Ghrelin modulates the immune response and increases resistance to Aeromonas hydrophila infection in hybrid tilapia

Journal Pre-proof Ghrelin modulates the immune response and increases resistance to Aeromonas hydrophila infection in hybrid tilapia Zhuojun Han, Yi Zhou, Xiaojin Zhang, Jinpeng Yan, Jun Xiao, Yongju Luo, Huifang Zheng, Huan Zhong PII:

S1050-4648(20)30006-1

DOI:

https://doi.org/10.1016/j.fsi.2020.01.006

Reference:

YFSIM 6742

To appear in:

Fish and Shellfish Immunology

Received Date: 28 August 2019 Revised Date:

1 January 2020

Accepted Date: 2 January 2020

Please cite this article as: Han Z, Zhou Y, Zhang X, Yan J, Xiao J, Luo Y, Zheng H, Zhong H, Ghrelin modulates the immune response and increases resistance to Aeromonas hydrophila infection in hybrid tilapia, Fish and Shellfish Immunology (2020), doi: https://doi.org/10.1016/j.fsi.2020.01.006. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier Ltd.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

Ghrelin modulates the immune response and increases resistance to Aeromonas hydrophila infection in hybrid tilapia Zhuojun Hana,b, Yi Zhoub, Xiaojin Zhangb,c, Jinpeng Yand, Jun Xiaob, Yongju Luob,c, Huifang Zhenga,e*, Huan Zhongb* a

College of Animal Science and Technology, Guangxi University, Nanning 530004, China

b

Guangxi Tilapia Genetic Breeding Center, Guangxi Academy of Fishery Sciences, Nanning, Guangxi

530021, China c

Key Laboratory of Aquatic Genetic Resources and Utilization, Ministry of Agriculture, Shanghai

Ocean University, Shanghai 201306, China d

Department of Cell Biology, School of Life Sciences, Central South University, Changsha 410017,

China e

Key Laboratory of Health Aquaculture and Nutrition Control of Aquatic Biology in Universities of

Guangxi, Nanning, Guangxi 530005, China *Corresponding author: Huifang Zheng E-mail: [email protected] College of Animal Science and Technology, Guangxi University, No. 100, East University Road, Nanning, Guangxi 530004, China Dr. Huan Zhong E-mail:[email protected] Guangxi Key Laboratory of Aquatic Genetic Breeding and Healthy Aquaculture, Guangxi Academy of Fishery Sciences, Qingshan Road 8, Nanning, Guangxi 530021, China

1

31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Ghrelin is a peptide hormone secreted by gastrointestinal tract which regulates multiple physiological processes such as appetite, metabolism, growth and gonad development in fish. In the present study, the effects of ghrelin on hybrid tilapia infected with Aeromonas hydrophila are elucidated. Juvenile hybrid tilapia fish (20.0± 5.0 g) were intraperitoneally injected with 0, 0.1, 1.0, or 10.0 ng/g ghrelin/body weight synthetic ghrelin alone or in combination with A. hydrophila (0.5×106 CFU). At 10 days post treatment, the survival rate in the group that received 1.0 ng/g ghrelin/body weight ghrelin in combination with A. hydrophila was higher (66.66%) than that of the Ah group (13.33%) that received A. hydrophila alone. In tilapia that received ghrelin injections, reactive oxygen species (ROS) levels tended to increase at 5 h, while injection of 10.0 ng/g ghrelin/body weight ghrelin resulted in a significant decrease in ROS levels at 10 h. No changes in serum immune or antioxidant-related indicators were observed in fish injected with A. hydrophila compared to controls. However, ghrelin injection decreased Albumin (ALB), glutathione peroxidase (GSH-Px), lysozyme (LZM) and superoxide dismutase (SOD). Histological analysis showed that ghrelin injection alleviated the pathological changes in liver and spleen caused by A. hydrophila infection. Overall, the expression of HSP70, IL-1β, and TGF-β in the liver tended to upregulate compared to the control. In the kidney, HSP70, IL-1β and TGF-β levels were increased, and TNF-α expression levels were decreased compared to the control. The HSP70 level in the spleen was decreased, and IL-1β, TGF-β, and TNF-α were expressed at significantly higher levels in the spleen in the tilapia that received ghrelin injections. Taken together, our results indicate that injection with 1.0 ng/g ghrelin/body weight ghrelin may effectively protect juvenile hybrid tilapia against A. hydrophila infection by improving hematological indicators, maintaining normal histology and regulating cytokine gene expression. Keywords: Ghrelin, Aeromonas hydrophila, hybrid tilapia, Survival rate, Immune response

2

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104

1. Introduction With the increase in the global aquatic market, tilapia, as one of the most commonly farmed fish, has been produced in increasing amounts in recent years. The expansion of market demand requires farmers to increase the intensity of farming, and this has led to several problems, including disease outbreaks and abuse of antibiotic drugs [1, 2]. Recent large-scale outbreaks of bacterial infection have hindered the growth of the tilapia farming industry. For example, infection of tilapia with Aeromonas hydrophila [3] and Streptococcus agalactiae [4] has caused great economic losses. In addition, these infectious diseases show fast transmission and, in the absence of early prevention and timely rescue, result in high mortality. Thus, the development of therapeutic drugs and strategies that can be used to control these pathogenic bacteria is urgently needed. A. hydrophila is a gram-negative bacterium belonging to the genus Aeromonas in the Vibrio family [5]. This bacterium is a widely distributed Aeromonas species in nature and is found in rivers, pools, and lakes. As a naturally existing bacterium, Aeromonas includes precursor microorganisms that may interact with other microorganisms to promote self-purification of water bodies [6]. At the same time, Aeromonas exists in normal microbial communities and within aquatic organisms, including fish. However, Aeromonas species have also been regarded as pathogenic bacteria in fish, leading to high mortality and deterioration of product quality and resulting in massive economic losses [7, 8]. A. hydrophila-infected fish usually show symptoms such as enteritis, bacterial septicemia and perforation [9, 10]. A number of pathogenic factors, including bacterial surface adhesion factors and a variety of exotoxins, have been found in A. hydrophila [11]. These pathogenic factors result in pathogenicity of A. hydrophila during the infection process in fish. Another review referred that the main pathogenic factors of A. hydrophila are hemolysin, aerolysin and protease [12]. Various methods and medicinal materials have been tested for their effectiveness in preventing or alleviating infection by A. hydrophila. Addition of Withania somnifera root to the diet has protective effects in A. hydrophila-infected Nile tilapia [13]. Dietary administration of probiotics Paenibacillus ehimensis NPUST1 can improve the resistance of Nile tilapia to A. hydrophila [14]. Supplementation of the diet with Bacillus licheniformis Dahb1 was shown to improve the growth performance, mucus and serum immune parameters, antioxidant enzyme activity and resistance to A. hydrophila in tilapia [15]. These studies of Chinese herbal medicines and probiotics suggest a direction for research on enhancing the autoimmunity and A. hydrophila resistance of tilapia, but these medicinal ingredients are expensive and difficult to obtain. Therefore, development of a variety of immune antipathogens that are derived from the fish itself or that can be obtained by chemical synthesis or microbial fermentation and used in the prevention and treatment of A. hydrophila infection is of great significance. Ghrelin is an endogenous ligand of the growth hormone secretagogue receptor. It was discovered by Kojima et al. [16] in 1999 in rat gastric tissue. In fish, ghrelin protein is mainly expressed in gastric tissues which regulates energy balance and appetite [17]. Ghrelin can bind to the growth hormone secretagogue receptor (GHSR) and stimulate GH release [18]. The pervasive expression of GHSR in tilapia tissues suggested that ghrelin may have multiple functions. The GHSR is a G-protein-coupled receptor that contains seven transmembrane domains and can promote the synthesis of growth hormone. Ghrelin also plays an important role in inflammatory responses and in tumorigenic diseases [19]. It can confer resistance to inflammation, mainly through the regulation of cytokine production [20]. As a self-expressed protein in fish, ghrelin can be expressed in large quantities at low cost through fermentation engineering technology. Therefore, as a new type of immunoregulatory factor, ghrelin has the potential for use as a therapeutic drug in the fish industry. 3

105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148

The hybrid Nile tilapia (O. niloticus) (♀) × blue tilapia (O. aureus) (♂) has become a main variety in the tilapia aquaculture industry worldwide in recent decades. This breeding population exhibits a high ratio of males, strong tolerance of low temperatures, rapid growth and high resistance to pathogenic infection [21]. Nevertheless, this hybrid is susceptible to A. hydrophila infection. In the present study, we aimed 1. to investigate the effect of ghrelin on the survival rate of tilapia infected with A. hydrophila and 2. to elucidate the effects of ghrelin on the innate immune system and to discover the molecular mechanism through which it improves the immune response in tilapia. 2. Materials and methods 2.1 Ghrelin synthesis We compared the three isoforms of ghrelin sequences in NCBI GenBank (isoform X1: XP_025763099.1; isoform X2: XP_025763100.1; isoform X3: XP_025763101.1). All of these isoforms have same mature sequences. According to the mature peptide from tilapia ghrelin in the NCBI

GenBank,

we

synthesized

the

mature

polypeptide

sequence

of

ghrelin

as

CGSSFLSPSQKPQNKVKSSRIGR. The polypeptide was synthesized by GenScript Biotechnology (Nanjing, China). The synthesized peptides were purified using high-performance liquid chromatography (HPLC) (Shimadzu, Japan) and confirmed based on molecular weight using LCMS2020 mass spectrometry (Shimadzu, Japan). 2.2 Pathogen and fish A. hydrophila was purchased from the Guangdong Institute of Microbiology under preservation number 1.551 (Guangzhou, China). The strain was cultured in LB liquid medium at 37°C for 24 h. The cultured A. hydrophila were collected by centrifugation for 10 min at 3000 revolutions/min (rpm). The supernatant was resuspended in phosphate-buffered saline at pH 7.4 (PBS 7.4). Subsequently, the bacterial suspension was diluted until the optical density [3] was 0.5 at 456 nm as determined using a Bio-Rad SmartSpec 3000 UV-visible spectrophotometer (Berkeley, CA, USA); this optical density corresponded to a concentration of 1×107 CFU ml-1. The hybrid tilapia used in the experiment were obtained from the Guangxi Academy of Fishery Sciences (Nanning, Guangxi). All the fish selected for the present study were healthy individuals with no obvious scars on the body surface. A total of 135 juvenile fish, each weighing 20.0±5.0 g (mean ± standard deviation), were used in the study. Prior to the experiment, all of the fish were acclimated to the experimental conditions for 7 days. The fish were maintained in tanks (1 m3 × 1 m3 × 1.5 m3) with a continuous flow system. The culture conditions were: water temperature 25-28°C, pH 7.2, and dissolved oxygen 6.50-8.00 mg/L. The fish were fed twice daily at 8:00 a.m. and 3:00 p.m. All experiments were conducted according to the guidelines set by the Animal Research and Ethics Committees of the Guangxi Academy of Fishery Sciences. 2.3 Challenge test Juvenile hybrid tilapia were randomly divided into 5 groups (n=15 for each group). The groups included a PBS-injected group (C group), an A. hydrophila-injected group (Ah group), a low-dose ghrelin group (L group), a medium-dose ghrelin group (M group) and a high-dose ghrelin group (H group). All the fish were injected as shown in Table 1. The injected materials were diluted in 0.1 ml PBS prior to intraperitoneal injection. The tilapia in the L group, the M group and the H group were injected with 2.0, 20.0, or 200.0 ng ghrelin per fish, respectively, as in a previous study [22]. After injection, the number of dead fish was recorded daily for 10 days. Because ghrelin expression could be changed by feeding conditions (feeding or starving) [23], all the fish were starved during the experimental trial. Dead fish were immediately removed from the tank when they were observed. 4

149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192

2.4 Immune response to ghrelin in tilapia with A. hydrophila infection 2.4.1 Sample collection Sixty fish were randomly assigned to 5 groups (C group, Ah group, L group, M group and H group, n=12 for each group). The fish were injected with various materials diluted in 0.1 ml PBS as shown in Table 1. At 5 h and 10 h postinjection, the fish were anesthetized with MS-222 and sacrificed. Whole blood was collected from the caudal vein, and the liver, kidney and spleen were excised. One part of the tissue was fixed in 4% polyformaldehyde for histological analysis, and another portion of the tissue was stored at -80°C for gene expression analysis. 2.4.2 Detection of serum indicators Samples taken from five individuals in each group at 5 h and 10 h postinjection were used in the serum indicators analysis. After overnight storage at 4°C, the supernatants obtained by centrifugation of whole blood at 3000 rpm for 10 min were taken as the serum samples. The serum samples were assayed at the Beijing Sino-UK Institute of Biological Technology (Beijing, China). The enzyme activities of glutathione peroxidase (GSH-Px), lysozyme (LZM), and superoxide dismutase (SOD) and the levels of reactive oxygen species (ROS) were analyzed on an A6 Semiautomatic Biochemical Instrument (Shiningsun, Beijing, China) using commercial kits obtained from the Beijing Sino-UK Institute of Biological Technology. Albumin [24] and total protein (TP) were assayed on a BS-420 automatic biochemical analyzer (Mindray, Shenzhen, China) using bromocresol green [25] and the biuret [26] method. 2.4.3 Histological analysis Liver, kidney and spleen were collected from the tilapia in each group at 10 h post-injection. The tissues were fixed in 4% polyformaldehyde, dehydrated in graded concentrations (70-100%) of alcohol and embedded in paraffin. Sections were cut using a microtome (RM 2135, Leica, Wetzlar, Germany) and stained with hematoxylin and eosin. The histological characteristics of the liver, kidney and spleen were observed under 40× magnification on an optical microscope (OLYMPUS-BX43, Mshot, Guangzhou, China). 2.4.4 Real-time quantitative PCR TRIzol reagent (Takara, Beijing, China) was employed for RNA extraction. After isolation of total RNA, the quality of the extracted RNA was determined by 1.2% agarose gel electrophoresis. The concentration of total RNA was measured using a Bio-Rad SmartSpec 3000 UV-visible spectrophotometer based on the absorbance at 260 nm. The cDNA used in the quantitative reverse transcription polymerase chain reaction (RT-PCR) was synthesized using a PrimeScript RT reagent Kit with gDNA Eraser (Takara, Beijing, China) using 1 µg total RNA according to the manufacturer’s instructions. The gDNA eraser from the kit was used to remove genomic DNA. After reverse transcription, the cDNA (20 µl) was diluted to a volume of 200 µl in ultrapure water and stored at -20°C until use. The primers used to transcribe cytokine genes were designed based on the tilapia sequences in the NCBI GenBank using Primer Express 3.0 software (Applied Biosystems, Foster City, USA) (Table 2). The total volume of each PCR was 10 µl, including 5 µl SYBR, 0.4 µl forward primer, 0.4 µl reverse primer, 0.8 µl cDNA and 3.4 µl ultrapure water. PCR was performed on a Pikoreal 96 Real-Time PCR system (Thermo Fisher Scientific, USA). The amplification conditions were as follows: 95°C for 7 min followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. Each sample was run in quadruplicate. Melting curve analysis was performed to confirm the specific amplification of the region defined by the primers. Relative expression was calculated using the 2(- Delta Delta CT) method [27]. 5

193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236

2.5 Statistical analysis The significant differences in Kaplan-Meier curve analysis were determined using log-rank (Mantel-Cox) test in GraphPad Prism 6. Serum indicators and gene expression in this study were shown as the mean ± standard deviation (SD). Significant differences among the groups were determined using one-way ANOVA followed by Tukey’s test using SPSS 17.0 statistical software (SPSS Inc., Chicago, IL, USA). A P-value of <0.05 was taken to indicate significant difference. 3. Results 3.1 Synthesis and treatment of ghrelin peptide The ghrelin peptide was synthesized using the solid-phase chemical method. The synthesized ghrelin was purified by HPLC, and the purity of the final product was determined as approximately 90.1% (Fig. 1A). We also used mass spectrometry to identify the synthetic peptide; the results showed that the synthesized peptide matched the known amino acid sequence of ghrelin (Fig. 1B). 3.2 Survival curve After injection with 0.5×106 A. hydrophila CFU/fish, the final survival rate of the Ah group was 13.33% over a 10-day period. The fish in the M group (injection with 0.5×106 CFU/fish and 20.0 ng ghrelin/fish) showed an improved survival rate significantly; their survival rate was 66.66% over the 10-day experimental period. The final survival rate of the fish in the L and H groups were 46.66% and 56.66%, respectively. The control group (PBS) showed 100% survival rate. These results suggest that there was amelioration of the survival rate after A. hydrophila infection (Fig. 2). 3.3 Serum immune-related and antioxidant-related indicators The serum immunity- and antioxidant-related markers of tilapia are shown in Fig. 3. No significant difference in ALB was found among the groups at 5 h, and only the M and H groups showed a significant decrease in ALB activity compared to the control at 10 h (Fig. 3A). Only the fish in the H group showed significantly decreased GSH-Px activity compared to the control at 5 h. No significant differences among the groups were observed at 10 h (Fig. 3B). The groups that received ghrelin injection showed decreased LZM activity compared to the control at 5 h, whereas at 10 h, only the H group had lower LZM activity than the other groups (Fig. 3C). The M and H groups showed a significant increase in ROS activity at 5 h, while the H group showed decreased ROS activity compared to the other groups (Fig. 3D). SOD activities were significantly lower in the M and H groups than in the other groups at 5 h. At 10 h, the H group had lower SOD activity than the other groups (Fig. 3E). No effects of ghrelin or A. hydrophila injection on TP levels in serum were observed (Fig. 3D). We also observed that ALB, GSH-Px, LZM, ROS, SOD and TP did not change after A. hydrophila injection compared to the levels found in control tilapia (Fig. 3). 3.4 Histopathology of A. hydrophila infection in tilapia Analysis of histological sections showed that the liver structure changed after infection with A. hydrophila. In the Ah group, the hepatocytes appeared swollen. Due to this swelling, the nuclei of the hepatocytes were shifted and gathered, indicating toxicity due to the bacterial infection. The ghrelin injection groups (L, M and H) showed alleviation of the pathological changes caused by A. hydrophila infection (Fig. 4A). Normal renal tubules, tubular lumen and glomeruli were found in the control group. The Ah group showed no significant changes in histomorphology compared to the control group. Similar results were found in the ghrelin injection groups (L, M and H) (Fig. 4B). These results indicate less severe toxic effects of A. hydrophila on kidney histology in hybrid tilapia. The spleens of tilapia in the control group showed normal structure, with separated red blood cells 6

237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280

and lymphocytes. All the groups displayed accumulations of melanomacrophages. However, the Ah group showed more a diffuse distribution of melanomacrophages. In addition, after 10 h infection with A. hydrophila, the spleen showed symptoms of hemorrhage. The red blood cells and lymphocytes could not be easily distinguished. In the ghrelin injection groups (L, M and H), the symptoms of hemorrhage and the diffuse distribution of melanomacrophages were alleviated (Fig. 4C). 3.5 Changes in the expression of immune-related genes in liver, kidney and spleen To evaluate the stress tolerance and the expression of cytokine genes in liver, kidney and spleen of tilapia, the expression of the genes encoding HSP70, IL-1β, TGF-β and TNF-α was measured by RT-qPCR. In liver, the H group showed significantly higher expression of HSP70 compared to the control at 5 h (Fig. 5A). Only the H group showed a significant increase in IL-1β mRNA expression compared to the control at 5 h. The other groups, including the Ah group, displayed no significant changes (Fig. 5B). The M and H groups at 5 h and the Ah group at 10 h showed significant upregulation of the expression of TGF-β compared to the control (Fig. 5C). The Ah, M and H groups showed significantly decreased TNF-α mRNA levels in liver compared to the control at 10 h (Fig. 5D). In kidney, expression of HSP70 was increased in H group at 5 h (Fig. 6A). Although none of the groups showed significant differences in IL-1β expression at 5 h, the L group showed a significant increase in IL-1β expression over the control at 10 h (Fig. 6B). The M group had higher expression of TGF-β than the other groups at 5 h (Fig. 6C). TNF-α expression was significantly decreased in other groups at 5 h compared to the control, while the other groups showed no significant changes in TNF-α expression in kidney (Fig. 6D). In spleen, HSP70 expression was significantly decreased in the Ah and L group compared to the control at 5 h, but no significant differences were found at 10 h (Fig. 7A). In the H group, IL-1β expression increased significantly compared to the control and Ah groups at both 5 h and 10 h (Fig. 7B). The H group showed significantly higher expression of TGF-β than the other groups at 5 h. At 10 h, the M and H groups displayed significantly increased TGF-β expression compared to the control (Fig. 7C). Only the H group had significantly increased expression of TNF-α at 5 h, and no significant differences among any of the groups were observed at 10 h in the spleen (Fig. 7D). 4. Discussion Ghrelin is a well-known hormone that regulates appetite; thus, there has been a focus on its function in food intake and growth in fish. Recent studies show that ghrelin can also be considered an antimicrobial peptide and that it plays a crucial role in immune regulation. Thus, investigation of the multiple functions of this peptide hormone may yield novel strategies that can be used to promote the yield and health of farmed fish. Unfortunately, the protective effects of ghrelin against disease have not been demonstrated. In the present study, we synthesized the mature ghrelin peptide of tilapia and developed an approach in which ghrelin injection was used to improve the survival rate of tilapia after A. hydrophila infection. The results showed that a dose of ghrelin of 20.0 ng/fish increased the survival rate in juvenile fish. To date, most studies using ghrelin injection have focused on its regulatory roles in stimulating food intake [28] and increasing plasma GH levels [29]. Delivery of ghrelin through implanted micro-osmotic pumps was shown to induce fat deposition in tilapia liver [30]. To our knowledge, our data are the first to show the protective effects of ghrelin in tilapia infected with A. hydrophila. We propose that two major mechanisms contribute to the amelioration of the effects of A. hydrophila infection by ghrelin: 1. ghrelin is a potential antimicrobial peptide that can decrease the activity of A. hydrophila; 2. through regulation of their internal immune defenses, the fish acquired 7

281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324

stronger resistance to the pathogen. To elucidate the mechanism through which ghrelin mediates immune function, we further monitored changes in serum indicators, histological parameters and the expression of key genes during the process of A. hydrophila infection. Aggregations of hemocytes and pyknotic nuclei in the liver were reported 10 days after infection of blue tilapia with A. hydrophila. Similarly, our results showed that nuclei were shifted and gathered in the Ah group. This histological change is thought to result from the effects of the toxins secreted by A. hydrophila, including protease, hemolysin and elastase, on the arrangement of hepatocytes in the liver [31]. The effect of A. hydrophila infection on gene expression in the kidney is recognized. However, the histological changes that occur after A. hydrophila infection are limited. The present study found no changes in hybrid tilapia kidney 10 h after A. hydrophila infection. In our opinion, hybrid tilapia exhibit heterosis that increases their resistance to pathogens, and 10 h may be too short a time to allow histological changes to develop in the kidney. In mandarin fish (Siniperca chuatsi), disordered arrangements of cells and cytoplasmic vacuolization were found after A. hydrophila infection [32]. Similarly, our results showed that A. hydrophila infection increased symptoms of hemorrhage and resulted in a diffuse distribution of melanomacrophages in the spleen. This evidence indicates that at the beginning of A. hydrophila infection (10 h) in hybrid tilapia, changes in the liver and spleen occur more rapidly than changes in the kidney. Intriguingly, we found that administration of ghrelin reduced the symptoms of liver and spleen injury due to A. hydrophila. These effects of ghrelin may be mediated by its function as an anti-pathogen and may occur through immunomodulation. GSH-Px and SOD are crucial indicators of oxidative stress. Several studies have suggested that increased GSH-Px and SOD activities in serum indicate improved antioxidant capacity. For example, plant polysaccharides [33] and W. somnifera root powder [13] increased GSH-Px and SOD levels and improved resistance to A. hydrophila infection in tilapia. In contrast, our data show that ghrelin injection resulted in decreased GSH-Px and SOD levels in several of the experimental groups. Similar to our result, Chlorella vulgaris decreased GSH-Px and SOD levels in serum and promoted immune response and disease resistance in tilapia [34]. When the cell membranes of phagocytes are stimulated, the cells produce a large amount of ROS through the respiratory burst mechanism; this ROS is the main mediator of phagocytosis and killing and provides a measure of immunity. The data obtained in the current study showed that ROS activity increased at 5 h but decreased at 10 h after ghrelin injection. When endogenous or exogenous stimuli are present, increased ROS levels lead to oxidative stress that enables cells to cope with pathogenic infections. Dietary supplementation with 105 cfu g-1 or 107 cfu g-1 of the probiotic Bacillus licheniformis Dahb1 for 4 weeks increased ROS in Oreochromis mossambicus infected with A. hydrophila [15]. The decrease in ROS activity observed at 10 h in the present study may result from a feedback mechanism related to high concentrations of ROS in a long-term effect of ghrelin. As an antimicrobial enzyme, LZM destroys the cell walls of bacteria by degrading peptidoglycans. Surprisingly, LZM tended to decease in ghrelin-injected tilapia infected with A. hydrophila. This is similar to the result obtained after feeding Chlorella vulgaris to Nile tilapia to regulate immune function [34]. The decrease in LZM may be due to the negative impact of pathogenic bacteria and is probably related to the participation of ghrelin in a different regulatory pathway. A previous report showed that TP and ALB levels decreased during A. hydrophila infection and increased after treatment with a prebiotic [35]. In our study, only 1.0 ng/g ghrelin/body weight and 10.0 ng/g ghrelin/body weight ghrelin were found to decrease ALB levels in serum at 10 h post-injection, indicating a feedback mechanism similar to that observed for ROS activity. There were no significant differences in serum indices in the control and Ah groups. This may be due to the greater resistance of 8

325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368

hybrid tilapia to pathogenic infections. We also found that the levels of some of the serum indicators measured in our study differed from those reported previously. As a hormone, the function of ghrelin depends on its receptors. Thus, the functional pathways associated with its effects on the immune system may differ from those that produce its dietary effects. In addition, injection of high levels of hormones may activate feedback mechanisms that contribute to negative effects. Finally, higher concentrations of ghrelin may possibly induce immune fatigue in tilapia [36]. Cytokines, including IL-1β, TGF-β, and TNF-α, are synthesized and secreted by immune cells and some nonimmune cells after stimulation. Immunogens, mitogens and other stimuli induce the production of these low-molecular-weight soluble proteins by multiple types of immune-related cells. In our study, IL-1β levels showed no significant changes at 5 h or 10 h post-injection in Ah compared to the control, indicating relatively weak effects of A. hydrophila infection on the expression of the IL-1β gene over a short period. However, we observed increased IL-1β levels in the tested tissues, including liver, kidney and spleen, in several groups. This result suggests that ghrelin has regulatory effects on the expression of IL-1β in tilapia. A probiotic, Lactobacillus delbrueckii, showed a strong effect on disease resistance against A. hydrophila and depressed IL-1β levels in the intestine [37]. Unlike IL-1β, TGF-β in liver increased significantly 10 h after A. hydrophila infection. This is consistent with previously reported results [38, 39]. In addition, after ghrelin injection, the upregulated TGF-β expression that occurred in untreated tilapia after A. hydrophila infection was decreased to normal levels. As a transforming growth factor, TGF-β acts primarily in inflammation and plays a role in wound repair and hematopoiesis [40]. High expression of TGF-β was found in topmouth culter (Culter alburnus) induced by LPS. Upregulation of TGF-β was also observed in the gills of tilapia infected with Cichlidogyrus sclerosus. These changes in TGF-β expression are consistent with the response of hybrid tilapia to A. hydrophila. The offsetting effect of ghrelin may rescue the dysfunction in TGF-β expression that otherwise occurs during the infection process. After A. hydrophila infection, TNF-α expression levels were decreased in liver at 10 h and in kidney at 5 h. In the three-striped trumpeter Latris lineata, TNF-α level in spleen cells did not change after Chondracanthus goldsmidi infection, but it was upregulated in head kidney cells [41]. Thus, changes in TNF-α expression are tissue-dependent. Moreover, we found that in the ghrelin injection groups, TNF-α expression was recovered compared to the infection group in liver. The stimulatory action of ghrelin on growth hormone (GH) release has been reported previously [42]. Injection of GH was shown to promote TNF-α expression in tilapia liver [43]. Thus, we conclude that ghrelin increased TNF-α expression by upregulating GH levels. HSP70 showed less marked changes in expression among the groups. Its expression was regulated by ghrelin only at 5 h in the liver in the H group and at 5 h in the spleen in the L group, suggesting that ghrelin has immunomodulatory effects on a key factor in the stress response. 5. Conclusion In conclusion, the present study demonstrated for the first time that ghrelin acts as an immunomodulatory hormone that enhances immunity and disease resistance to A. hydrophila injection with ghrelin at levels of 1.0 ng/g ghrelin/body weight protected juvenile hybrid tilapia against A. hydrophila infection. The results suggest that ghrelin decreased mortality in infected tilapia by alleviating histological and hematological symptoms and regulating cytokine gene expression. Acknowledgments This work was supported by the National Natural Science Foundation of China (grant no. 31760756, 31672627), the Natural Science Foundation of Guangxi (grant no. 2017GXNSFFA198001) and China 9

369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412

Agriculture Research System (CARS-46). References [1] S.H. Monteiro, J.G. Francisco, T.F. Campion, R.F. Pimpinato, G.C.R. Moura Andrade, F. Garcia, V.L. Tornisielo, Multiresidue antimicrobial determination in Nile tilapia (Oreochromis Niloticus) cage farming by liquid chromatography tandem mass spectrometry, Aquaculture 447 (2015) 37-43. [2] J.E.M. Watts, H.J. Schreier, L. Lanska, M.S. Hale, The rising tide of antimicrobial resistance in aquaculture: sources, sinks and solutions, Mar Drugs 15(6) (2017) 158. [3] V.R. Reque, J.R.E. de Moraes, M.A. de Andrade Belo, F.R. de Moraes, Inflammation induced by inactivated Aeromonas hydrophila in Nile tilapia fed diets supplemented with Saccharomyces cerevisiae, Aquaculture 300(1) (2010) 37-42. [4] J. Sun, W. Fang, B. Ke, D. He, Y. Liang, D. Ning, H. Tan, H. Peng, Y. Wang, Y. Ma, Inapparent Streptococcus agalactiae infection in adult/commercial tilapia, Sci Rep 6 (2016) 26319. [5] N. Van Hai, Research findings from the use of probiotics in tilapia aquaculture: a review, Fish Shellfish Immunol 45(2) (2015) 592-597. [6] P. Rajasulochana, V. Preethy, Comparison on efficiency of various techniques in treatment of waste and sewage water – A comprehensive review, Resource-Efficient Technologies 2(4) (2016) 175-184. [7] J.M. Janda, S.L. Abbott, The Genus Aeromonas Taxonomy, Pathogenicity, and Infection, Clin Microbiol Rev 23(1) (2010) 35. [8] M.E. El-Boshy, A.M. El-Ashram, F.M. AbdelHamid, H.A. Gadalla, Immunomodulatory effect of dietary Saccharomyces cerevisiae, β-glucan and laminaran in mercuric chloride treated Nile tilapia (Oreochromis niloticus) and experimentally infected with Aeromonas hydrophila, Fish Shellfish Immunol 28(5) (2010) 802-808. [9] M.K.R. Dias, L.S. Sampaio, A.A. Proietti-Junior, E.T.O. Yoshioka, D.P. Rodrigues, A.F.R. Rodriguez, R.A. Ribeiro, F.S.E.D.V. Faria, R.O.A. Ozório, M. Tavares-Dias, Lethal dose and clinical signs of Aeromonas hydrophila in Arapaima gigas (Arapaimidae), the giant fish from Amazon, Vet Microbiol 188 (2016) 12-15. [10] X. Huang, M. Peng, J. Huang, D. Hu, Y. Peng, Y. Huang, J. Shi, H. Wen, G. Wei, Acquisition and vanishing rate of drug resistance of Aeromonas hydrophila in Pelteobagrus fulvidraco against sarafloxacin hydrochloride, Jounarl of southern agriculture 44(10) (2013) 1731-1734. [11] C.R. Rasmussen-Ivey, M.J. Figueras, D. McGarey, M.R. Liles, Virulence factors of Aeromonas hydrophila: in the wake of reclassification, Front Microbiol 7 (2016) 1337. [12] D. Stratev, O.A. Odeyemi, Antimicrobial resistance of Aeromonas hydrophila isolated from different food sources: A mini-review, J Infect Public Health 9(5) (2016) 535-544. [13] E. Zahran, E.A. Abd El-Gawad, E. Risha, Dietary Withania sominefera root confers protective and immunotherapeutic effects against Aeromonas hydrophila infection in Nile tilapia (Oreochromis niloticus), Fish Shellfish Immunol 80 (2018) 641-650. [14] S.-W. Chen, C.-H. Liu, S.-Y. Hu, Dietary administration of probiotic Paenibacillus ehimensis NPUST1 with bacteriocin-like activity improves growth performance and immunity against Aeromonas hydrophila and Streptococcus iniae in Nile tilapia (Oreochromis niloticus), Fish Shellfish Immunol 84 (2019) 695-703. [15] N. Gobi, B. Vaseeharan, J.-C. Chen, R. Rekha, S. Vijayakumar, M. Anjugam, A. Iswarya, Dietary supplementation of probiotic Bacillus licheniformis Dahb1 improves growth performance, mucus and serum immune parameters, antioxidant enzyme activity as well as resistance against Aeromonas 10

413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456

hydrophila in tilapia Oreochromis mossambicus, Fish Shellfish Immunol 74 (2018) 501-508. [16] M. Kojima, H. Hosoda, Y. Date, M. Nakazato, H. Matsuo, K. Kangawa, Ghrelin is a growth-hormone-releasing acylated peptide from stomach, Nature 402(6762) (1999) 656-660. [17] E. Jönsson, The role of ghrelin in energy balance regulation in fish, Gen Comp Endocrinol 187 (2013) 79-85. [18] N. Khatib, S. Gaidhane, A.M. Gaidhane, M. Khatib, P. Simkhada, D. Gode, Q.S. Zahiruddin, Ghrelin: ghrelin as a regulatory Peptide in growth hormone secretion, J Clin Diagn Res 8(8) (2014) MC13–MC17. [19] S. Brod, L. Rattazzi, G. Piras, F. D'Acquisto, ‘As above, so below’ examining the interplay between emotion and the immune system, Immunology 143(3) (2014) 311-318. [20] R. Barazzoni, G. Biolo, M. Zanetti, A. Bernardi, G. Guarnieri, Inflammation and Adipose Tissue in Uremia, J Ren Nutr 16(3) (2006) 204-207. [21] J. Deng, Y. Wang, L. Chen, K. Mai, Z. Wang, X. Zhang, Effects of replacing plant proteins with rubber seed meal on growth, nutrient utilization and blood biochemical parameters of tilapia (Oreochromis niloticus × O. aureus), Aquac Nutr 23(1) (2017) 30-39. [22] B.K. Fox, L.G. Riley, C. Dorough, H. Kaiya, T. Hirano, E.G. Grau, Effects of homologous ghrelins on the growth hormone/insulin-like growth factor-I axis in the tilapia, Oreochromis mossambicus, Zoolog Sci 24(4) (2007) 391-400, 10. [23] E.M. Hevrøy, C. Azpeleta, M. Shimizu, A., A. Lanzén, H. Kaiya, M. Espe, P.A. Olsvik, Effects of short-term starvation on ghrelin, GH-IGF system, and IGF-binding proteins in Atlantic salmon. Fish Physiol Biochem. 37 (2011), 217-232. [24] N.K. Abdelkhalek, I.A. Eissa, E. Ahmed, O.E. Kilany, M. El-Adl, M.A. Dawood, A.M. Hassan, M.M. Abdel-Daim, Protective role of dietary Spirulina platensis against diazinon-induced Oxidative damage in Nile tilapia; Oreochromis niloticus, Environ Toxicol Pharmacol 54 (2017) 99-104. [25] A.T. Mansour, M.Á. Esteban, Effects of carbon sources and plant protein levels in a biofloc system on growth performance, and the immune and antioxidant status of Nile tilapia (Oreochromis niloticus), Fish Shellfish Immunol 64 (2017) 202-209. [26] A. Brum, S.A. Pereira, M.S. Owatari, E.C. Chagas, F.C.M. Chaves, J.L.P. Mouriño, M.L. Martins, Effect of dietary essential oils of clove basil and ginger on Nile tilapia (Oreochromis niloticus) following challenge with Streptococcus agalactiae, Aquaculture 468 (2017) 235-243. [27] K.J. Livak, T.D. Schmittgen, Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−∆∆CT Method, Methods 25(4) (2001) 402-408. [28] C. Navarro-Guillén, M. Yúfera, S. Engrola, Ghrelin in Senegalese sole (Solea senegalensis) post-larvae: Paracrine effects on food intake, Comp Biochem Physiol A Mol Integr Physiol 204 (2017) 85-92. [29] S. Ogawa, X. Liu, B.S. Shepherd, I.S. Parhar, Ghrelin stimulates growth hormone release from the pituitary via hypothalamic growth hormone-releasing hormone neurons in the cichlid, Oreochromis niloticus, Cell Tissue Res 374(2) (2018) 349-365. [30] L.G. Riley, B.K. Fox, H. Kaiya, T. Hirano, E.G. Grau, Long-term treatment of ghrelin stimulates feeding, fat deposition, and alters the GH/IGF-I axis in the tilapia, Oreochromis mossambicus, Gen Comp Endocrinol 142(1) (2005) 234-240. [31] S.A. AlYahya, F. Ameen, K.S. Al-Niaeem, B.A. Al-Sa'adi, S. Hadi, A.A. Mostafa, Histopathological studies of experimental Aeromonas hydrophila infection in blue tilapia, Oreochromis aureus, Saudi J Biol Sci 25(1) (2018) 182-185. 11

457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497

[32] N. Chen, J. Jiang, X. Gao, X. Li, Y. Zhang, X. Liu, H. Yang, X. Bing, X. Zhang, Histopathological analysis and the immune related gene expression profiles of mandarin fish (Siniperca chuatsi) infected with Aeromonas hydrophila, Fish Shellfish Immunol 83 (2018) 410-415. [33] E. Wang, X. Chen, K. Wang, J. Wang, D. Chen, Y. Geng, W. Lai, X. Wei, Plant polysaccharides used as immunostimulants enhance innate immune response and disease resistance against Aeromonas hydrophila infection in fish, Fish Shellfish Immunol 59 (2016) 196-202. [34] A.A.A. Galal, R.M. Reda, A. Abdel-Rahman Mohamed, Influences of Chlorella vulgaris dietary supplementation on growth performance, hematology, immune response and disease resistance in Oreochromis niloticus exposed to sub-lethal concentrations of penoxsulam herbicide, Fish Shellfish Immunol 77 (2018) 445-456. [35] P. Yarahmadi, H. Ghafari Farsani, A. Khazaei, M. Khodadadi, G. Rashidiyan, M.A. Jalali, Protective effects of the prebiotic on the immunological indicators of rainbow trout (Oncorhynchus mykiss) infected with Aeromonas hydrophila, Fish Shellfish Immunol 54 (2016) 589-597. [36] J.-h. Wang, L.-q. Zhao, J.-f. Liu, H. Wang, S. Xiao, Effect of potential probiotic Rhodotorula benthica D30 on the growth performance, digestive enzyme activity and immunity in juvenile sea cucumber Apostichopus japonicus, Fish Shellfish Immunol 43(2) (2015) 330-336. [37] C.-N. Zhang, J.-L. Zhang, W.-C. Guan, X.-F. Zhang, S.-H. Guan, Q.-H. Zeng, G.-F. Cheng, W. Cui, Effects of Lactobacillus delbrueckii on immune response, disease resistance against Aeromonas hydrophila, antioxidant capability and growth performance of Cyprinus carpio Huanghe var, Fish Shellfish Immunol 68 (2017) 84-91. [38] G. Chen, Y. Liu, J. Jiang, W. Jiang, S. Kuang, L. Tang, W. Tang, Y.-A. Zhang, X. Zhou, L. Feng, Effect of dietary arginine on the immune response and gene expression in head kidney and spleen following infection of Jian carp with Aeromonas hydrophila, Fish Shellfish Immunol 44(1) (2015) 195-202. [39] O.-J. Park, J. Kim, J. Yang, C.-H. Yun, S.H. Han, Enterococcus faecalis inhibits osteoblast differentiation and induces chemokine expression, J Endod 41(9) (2015) 1480-1485. [40] M.A. Travis, D. Sheppard, TGF-β Activation and function in immunity, Annual Rev Immunol 32(1) (2014) 51-82. [41] J.M. Covello, S. Bird, R.N. Morrison, S.C. Battaglene, C.J. Secombes, B.F. Nowak, Cloning and expression analysis of three striped trumpeter (Latris lineata) pro-inflammatory cytokines, TNF-α, IL-1β and IL-8, in response to infection by the ectoparasitic, Chondracanthus goldsmidi, Fish Shellfish Immunol 26(5) (2009) 773-786. [42] C.D. Foradori, B.K. Whitlock, J.A. Daniel, A.D. Zimmerman, M.A. Jones, C.C. Read, B.P. Steele, J.T. Smith, I.J. Clarke, T.H. Elsasser, Kisspeptin stimulates growth hormone release by utilizing neuropeptide Y pathways and is dependent on the presence of ghrelin in the ewe, Endocrinology 158(10) (2017) 3526-3539. [43] N. Shved, G. Berishvili, P. Mazel, J.F. Baroiller, E. Eppler, Growth hormone (GH) treatment acts on the endocrine and autocrine/paracrine GH/IGF-axis and on TNF-α expression in bony fish pituitary and immune organs. Fish Shellfish Immunol 31(6) (2011) 944-952.

12

498 499 500 501 502 503 504 505 506

Figure Legends

507

group: injection with 0.5 × 106 A. hydrophila CFU and 200 ng ghrelin. Symbols (*, Δ, #) indicate

508

significant difference (p<0.05) by log-rank (Mantel-Cox) test. * vs. Δ, * vs. #, Δ vs. #, p<0.05. Same

509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539

symbol in groups showed no significant differences.

Fig. 1 Synthesis of tilapia ghrelin. (A) Chromatogram of the purified ghrelin; the purity of the final product was 90.1%. (B) Mass spectrum indicating that the synthetic peptide matches the amino acid sequence of tilapia ghrelin. Fig. 2 The survival rate (%) of hybrid tilapia was recorded daily for 10 days after intraperitoneal injection. Seventy-five juvenile hybrid tilapia were used (n=15). C group: injection with PBS; Ah group: injection with 0.5 × 106 A. hydrophila CFU; L group: injection with 0.5 × 106 A. hydrophila CFU and 2.0 ng ghrelin; M group: injection with 0.5 × 106 A. hydrophila CFU and 20 ng ghrelin; H

Fig. 3 Serum immune- and antioxidant-related indicators after intraperitoneal injection. (A) albumin (ALB) concentration, (B) glutathione peroxidase (GSH-Px) activity, (C) lysozyme (LZM) activity, (D) reactive oxygen species (ROS), (E) superoxide dismutase (SOD) activity and (F) total protein (TP) concentration in sera from hybrid tilapia at 5 h and 10 h after A. hydrophila infection. The bars represent the mean ± SD (n=5). The white bars show the results at 5 h; the dark gray bars show the results at 10 h. Different superscripted letters indicate significant differences (p < 0.05). Fig. 4 Histological analysis of liver, kidney and spleen of hybrid tilapia after H&E staining. The liver sections showed hepatocyte swelling (black arrow), nuclear migration and aggregation (green arrow) in the Ah group. The kidney sections displayed normal renal tubules and glomeruli in the control group; no significant changes were observed in the Ah, L, M or H groups. The spleen sections showed that the structure of the spleen was normal in the control group; red blood cells and lymphocytes were separated (red arrow). Melanomacrophages appeared aggregated in all groups, but more melanomacrophages were diffusely distributed in the Ah group (blue arrow). The spleen showed hemorrhagic symptoms, and the hemorrhagic symptoms and the spread of melanomacrophages were alleviated after ghrelin injection. Bar=50 µm. Fig. 5 Effects of ghrelin on the relative expression levels of HSP70, IL-1β, TGF-β, and TNF-α in the livers of hybrid tilapia 5 h and 10 h after infection with A. hydrophila. The bars represent the mean ± SD (n=5). The white bars show the results at 5 h; the dark gray bars show the results at 10 h. Different lower-case letters indicate significant differences (p < 0.05). HSP70: heat shock protein 70; IL-1β: interleukin-1β; TGF-β: transforming growth factor-β; TNF-α: tumor necrosis factor α. Fig. 6 Effects of ghrelin on the relative expression levels of HSP70, IL-1β, TGF-β, and TNF-α in the kidneys of hybrid tilapia 5 h and 10 h after infection with A. hydrophila. The bars represent the mean ± SD (n=5). The white bars show the results at 5 h; the dark gray bars show the results at 10 h. Different lower-case letters indicate significant differences (p < 0.05). HSP70: heat shock protein 70; IL-1β: interleukin-1β; TGF-β: transforming growth factor-β; TNF-α: tumor necrosis factor α.

13

540 541 542 543 544 545 546

Fig. 7 Effects of ghrelin on the relative expression levels of HSP70, IL-1β, TGF-β, TNF-α in the spleens of hybrid tilapia 5 h and 10 h after infection with A. hydrophila. The bars represent the mean ± SD (n=5). The white bars show the results at 5 h; the dark gray bars show the results at 10 h. Different lower-case letters indicate significant differences (p < 0.05). HSP70: heat shock protein 70; IL-1β: interleukin-1β; TGF-β: transforming growth factor-β; TNF-α: tumor necrosis factor α.

14

Table 1 injected ingredients for each group. PBS (ml/fish) A. hydrophila (CFU/fish) Ghrelin (ng/fish)

group C

group Ah

group L

group M

group H

0.1 0.0

0.1 0.5×106

0.1 0.5×106

0.1 0.5×106

0.1 0.5×106

0.0

0.0

2.0

20.0

200.0

Table 2 Primers used for RT-PCR analysis Primer name

Oligonucleotide (5’-3’)

References (NCBI accession No.)

HSP70-F

GTGTCCAACGCTGTCATCAC

HSP70-R IL-1β-F IL-1β-R

TGCCTTTGTCCAGACCGTAG TGCACTGTCACTGACAGCCAA ATGTTCAGGTGCACTTTGCGG

TGF-β-F TGF-β-R

TGCGGCACCCAATCACACAAC GTTAGCATAGTAACCCGTTGGC

JF957374.1

TNF-α-F TNF-α-R

GAGGCCAACAAAATCATCATCCC CTTCCCATAGACTCTGAGTAGCG

JF957373.1

Actin-β-F

CCACAGCCGAGAGGGAAAT

Actin-β-R

CCATCTCCTGCTCGAAGTC

JF957367.1 JF957370.1

XM_003443127

Highlights • Ghrelin injection improved survival rate of A. hydrophila infected tilapia. • Ghrelin treatment increased the reactive oxygen species levels. • Ghrelin injection alleviated the haptic histology changes caused by A. hydrophila infection. • Immune related genes were regulated by ghrelin in liver and spleen.