, UCP3 may perform a protective physiological function providing protection against lipid-induced mitochondrial damage [46]. The in vivo and in vitro expression of UCP3 mRNA in the skeletal muscle is much higher than that of UCP2 mRNA [33,34,49]. UCP3 is considered to be the principle UCP expressed in the skeletal muscle, given the negligible expression of UCP1 in this tissue (data not shown). To date, two groups have performed studies using UCP3-knockout mice [50,51]. Hioki et al., reported the effects of GH on mRNA levels of UCP1, UCP2, and UCP3 in brown and white adipose tissue and skeletal muscle in a KK-Ay obese mouse model [14]. Subcutaneous injection of human GH (1.0 mg/kg/day) for 10 days increased the mRNA expression of UCP2 and UCP3 by 2.0- and 2.8-fold, respectively, (p < 0.05 versus controls) in the skeletal muscle [46]. Kim et al., described the effect of

A Densitometry units normalized to -actin expression

3

*

2

1

0

vehicle

GH

UCP3 -actin *, p<0.05

B

*

Densitometry units normalized to -actin expression

3

2

1

0

vehicle

GH

UCP3 -actin

*, p<0.05

Densitometry units normalized to -actin expression

C 3

* 2

1

0

vehicle

GH

UCP3 -actin *, p<0.05 Fig. 7. UCP3 protein expression in differentiated C2C12 (A), L6 (B), and H-EMC-SS (C) cells treated with 2 μg/well of human recombinant growth hormone (GH). The data are presented as the mean ± SD from three independent experiments performed in triplicate. *: p < 0.05 vs. vehicle.

9

Growth Hormone & IGF Research xxx (xxxx) xxx–xxx

M. Hayashi et al.

differentiation and myogenic regulatory factors on the promoter activities of the mouse UCP2 and UCP3 genes [52]. It was reported that differentiation positively induced the expression by 20-fold via UCP3 promoter, but only 2-fold via UCP2 promoter upon co-transfection with expression vectors for myogenin and/or MyoD [52]. In C2C12 myoblasts, the introduction of both expression vectors (myogenin and MyoD) resulted in an additional 20-fold increase in the reporter expression via UCP3 promoter, but only a weak effect was observed via UCP2 promoter. In our study, STAT5 stimulated the transcription of UCP3 more effectively than that of UCP2. Although the expression of both UCP2 and UCP3 is stimulated by the same transcriptional signal and similar response motifs (GAS), the molecular mechanism underlying the superior effect of STAT5 on UCP3 expression is currently unknown. Indeed, GH acts through the GHR/JAK/STAT5 pathway, but other factors may be involved in differential regulations of UCP3 promoter region. In summary, the present study demonstrates that the regulation of UCP3 expression in myocytes by GH via JAK/STAT5, the transcription factor of downstream of GH/GHR. Moreover, UCP3 is selectively expressed throughout skeletal muscles and its expression is higher than that of UCP2 in myocytes. Thus, the GH-UCP3 axis in the skeletal muscle is thought to exert some physiological functions aside from its role in thermogenesis.

[12] O. Boss, T. Hagen, B.B. Lowell, Uncoupling proteins 2 and 3: potential regulators of mitochondrial energy metabolism, Diabetes 49 (2000) 143–156. [13] R.A. Busiello, S. Savarese, A. Lombardi, Mitochondrial uncoupling proteins and energy metabolism, Front. Physiol. 6 (2015) 36. [14] C. Hioki, T. Yoshida, A. Kogure, Y. Takakura, et al., Effects of growth hormone (GH) on mRNA levels of uncoupling proteins 1, 2, and 3 in brown and white adipose tissues and skeletal muscle in obese mice, Horm. Metab. Res. 36 (2004) 607–613. [15] H.J. Schirra, C.G. Anderson, W.J. Wilson, et al., Altered metabolism of growth hormone receptor mutant mice: a combined NMR metabonomics and microarray study, PLoS One 3 (2008) e2764. [16] J. Kotzka, B. Knebel, H. Avci, et al., Phosphorylation of sterol regulatory elementbinding protein (SREBP)-1a links growth hormone action to lipid metabolism in hepatocytes, Atherosclerosis 213 (2010) 156–165. [17] J.T. Zhao, M.J. Cowley, P. Lee, V. Birzniece, W. Kaplan, K.K.Y. Ho, Identification of novel GH-regulated pathway of lipid metabolism in adipose tissue: a gene expression study in hypopituitary men, J. Clin. Endocrinol. Metab. 96 (2011) E1188–E1196. [18] Y. Qin, Y.P. Tian, Preventive effects of chronic exogenous growth hormone levels on diet-induced hepatic steatosis in rats, Lipids Health Dis. 9 (2010) 78. [19] A.F. Attanasio, S.W. Lamberts, A.M. Matranga, et al., Adult growth hormone (GH)deficient patients demonstrate heterogeneity between childhood onset and adult onset before and during human GH treatment. Adult growth hormone deficiency study Group, J. Clin. Endocrinol. Metab. 82 (1997) 82–88. [20] S.B. Pedersen, K. Kristensen, S. Fisker, J.O. Jørgensen, J.S. Christiansen, B. Richelsen, Regulation of uncoupling protein-2 and -3 by growth hormone in skeletal muscle and adipose tissue in growth hormone-deficient adults, J. Clin. Endocrinol. Metab. 84 (1999) 4073–4078. [21] T. Tagami, Y. Park, J.L. Jameson, Mechanisms that mediate negative regulation of the thyroid-stimulating hormone alpha gene by the thyroid hormone receptor, J. Biol. Chem. 274 (1999) 22345–22353. [22] H. Nishizawa, A.E. Handayaningsih, G. Iguchi, et al., Enhanced oxidative stress in GH-transgenic rat and acromegaly in humans, Growth Hormon. IGF Res. 22 (2012) 64–68. [23] M. Waters, H. Hoang, D. Fairlie, R. Pelekanos, R. Brown, New insights into growth hormone action, J. Mol. Endocrinol. 36 (2006) 1–7. [24] D.J. Waxman, C. O'Connor, Growth hormone regulation of sex-dependent liver gene expression, Mol. Endocrinol. 20 (2006) 2613–2629. [25] J. Woelfle, D.J. Chia, P. Rotwein, Mechanisms of growth hormone (GH) action identification of conserved STAT5 binding sites that mediate GH-induced insulinlike growth factor-i gene activation, J. Biol. Chem. 278 (2003) 51261–51266. [26] P. Klover, W. Chen, B.M. Zhu, L. Hennighausen, Skeletal muscle growth and fiber composition in mice are regulated through the transcription factors STAT5a/b: linking growth hormone to the androgen receptor, FASEB J. 23 (2009) 3140–3148. [27] H. Gustafsson, L. Adamson, J. Hedander, et al., Insulin-like growth factor type 1 upregulates uncoupling protein 3, Biochem. Biophys. Res. Commun. 287 (2001) 1105–1111. [28] H. Gustafsson, C. Tamm, A. Forsby, Signalling pathways for insulin-like growth factor type 1-mediated expression of uncoupling protein 3, J. Neurochem. 88 (2004) 462–468. [29] V. Chikani, K.K. Ho, Action of GH on skeletal muscle function: molecular and metabolic mechanisms, J. Mol. Endocrinol. 52 (2013) R107–R123. [30] J.O. Jorgensen, K.Z. Rubeck, T.S. Nielsen, et al., Effects of GH in human muscle and fat, Pediatr. Nephrol. 25 (2010) 705–709. [31] M. Baik, M.S. Lee, H.J. Kang, et al., Muscle-specific deletion of signal transducer and activator of transcription 5 augments lipid accumulation in skeletal muscle and liver of mice in response to high-fat diet, Eur. J. Nutr. 56 (2017) 569–579. [32] C. Fleury, M. Neverova, S. Collins, et al., Uncoupling protein-2: a novel gene linked to obesity and hyperinsulinemia, Nat. Genet. 15 (1997) 269–272. [33] O. Boss, S. Samec, A. Paoloni-Giacobino, et al., Uncoupling protein-3: a new member of the mitochondrial carrier family with tissue-specific expression, FEBS Lett. 408 (1997) 39–42. [34] A. Vidal-Puig, G. Solanes, D. Grujic, J.S. Flier, B.B. Lowell, UCP3: an uncoupling protein homologue expressed preferentially and abundantly in skeletal muscle and brown adipose tissue, Biochem. Biophys. Res. Commun. 235 (1997) 79–82. [35] I. Nagase, S. Yoshida, X. Canas, et al., Up-regulation of uncoupling protein 3 by thyroid hormone, peroxisome proliferator-activated receptor ligands and 9-cis retinoic acid in L6 myotubes, FEBS Lett. 461 (1999) 319–322. [36] D.S. Weigle, L.E. Selfridge, M.W. Schwartz, et al., Elevated free fatty acids induce uncoupling protein 3 expression in muscle: a potential explanation for the effect of fasting, Diabetes 47 (1998) 298–302. [37] O. Boss, E. Bobbioni-Harsch, F. Assimacopoulos-Jeannet, et al., Uncoupling protein3 expression in skeletal muscle and free fatty acids in obesity, Lancet 351 (1998) 1933. [38] L.C. Groop, R.C. Bonadonna, D.C. Simonson, A.S. Petrides, M. Shank, R.A. DeFronzo, Effect of insulin on oxidative and nonoxidative pathways of free fatty acid metabolism in human obesity, Am. J. Phys. 263 (1992) E79–E84. [39] J.O. Jorgensen, J. Moller, T. Laursen, H. Orskov, J.S. Christiansen, J. Weeke, Growth hormone administration stimulates energy expenditure and extrathyroidal conversion of thyroxine to triiodothyronine in a dose-dependent manner and suppresses circadian thyrotrophin levels: studies in GH-deficient adults, Clin. Endocrinol. 41 (1994) 609–614. [40] J.O.L. Jørgensen, S.B. Pedersen, J.D. Børglum, et al., Fuel metabolism, energy expenditure, and thyroid function in growth hormone-treated obese women: a doubleblind placebo controlled study, Metabolism 43 (1994) 872–877. [41] O. Boss, S. SamecS, A. Dulloo, J. Seydoux, P. Muzzin, J.P. Giacobino, Tissue-dependent upregulation of rat uncoupling protein-2 expression in response to fasting

Disclosure The authors have nothing to disclose. Declaration of interest Conflicts of interest: None. Acknowledgements The authors are grateful to Dr. Toshio Kitamura for kindly providing the plasmids. This study was supported by grants from KAKENHI (16K08290 to K.M.), the Smoking Research Foundation, the MWU Bioscience Research Center (to K.M.), the Nakatomi Foundation (to K.F.), the TANITA Healthy Weight Community Trust (to K.F.), and the Foundation for Growth Science (to K.M., K. F.). References [1] J. Devesa, C. Almengló, P. Deves, Multiple effects of growth hormone in the body: is it really the hormone for growth? Clin. Med. Insights Endocrinol. Diabetes 12 (2016) 47–71. [2] C. Camacho-Hübner, Normal Physiology of Growth Hormone and Insulin-like Growth Factors in Childhood, in: L.J. De Groot, G. Chrousos, K. Dungan, et al. (Eds.), Endotext, MD Text.com, Inc., South Dartmouth (MA), 2000. [3] E. Inzaghi, S. Cianfarani, The challenge of growth hormone deficiency diagnosis and treatment during the transition from puberty into adulthood, Front. Endocrinol. (Lausanne). 20 (2013) 1–8. [4] Y. Furuhata, M. Nishihara, M. Takahashi, Effects of pulsatile secretion of growth hormone (GH) on fat deposition in human GH transgenic rats, Nutr. Res. Rev. 15 (2002) 231–244. [5] R.G. Clark, D.L. Mortensen, L.M. Carlsson, Insulin-like growth factor-1 and growth hormone (GH) have distinct and overlapping anabolic effects in GH-deficient rats, Endocrine 3 (1995) 297–304. [6] S. Harvey, K.L. Hull, Growth Hormone Action: Receptors, in: S. Harvey, G. Colin, S. William, H. Daughaday (Eds.), Growth Hormone, CRC Press, Florida, 1995, pp. 303–335. [7] T.G. Ramsay, A.D. Mitchell, M.P. Richards, Uncoupling protein expression in skeletal muscle and adipose tissue in response to in vivo porcine somatotropin treatment, Domest. Anim. Endocrinol. 35 (2008) 130–141. [8] D.J. Chia, Mechanisms of growth hormone-mediated gene regulation, Mol. Endocrinol. 28 (2014) 1012–1025. [9] M. Azam, H. Erdjument-Bromage, B.L. Kreider, et al., Interleukin-3 signals through multiple isoforms of Stat5, EMBO J. 14 (1995) 1402–1411. [10] K. Futawaka, T. Tagami, Y. Fukuda, et al., Growth hormone regulates the expression of UCP2 in myocytes, Growth Hormon. IGF Res. 29 (2016) 57–62. [11] W.H. Daughaday, Endocrinology-the way we were: a personal history of somatomedin, Growth Hormon. IGF Res. 16 (2006) S3–S5.

10

Growth Hormone & IGF Research xxx (xxxx) xxx–xxx

M. Hayashi et al.

[47] E.L. Seifert, V. Bézaire, C. Estey, M.E. Harper, Essential role for uncoupling protein3 in mitochondrial adaptation to fasting but not in fatty acid oxidation or fatty acid anion export, J. Biol. Chem. 283 (2008) 25124–25131. [48] P. Schrauwen, M.K. Hesselink, The role of uncoupling protein 3 in fatty acid metabolism: protection against lipotoxicity? Proc. Nutr. Soc. 63 (2004) 287–292. [49] J. Matsuda, K. Hosoda, H. Itoh, et al., Cloning of rat uncoupling protein-3 and uncoupling protein-2 cDNAs: their gene expression in rats fed high-fat diet, FEBS Lett. 418 (1997) 200–204. [50] D.W. Gong, S. Monemdjou, O. Gavrilova, et al., Lack of obesity and normal response to fasting and thyroid hormone in mice lacking uncouplingprotein-3, J. Biol. Chem. 275 (2000) 16251–16257. [51] A.J. Vidal-Puig, D. Grujic, C.Y. Zhang, et al., Energy metabolism in uncoupling protein 3 gene knockout mice, J. Biol. Chem. 275 (2000) 16258–16266. [52] D. Kim, S. Jitrapakdee, M. Thompson, Differential regulation of the promoter activity of the mouse UCP2 and UCP3 genes by MyoD and myogenin, J. Biochem. Mol. Biol. 40 (2007) 921–927.

or cold, FEBS Lett. 412 (1997) 111–114. [42] O. Boss, S. Samec, F. Kuhne, et al., Uncoupling protein-3 expression in rodent skeletal muscle is modulated by food intake but not by changes in environmental temperature, J. Biol. Chem. 273 (1998) 5–8. [43] L. Millet, H. Vidal, F. Andreelli, et al., Increased uncoupling protein-2 and -3 mRNA expression during fasting in obese and lean humans, J. Clin. Invest. 100 (1997) 2665–2670. [44] P.J. Randle, P.B. Garland, E.A. Newsholme, C.N. Hales, The glucose fatty acid cycle in obesity and maturity onset diabetes mellitus, Ann. N. Y. Acad. Sci. 131 (1965) 324–333. [45] V. Bezaire, L.L. Spriet, S. Campbell, et al., Constitutive UCP3 overexpression at physiological levels increases mouse skeletal muscle capacity for fatty acid transport and oxidation, FASEB J. 19 (2005) 977–979. [46] M. Jaburek, M. Varecha, R.E. Gimeno, et al., Transport function and regulation of mitochondrial uncoupling proteins 2 and 3, J. Biol. Chem. 274 (1999) 26003–26007.

11