- Email: [email protected]
GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico
G Model
PEDOT-7290; No. of Pages 6 International Journal of Pediatric Otorhinolaryngology xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
International Journal of Pediatric Otorhinolaryngology journal homepage: www.elsevier.com/locate/ijporl
GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico Aidee´ Alejandra Herna´ndez-Jua´rez a, Jose´ de Jesu´s Lugo-Trampe a, ˜ o-Gonza´lez c, Luis Daniel Campos-Acevedo a, Angel Lugo-Trampe b, Jose´ Luis Trevin d a, Israel de-la-Cruz-A´vila , Laura Elia Martı´nez-de-Villarreal * a
Departamento de Gene´tica, Facultad de Medicina y Hospital Universitario ‘‘Jose´ E. Gonza´lez’’, Universidad Auto´noma de Nuevo Leo´n (UANL), Av. Gonzalitos s/n cruce con Av. Madero, Col. Mitras Centro CP 64460, Monterrey, N.L., Me´xico b Centro Mesoamericano de Estudios en Salud Pu´blica y Desastres, Universidad Auto´noma de Chiapas (UNACH), Carretera Antiguo Aeropuerto; Pista Principal cruce con Pista Secundaria S/N, Col. Solidaridad 2000, CP 30798, Tapachula, Chis, Me´xico c Departamento de Otorrinolaringologı´a, Facultad de Medicina y Hospital Universitario ‘‘Jose´ E. Gonza´lez’’, Universidad Auto´noma de Nuevo Leo´n (UANL), Av. Gonzalitos s/n cruce con Av. Madero, Col. Mitras Centro CP 64460, Monterrey, N.L., Me´xico d Servicio de Audiologı´a Pedia´trica, Hospital Materno-Infantil, Aldama 460, Col. San Rafael, CP. 67190, Guadalupe, N.L., Me´xico
A R T I C L E I N F O
A B S T R A C T
Article history: Received 16 June 2014 Received in revised form 12 September 2014 Accepted 16 September 2014 Available online xxx
Objectives: Mutations in the DFNB1 locus are the most common cause of autosomal-recessive nonsyndromic hearing loss (ARNSHL) worldwide. The aim of this study was to identify the most frequent mutations in patients with ARNSHL who reside in Northeastern Mexico. Methods: We determined the nucleotide sequence the coding region of GJB2 of 78 patients with ARNSHL. Polymerase chain reaction assays were used to detect the GJB2 IVS1 + 1G > A mutation and deletions within GJB6. Results: GJB2 mutations were detected in 9.6% of the alleles, and c.35delG was the most frequent. Six other less-frequent mutations were detected, including an extremely rare variant (c.645_648delTAGA), a novel mutation (c.35G > A), and one of possible Mexican origin (c.34G > T). GJB6 deletions and GJB2 IVS1 + 1G > A were not detected. Conclusions: These data suggest that mutations in the DFNB1 locus are a rare cause of ARNSHL among the population of Northeastern Mexico. This confirms the genetic heterogeneity of this condition and indicates that further research is required to determine the other mechanisms of pathogenesis of ARNSHL in Mexicans. ß 2014 Elsevier Ireland Ltd. All rights reserved.
Keywords: DFNB1 GJB2 GJB6 deafness autosomal-recessive nonsyndromic
1. Introduction The most common neurosensory disorder is hearing loss, which occurs in approximately 1–2 of 1,000 live births worldwide [1]. Genetic factors account for approximately 50% of patients with hearing loss [2], of which 70% do not show a syndromic association [3]. This type of nonsyndromic genetic hearing loss is grouped into four categories according to the mode of inheritance, and the most common (75–80%) cause is autosomal-recessive mutations
* Corresponding author. Departamento de Gene´tica, Facultad de Medicina y Hospital Universitario ‘‘Jose´ E. Gonza´lez’’, Universidad Auto´noma de Nuevo Leo´n (UANL), Av. Gonzalitos s/n cruce con Av. Madero, Col. Mitras Centro CP 64460, Monterrey, N.L., Me´xico. Tel.: +52 81 83483704; fax: +52 81 83294217. E-mail address: [email protected] (L.E. Martı´nez-de-Villarreal).
[4]. Mutations in the gene (GJB2) encoding connexin 26 (CX26) are the most frequent cause of autosomal-recessive nonsyndromic hearing loss (ARNSHL). The frequency of each mutation depends on the ethnic origin of the population. For example, the frequency of c.35delG is high in Europe and the Middle East (2-4%), c.235delC in East Asia (1–2%), V37I in Southeast Asia (carrier rate 11.6%), and W24X in India (4.05%). In smaller populations such as Ashkenazi Jews, c.167delT is most prevalent (4.0%) [5–7]. However, there are variants or polymorphisms of unknown clinical significance [8– 10]. Further, such variants may account for a high percentage of individuals with deafness in certain Eastern European populations as those of the Czech Republic and Hungary [11,12]. Similarly, two large deletions in GJB6, del(GJB6-D13S1830) and del(GJB6D13S1854), cause ARNSHL in carriers of a variant of one GJB2 allele [13]. There are reports of mutations in GJB2 and GJB6 in Latin American countries [4,14–18]. Two studies are available on the
http://dx.doi.org/10.1016/j.ijporl.2014.09.016 0165-5876/ß 2014 Elsevier Ireland Ltd. All rights reserved.
Please cite this article in press as: A.A. Herna´ndez-Jua´rez, et al., GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico, Int. J. Pediatr. Otorhinolaryngol. (2014), http://dx.doi.org/10.1016/ j.ijporl.2014.09.016
G Model
PEDOT-7290; No. of Pages 6 A.A. Herna´ndez-Jua´rez et al. / International Journal of Pediatric Otorhinolaryngology xxx (2014) xxx–xxx
2
population of Central Mexico [19,20]; however, the incidence of GJB2 and GJB6 mutations in residents of Northeastern Mexico is unknown [21]. Therefore, the goal of the present study was to characterize the DFNB1 locus (13q11-q12) in patients with ARNSHL living in Northeastern Mexico. 2. Materials and Methods 2.1. Patients Seventy-eight individuals with congenital hearing loss and no evidence of syndromic features were referred to the Department of Genetics of Dr. Jose´ Eleuterio Gonza´lez Hospital. The 78 individuals were children or adolescents from 1 to 13 years of age. The samples were obtained from the Department of Otorhinolaryngology of Dr. Jose´ Eleuterio Gonza´lez Hospital and Materno-Infantil Hospital. The population resided in Northeastern Mexico in the states of Nuevo Leo´n, San Luis Potosı´ and Tamaulipas. Each patient was evaluated according to their clinical history and the results of a physical examination and audiometry. Informed consent was obtained from all participants in the study, and the study was approved by the ethics committee of the Autonomous University of Nuevo Leo´n. 2.2. DNA extraction and sequencing Genomic DNA was extracted from peripheral venous blood using the QIAamp DNA Blood mini kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. Polymerase chain reaction (PCR) amplification of the coding region of GJB2 was performed in a final volume of 15 ml in a solution containing 1 Colorless GoTaq Flexi Buffer, 1.5 mM MgCl2, 0.2 mM each dNTP, 1 U of GoTaq Hot Start (Promega, Madison, WI, USA), 25 ng DNA, 0.66 pmol each primer (forward primer 5 0 ACATTTTGCTGCCGGTCATCTCCCTGTTCTGTCCTA-30 and reverse primer 50 -GTCCTTTGTCGATACTGGAATCTAACAACTGGGCAATG30 ), and 2% Hi-DiTM formamide (Applied Biosystems, Foster City, CA, USA). All amplifications were performed using a Veriti 96-well Thermal Cycler (Applied Biosystems, Foster City, CA, USA). Amplification conditions were as follows: 1 cycle at 95 8C for 5 min, 30 cycles at 95 8C for 30 s, 60 8C for 40 s, 72 8C for 50 s, 1 cycle at 72 8C for 2 min and storage at 4 8C. The primers were incorporated into the 50 -terminus of phage M13 DNA to enhance data quality. PCR products were purified using ExoSAP-IT (Affymetrix, Santa Clara, CA, USA). The purified amplicons were directly sequenced using a BigDye Terminator version 3.1 kit (Applied Biosystems, Foster City, CA, USA) and analysed using a ABI Prism 3130 DNA sequencer (Applied Biosystems, Foster City, CA, USA) with Geneious version 4.1 software (Biomatters, Auckland, NZ). Sequence variants were verified using the NCBI http:// www.ncbi.nlm.nih.gov) and Ensembl (http://www.ensembl.org) databases. All negative samples or those with one affected GJB2 allele were screened for mutations in IVS1 + 1G > A and for deletions in GJB6. 2.3. PCR-restriction fragment length polymorphism analysis to detect IVS1 + 1 G > A Assays to detect the IVS1 + 1G > A splice-site mutation in GJB2 exon 1 were performed using PCR–restriction fragment length polymorphism analysis (PCR-RFLP). In general, PCR reactions were performed in 15 ml of a solution containing 1x Colorless GoTaq Flexi Buffer, 0.9 mM MgCl2, 0.2 mM each dNTP, 25 ng DNA, 1 U of GoTaq Hot Start, 0.66 pmol each primer (forward primer 50 GGGCTCAAAGGAACTAGGAGAT-30 reverse primer 50 -ACATCGGCGACACCACAA-30 ) and 2% Hi-DiTM formamide. All amplifications
Table 1 Quantitative PCR Primers for amplifying GJB6. Primer
Sequence (50 -30 )
IL4-CTL-F IL4-CTL-R GJB6-Ex6-F GJB6-Ex6-R GJB6-Ex3-F GJB6-Ex3-R GJB6-ups-F GJB6-ups-R
CACGGACACAAGTGCGATA AGAGATGGTGCCAGATAGGT TGAATGTAGACGGAACAGTGT TGAGGCAATCACATCCACAT TCTGGCTAAACAATTTCTGTATGG GCTCACAGCACCTGGAATA CAATAGCGTGGACGACAGTA GTCTTCTTCACCGACAGGAA
were performed using a Veriti 96-well thermal cycler. Amplification conditions were as follows: 1 cycle at 95 8C for 4 min; 35 cycles at 95 8C for 15 s, 62 8C for 50 s, 72 8C for 40 s; and 1 cycle at 72 8C for 2 min with storage at 4 8C. Amplicons were incubated in 20 ml of a solution containing 1 U Hph1, 1 CutSmartTM digestion buffer (New England BioLabs, Ipswich, MA), and 100 ng of amplicon. The samples were then incubated at 37 8C for 8 h, and the reactions were terminated by incubation at 65 8C for 20 min. All digests were analysed using 2% (w/v) agarose gel electrophoresis (Bio-Rad Laboratories, Hercules, CA). DNA fragments were detected using a Gel DocTM XR+ documentation system (Bio-Rad Laboratories, Hercules, CA). The G-allele-specific 684-bp amplicon was cleaved into 385-bp and 299-bp fragments. In contrast, the 684-bp A-allele-specific amplicon was not cleaved under these conditions (the A-allele amplicon lacks an Hph1 site). 2.4. Real-time quantitative PCR (qPCR) screening for deletions in GJB6 A StepOne Real-Time (Applied Biosystems, Foster City, CA) system with 48-well plates was used to perform qPCR. Reactions contained 25 ng DNA, 0.66 pmol each primer (Table 1), and 1x Maxima SYBR Green/ROX qPCR Master Mix (Fermentas, Vilnius, Lithuania) in a total volume of 15 ml. Each sample was assayed in triplicate. Amplification conditions were as follows: 1 cycle at 95 8C for 10 min, followed by 45 cycles at 95 8C for 10 s, 60 8C for 10 s, and 72 8C for 50 s. Melting curve analysis was performed from 50 8C to 95 8C (1 8C/5 s) to ensure consistency and specificity of the amplified product. Baseline and quantification cycle (Cq) were determined automatically by StepOne v2.0. software for direct comparison of Ct values for the target vs. reference gene, which were calculated using the delta-delta-CT method. 3. Results We screened 78 unrelated individuals with profound or severe prelingual nonsyndromic deafness of unknown cause for GJB2 and GJB6 mutations. The analysis of the GJB2 coding region revealed eight different variants in 38 individuals (48.7%) (Table 2). We observed 7 different previously described variants in GJB2 [5]. The variant c.79G > A was detected in 68.4% (26/38) of affected individuals. Four were biallelic, three were compound heterozygotes, and 19 were mono-allelic; however, this variant corresponds to a nonpathogenic polymorphism. The other 12 (31.6%) represented pathogenic variants (c.35delG, c.645_648delTAGA, c.35G > T, c.427C > T, c.101T > C, and c.34G > T) as well as one novel mutation (c.35G > A). Two individuals were homozygous for the c.35delG and c.35G > T mutations. One patient was a compound heterozygote (c.35delG and c.645_648delTAGA), and the remaining nine were mono-allelic variants (Table 3). Biallelic mutations accounted for 3.8% (3/78) of those that cause hearing loss. The c.35delG mutation was the most common (46.7%, 7/15). GJB6 deletions and GJB2 IVS1 + 1G > A were not detected. Genetic analysis of the parents was performed to determine whether the
Please cite this article in press as: A.A. Herna´ndez-Jua´rez, et al., GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico, Int. J. Pediatr. Otorhinolaryngol. (2014), http://dx.doi.org/10.1016/ j.ijporl.2014.09.016
G Model
PEDOT-7290; No. of Pages 6 A.A. Herna´ndez-Jua´rez et al. / International Journal of Pediatric Otorhinolaryngology xxx (2014) xxx–xxx
3
Table 2 Frequency of GJB2 mutations (n = 156). Variant Codon
Change
Location*
Type of mutation
Effect
Allele (frequency)
p.Val27Ile p.Gly12Valfs*2 p.Ile214Ilefs*17 p.Gly12Asp p.Gly12Val p.Arg143Trp p.Met34Thr p.Gly12Cys
c.79G > A c.35delG c.645_648delTAGA c.35G > A c.35G > T c.427C > T c.101T > C c.34G > T
M1 N-Terminus C-Terminus N-Terminus N-Terminus E1 N-Terminus N-Terminus
Missense Frameshift Frameshift Missense Missense Missense Missense Missense
Benign Pathogenic Pathogenic Novel Pathogenic Pathogenic Pathogenic Pathogenic
30 (0.19) 7 (0.04) 2 (0.01) 1 (0.006) 2 (0.01) 1 (0.006) 1 (0.006) 1 (0.006)
*N-Terminus = amino-terminus, M1–M4 = transmembrane domains 1–4, E1 and E2 = extracellular domains 1 and 2, and C-Terminus = carboxy-terminus.
mutations were in trans. In three cases, each parent carried one of the mutations. Therefore, the children were effectively homozygous or compound heterozygous. In contrast, in cases with a single mutation, it was verified only in one of the parents, suggesting a mutation in cis. Nevertheless, we cannot rule out a mutation in another gene. 4. Discussion ARNSHL is a genetically heterogeneous disease that comprises 98 loci (http://www.hereditaryhearingloss.org; June 8, 2014). However, mutations in the DFNB1 locus (13q11-12), which contains the GJB2 (OMIM 121011) and GJB6 (OMIM 604418) genes, are the most common cause of this disorder in different populations, representing 10–50% of cases [5,22–24]. DNA sequence analysis of GJB2 in the present study led to a diagnosis of hearing loss in only 3.8% of the patients, which is remarkably low compared with those of other reports [5]. In a study of Mexicans residing in Central Mexico, de la Luz Arenas-Sordo et al. [20] found that 10.6% of those with nonsyndromic hearing loss harboured GJB2 mutations. This difference between frequencies, although not very large compared with our study, is low and consistent with the frequency of GJB2 mutations in non-Europeans [4,5,25], which may be attributed to the high genomic diversity in the Mexican population caused by miscegenation [21,26]. In the present study, the most frequent polymorphism (33%, n = 26) was c.79G > A (rs2274084). This variant is detected at greater frequency in Hispanics and Asians, representing 12.5% and 20.8%, respectively [7,14,15,27–31]; however, it is classified as benign [32,33]. Although c.341A > G (rs2274083) was not detected in the present study, a single nucleotide polymorphism may be involved in hearing loss [7]. For example, Cheng et al. [34] suggest that the rs2274084 and rs2274083 haplotypes (C-C genotype) confer a risk of sporadic hearing loss while the T-T genotype may
Table 3 Genotypes of patients with GJB2 mutations. Genotype allele 1
allele 2
c.35delG c.35delG c.35G > T c.35delG c.34G > T c.101T > C c.35G > A c.645delTAGA c.427C > T Wt
c.35delG c.645delTAGA c.35G > T wt wt wt wt wt wt wt
Patients with ARNSHL (n = 78)
Etiology
1 (1.28%) 1 (1.28%) 1 (1.28%) 4 (5.13%) 1 (1.28%) 1 (1.28%) 1 (1.28%) 1 (1.28%) 1 (1.28%) 66 (84.6%)
DFNB1 DFNB1 DFNB1 Unknown Unknown Unknown Unknown Unknown Unknown Unknown
Wt = Wild-type, DFNB1 = Nonsyndromic hearing loss and deafness
be protective. These authors conclude that single nucleotide polymorphisms in the DFNB1 locus play an important role in sporadic cases of hearing loss. The second most frequent variant detected here was c.35delG (also called c.30delG) [35,36], which is the most common variant associated with autosomal-recessive hearing loss. This mutation causes a frameshift at position 12 of the coding region of GJB2 that prematurely terminates the polypeptide chain (p.Gly12Valfs*2) [31,37]. This mutation was present in seven of the 156 alleles, which represents a prevalence of 4.5% and a frequency of 46.7% of the alleles mutated in this population. The c.35delG mutation is one of the most frequent mutations (11%–59.5%) in different populations, including Hispanics [5,14,16,27]. However, our results are inconsistent with expectations based on studies of the Caucasian population of South America [38,39] but are similar to those of studies of the population of Central America, including Venezuela [4,17,40]. Here we found a patient with a homozygous c.35delG mutation and another compound heterozygous patient (c.35delG and c.645 648delTAGA) with profound hearing disability, as expected [18,41]. Individuals homozygous for c.35delG represent approximately 47% of patients with predominance in Europe, North Africa and the Middle East, decreasing to 0% in South and East Asia [5,42]. This mutation accounts for 1.3% (1/78) of our study patients. This predominance is present in Mexican patients in Central Mexico [19,20]. We detected a four-base deletion (c.645 648delTAGA) that shifts the reading frame and introduces a delayed stop codon (p.Ile214Ilefs*17) in the carboxyl-terminal domain (CT) in two patients. This extremely rare variant was described first by Prasad et al. [43], in 209 patients with hearing loss in the Midwest United States and is accompanied by only one mutated allele (c.35delG). This mutation was subsequently reported in three other studies [22,44,45]. Our present findings are consistent with studies that identified compound heterozygosity in one patient associated with c.35delG and in another heterozygous patient. Until recently, it was believed that the CT domain did not play an important functional role, because it is too short to exert regulatory effects. [46] However, Locke et al. [47] demonstrated that the CT domain plays a direct role in the modulation of pores in the occlusion of the pathway of permeability [3]. In our present study, two patients with this mutation suffered from profound hearing loss. The c.35G > T mutation encodes a valine at residue 12 of CX26 (p.Gly12Val), and is present in Italians and Spaniards in a compound heterozygous state with c.35delG [48]. Subsequently, a multicenter study of a large cohort of North Americans reported c.35G > T as one of the most common in Hispanics (4.8%) [7]. This mutation as well as p.Gly12Valfs*2, p.Gly12Asp, p.Met34Thr and p.Gly12Cys reported here occur in the N-terminal domain and are highly conserved between b-connexins. This domain is involved in membrane integration and restricts the size of molecules that
Please cite this article in press as: A.A. Herna´ndez-Jua´rez, et al., GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico, Int. J. Pediatr. Otorhinolaryngol. (2014), http://dx.doi.org/10.1016/ j.ijporl.2014.09.016
G Model
PEDOT-7290; No. of Pages 6 4
A.A. Herna´ndez-Jua´rez et al. / International Journal of Pediatric Otorhinolaryngology xxx (2014) xxx–xxx
enter the channel. In particular, G12 V causes complete intracellular retention of b-connexin, which accumulates in large perinuclear vesicles and is accompanied by a significant decrease in its expression, suggesting that G12 is required for the maturation of connexin [49]. In our present study, c.35G > T was one of two homozygous mutations that caused the profound hearing loss of the patient. We identified the unreported mutation c.35G > A (p.Gly12Asp), which unlike the c.35G > T known mutation [48], Val replaces Asp (c.35G > A). Val and Gly (wild-type) are nonpolar, and Asp carries a negative charge. Both mutations are located in a region required for the regulation of channel selectivity [50,51]. The results of sequence analyses using SIFT, PolyPhen-2, and multiple alignments indicate that this change alters protein conformation and likely represents a pathogenic variant (Fig. 1). Thus, we observed three possible genotypes at the same position. The c.35G > T (rs1801002) mutation is pathogenic [7,48,52], suggesting that p.Gly12Asp alters or inhibits the function of the protein that leads to hearing loss. However, functional evaluation of the protein carrying the p.Gly12Asp mutation is required. Patients with the c.35G > A mutation experience profound hearing loss.
The other less common mutations detected in the present study are as follows: c.427C > T, c.101T > C and c.34G > T. These mutations are prevalent in populations of Africa, North America and Europe, respectively [7,27,53–55] and are responsible for a proportion of nonsyndromic deafness with a phenotype of moderate to profound hearing loss. In the present study, these mutations were present in 1.92% of alleles. Patients with profound deafness harboured the first two mutations, and one patient with c.34G > T progressed from moderate to profound deafness. There are few studies of this variant [7,19,22,32], which were all conducted in North America. In most cases, the patients were of Hispanic ancestry or Mexican descent and resided in California, Texas (states with the highest percentage of Mexican migrants) [56] or Mexico. The mutation was likely present in a Mexican who migrated north. The c.34G > T mutation is heterozygous in the majority of patients (86%), suggesting an autosomal-dominant pattern of inheritance. Here, the subject reported a family history of hearing loss, which is consistent with the mother’s mild hearing loss. Therefore, we believe that the level of expression of the mutant protein varies according to the severity of the phenotype.
Fig. 1. PolyPhen-2 and SIFT analyses and multiple alignments of connexins encoded by GJB2 of different species and human connexin isoforms. (A) Single Nucleotide Variant (SNV) c.35G > A. The substituted amino acid residue, Gly12Asp, is shown in red. (B) Sequence analyses predict a change that alters the structure of the protein. (C) Multiple alignment of the first N-terminal amino acid residues of 12 human connexins and 12 connexins encoded by GJB2 of different species (corresponding to amino acid residues 1–27). The grey box highlights the evolutionary conservation of Gly12. PolyPhen prediction tool: http://genetics.bwh.harvard.edu/ pph2/; SIFT prediction tool: http://provean.jcvi.org/genome_submit.php; multiple sequence alignment tool: https://www.ebi.ac.uk/Tools/msa/clustalw2/.
Please cite this article in press as: A.A. Herna´ndez-Jua´rez, et al., GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico, Int. J. Pediatr. Otorhinolaryngol. (2014), http://dx.doi.org/10.1016/ j.ijporl.2014.09.016
G Model
PEDOT-7290; No. of Pages 6 A.A. Herna´ndez-Jua´rez et al. / International Journal of Pediatric Otorhinolaryngology xxx (2014) xxx–xxx
Answering this question requires further study. Although hearing loss associated with biallelic GJB2 mutations is predominantly high (10%–50%) worldwide, this is apparently not true for Mexico, suggesting that the DFNB1 locus is a rare cause of nonsyndromic deafness in Mexico, clearly indicating the complex genetic heterogeneity of this disorder [1,4,22,57]. Therefore, the infrequent contribution of mutations in DFNB1 and the presence of GJB2 heterozygotes implicate the involvement of other genomic regions. Acknowledgements We are grateful to the patients and their families for their cooperation. The authors of this study declare that there is no conflict of interest. References [1] M. Babanejad, Z. Fattahi, N. Bazazzadegan, C. Nishimura, N. Meyer, N. Nikzat, et al., A comprehensive study to determine heterogeneity of autosomal recessive nonsyndromic hearing loss in Iran, Am. J. Med. Genet. A. 158A (10) (2012) 2485–2492. [2] A. Sirmaci, Y.J. Edwards, H. Akay, M. Tekin, Challenges in whole exome sequencing: an example from hereditary deafness, PLoS One 7 (2) (2012) e32000. [3] A.C. Gonc¸alves, J. Chora, T.D. Matos, R. Santos, A. O‘Neill, P. Escada, et al., A novel p.Leu213X mutation in GJB2 gene in a Portuguese family, Int. J. Pediatr. Otorhinolaryngol. 77 (1) (2013) 89–91. [4] J. Shan, J. Chobot-Rodd, R. Castellanos, M. Babcock, A. Shanske, S.R. Parikh, et al., GJB2 mutation spectrum in 209 hearing impaired individuals of predominantly Caribbean Hispanic and African descent, Int. J. Pediatr. Otorhinolaryngol. 74 (6) (2010) 611–618. [5] D.K. Chan, K.W. Chang, GJB2-associated hearing loss: systematic review of worldwide prevalence, genotype, and auditory phenotype, Laryngoscope 124 (2) (2014) E34–E53. [6] A.Y. Joseph, B.A. Rasool, High frequency of connexin26 (GJB2) mutations associated with nonsyndromic hearing loss in the population of kerala, India. 73 (3) (2009) 437–443. [7] G.V. Putcha, B.A. Bejjani, S. Bleoo, J.K. Booker, J.C. Carey, N. Carson, et al., A multicenter study of the frequency and distribution of GJB2 and GJB6 mutations in a large North American cohort, Genet. Med. 9 (7) (2007) 413–426. [8] T. Chen, L. Jiang, C. Liu, H. Shan, J. Chen, B. Yang, et al., Update of the Spectrum of GJB2 Mutations in 107 Patients with Nonsyndromic Hearing Loss in the Fujian Population of China, Ann. Hum. Genet. 78 (3) (2014) 235–242. [9] S. Marlin, D. Feldmann, H. Blons, N. Loundon, I. Rouillon, S. Albert, et al., GJB2 and GJB6 mutations: genotypic and phenotypic correlations in a large cohort of hearing-impaired patients, Arch. Otolaryngol. Head Neck Surg. 131 (6) (2005) 481–487. [10] N.A. Barashkov, L.U. Dzhemileva, S.A. Fedorova, F.M. Teryutin, O.L. Posukh, E.E. Fedotova, et al., Autosomal recessive deafness 1A (DFNB1A) in Yakut population isolate in Eastern Siberia: extensive accumulation of the splice site mutation IVS1 + 1G > A in GJB2 gene as a result of founder effect, J. Hum. Genet. 56 (9) (2011) 631–639. [11] P. Seeman, I. Sakmaryova´, High prevalence of the IVS 1 + 1 G to A/GJB2 mutation among Czech hearing impaired patients with monoallelic mutation in the coding region of GJB2, Clin. Genet. 69 (5) (2006) 410–413. [12] T. To´th, S. Kupka, B. Haack, F. Fazakas, L. Muszbek, N. Blin, et al., Coincidence of mutations in different connexin genes in Hungarian patients, Int. J. Mol. Med. 20 (3) (2007) 315–321. [13] J. Rodriguez-Paris, M.L. Tamayo, N. Gelvez, I. Schrijver, Allele-specific impairment of GJB2 expression by GJB6 deletion del(GJB6-D13S1854), PLoS One 6 (6) (2011) e21665. [14] M.L. Tamayo, M. Olarte, N. Gelvez, et al., Molecular studies in the GJB2 gene (Cx26) among a deaf population from Bogota, Colombia: results of a screening program, Int. J. Pediatr. Otorhinolaryngol. 73 (1) (2009) 97–101. [15] L.S. Castro, A.N. Marinho, E.M. Rodrigues, G.C. Marques, T.A. Carvalho, L.C. Silva, et al., A study of GJB2 and delGJB6-D13S1830 mutations in Brazilian nonsyndromic deaf children from the Amazon region, Braz. J. Otorhinolaryngol. 79 (1) (2013) 95–99. [16] L. Cifuentes, M. Arancibia, M. Torrente, M. Acuna, C. Farfan, C. Rios, Prevalence of the 35delG mutation in the GJB2 gene in two samples of non-syndromic deaf subjects from Chile, Biol. Res. 46 (3) (2013) 239–242. [17] R. Utrera, V. Ridaura, Y. Rodrı´guez, M.J. Rojas, L. Mago, S. Angeli, et al., Detection of the 35delG/GJB2 and del(GJB6-D13S1830) mutations in Venezuelan patients with autosomal recessive nonsyndromic hearing loss, Genet. Test. 11 (4) (2007) 347–352. [18] A.C. Batissoco, R.S. Abreu-Silva, M.C. Braga, K. Lezirovitz, V. Della-Rosa, T. Alfredo Jr., et al., Prevalence of GJB2 (connexin-26) and GJB6 (connexin-30) mutations in a cohort of 300 Brazilian hearing-impaired individuals: implications for diagnosis and genetic counseling, Ear Hear. 30 (1) (2009) 1–7. [19] P. Mendelsberg-Fishbein, C.S. Ma´rquez-A´vila, C. Garcı´a-Delgado, A. Sa´nchezBoiso, B.A. Rodrı´guez-Espino, E.R. Va´zquez-Martı´nez, et al., Importance of the diagnosis of protein connexin 26 mutations in the integral management of nonsyndromic congenital deafness, Bol. Med. Hosp. Infant Mex. 70 (2) (2013) 88–96.
5
[20] M. de la Luz Arenas-Sordo, I. Menendez, E. Herna´ndez-Zamora, A. Sirmaci, D. Gutie´rrez-Tinajero, M. McGetrick, et al., Unique spectrum of GJB2 mutations in Mexico, Int. J. Pediatr. Otorhinolaryngol. 76 (11) (2012) 1678–1680. [21] H. Rangel-Villalobos, J.F. Mun˜oz-Valle, A. Gonza´lez-Martı´n, A. Gorostiza, M.T. Magan˜a, L.A. Pa´ez-Riberos, Genetic admixture, relatedness, and structure patterns among Mexican populations revealed by the Y-chromosome, Am. J. Phys. Anthropol. 135 (4) (2008) 448–461. [22] H.Y. Tang, P. Fang, P.A. Ward, E. Schmitt, S. Darilek, S. Manolidis, et al., DNA sequence analysis of GJB2, encoding connexin 26: observations from a population of hearing impaired cases and variable carrier rates, complex genotypes, and ethnic stratification of alleles among controls, Am. J. Med. Genet. A. 140 (22) (2006) 2401–2415. [23] F.J. del Castillo, M. Rodrı´guez-Ballesteros, A. Alvarez, T. Hutchin, E. Leonardi, C.A. de Oliveira, et al., A novel deletion involving the connexin-30 gene, del(GJB6d13s1854), found in trans with mutations in the GJB2 gene (connexin-26) in subjects with DFNB1 non-syndromic hearing impairment, J. Med. Genet. 42 (7) (2005) 588–594. [24] I. del Castillo, M. Villamar, M.A. Moreno-Pelayo, F.J. del Castillo, A. Alvarez, D. Tellerı´a, I. Mene´ndez, F. Moreno, et al., A deletion involving the connexin 30 gene in nonsyndromic hearing impairment, N. Engl. J. Med. 346 (4) (2002) 243–249. [25] A. Kenneson, K. Van Naarden Braun, C. Boyle, GJB2 (connexin 26) variants and nonsyndromic sensorineural hearing loss: a HuGE review, Genet. Med. 4 (4) (2002) 258–274. [26] I. Silva-Zolezzi, A. Hidalgo-Miranda, J. Estrada-Gil, J.C. Fernandez-Lopez, L. UribeFigueroa, A. Contreras, et al., Analysis of genomic diversity in Mexican Mestizo populations to develop genomic medicine in Mexico, Proc. Natl. Acad. Sci. U S A. 106 (21) (2009) 8611–8616. [27] L.P. Gravina, M.E. Foncuberta, M.E. Prieto, J. Garrido, C. Barreiro, L. Chertkoff, Prevalence of DFNB1 mutations in Argentinean children with non-syndromic deafness. Report of a novel mutation in GJB2, Int. J. Pediatr. Otorhinolaryngol. 74 (3) (2010) 250–254. [28] P.M. Kelley, D.J. Harris, B.C. Comer, J.W. Askew, T. Fowler, S.D. Smith, et al., Novel mutations in the connexin 26 gene (GJB2) that cause autosomal recessive (DFNB1) hearing loss, Am. J. Hum. Genet. 62 (4) (1998) 792–799. [29] Z.A. Xiao, D.H. Xie, GJB2 (Cx26) gene mutations in Chinese patients with congenital sensorineural deafness and a report of one novel mutation, Chinese Med. J 117 (12) (2004) 1797–1801. [30] M. Tekin, X.J. Xia, R. Erdenetungalag, et al., GJB2 mutations in Mongolia: complex alleles, low frequency, and reduced fitness of the deaf, Annals. Hum. Genet. 74 (2) (2010) 155–164. [31] S.A. Zainal, M.K. Md Daud, N. Abd Rahman, Z. Zainuddin, Z. Alwi, Mutation detection in GJB2 gene among Malays with non-syndromic hearing loss, Int. J. Pediatr. Otorhinolaryngol. 76 (8) (2012) 1175–1179. [32] D.K. Chan, I. Schrijver, K.W. Chang, Connexin-26-associated deafness: phenotypic variability and progression of hearing loss, Genet. Med. 12 (3) (2010) 174–181. [33] S.Y. Choi, K.Y. Lee, H.J. Kim, H.K. Kim, Q. Chang, H.J. Park, et al., Functional evaluation of GJB2 variants in nonsyndromic hearing loss, Mol. Med. 17 (6) (2011) 550–556. [34] H.B. Cheng, Z.B. Chen, Q.J. Wei, Y.J. Lu, G.Q. Xing, X. Cao, Single nucleotide polymorphisms and haplotypes analysis of DFNB1 locus in Chinese sporadic hearing impairment population, Chinese Med. J. 122 (13) (2009) 1549–1553. [35] F. Denoyelle, D. Weil, M.A. Maw, S.A. Wilcox, N.J. Lench, D.R. Allen-Powell, et al., Prelingual deafness: high prevalence of a 30delG mutation in the connexin 26 gene, Hum. Mol. Genet. 6 (12) (1997) 2173–2177. [36] L.H. Hoefsloot, A.F. Roux, M. Bitner-Glindzicz, contributors to EMQN DFNB1 best practice meeting, EMQN Best Practice guidelines for diagnostic testing of mutations causing non-syndromic hearing impairment at the DFNB1 locus, Eur. J. Hum. Genet. 21 (11) (2013) 1325–1329. [37] M. Palmada, K. Schmalisch, C. Bo¨hmer, N. Schug, M. Pfister, F. Lang, et al., Loss of function mutations of the GJB2 gene detected in patients with DFNB1-associated hearing impairment, Neurobiol. Dis. 22 (1) (2006) 112–118. [38] Z. Riahi, H. Hammami, H. Ouragini, H. Messai, R. Zainine, Y. Bouyacoub, et al., Update of the spectrum of GJB2 gene mutations in Tunisian families with autosomal recessive nonsyndromic hearing loss, Gene 525 (1) (2013) 1–4. [39] T.D. Matos, H. Simo˜es-Teixeira, H. Caria, A.C. Gonc¸alves, J. Chora, C. Correia Mdo, et al., Spectrum and frequency of GJB2 mutations in a cohort of 264 Portuguese nonsyndromic sensorineural hearing loss patients, Int. J. Audiol. 52 (7) (2013) 466–471. [40] S. Angeli, R. Utrera, S. Dib, E. Chiossone, C. Naranjo, O. Henrı´quez, et al., GJB2- gene mutations in childhood deafness, Acta. Otolaryngol. 120 (2) (2000) 133–136. [41] I. Sansovic, J. Knezevic, V. Musani, P. Seeman, I. Barisic, J. Pavelic, GJB2 mutations in patients with nonsyndromic hearing loss from Croatia, Genet. Test Mol. Biomarkers 13 (5) (2009) 693–699. [42] L.U. Dzhemileva, N.A. Barashkov, O.L. Posukh, R.I. Khusainova, V.L. Akhmetova, I.A. Kutuev, et al., Carrier frequency of GJB2 gene mutations c.35delG, c.235delC and c.167delT among the populations of Eurasia, J. Hum. Genet. 55 (11) (2010) 749–754. [43] S. Prasad, R.A. Cucci, G.E. Green, R.J. Smith, Genetic testing for hereditary hearing loss: connexin 26 (GJB2) allele variants and two novel deafness-causing mutations (R32 C and 645-648delTAGA), Hum. Mut. 16 (6) (2000) 502–508. [44] W.T. McGuirt, S.D. Prasad, R.A. Cucci, G.E. Green, R.J. Smith, Clinical presentation of DFNB1, Adv. Otorhinoalryngol. 61 (2002) 113–119. [45] H. Azaiez, G.P. Chamberlin, S.M. Fischer, C.L. Welp, S.D. Prasad, R.T. Taggart, I. del Castillo, G. Van Camp, R.J. Smith, et al., GJB2: the spectrum of deafness-causing allele variants and their phenotype, Hum. Mut. 24 (4) (2004) 305–311. [46] J.L. Solan, P.D. Lampe, Connexin 43 phosphorylation: structural changes and biological effects, Biochem J. 419 (2) (2009) 261–272.
Please cite this article in press as: A.A. Herna´ndez-Jua´rez, et al., GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico, Int. J. Pediatr. Otorhinolaryngol. (2014), http://dx.doi.org/10.1016/ j.ijporl.2014.09.016
G Model
PEDOT-7290; No. of Pages 6 6
A.A. Herna´ndez-Jua´rez et al. / International Journal of Pediatric Otorhinolaryngology xxx (2014) xxx–xxx
[47] D. Locke, F. Kieken, L. Tao, P.L. Sorgen, A.L. Harris, Mechanism for modulation of gating of connexin26-containing channels by taurine, J. Gen. Physiol. 138 (3) (2011) 321–339. [48] R. Rabionet, L. Zelante, N. Lo´pez-Bigas, L. D‘Agruma, S. Melchionda, G. Restagno, et al., Molecular basis of childhood deafness resulting from mutations in the GJB2 (connexin 26) gene, Hum. Genet. 106 (1) (2000) 40–44. [49] P. D‘Andrea, V. Veronesi, M. Bicego, S. Melchionda, L. Zelante, E. Di Iorio, et al., Hearing loss: frequency and functional studies of the most common connexin26 alleles, Biochem. Biophys. Res. Commun. 296 (3) (2002) 685–691. [50] E.C. Beyer, G.M. Lipkind, J.W. Kyle, V.M. Berthoud, Structural organization of intercellular channels II. Amino terminal domain of the connexins: sequence, functional roles, and structure, Biochim. Biophys. Acta. 1818 (8) (2012) 1823– 1830. [51] A.D. Martinez, R. Acuna, V. Figueroa, J. Maripillan, B. Nicholson, Gap–junction channels dysfunction in deafness and hearing loss, Antioxid. Redox. Signal. 11 (2009) 309–322.
[52] G. Chen, S. Fu, J. Dong, P. Chen, Low frequency of GJB2 mutations in thirty-five students with hearing loss in Chinese consanguineous families, Int. J. Pediatr. Otorhinolaryngol. 75 (12) (2011) 1535–1537. [53] G.W. Brobby, B. Mu¨ller-Myhsok, R.D. Horstmann, Connexin 26 R143 W mutation associated with recessive nonsyndromic sensorineural deafness in Africa, N. Engl. J. Med. 338 (8) (1998) 548–550. [54] C. Hayashi, M. Funayama, Y. Li, K. Kamiya, A. Kawano, M. Suzuki, et al., Prevalence of GJB2 causing recessive profound non-syndromic deafness in Japanese children, Int. J. Pediatr. Otorhinolaryngol. 75 (12) (2011) 211–214. [55] A. Hall, M., Pembrey, M., Lutman, C., Steer, M. Bitner-Glindzicz, Prevalence and audiological features in carriers of GJB2 mutations, c.35delG and c.101T > C (p.M34 T), in a UK population study, BMJ Open 2 (4) (2012) pii: e001238. [56] S. Ennis, M. Rı´os, N. Albert, The Hispanic Population: 2010, Census Bureau, U.S., 2011. [57] L.A. Schimmenti, A. Martinez, M. Telatar, C.H. Lai, N. Shapiro, M. Fox, et al., Infant hearing loss and connexin testing in a diverse population, Genet. Med. 10 (7) (2008) 517–524.
Please cite this article in press as: A.A. Herna´ndez-Jua´rez, et al., GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico, Int. J. Pediatr. Otorhinolaryngol. (2014), http://dx.doi.org/10.1016/ j.ijporl.2014.09.016
PEDOT-7290; No. of Pages 6 International Journal of Pediatric Otorhinolaryngology xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
International Journal of Pediatric Otorhinolaryngology journal homepage: www.elsevier.com/locate/ijporl
GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico Aidee´ Alejandra Herna´ndez-Jua´rez a, Jose´ de Jesu´s Lugo-Trampe a, ˜ o-Gonza´lez c, Luis Daniel Campos-Acevedo a, Angel Lugo-Trampe b, Jose´ Luis Trevin d a, Israel de-la-Cruz-A´vila , Laura Elia Martı´nez-de-Villarreal * a
Departamento de Gene´tica, Facultad de Medicina y Hospital Universitario ‘‘Jose´ E. Gonza´lez’’, Universidad Auto´noma de Nuevo Leo´n (UANL), Av. Gonzalitos s/n cruce con Av. Madero, Col. Mitras Centro CP 64460, Monterrey, N.L., Me´xico b Centro Mesoamericano de Estudios en Salud Pu´blica y Desastres, Universidad Auto´noma de Chiapas (UNACH), Carretera Antiguo Aeropuerto; Pista Principal cruce con Pista Secundaria S/N, Col. Solidaridad 2000, CP 30798, Tapachula, Chis, Me´xico c Departamento de Otorrinolaringologı´a, Facultad de Medicina y Hospital Universitario ‘‘Jose´ E. Gonza´lez’’, Universidad Auto´noma de Nuevo Leo´n (UANL), Av. Gonzalitos s/n cruce con Av. Madero, Col. Mitras Centro CP 64460, Monterrey, N.L., Me´xico d Servicio de Audiologı´a Pedia´trica, Hospital Materno-Infantil, Aldama 460, Col. San Rafael, CP. 67190, Guadalupe, N.L., Me´xico
A R T I C L E I N F O
A B S T R A C T
Article history: Received 16 June 2014 Received in revised form 12 September 2014 Accepted 16 September 2014 Available online xxx
Objectives: Mutations in the DFNB1 locus are the most common cause of autosomal-recessive nonsyndromic hearing loss (ARNSHL) worldwide. The aim of this study was to identify the most frequent mutations in patients with ARNSHL who reside in Northeastern Mexico. Methods: We determined the nucleotide sequence the coding region of GJB2 of 78 patients with ARNSHL. Polymerase chain reaction assays were used to detect the GJB2 IVS1 + 1G > A mutation and deletions within GJB6. Results: GJB2 mutations were detected in 9.6% of the alleles, and c.35delG was the most frequent. Six other less-frequent mutations were detected, including an extremely rare variant (c.645_648delTAGA), a novel mutation (c.35G > A), and one of possible Mexican origin (c.34G > T). GJB6 deletions and GJB2 IVS1 + 1G > A were not detected. Conclusions: These data suggest that mutations in the DFNB1 locus are a rare cause of ARNSHL among the population of Northeastern Mexico. This confirms the genetic heterogeneity of this condition and indicates that further research is required to determine the other mechanisms of pathogenesis of ARNSHL in Mexicans. ß 2014 Elsevier Ireland Ltd. All rights reserved.
Keywords: DFNB1 GJB2 GJB6 deafness autosomal-recessive nonsyndromic
1. Introduction The most common neurosensory disorder is hearing loss, which occurs in approximately 1–2 of 1,000 live births worldwide [1]. Genetic factors account for approximately 50% of patients with hearing loss [2], of which 70% do not show a syndromic association [3]. This type of nonsyndromic genetic hearing loss is grouped into four categories according to the mode of inheritance, and the most common (75–80%) cause is autosomal-recessive mutations
* Corresponding author. Departamento de Gene´tica, Facultad de Medicina y Hospital Universitario ‘‘Jose´ E. Gonza´lez’’, Universidad Auto´noma de Nuevo Leo´n (UANL), Av. Gonzalitos s/n cruce con Av. Madero, Col. Mitras Centro CP 64460, Monterrey, N.L., Me´xico. Tel.: +52 81 83483704; fax: +52 81 83294217. E-mail address: [email protected] (L.E. Martı´nez-de-Villarreal).
[4]. Mutations in the gene (GJB2) encoding connexin 26 (CX26) are the most frequent cause of autosomal-recessive nonsyndromic hearing loss (ARNSHL). The frequency of each mutation depends on the ethnic origin of the population. For example, the frequency of c.35delG is high in Europe and the Middle East (2-4%), c.235delC in East Asia (1–2%), V37I in Southeast Asia (carrier rate 11.6%), and W24X in India (4.05%). In smaller populations such as Ashkenazi Jews, c.167delT is most prevalent (4.0%) [5–7]. However, there are variants or polymorphisms of unknown clinical significance [8– 10]. Further, such variants may account for a high percentage of individuals with deafness in certain Eastern European populations as those of the Czech Republic and Hungary [11,12]. Similarly, two large deletions in GJB6, del(GJB6-D13S1830) and del(GJB6D13S1854), cause ARNSHL in carriers of a variant of one GJB2 allele [13]. There are reports of mutations in GJB2 and GJB6 in Latin American countries [4,14–18]. Two studies are available on the
http://dx.doi.org/10.1016/j.ijporl.2014.09.016 0165-5876/ß 2014 Elsevier Ireland Ltd. All rights reserved.
Please cite this article in press as: A.A. Herna´ndez-Jua´rez, et al., GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico, Int. J. Pediatr. Otorhinolaryngol. (2014), http://dx.doi.org/10.1016/ j.ijporl.2014.09.016
G Model
PEDOT-7290; No. of Pages 6 A.A. Herna´ndez-Jua´rez et al. / International Journal of Pediatric Otorhinolaryngology xxx (2014) xxx–xxx
2
population of Central Mexico [19,20]; however, the incidence of GJB2 and GJB6 mutations in residents of Northeastern Mexico is unknown [21]. Therefore, the goal of the present study was to characterize the DFNB1 locus (13q11-q12) in patients with ARNSHL living in Northeastern Mexico. 2. Materials and Methods 2.1. Patients Seventy-eight individuals with congenital hearing loss and no evidence of syndromic features were referred to the Department of Genetics of Dr. Jose´ Eleuterio Gonza´lez Hospital. The 78 individuals were children or adolescents from 1 to 13 years of age. The samples were obtained from the Department of Otorhinolaryngology of Dr. Jose´ Eleuterio Gonza´lez Hospital and Materno-Infantil Hospital. The population resided in Northeastern Mexico in the states of Nuevo Leo´n, San Luis Potosı´ and Tamaulipas. Each patient was evaluated according to their clinical history and the results of a physical examination and audiometry. Informed consent was obtained from all participants in the study, and the study was approved by the ethics committee of the Autonomous University of Nuevo Leo´n. 2.2. DNA extraction and sequencing Genomic DNA was extracted from peripheral venous blood using the QIAamp DNA Blood mini kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. Polymerase chain reaction (PCR) amplification of the coding region of GJB2 was performed in a final volume of 15 ml in a solution containing 1 Colorless GoTaq Flexi Buffer, 1.5 mM MgCl2, 0.2 mM each dNTP, 1 U of GoTaq Hot Start (Promega, Madison, WI, USA), 25 ng DNA, 0.66 pmol each primer (forward primer 5 0 ACATTTTGCTGCCGGTCATCTCCCTGTTCTGTCCTA-30 and reverse primer 50 -GTCCTTTGTCGATACTGGAATCTAACAACTGGGCAATG30 ), and 2% Hi-DiTM formamide (Applied Biosystems, Foster City, CA, USA). All amplifications were performed using a Veriti 96-well Thermal Cycler (Applied Biosystems, Foster City, CA, USA). Amplification conditions were as follows: 1 cycle at 95 8C for 5 min, 30 cycles at 95 8C for 30 s, 60 8C for 40 s, 72 8C for 50 s, 1 cycle at 72 8C for 2 min and storage at 4 8C. The primers were incorporated into the 50 -terminus of phage M13 DNA to enhance data quality. PCR products were purified using ExoSAP-IT (Affymetrix, Santa Clara, CA, USA). The purified amplicons were directly sequenced using a BigDye Terminator version 3.1 kit (Applied Biosystems, Foster City, CA, USA) and analysed using a ABI Prism 3130 DNA sequencer (Applied Biosystems, Foster City, CA, USA) with Geneious version 4.1 software (Biomatters, Auckland, NZ). Sequence variants were verified using the NCBI http:// www.ncbi.nlm.nih.gov) and Ensembl (http://www.ensembl.org) databases. All negative samples or those with one affected GJB2 allele were screened for mutations in IVS1 + 1G > A and for deletions in GJB6. 2.3. PCR-restriction fragment length polymorphism analysis to detect IVS1 + 1 G > A Assays to detect the IVS1 + 1G > A splice-site mutation in GJB2 exon 1 were performed using PCR–restriction fragment length polymorphism analysis (PCR-RFLP). In general, PCR reactions were performed in 15 ml of a solution containing 1x Colorless GoTaq Flexi Buffer, 0.9 mM MgCl2, 0.2 mM each dNTP, 25 ng DNA, 1 U of GoTaq Hot Start, 0.66 pmol each primer (forward primer 50 GGGCTCAAAGGAACTAGGAGAT-30 reverse primer 50 -ACATCGGCGACACCACAA-30 ) and 2% Hi-DiTM formamide. All amplifications
Table 1 Quantitative PCR Primers for amplifying GJB6. Primer
Sequence (50 -30 )
IL4-CTL-F IL4-CTL-R GJB6-Ex6-F GJB6-Ex6-R GJB6-Ex3-F GJB6-Ex3-R GJB6-ups-F GJB6-ups-R
CACGGACACAAGTGCGATA AGAGATGGTGCCAGATAGGT TGAATGTAGACGGAACAGTGT TGAGGCAATCACATCCACAT TCTGGCTAAACAATTTCTGTATGG GCTCACAGCACCTGGAATA CAATAGCGTGGACGACAGTA GTCTTCTTCACCGACAGGAA
were performed using a Veriti 96-well thermal cycler. Amplification conditions were as follows: 1 cycle at 95 8C for 4 min; 35 cycles at 95 8C for 15 s, 62 8C for 50 s, 72 8C for 40 s; and 1 cycle at 72 8C for 2 min with storage at 4 8C. Amplicons were incubated in 20 ml of a solution containing 1 U Hph1, 1 CutSmartTM digestion buffer (New England BioLabs, Ipswich, MA), and 100 ng of amplicon. The samples were then incubated at 37 8C for 8 h, and the reactions were terminated by incubation at 65 8C for 20 min. All digests were analysed using 2% (w/v) agarose gel electrophoresis (Bio-Rad Laboratories, Hercules, CA). DNA fragments were detected using a Gel DocTM XR+ documentation system (Bio-Rad Laboratories, Hercules, CA). The G-allele-specific 684-bp amplicon was cleaved into 385-bp and 299-bp fragments. In contrast, the 684-bp A-allele-specific amplicon was not cleaved under these conditions (the A-allele amplicon lacks an Hph1 site). 2.4. Real-time quantitative PCR (qPCR) screening for deletions in GJB6 A StepOne Real-Time (Applied Biosystems, Foster City, CA) system with 48-well plates was used to perform qPCR. Reactions contained 25 ng DNA, 0.66 pmol each primer (Table 1), and 1x Maxima SYBR Green/ROX qPCR Master Mix (Fermentas, Vilnius, Lithuania) in a total volume of 15 ml. Each sample was assayed in triplicate. Amplification conditions were as follows: 1 cycle at 95 8C for 10 min, followed by 45 cycles at 95 8C for 10 s, 60 8C for 10 s, and 72 8C for 50 s. Melting curve analysis was performed from 50 8C to 95 8C (1 8C/5 s) to ensure consistency and specificity of the amplified product. Baseline and quantification cycle (Cq) were determined automatically by StepOne v2.0. software for direct comparison of Ct values for the target vs. reference gene, which were calculated using the delta-delta-CT method. 3. Results We screened 78 unrelated individuals with profound or severe prelingual nonsyndromic deafness of unknown cause for GJB2 and GJB6 mutations. The analysis of the GJB2 coding region revealed eight different variants in 38 individuals (48.7%) (Table 2). We observed 7 different previously described variants in GJB2 [5]. The variant c.79G > A was detected in 68.4% (26/38) of affected individuals. Four were biallelic, three were compound heterozygotes, and 19 were mono-allelic; however, this variant corresponds to a nonpathogenic polymorphism. The other 12 (31.6%) represented pathogenic variants (c.35delG, c.645_648delTAGA, c.35G > T, c.427C > T, c.101T > C, and c.34G > T) as well as one novel mutation (c.35G > A). Two individuals were homozygous for the c.35delG and c.35G > T mutations. One patient was a compound heterozygote (c.35delG and c.645_648delTAGA), and the remaining nine were mono-allelic variants (Table 3). Biallelic mutations accounted for 3.8% (3/78) of those that cause hearing loss. The c.35delG mutation was the most common (46.7%, 7/15). GJB6 deletions and GJB2 IVS1 + 1G > A were not detected. Genetic analysis of the parents was performed to determine whether the
Please cite this article in press as: A.A. Herna´ndez-Jua´rez, et al., GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico, Int. J. Pediatr. Otorhinolaryngol. (2014), http://dx.doi.org/10.1016/ j.ijporl.2014.09.016
G Model
PEDOT-7290; No. of Pages 6 A.A. Herna´ndez-Jua´rez et al. / International Journal of Pediatric Otorhinolaryngology xxx (2014) xxx–xxx
3
Table 2 Frequency of GJB2 mutations (n = 156). Variant Codon
Change
Location*
Type of mutation
Effect
Allele (frequency)
p.Val27Ile p.Gly12Valfs*2 p.Ile214Ilefs*17 p.Gly12Asp p.Gly12Val p.Arg143Trp p.Met34Thr p.Gly12Cys
c.79G > A c.35delG c.645_648delTAGA c.35G > A c.35G > T c.427C > T c.101T > C c.34G > T
M1 N-Terminus C-Terminus N-Terminus N-Terminus E1 N-Terminus N-Terminus
Missense Frameshift Frameshift Missense Missense Missense Missense Missense
Benign Pathogenic Pathogenic Novel Pathogenic Pathogenic Pathogenic Pathogenic
30 (0.19) 7 (0.04) 2 (0.01) 1 (0.006) 2 (0.01) 1 (0.006) 1 (0.006) 1 (0.006)
*N-Terminus = amino-terminus, M1–M4 = transmembrane domains 1–4, E1 and E2 = extracellular domains 1 and 2, and C-Terminus = carboxy-terminus.
mutations were in trans. In three cases, each parent carried one of the mutations. Therefore, the children were effectively homozygous or compound heterozygous. In contrast, in cases with a single mutation, it was verified only in one of the parents, suggesting a mutation in cis. Nevertheless, we cannot rule out a mutation in another gene. 4. Discussion ARNSHL is a genetically heterogeneous disease that comprises 98 loci (http://www.hereditaryhearingloss.org; June 8, 2014). However, mutations in the DFNB1 locus (13q11-12), which contains the GJB2 (OMIM 121011) and GJB6 (OMIM 604418) genes, are the most common cause of this disorder in different populations, representing 10–50% of cases [5,22–24]. DNA sequence analysis of GJB2 in the present study led to a diagnosis of hearing loss in only 3.8% of the patients, which is remarkably low compared with those of other reports [5]. In a study of Mexicans residing in Central Mexico, de la Luz Arenas-Sordo et al. [20] found that 10.6% of those with nonsyndromic hearing loss harboured GJB2 mutations. This difference between frequencies, although not very large compared with our study, is low and consistent with the frequency of GJB2 mutations in non-Europeans [4,5,25], which may be attributed to the high genomic diversity in the Mexican population caused by miscegenation [21,26]. In the present study, the most frequent polymorphism (33%, n = 26) was c.79G > A (rs2274084). This variant is detected at greater frequency in Hispanics and Asians, representing 12.5% and 20.8%, respectively [7,14,15,27–31]; however, it is classified as benign [32,33]. Although c.341A > G (rs2274083) was not detected in the present study, a single nucleotide polymorphism may be involved in hearing loss [7]. For example, Cheng et al. [34] suggest that the rs2274084 and rs2274083 haplotypes (C-C genotype) confer a risk of sporadic hearing loss while the T-T genotype may
Table 3 Genotypes of patients with GJB2 mutations. Genotype allele 1
allele 2
c.35delG c.35delG c.35G > T c.35delG c.34G > T c.101T > C c.35G > A c.645delTAGA c.427C > T Wt
c.35delG c.645delTAGA c.35G > T wt wt wt wt wt wt wt
Patients with ARNSHL (n = 78)
Etiology
1 (1.28%) 1 (1.28%) 1 (1.28%) 4 (5.13%) 1 (1.28%) 1 (1.28%) 1 (1.28%) 1 (1.28%) 1 (1.28%) 66 (84.6%)
DFNB1 DFNB1 DFNB1 Unknown Unknown Unknown Unknown Unknown Unknown Unknown
Wt = Wild-type, DFNB1 = Nonsyndromic hearing loss and deafness
be protective. These authors conclude that single nucleotide polymorphisms in the DFNB1 locus play an important role in sporadic cases of hearing loss. The second most frequent variant detected here was c.35delG (also called c.30delG) [35,36], which is the most common variant associated with autosomal-recessive hearing loss. This mutation causes a frameshift at position 12 of the coding region of GJB2 that prematurely terminates the polypeptide chain (p.Gly12Valfs*2) [31,37]. This mutation was present in seven of the 156 alleles, which represents a prevalence of 4.5% and a frequency of 46.7% of the alleles mutated in this population. The c.35delG mutation is one of the most frequent mutations (11%–59.5%) in different populations, including Hispanics [5,14,16,27]. However, our results are inconsistent with expectations based on studies of the Caucasian population of South America [38,39] but are similar to those of studies of the population of Central America, including Venezuela [4,17,40]. Here we found a patient with a homozygous c.35delG mutation and another compound heterozygous patient (c.35delG and c.645 648delTAGA) with profound hearing disability, as expected [18,41]. Individuals homozygous for c.35delG represent approximately 47% of patients with predominance in Europe, North Africa and the Middle East, decreasing to 0% in South and East Asia [5,42]. This mutation accounts for 1.3% (1/78) of our study patients. This predominance is present in Mexican patients in Central Mexico [19,20]. We detected a four-base deletion (c.645 648delTAGA) that shifts the reading frame and introduces a delayed stop codon (p.Ile214Ilefs*17) in the carboxyl-terminal domain (CT) in two patients. This extremely rare variant was described first by Prasad et al. [43], in 209 patients with hearing loss in the Midwest United States and is accompanied by only one mutated allele (c.35delG). This mutation was subsequently reported in three other studies [22,44,45]. Our present findings are consistent with studies that identified compound heterozygosity in one patient associated with c.35delG and in another heterozygous patient. Until recently, it was believed that the CT domain did not play an important functional role, because it is too short to exert regulatory effects. [46] However, Locke et al. [47] demonstrated that the CT domain plays a direct role in the modulation of pores in the occlusion of the pathway of permeability [3]. In our present study, two patients with this mutation suffered from profound hearing loss. The c.35G > T mutation encodes a valine at residue 12 of CX26 (p.Gly12Val), and is present in Italians and Spaniards in a compound heterozygous state with c.35delG [48]. Subsequently, a multicenter study of a large cohort of North Americans reported c.35G > T as one of the most common in Hispanics (4.8%) [7]. This mutation as well as p.Gly12Valfs*2, p.Gly12Asp, p.Met34Thr and p.Gly12Cys reported here occur in the N-terminal domain and are highly conserved between b-connexins. This domain is involved in membrane integration and restricts the size of molecules that
Please cite this article in press as: A.A. Herna´ndez-Jua´rez, et al., GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico, Int. J. Pediatr. Otorhinolaryngol. (2014), http://dx.doi.org/10.1016/ j.ijporl.2014.09.016
G Model
PEDOT-7290; No. of Pages 6 4
A.A. Herna´ndez-Jua´rez et al. / International Journal of Pediatric Otorhinolaryngology xxx (2014) xxx–xxx
enter the channel. In particular, G12 V causes complete intracellular retention of b-connexin, which accumulates in large perinuclear vesicles and is accompanied by a significant decrease in its expression, suggesting that G12 is required for the maturation of connexin [49]. In our present study, c.35G > T was one of two homozygous mutations that caused the profound hearing loss of the patient. We identified the unreported mutation c.35G > A (p.Gly12Asp), which unlike the c.35G > T known mutation [48], Val replaces Asp (c.35G > A). Val and Gly (wild-type) are nonpolar, and Asp carries a negative charge. Both mutations are located in a region required for the regulation of channel selectivity [50,51]. The results of sequence analyses using SIFT, PolyPhen-2, and multiple alignments indicate that this change alters protein conformation and likely represents a pathogenic variant (Fig. 1). Thus, we observed three possible genotypes at the same position. The c.35G > T (rs1801002) mutation is pathogenic [7,48,52], suggesting that p.Gly12Asp alters or inhibits the function of the protein that leads to hearing loss. However, functional evaluation of the protein carrying the p.Gly12Asp mutation is required. Patients with the c.35G > A mutation experience profound hearing loss.
The other less common mutations detected in the present study are as follows: c.427C > T, c.101T > C and c.34G > T. These mutations are prevalent in populations of Africa, North America and Europe, respectively [7,27,53–55] and are responsible for a proportion of nonsyndromic deafness with a phenotype of moderate to profound hearing loss. In the present study, these mutations were present in 1.92% of alleles. Patients with profound deafness harboured the first two mutations, and one patient with c.34G > T progressed from moderate to profound deafness. There are few studies of this variant [7,19,22,32], which were all conducted in North America. In most cases, the patients were of Hispanic ancestry or Mexican descent and resided in California, Texas (states with the highest percentage of Mexican migrants) [56] or Mexico. The mutation was likely present in a Mexican who migrated north. The c.34G > T mutation is heterozygous in the majority of patients (86%), suggesting an autosomal-dominant pattern of inheritance. Here, the subject reported a family history of hearing loss, which is consistent with the mother’s mild hearing loss. Therefore, we believe that the level of expression of the mutant protein varies according to the severity of the phenotype.
Fig. 1. PolyPhen-2 and SIFT analyses and multiple alignments of connexins encoded by GJB2 of different species and human connexin isoforms. (A) Single Nucleotide Variant (SNV) c.35G > A. The substituted amino acid residue, Gly12Asp, is shown in red. (B) Sequence analyses predict a change that alters the structure of the protein. (C) Multiple alignment of the first N-terminal amino acid residues of 12 human connexins and 12 connexins encoded by GJB2 of different species (corresponding to amino acid residues 1–27). The grey box highlights the evolutionary conservation of Gly12. PolyPhen prediction tool: http://genetics.bwh.harvard.edu/ pph2/; SIFT prediction tool: http://provean.jcvi.org/genome_submit.php; multiple sequence alignment tool: https://www.ebi.ac.uk/Tools/msa/clustalw2/.
Please cite this article in press as: A.A. Herna´ndez-Jua´rez, et al., GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico, Int. J. Pediatr. Otorhinolaryngol. (2014), http://dx.doi.org/10.1016/ j.ijporl.2014.09.016
G Model
PEDOT-7290; No. of Pages 6 A.A. Herna´ndez-Jua´rez et al. / International Journal of Pediatric Otorhinolaryngology xxx (2014) xxx–xxx
Answering this question requires further study. Although hearing loss associated with biallelic GJB2 mutations is predominantly high (10%–50%) worldwide, this is apparently not true for Mexico, suggesting that the DFNB1 locus is a rare cause of nonsyndromic deafness in Mexico, clearly indicating the complex genetic heterogeneity of this disorder [1,4,22,57]. Therefore, the infrequent contribution of mutations in DFNB1 and the presence of GJB2 heterozygotes implicate the involvement of other genomic regions. Acknowledgements We are grateful to the patients and their families for their cooperation. The authors of this study declare that there is no conflict of interest. References [1] M. Babanejad, Z. Fattahi, N. Bazazzadegan, C. Nishimura, N. Meyer, N. Nikzat, et al., A comprehensive study to determine heterogeneity of autosomal recessive nonsyndromic hearing loss in Iran, Am. J. Med. Genet. A. 158A (10) (2012) 2485–2492. [2] A. Sirmaci, Y.J. Edwards, H. Akay, M. Tekin, Challenges in whole exome sequencing: an example from hereditary deafness, PLoS One 7 (2) (2012) e32000. [3] A.C. Gonc¸alves, J. Chora, T.D. Matos, R. Santos, A. O‘Neill, P. Escada, et al., A novel p.Leu213X mutation in GJB2 gene in a Portuguese family, Int. J. Pediatr. Otorhinolaryngol. 77 (1) (2013) 89–91. [4] J. Shan, J. Chobot-Rodd, R. Castellanos, M. Babcock, A. Shanske, S.R. Parikh, et al., GJB2 mutation spectrum in 209 hearing impaired individuals of predominantly Caribbean Hispanic and African descent, Int. J. Pediatr. Otorhinolaryngol. 74 (6) (2010) 611–618. [5] D.K. Chan, K.W. Chang, GJB2-associated hearing loss: systematic review of worldwide prevalence, genotype, and auditory phenotype, Laryngoscope 124 (2) (2014) E34–E53. [6] A.Y. Joseph, B.A. Rasool, High frequency of connexin26 (GJB2) mutations associated with nonsyndromic hearing loss in the population of kerala, India. 73 (3) (2009) 437–443. [7] G.V. Putcha, B.A. Bejjani, S. Bleoo, J.K. Booker, J.C. Carey, N. Carson, et al., A multicenter study of the frequency and distribution of GJB2 and GJB6 mutations in a large North American cohort, Genet. Med. 9 (7) (2007) 413–426. [8] T. Chen, L. Jiang, C. Liu, H. Shan, J. Chen, B. Yang, et al., Update of the Spectrum of GJB2 Mutations in 107 Patients with Nonsyndromic Hearing Loss in the Fujian Population of China, Ann. Hum. Genet. 78 (3) (2014) 235–242. [9] S. Marlin, D. Feldmann, H. Blons, N. Loundon, I. Rouillon, S. Albert, et al., GJB2 and GJB6 mutations: genotypic and phenotypic correlations in a large cohort of hearing-impaired patients, Arch. Otolaryngol. Head Neck Surg. 131 (6) (2005) 481–487. [10] N.A. Barashkov, L.U. Dzhemileva, S.A. Fedorova, F.M. Teryutin, O.L. Posukh, E.E. Fedotova, et al., Autosomal recessive deafness 1A (DFNB1A) in Yakut population isolate in Eastern Siberia: extensive accumulation of the splice site mutation IVS1 + 1G > A in GJB2 gene as a result of founder effect, J. Hum. Genet. 56 (9) (2011) 631–639. [11] P. Seeman, I. Sakmaryova´, High prevalence of the IVS 1 + 1 G to A/GJB2 mutation among Czech hearing impaired patients with monoallelic mutation in the coding region of GJB2, Clin. Genet. 69 (5) (2006) 410–413. [12] T. To´th, S. Kupka, B. Haack, F. Fazakas, L. Muszbek, N. Blin, et al., Coincidence of mutations in different connexin genes in Hungarian patients, Int. J. Mol. Med. 20 (3) (2007) 315–321. [13] J. Rodriguez-Paris, M.L. Tamayo, N. Gelvez, I. Schrijver, Allele-specific impairment of GJB2 expression by GJB6 deletion del(GJB6-D13S1854), PLoS One 6 (6) (2011) e21665. [14] M.L. Tamayo, M. Olarte, N. Gelvez, et al., Molecular studies in the GJB2 gene (Cx26) among a deaf population from Bogota, Colombia: results of a screening program, Int. J. Pediatr. Otorhinolaryngol. 73 (1) (2009) 97–101. [15] L.S. Castro, A.N. Marinho, E.M. Rodrigues, G.C. Marques, T.A. Carvalho, L.C. Silva, et al., A study of GJB2 and delGJB6-D13S1830 mutations in Brazilian nonsyndromic deaf children from the Amazon region, Braz. J. Otorhinolaryngol. 79 (1) (2013) 95–99. [16] L. Cifuentes, M. Arancibia, M. Torrente, M. Acuna, C. Farfan, C. Rios, Prevalence of the 35delG mutation in the GJB2 gene in two samples of non-syndromic deaf subjects from Chile, Biol. Res. 46 (3) (2013) 239–242. [17] R. Utrera, V. Ridaura, Y. Rodrı´guez, M.J. Rojas, L. Mago, S. Angeli, et al., Detection of the 35delG/GJB2 and del(GJB6-D13S1830) mutations in Venezuelan patients with autosomal recessive nonsyndromic hearing loss, Genet. Test. 11 (4) (2007) 347–352. [18] A.C. Batissoco, R.S. Abreu-Silva, M.C. Braga, K. Lezirovitz, V. Della-Rosa, T. Alfredo Jr., et al., Prevalence of GJB2 (connexin-26) and GJB6 (connexin-30) mutations in a cohort of 300 Brazilian hearing-impaired individuals: implications for diagnosis and genetic counseling, Ear Hear. 30 (1) (2009) 1–7. [19] P. Mendelsberg-Fishbein, C.S. Ma´rquez-A´vila, C. Garcı´a-Delgado, A. Sa´nchezBoiso, B.A. Rodrı´guez-Espino, E.R. Va´zquez-Martı´nez, et al., Importance of the diagnosis of protein connexin 26 mutations in the integral management of nonsyndromic congenital deafness, Bol. Med. Hosp. Infant Mex. 70 (2) (2013) 88–96.
5
[20] M. de la Luz Arenas-Sordo, I. Menendez, E. Herna´ndez-Zamora, A. Sirmaci, D. Gutie´rrez-Tinajero, M. McGetrick, et al., Unique spectrum of GJB2 mutations in Mexico, Int. J. Pediatr. Otorhinolaryngol. 76 (11) (2012) 1678–1680. [21] H. Rangel-Villalobos, J.F. Mun˜oz-Valle, A. Gonza´lez-Martı´n, A. Gorostiza, M.T. Magan˜a, L.A. Pa´ez-Riberos, Genetic admixture, relatedness, and structure patterns among Mexican populations revealed by the Y-chromosome, Am. J. Phys. Anthropol. 135 (4) (2008) 448–461. [22] H.Y. Tang, P. Fang, P.A. Ward, E. Schmitt, S. Darilek, S. Manolidis, et al., DNA sequence analysis of GJB2, encoding connexin 26: observations from a population of hearing impaired cases and variable carrier rates, complex genotypes, and ethnic stratification of alleles among controls, Am. J. Med. Genet. A. 140 (22) (2006) 2401–2415. [23] F.J. del Castillo, M. Rodrı´guez-Ballesteros, A. Alvarez, T. Hutchin, E. Leonardi, C.A. de Oliveira, et al., A novel deletion involving the connexin-30 gene, del(GJB6d13s1854), found in trans with mutations in the GJB2 gene (connexin-26) in subjects with DFNB1 non-syndromic hearing impairment, J. Med. Genet. 42 (7) (2005) 588–594. [24] I. del Castillo, M. Villamar, M.A. Moreno-Pelayo, F.J. del Castillo, A. Alvarez, D. Tellerı´a, I. Mene´ndez, F. Moreno, et al., A deletion involving the connexin 30 gene in nonsyndromic hearing impairment, N. Engl. J. Med. 346 (4) (2002) 243–249. [25] A. Kenneson, K. Van Naarden Braun, C. Boyle, GJB2 (connexin 26) variants and nonsyndromic sensorineural hearing loss: a HuGE review, Genet. Med. 4 (4) (2002) 258–274. [26] I. Silva-Zolezzi, A. Hidalgo-Miranda, J. Estrada-Gil, J.C. Fernandez-Lopez, L. UribeFigueroa, A. Contreras, et al., Analysis of genomic diversity in Mexican Mestizo populations to develop genomic medicine in Mexico, Proc. Natl. Acad. Sci. U S A. 106 (21) (2009) 8611–8616. [27] L.P. Gravina, M.E. Foncuberta, M.E. Prieto, J. Garrido, C. Barreiro, L. Chertkoff, Prevalence of DFNB1 mutations in Argentinean children with non-syndromic deafness. Report of a novel mutation in GJB2, Int. J. Pediatr. Otorhinolaryngol. 74 (3) (2010) 250–254. [28] P.M. Kelley, D.J. Harris, B.C. Comer, J.W. Askew, T. Fowler, S.D. Smith, et al., Novel mutations in the connexin 26 gene (GJB2) that cause autosomal recessive (DFNB1) hearing loss, Am. J. Hum. Genet. 62 (4) (1998) 792–799. [29] Z.A. Xiao, D.H. Xie, GJB2 (Cx26) gene mutations in Chinese patients with congenital sensorineural deafness and a report of one novel mutation, Chinese Med. J 117 (12) (2004) 1797–1801. [30] M. Tekin, X.J. Xia, R. Erdenetungalag, et al., GJB2 mutations in Mongolia: complex alleles, low frequency, and reduced fitness of the deaf, Annals. Hum. Genet. 74 (2) (2010) 155–164. [31] S.A. Zainal, M.K. Md Daud, N. Abd Rahman, Z. Zainuddin, Z. Alwi, Mutation detection in GJB2 gene among Malays with non-syndromic hearing loss, Int. J. Pediatr. Otorhinolaryngol. 76 (8) (2012) 1175–1179. [32] D.K. Chan, I. Schrijver, K.W. Chang, Connexin-26-associated deafness: phenotypic variability and progression of hearing loss, Genet. Med. 12 (3) (2010) 174–181. [33] S.Y. Choi, K.Y. Lee, H.J. Kim, H.K. Kim, Q. Chang, H.J. Park, et al., Functional evaluation of GJB2 variants in nonsyndromic hearing loss, Mol. Med. 17 (6) (2011) 550–556. [34] H.B. Cheng, Z.B. Chen, Q.J. Wei, Y.J. Lu, G.Q. Xing, X. Cao, Single nucleotide polymorphisms and haplotypes analysis of DFNB1 locus in Chinese sporadic hearing impairment population, Chinese Med. J. 122 (13) (2009) 1549–1553. [35] F. Denoyelle, D. Weil, M.A. Maw, S.A. Wilcox, N.J. Lench, D.R. Allen-Powell, et al., Prelingual deafness: high prevalence of a 30delG mutation in the connexin 26 gene, Hum. Mol. Genet. 6 (12) (1997) 2173–2177. [36] L.H. Hoefsloot, A.F. Roux, M. Bitner-Glindzicz, contributors to EMQN DFNB1 best practice meeting, EMQN Best Practice guidelines for diagnostic testing of mutations causing non-syndromic hearing impairment at the DFNB1 locus, Eur. J. Hum. Genet. 21 (11) (2013) 1325–1329. [37] M. Palmada, K. Schmalisch, C. Bo¨hmer, N. Schug, M. Pfister, F. Lang, et al., Loss of function mutations of the GJB2 gene detected in patients with DFNB1-associated hearing impairment, Neurobiol. Dis. 22 (1) (2006) 112–118. [38] Z. Riahi, H. Hammami, H. Ouragini, H. Messai, R. Zainine, Y. Bouyacoub, et al., Update of the spectrum of GJB2 gene mutations in Tunisian families with autosomal recessive nonsyndromic hearing loss, Gene 525 (1) (2013) 1–4. [39] T.D. Matos, H. Simo˜es-Teixeira, H. Caria, A.C. Gonc¸alves, J. Chora, C. Correia Mdo, et al., Spectrum and frequency of GJB2 mutations in a cohort of 264 Portuguese nonsyndromic sensorineural hearing loss patients, Int. J. Audiol. 52 (7) (2013) 466–471. [40] S. Angeli, R. Utrera, S. Dib, E. Chiossone, C. Naranjo, O. Henrı´quez, et al., GJB2- gene mutations in childhood deafness, Acta. Otolaryngol. 120 (2) (2000) 133–136. [41] I. Sansovic, J. Knezevic, V. Musani, P. Seeman, I. Barisic, J. Pavelic, GJB2 mutations in patients with nonsyndromic hearing loss from Croatia, Genet. Test Mol. Biomarkers 13 (5) (2009) 693–699. [42] L.U. Dzhemileva, N.A. Barashkov, O.L. Posukh, R.I. Khusainova, V.L. Akhmetova, I.A. Kutuev, et al., Carrier frequency of GJB2 gene mutations c.35delG, c.235delC and c.167delT among the populations of Eurasia, J. Hum. Genet. 55 (11) (2010) 749–754. [43] S. Prasad, R.A. Cucci, G.E. Green, R.J. Smith, Genetic testing for hereditary hearing loss: connexin 26 (GJB2) allele variants and two novel deafness-causing mutations (R32 C and 645-648delTAGA), Hum. Mut. 16 (6) (2000) 502–508. [44] W.T. McGuirt, S.D. Prasad, R.A. Cucci, G.E. Green, R.J. Smith, Clinical presentation of DFNB1, Adv. Otorhinoalryngol. 61 (2002) 113–119. [45] H. Azaiez, G.P. Chamberlin, S.M. Fischer, C.L. Welp, S.D. Prasad, R.T. Taggart, I. del Castillo, G. Van Camp, R.J. Smith, et al., GJB2: the spectrum of deafness-causing allele variants and their phenotype, Hum. Mut. 24 (4) (2004) 305–311. [46] J.L. Solan, P.D. Lampe, Connexin 43 phosphorylation: structural changes and biological effects, Biochem J. 419 (2) (2009) 261–272.
Please cite this article in press as: A.A. Herna´ndez-Jua´rez, et al., GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico, Int. J. Pediatr. Otorhinolaryngol. (2014), http://dx.doi.org/10.1016/ j.ijporl.2014.09.016
G Model
PEDOT-7290; No. of Pages 6 6
A.A. Herna´ndez-Jua´rez et al. / International Journal of Pediatric Otorhinolaryngology xxx (2014) xxx–xxx
[47] D. Locke, F. Kieken, L. Tao, P.L. Sorgen, A.L. Harris, Mechanism for modulation of gating of connexin26-containing channels by taurine, J. Gen. Physiol. 138 (3) (2011) 321–339. [48] R. Rabionet, L. Zelante, N. Lo´pez-Bigas, L. D‘Agruma, S. Melchionda, G. Restagno, et al., Molecular basis of childhood deafness resulting from mutations in the GJB2 (connexin 26) gene, Hum. Genet. 106 (1) (2000) 40–44. [49] P. D‘Andrea, V. Veronesi, M. Bicego, S. Melchionda, L. Zelante, E. Di Iorio, et al., Hearing loss: frequency and functional studies of the most common connexin26 alleles, Biochem. Biophys. Res. Commun. 296 (3) (2002) 685–691. [50] E.C. Beyer, G.M. Lipkind, J.W. Kyle, V.M. Berthoud, Structural organization of intercellular channels II. Amino terminal domain of the connexins: sequence, functional roles, and structure, Biochim. Biophys. Acta. 1818 (8) (2012) 1823– 1830. [51] A.D. Martinez, R. Acuna, V. Figueroa, J. Maripillan, B. Nicholson, Gap–junction channels dysfunction in deafness and hearing loss, Antioxid. Redox. Signal. 11 (2009) 309–322.
[52] G. Chen, S. Fu, J. Dong, P. Chen, Low frequency of GJB2 mutations in thirty-five students with hearing loss in Chinese consanguineous families, Int. J. Pediatr. Otorhinolaryngol. 75 (12) (2011) 1535–1537. [53] G.W. Brobby, B. Mu¨ller-Myhsok, R.D. Horstmann, Connexin 26 R143 W mutation associated with recessive nonsyndromic sensorineural deafness in Africa, N. Engl. J. Med. 338 (8) (1998) 548–550. [54] C. Hayashi, M. Funayama, Y. Li, K. Kamiya, A. Kawano, M. Suzuki, et al., Prevalence of GJB2 causing recessive profound non-syndromic deafness in Japanese children, Int. J. Pediatr. Otorhinolaryngol. 75 (12) (2011) 211–214. [55] A. Hall, M., Pembrey, M., Lutman, C., Steer, M. Bitner-Glindzicz, Prevalence and audiological features in carriers of GJB2 mutations, c.35delG and c.101T > C (p.M34 T), in a UK population study, BMJ Open 2 (4) (2012) pii: e001238. [56] S. Ennis, M. Rı´os, N. Albert, The Hispanic Population: 2010, Census Bureau, U.S., 2011. [57] L.A. Schimmenti, A. Martinez, M. Telatar, C.H. Lai, N. Shapiro, M. Fox, et al., Infant hearing loss and connexin testing in a diverse population, Genet. Med. 10 (7) (2008) 517–524.
Please cite this article in press as: A.A. Herna´ndez-Jua´rez, et al., GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico, Int. J. Pediatr. Otorhinolaryngol. (2014), http://dx.doi.org/10.1016/ j.ijporl.2014.09.016