Giant linear plasmids of β-lactam antibiotic producing Streptomyces

ELSEVIER

FEMS Microbiology

Letters 131 (199.5) 27-34

Giant linear plasmids of p-lactam antibiotic producing Streptomyces Donald J. Netolitzky, Xiaoning Wu ‘, Susan E. Jensen, Kenneth L. Roy

*

Department of Biological Sciences, University of Alberta, Edmonton, AB, Canada T6G 2E9 Received 6 March 1995; revised 26 May 1995; accepted 31 May 1995

Abstract A survey of the total cellular DNA from five /3-lactam antibiotic-producing Streptomyces spp. by pulsed field gel electrophoresis was conducted to investigate the presence of linear plasmids. Streptomyces cluuuligerus NRRL 3585 contained two giant linear plasmids of 120 and 430 kb, in addition to the well-characterized 11.7 kb linear plasmid. Streptomyces griseus NRRL 3851 contained a single giant linear plasmid of 120 kb, and Streptomyces jumonjinensis NRRL 5741 contained two giant linear plasmids (220 and 280 kb), and two smaller linear plasmids. No plasmidswere identified in Streptomyces cattleya NRRL 3841 or Streptomyces lipmannii NRRL 3584. Southern hybridization did not reveal any homology shared by these plasmids, and /3-lactam antibiotic synthesis gene clusters were located on the chromosome. Keywords: Streptomyces spp.; Pulsed field gel electrophoresis;

Linear plasmid; Isopenicillin

1. Introduction

Of the numerous plasmids which have been detected in bacteria, only a minority are linear. These linear plasmids can be subdivided into those which have proteins covalently attached to the 5’ termini of the DNA and replicate by protein primed DNA synthesis [l], and those with hairpin loop termini 121. Most bacterial linear plasmids are of the former type and have been isolated largely from actinomycetes, typically from members of the filamentous Grampositive bacterial genus Streptomyces. While some

* Corresponding author. Tel: +l (403) 492-5610; Fax: +l (403) 492-9234; E-mail: [email protected]. ’ Present address: Department of Microbiology, University of British Columbia, Vancouver, British Columbia, Canada, V6T 123 037%1097/95/$09.50 0 1995 Federation SSDI 0378-1097(95)00230-8

of European

Microbiological

N synthase

of the smaller linear plasmids have been well studied, such as the 11.7 kb pSCL1 plasmid of Streptomyces clavuligerus [3,4], and the 50 kb SLP2 of Streptomyces liviaizns [5], most of these plasmids are cryptic, and poorly characterized. In addition to these small linear plasmids, larger plasmids have been detected using pulsed field gel electrophoresis techniques [6-81. These large plasmids are often referred to as ‘giant’ linear plasmids (GLPs), though no evidence exists of any essential differences between these classes other than their size (commonly over 50 kb in length). Only a few of these plasmids have known phenotypes; the methylenomycin biosynthesis genes on SCPl [9], the lithoautotrophic growth (Aut) genes on GLPs in Rhodococcus sp. strains MRll and MR 22, and genes required for the catabolism of isopropylbenzene and trichloroethylene on a GLP in RhodococSocieties. All rights reserved

28

D.J. Netolitzky et al. /FEMS Microbiology Letters I31 (1995) 27-34

cus erythropolis BD2. Despite the detection of linear plasmids in various antibiotic-producing Streptomyces spp. [8] evidence has not indicated that the antibiotic production genes are typically plasmidborne. Indeed, the only common traits associated with actinomycete linear plasmids of any size are conjugation and pock formation [lo]. In this report we describe a plasmid content survey of five p-lactam antibiotic producing Streptomyces spp. and characterize several previously unreported GLPs identified in these organisms. A preliminary report of this research was presented at the International Symposium on Biology of Actinomycetes in Madison, Wisconsin, August 1991.

2. Materials and methods

2.1. Bacterial strains and growth conditions Streptomyces cattleya NRRL 3841, Streptomyces clavuligerus NRRL 3585, Streptomyces griseus NRRL 385 1, Streptomyces jumonjinensis NRRL 5741, and Streptomyces lipmannii NRRL 3584 were obtained from NRRL, Peoria, Illinois. Streptomyces liuidans 1326 was provided by Dr. T. Kieser, John Innes Foundation, Norwich, UK. These organisms were maintained on Tomato Oatmeal Agar plates at 28°C [3], or in Trypticase Soy Broth (TSB) media

[ill. 2.2. In situ cell lysis and digestion In situ cell lysis and DNA isolation techniques were used to prepare samples of large intact DNA molecules, such as GLPs and chromosomes. The ‘Bacterial DNA in Agarose Insert’ technique of Smith and Cantor [12] was used with the following modifications. Harvested cells were resuspended in 0.5 M EDTA, 0.01 M Tris . HCl (pH 8.0) (LET) buffer, at 0.25 g wet weight of cells/ml of LET buffer, and mixed with an equal volume of molten 2% (w/v) InCert agarose (FMC Bioproducts). The cell lysis solution contained 5 mg/ml lysozyme, 10 mg/ml sodium lauryl sarcosinate in LET buffer solution. An additional incubation step in which blocks were stored in 1% (w/v> SDS in LET buffer at 37°C for 24 h was added prior to proteinase K digestion.

Following proteinase K treatment the blocks were washed twice in 0.5 M EDTA, and stored at 4°C. 2.3. High molecular proteinase K

mass DNA preparation

using

To prepare high molecular mass DNA samples suitable for the preparative isolation of GLPs, a gentle lysis protocol was used. One gram (wet weight) of mycelium was resuspended in 4 ml of a solution of 15% sucrose, 10 mM Tris . HCl (pH 8.0), 1 mM EDTA followed by the addition of 1.5 ml of 0.5 M EDTA and 5 mg of lysozyme, and incubation at 21°C for 15 min. Proteinase K (2.5 mg) was added, followed by 0.5 ml of 20% sodium lauryl sarcosinate, and incubation at 55°C for 2 to 3 h. All mixing was achieved by gentle inversion. The resulting cell lysate was cleared by the addition of 1.4 ml of 5 M NaCl, and centrifugation in a Ti 50 rotor (Beckman) at 110 000 X g for 45 min. The supernatant was fractionated directly using a sucrose gradient without further preparative steps. 2.4. Sucrose gradient separation

of plasmids

Separation of a wide range of linear plasmids from proteinase K high molecular mass DNA preparations was achieved by sucrose gradient centrifugation using gradients of 13 ml lo-35% sucrose in 1 M NaCl, 20 mM Tris . HCl (pH S.O>, 2 mM EDTA. Samples of 0.1-0.5 ml were layered on top of the gradients, and then centrifuged for 48 h at 40 000 X g in a SW40Ti rotor (Beckman). Gradients were fractionated by pipetting 0.7 ml fractions from the top of each gradient and DNA was precipitated with 0.7 ml of 2-propanol at - 20°C. 2.5. Pulsed field gel electrophoresis GLPs were separated using a Bio-Rad CHEF DR II apparatus [13] capable of resolving DNA fragments up to at least 2 Mb in size. CHEF gels were prepared in 0.5 X TEB buffer (1 X TEB contains 100 mM Tris (pH 8.31, 2.5 mM EDTA, 100 mM borate) using 1.2% low melting temperature agarose (Boehringer-Mannheim), and electrophoresed at 165 V with a 5 to 80 s ramp at lo-15°C. During electrophoresis of DNA samples isolated from S. liui-

29

D.J. Netolitzky et al. / FEMS Microbiology Letters 131 (1995) 27-34

dam, 0.1 mM thiourea was added to the gel buffers

to minimize base modification induced DNA degradation [14]. 2.6. Recovery of DNA from agarose gel and radiolabelling

DNA used for preparation of probes was obtained by cutting out pieces of CHEF gels containing ethidium bromide stained GLP bands. A similar technique employing conventional agarose gels was used to isolate small linear plasmids. The pieces of agarose were washed twice with TE buffer (10 mM Tris . HCl (pH 8.0), 1 mM EDTA (1 ml per band)) for 15 min at 4°C then melted at 60°C for 15-30 min, and incubated at 40°C with 10 units of /3-agarase (New England Biolabs) for 2-3 h. Radioactive DNA probes used in hybridization analysis of Southern transfers were obtained by one of two methods. Agarase prepared DNA samples were labeled with [ (Y-~*P]~ATP (ICN) using the random primer techniques [15]. Oligonucleotide

1

2

3

4

probes were synthesized using a 391EP DNA synthesizer (Applied Biosystems) and end labeled with T4 polynucleotide kinase and [ y 32P]ATP (ICN). All probes were passed through a 3 ml Sephadex G-50 column after labeling, to remove unincorporated nucleotides. 2.7. Southern transfer and hybridization DNA from conventional agarose gels was transferred to nylon membranes (Amersham) following an alkaline buffer Southern blotting procedure as modified for nylon membranes 1161. Filters were prehybridized at an appropriate temperature (60°C random primer probes; 45°C terminally labeled oligonucleotide probes) for at least 1 h. Twenty percent vol/vol of deionized formamide was incorporated into the prehybridization solution for random primer probe hybridizations. Hybridization with the labeled DNA probe was conducted for 3 to 18 h, then filters were washed three times at 50°C and

5

6

7

-c -485 -436.5 -388 -339.5

-291

-242.5 -194 -146.5 -97 -48.5

Fig. 1. CHEF gel electrophoresis of DNA preparations prepared by in situ lysis of @-la&m producing Streptomyces spp. Lanes 1-7: (1) S. canleya; (2) S. chuligerus; (3) S. grisew; (4) S. jumonjinensis; (5) S. lipmannii; (6) S. iividans 1326; (7) h ladder molecular mass marker (New England Biolabs). Numbers to the side of the figures indicate molecular mass marker positions (size in kb), C indicates zone of compression.

30

D.J. Netolitzb

et al. / FEMS Microbiology

exposed to Kodak XAK5 X-ray film with a DuPont Cronex Lightning Plus intensifying screen at - 80°C.

3. Results

Letters 131 (1995) 27-34

Table 1 Plasmid content of Streptomyces Organism

Plasmid name

S. cattleya NRRL 3841 S. clauuligerus NRRL 3585

_

3.1. Survey of extrachromosomal elements The CHEF gel electrophoresis and in situ lysis DNA preparation techniques used to survey the /3lactam producing Streptomyces strains detected the DNA species illustrated in Fig. 1. The estimated sizes and names of these plasmids are summarized in Table 1. In addition to the previously identified 11.7 kb pSCL plasmid [3], S. clavuligerus was found to contain two larger, previously unidentified plasmids, estimated to be 120 and 430 kb in size. These new plasmids were designated pSCL2 and pSCL3, and the previously identified pSCL plasmid was renamed pSCL1 [4]. Similarly, the single GLP of 120 kb observed in S. griseus was named pSGL1, and the two GLPS of 220 kb and 280 kb found in S. jumonjinensis were named pSJL3 and pSJL4. Two smaller linear plasmids were also detected in S. jumonjinensis (pSJL1, 11.7 kb, and pSJL2, 17.5 kb). 12345678910

spp. in this study

S. griseus NRRL 385 1 S. jumonjinensis NRRL 5741

S. lipmannii NRRL 3584 S. lividans 1326

Size (kb)

pSCL1 pSCL2 pscL3 pSGL1 pSJL1 pSJL2 pSJL3 pSJL4 _

11.7 120 430 120 11.7 17.5 220 280 _

SLP2

50

3.2. Identification of topological conformation of plasmid DNA by sucrose gradient centrifugation The migration of DNA molecules through a sucrose gradient is affected by both molecular mass and shape, thus allowing an assessment of topological conformation. Fig. 2 depicts a typical sucrose gradient separation of S. claouligerus DNA. pSCL1 and pSCL2 are clearly visible as bands present mainly 11 12 13

14

15 16

1718

1920

-291

24229 19 146. 9

-242.5 -194 -146.5 -97 -48.5 -23.1 -9.4

9.

-6.6

6. Fig. 2. Sucrose gradient fractionation of linear plasmid DNA from a proteinase K high molecular mass DNA preparation of S. clauuligerus. S. clauuligerus DNA was fractionated and electrophoresed in a CHEF gel as described in the materials and methods, and stained with ethidium bromide. Lanes 1 and 20 are A ladder/A Hind111 molecular mass markers, lanes 2 to 19 correspond to sucrose gradient fractions, with lane 2 being the top of the gradient, lane 19 the bottom. Numbers to the side of the figures indicate molecular mass marker positions (sizes in kb.)

31

D.J. Netolitzky et al. / FEMS Microbiology Letters 131 (1995) 27-34

in fractions 4-6 (lanes 5-7) and 11-13 (lanes 12141, respectively. pSCL3 was not observed in this preparation. pSCL2 co-migrated with sheared chromosomal DNA, a result also observed for pSGL1, pSJL3, and pSJL.4 (data not shown). 3.3. Homology between linear plasmids Hybridizations were conducted using each of the linear plasmids detected in this survey as both target and probe DNA. Evaluation of homology among the linear plasmids of the Streptomyces spp. in this survey is shown in Fig. 3. No cross-hybridization was observed between linear plasmid probes and

other plasmid species or chromosomal DNA, with the exception that pSCL3 hybridized to the 5. clauuligerus chromosomal DNA found in the zone of compression. Although hybridization results with the two small linear plasmids from S. jumonjinensis are not shown in Fig. 3, no hybridization was observed between pSJL1 and pSJL2 and any of the plasmids discussed in this survey. These two plasmids are further characterized in a separate study to be published elsewhere. 3.4. Location of the pcbC gene The possibility that the /3-lactam antibiotic production gene clusters might be located on any of the

C-

48.5-

Fig. 3. Southern transfer and hybridization analysis of total cellular DNA in situ preparations of 8. clauuligerus, S. gri.seus, S. jumonjinensis, and 5. liuidans 1326 with linear plasmid probes. A: Ethidium bromide stained CHEF gel mn under the same conditions as in Fig. 1, with the DNA samples: (1) A concatamer ladder molecular mass markers; (2) 5. clauuligerus; (3) S. griseus; (4) S. jumonjinensis; and (5) 5. liuidans 1326. Panels B to H represent autoradiographs of the gel shown in panel A after hybridizations with random primer labeled probes: (B) pSCL1; (0 pSCL2; (D) pSCL3; (El pSGL1; (F) pSJL3; (G) pSJL4; and_(H) SLP2. Scale and lane contents remain constant between panels. Numbers to the side of the figures indicate molecular mass marker positions (size in kb), C indicates zone of compression.

260 264

.._

CCGACCAGGAGAAGCACGACCTGGCGATCCACGCG...

296

s. &vu/igens

CGGACGAGGAGAAGTACGACCTGGCGATCAACGCT...

290

s. glk.9us pdJc gene

p&c

200

. ..GCGACCAGGAGAAGCACGACCTGGCGATCAACGCG...

246

S. jumonjinensis p&C

200

. ..CCGACCAGGAGAAGCACGACCTGGCGATCCACGCG...

246

S. lipmanii p&C gene

AGGAGAAGCACGACCTGGCGATC

pcbC oliionucleotide

gene

gene

probe

Fig. 4. p&C oligonucleotide probe design based on a consensus sequence among four sequenced p&C genes: 5. clauuligerus (GenBank accession # M194211, 5. griseus (GenBank accession # X54609), S. jumonjinensis (GenBank accession # M36687), and S. lipmannii (GenBank accession # M22081). Numbers to the left and right of the aligned sequences indicate the position of the terminal nucleotides within the gene sequence.

32

D.J. Netolitzky et al. /FEMS Microbiology Letters 131 (1995) 27-34

485 438.5388339.5291242.5194148.59748.5-

Fig. 5. Southern hybridization analysis of whole cellular in situ DNA preparations of S. clavuligerus, S. griseus, and S. jumonjinensis with the pcbC oligonucleotide probe. The autoradiograph represents the CHEF gel in panel A, Fig. 3. Lanes: (1) A concatamer ladder molecular mass markers; (2) S. clavuligerus; (3) S. griseus; (4) S. jumonjinensis; and (5) S. lividans 1326. Hybridization was carried out at 45°C without formamide. Numbers to the side of the figures indicate molecular mass marker positions (size in kb), C indicates zone of compression.

GLPs identified was examined. An oligonucleotide was constructed to match a consensus sequence identified among the sequenced pcbC genes which encode the isopenicillin N synthase protein (Fig. 4). Fig. 5 shows the result of a hybridization study of the probe with the whole cellular DNA profile of these organisms, as separated by the CHEF technique. In all cases, the sheared chromosomal DNA within the zone of compression hybridized with the probe; no signal was observed with any of the GLPs.

4. Discussion This report describes a variety of previously unidentified linear plasmids within the organisms studied, including several GLPs. The sizes of the plasmids were determined by comparison with molecular mass markers (concatemers of A phage and chromosomes of Saccharomyces cerevisiae), however, the estimates may be inaccurate given the

high GC content of streptomycete DNA. Quantitative estimates by pulsed field electrophoresis have suggested that the size of G + C rich DNA is consistently underestimated when compared to 50% G + C DNA markers [17]. The presence of additional S. clauuligerus linear plasmids had been predicted [4], as analysis of the potential open reading frames encoded by pSCL1 had failed to locate any identifiable DNA polymerase or terminal protein genes. This observation suggested that another linear plasmid might encode these functions, and thus allow pSCL1 to replicate as a satellite plasmid. Hence, the discovery and identification of a linear topology for the plasmids pSCL2 and pSCL3 was consistent with this theory. However, the recent discovery that some, and possibly all, Streptomyces genomes are linear [l&191 provides an alternative possibility; the genome itself may encode these proteins. Still, the topology of the S. clavuligerus genome has not yet been confirmed. Sucrose gradient separation of proteinase K high molecular mass DNA preparations was found to be an effective method for the isolation of both the smaller linear plasmids, including pSCL1, pSJL1 and pSJL5 and most of the GLPs, such as pSCL2, pSGL1, pSJL3 and pSJL4. In addition, the behaviour of the plasmids during this treatment provided confirmation of their linear topology. Unfortunately, this technique proved inefficient for the recovery of pSCL3 as it was likely damaged during the preparation, or sedimented with the cell debris and chromosomal DNA during the high molecular mass DNA preparation. The linear topology of the plasmids discovered in this survey was also demonstrated by their constant apparent fixed size relative to the molecular mass markers under varying CHEF pulse times (data not shown), a phenomenon not observed with circular DNA molecules [20]. The identification of previously undetected plasmids within the species examined raised the question as to whether they share any common sequences. The close taxonomic relationship between some of the species studied (S. clauuligerus and S. jumonjinensis for example), the apparent similarities between published terminal inverted repeat (TIR) sequences [4,18,21], the shared telomeric sequences of SLP2 and the S. Ziuidans linear chromosome, and the similar sizes of certain plasmids suggested that some

DJ. Netolitzky et al. /FEMS Microbiology Letters 131 (1995) 27-34

of the DNA species identified might share common sequences, or even be identical. Surprisingly, the only cross-hybridization observed was between pSCL3 and S. clavuligerus chromosomal DNA, indicating that an integrated form of the plasmid may exist within the chromosome or pSCL3 may share telomeric sequences with a putative linear chromosome; contamination of the probe DNA with sheared chromosomal DNA appears minimal (Fig. 1). The lack of apparent sequence homology between the GLPs of S. clavuligerus, S. griseus, and S. jumonjinensis indicates that these plasmids are neither related nor are they recombination products, despite their large size and the close phylogenetic relation of some of the host organisms. The apparent lack of TIR cross-hybridization between these plasmids raises several possibilities. Given the likelihood that pSCL1 shares replication machinery with another linear DNA structure, common TIR sequences would also seem likely. Reported sequence conservation among Streptomyces spp. linear plasmids TIRs examined to date [4,18] would also support this expectation. The observed absence of sequence homology may reflect a smaller than anticipated shared terminal sequence, or may indicate that the proteins involved in linear DNA replication recognize common structural features, such as palindromic sequences, rather than any specific DNA sequences. Except for S. lividans, all of the organisms in this survey have been previously identified as @-lactam antibiotic producing strains. While the penicillin and clavulanic acid antibiotic genes of S. clavuligerus have been determined to reside on a large DNA fragment [22], this cluster could be accommodated within either of the GLPs (pSCL2 and pSCL3) identified by this survey. Less information is available concerning the S. griseus and S. jumonjinensis /3lactam production genes, again raising the possibility that their GLPs might carry these genes. However, the hybridization results clearly indicate that the IPNS gene is chromosomally encoded, raising the question as to which function(s) are encoded on the GLPs. Given that these plasmids do not appear to share any genes, nor encode any identified genes, a simple explanation for their function and replication is difficult. Possible scenarios include a role in the high rate of recombination and genetic rearrangement commonly observed among Streptomyces spp.,

33

or perhaps as parts of a segmented genome. Characterization of the genes located on these plasmids may prove to be the only means to properly assess their cellular function.

Acknowledgements This research was supported by grants from the Natural Sciences and Engineering Research Council of Canada. D.J.N. was the recipient of a studentship from the Alberta Heritage Foundation for Medical Research.

References [I] Sakaguchi, K. (1990) Invertrons,a classof structurallyand functionallyrelated genetic elementsthat includeslinear [2]

[3]

[4]

[5]

[6]

17)

[8]

[9]

[lo]

[ll]

DNA plasmids, transposable elements, and genomes of adeno-type viruses. Microbial. Rev. 54, 66-74. Barbour, A.G. and Garon CF. (1987) Linear plasmids of the bacterium Borreh burgdorferi have covalently closed ends. Science 237, 409-411. Keen, C., Mendelovitz, S., Cohen, G., Aharonowitz, Y. and Roy, K.L. (1988) Isolation and characterization of a linear DNA plasmid from Streptomyces clavuligerus. Mol. Gen. Genet. 212, 173-176. Wu, X. and Roy, K.L. (1993) Complete nucleotide sequence of a linear plasmid from Streptomyces clavuligerus and characterization of its RNA transcripts. J. Bacterial. 175, 37-52. Chen, C.W., Yu, T., Lin, Y., Kieser, H.M. and Hopwood, D.A. (1993) The conjugative plasmid SLP2 of Streptomyces Iividans is a 50 kb linear molecule. Mol. Microbial. 7, 925-932. Kinashi, H. and Shimaji, M. (1987) Detection of giant linear plasmids in antibiotic producing strains of Sfreptomyces by OFAGE technique. J. Antibiot. 40, 913-916. Kinashi, H. and Shimaji-Murayama, M. (1991) Physical characterization of SCPl, a giant linear plasmid from Strepfomyces we&color. J. Bacterial. 173, 1523-1529. Kinashi, H., Shimaji, M. and Sakai, A. (1987) Giant linear plasmids in Sfreptomyces which code for antibiotic biosynthesis genes. Nature 329, 454-456. Kirby, R. and Hopwood, D.A. (1977) Genetic determination of methylenomycin biosynthesis by the SCPl plasmid of Streptomyces coelicolor A3(2). J. Gen. Microbial. 98, 239252. Hopwood, D.A. and Kieser, T. (1993) Conjugative plasmids of Stiepromyces. In: Bacterial Conjugation (ClewelI, D.B., Ed.), pp. 293-311. Plenum Press, New York. Hopwood, D.A., Bibb, M.J., Chater, K.F., Kieser, T., Bruton,

34

[12]

[13]

[14]

[15]

[16]

[17]

D.J. Netolitzky et al. /FEMS

Microbiology

C.J., Kieser, H.M., Lydiate, D.J., Smith, C.P., Ward, J.M. and Schrempf, H. (1985) Genetic manipulation of Streptomyces -A Laboratory Manual, pp. 356. The John Innes Foundation, Norwich. Smith, C.L. and Cantor, C.R. (1987) Purification, specific fragmentation, and separation of large DNA molecules. Meth. Enzymol. 155, 449-461. Chu, G. (1989) Pulsed-field electrophoresis in contourclamped homogeneous electric fields for the resolution of DNA by size and topology. Electrophoresis 10, 290-295. Ray, T., Weaden, J. and Dyson, P. (1992) Tris-dependent site-specific cleavage of Streptomyces liuidans DNA. FEMS Microbial. Lett. 96, 247-252. Feinberg, A. and Vogelstein, B. (1983) A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. B&hem. 132, 6-13. Riguad, G., Grange, T. and Picket, R. (1987) The use of NaOH as transfer solution of DNA onto nylon membranes decreases the hybridization efficiency. Nucleic Acids Res. 15, 857. Gravius, B., Cullum, J. and Hranueli, D. (1994) High G+C

[18]

1191

[20]

[21]

[22]

Letters 131 (1995) 27-34 content DNA markers for pulsed-field gel electrophoresis. BioTechniques 16, 52. Lin, Y., Kieser, H.M., Hopwood, D.A. and Chen, C.W. (1993) The chromosomal DNA of Streptomyces liuidans is linear. Mol. Microbial. 10, 923-933. Leblond, P., Redenback, M. and Cullum, J. (1993) Physical map of the Streptomyces liuidans 66 genome and comparison with that of the related strain Streptomyces coelicolor A3(2). J. Bacterial. 175, 3422-3429. Matthew, M.K., Hiu, C.-F., Smith, CL. and Cantor, C.R. (1988) High resolution separation and accurate size determination in pulsed field gel electrophoresis of DNA. IV. The influence of DNA topology. Biochem. 27, 9222-9226. Hirochika, H., Nakamura, K. and Sakaguichi, K. (1984) A linear DNA plasmid from Streptomyces rochei with an inverted terminal repetition of 614 base pairs. EMBO J. 3, 761-766. Ward, J.M., and Hodgson, J.E. (1993) The biosynthetic genes for clavulanic acid and cephamycin production occur as a ‘super-cluster’ in three Streptomyces. FEMS Microbial. Lett. 110, 239-242.