- Email: [email protected]
Glioma cell-derived placental growth factor induces regulatory B cells
The International Journal of Biochemistry & Cell Biology 57 (2014) 63–68
Contents lists available at ScienceDirect
The International Journal of Biochemistry & Cell Biology journal homepage: www.elsevier.com/locate/biocel
Glioma cell-derived placental growth factor induces regulatory B cells Song Han a,b , Sizhe Feng b , Mingliang Ren a , Enlong Ma c , Xiaonan Wang c , Lunshan Xu a,∗ , Minhui Xu a,∗ a b c
Department of Neurosurgery, Research Institute of Field Surgery, Daping Hospital, Third Military Medical University, Chongqing 400042, China Department of Neurosurgery, General Hospital of Shenyang Military Area Command of Chinese PLA, Shenyang, Liaoning 110016, China Department of Pharmacology, Shenyang Pharmaceutical University, Shenyang 110016, China
a r t i c l e
i n f o
Article history: Received 8 June 2014 Received in revised form 27 September 2014 Accepted 4 October 2014 Keywords: Glioma Placental growth factor B lymphocyte Immune regulation
a b s t r a c t Tumor specific immune regulatory cells play an important role in the pathogenesis of glioma. The mechanisms have not been fully understood yet. It is suggested that placenta growth factor (PlGF) is involved in the generation of immune regulatory cells. This study aims to investigate the role of glioma cell-derived PlGF in the generation of regulatory B cells (Breg). Glioma cells were isolated from surgically removed glioma tissue. Cytokines were measured by enzyme-linked immunosorbent assay, quantitative real time RT-PCR and Western blotting. Immune suppressor functions of Bregs were assessed by T cell proliferation assay. The results showed that glioma cells expressed PlGF, which was increased after a non-specific activation. Naïve B cells captured the PlGF to differentiate into transforming growth factor- positive Bregs. The Bregs were activated upon exposure to protein extracts of glioma tissue to suppress the CD8+ T cell proliferation and the release of perforin and granzyme B. We conclude that glioma cell-released PlGF can induce Bregs to suppress CD8+ T cell activities. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction The malignant gliomas (glioma, in short) include two subtypes, the anaplastic astrocytoma and the glioblastoma multiforme. The pathogenesis of glioma is to be further understood. It is accepted that glioma is associated with the dysregulation of immune function (Yang et al., 2010). It is unknown how glioma cells escape from the immune surveillance, grow out in a potently immunosuppressive tumor microenvironment, and efficiently evade the host anti-tumor response (Kaur et al., 2010). Published data indicate that the intra-tumor immune regulatory cells are responsible for the deficiency of anti-tumor functions of the host (Humphries et al., 2010). The mechanism of the development of tumor specific immune regulatory cells is incompletely understood yet. Immune regulatory cells mainly include regulatory T cells (Treg) and regulatory B cells (Bregs). Several phenotypes of Bregs have been described including interleukin (IL)-10+ Bregs (Liu et al., 2013a) and transforming growth factor (TGF)-+ Bregs (Liu et al., 2013b). The development of IL-10+ Bregs has been described by a number of investigators (Liu et al., 2013a). The knowledge of the
development of TGF-+ Bregs is still limited. Whether Bregs are associated with the pathogenesis of glioma is unknown. Placenta growth factor (PlGF) is a member of the vascular endothelial growth factor sub-family; it is a key molecule in angiogenesis and vasculogenesis. The placental trophoblast is the main source of PlGF during pregnancy (Ribatti, 2008). Besides its major role in pregnancy, PlGF is also involved in other physiological processes and the pathogenesis of some diseases, such as acting as angiogenic cytokine to control angiogenic functions and recruiting monocyte/macrophage lineage cells in inflammatory sites (Carnevale and Lembo, 2012). Recent reports indicate that PlGF is also involved in the pathogenesis of glioma (Snuderl et al., 2013) and immune regulation (Lin et al., 2007). Thus, we hypothesize that PlGF regulates Bregs in glioma to suppress the anti-tumor immune function. To test the hypothesis, we isolated glioma cells from surgically removed glioma tissue. The glioma cell-released exosomes induced Bregs; the latter efficiently suppressed gliomaspecific CD8+ T cell activities. 2. Materials and methods 2.1. Reagents
∗ Corresponding authors. Tel.: +86 23 68757976; fax: +86 23 68757979. E-mail address: [email protected] (L. Xu). http://dx.doi.org/10.1016/j.biocel.2014.10.005 1357-2725/© 2014 Elsevier Ltd. All rights reserved.
PlGF inhibitor, TB-403 (RO5323441), was purchased from BioInvent International (Lund, Sweden). Antibodies of PlGF, LAMP1
64
S. Han et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 63–68
and TGF- were purchased from Santa Cruz Biotech (Shanghai, China). The immune cell isolation kits were purchased from Miltenyi Biotech (Shanghai, China). The reagents of real time RT-PCR were purchased from Invitrogen (Shanghai, China). The ELISA kits of perforin and granzyme B were purchased from R&D Systems (Shanghai, China). The collagenase IV and PMA was purchased from Sigma–Aldrich (Shanghai, China). 2.2. Collection of human glioma tissue Surgically removed glioma tissue was collected from 30 patients (18 males, 12 females). The glioma tissue was proved by a pathologist. The use of human tissue in the present study was approved by the Human Research Ethic Committee at the Third Military Medical University. An informed, written consent was obtained from each patient. 2.3. Preparation of glioma cells The glioma tissue was cut into small pieces (2 mm × 2 mm × 2 mm) and incubated in RPMI1640 medium containing collagenase IV (0.5 g/ml) for 1 h at 37 ◦ C with mild stirring. The cells were filtered through cell strainer-1 (100 m) and followed by cell strainer-2 (40 m). The immune cells, including CD11c+ DCs, CD3+ T cells and CD19+ B cells, were isolated out by magnetic cell sorting with commercial reagent kits following the manufacturer’s instructions. The negatively selected glioma cells contained less than 1% immune cells as checked by flow cytometry.
density of immune blots was analyzed with PhotoShop software (version CS5). 2.7. Cell culture The cells were cultured in Dulbecco’s modified eagle medium complemented with 10% fetal calf serum, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 2 mM l-glutamin. The cell viability was assessed by Trypan blue exclusion assay. 2.8. Purification of exosomes After confluence, the glioma cells were cultured in the no-serum medium overnight. The supernatant was collected and centrifuged at 1000 × g, 8000 × g, 60,000 × g and 100,000 × g respectively. The isolated exosomes were resuspended in PBS and filtered twice through 0.22-m filters. Sample exosomes were processed for electron microscopy following published procedues (Chen et al., 2011). 2.9. Induction of TGF-ˇ expressing Bregs CD19+ IL-7R+ CD45+ naïve B cells were isolated from PBMC by MACS. The cells were cultured in RPMI1640 medium complemented with 10% fetal calf serum, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 2 mM l-glutamin in the presence of the gliomaderived exosomes (10 g/ml), anti-CD40 (20 ng/ml) and anti-IgM (20 ng/ml). The medium with the reagents was changed on day 3. The cells were used in further experiments after day 6. The cell viability was assessed by Trypan blue exclusion assay.
2.4. Immune cell isolation 2.10. Assessment of exosome capture by Bregs The peripheral blood was collected from glioma patients as well as healthy subjects (20 ml/person). The peripheral blood mononuclear cells (PBMC) were isolated by gradient density centrifugation. The immune cells, including DCs, CD19+ B cells and CD8+ CD25− T cells, were isolated by magnetic cell sorting with commercial reagent kits following the manufacturer’s instructions. As checked by flow cytometry, the purity of the isolated immune cells was greater than 98%. 2.5. Quantitative real time RT-PCR (qRT-PCR) The total RNA was extracted from cells with the TRIzol reagents. The cDNA was synthesized with a reverse transcription kit. Realtime RT-PCR was performed with the SYBR Green Master Mix and gene-specific primers (see below) on an EcoTM Real-Time PCR System (Shanghai, China). The primers using in the present study include: PlGF, forward, CAGTGCCTTCAACAACGTGA; reverse, TGAGGCCCAAGAACAGGTAG. TGF-, forward, GCAGCTGTCCAACATGATCG; reverse, GAGATCCGCAGTCCTCTCTC. -actin, forward, CGCAAAGACCTGTATGCCAA; reverse, CACACAGAGTACTTGCGCTC. The results were calculated with the 2−Ct method, and expressed as the percentage of the internal control -actin.
The exosomes were labeled with CFSE. Bregs were cultured in the presence of CFSE-labeled exosomes (10 g/ml). The cells were collected 6 h later and analyzed by flow cytometry and confocal microscopy. 2.11. Assessment of suppressor function of Bregs Bregs, DCs, CD8+ CD25− T cells (labeled with CFSE) and gliomaextracts were obtained from the same patients with glioma. The cells were cultured at a ratio of 1:1 (Breg:T cell) in the presence of DC (1:10; DC:T cell) and glioma extracts (10 g/ml) for 3 days. The cells were analyzed by the CFSE-dilution assay. 2.12. Statistical analysis A Student’s t test was performed to compare means between two groups, an ANOVA analysis with a Tukey–Kramer post hoc test was used to compare means between more than two groups; a p < 0.05 was considered significant. 3. Results
2.6. Western blotting 3.1. Assessment of expression of PlGF in glioma cells The total proteins were extracted from the cells, fractioned by SDS-PAGE and transferred onto a PVDF membrane. After blocking with 5% skim milk for 30 min, the membranes were incubated with the primary antibodies (0.1–0.5 g/ml) overnight at 4 ◦ C, and followed by incubation with the second antibodies (labeled with horseradish peroxidase) for 1 h. Washing with TBST was performed after each incubation. The membranes were blotted with the ECL system. The results were recorded with X-ray films. The integrated
It is reported that glioma cells express PlGF (Kerber et al., 2008). In this study, we firstly assessed the expression of PlGF in glioma cells from surgically removed glioma tissue. As shown by qRT-PCR and Western blotting, PlGF was detected in the cellular extracts of glioma cells at both mRNA levels (Fig. 1A) and protein levels (Fig. 1B and C), which were increased after activation by PMA. The results indicate that glioma cells produce PlGF upon activation.
S. Han et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 63–68
65
Fig. 1. Glioma cells express PlGF. Glioma cells were isolated from surgically removed glioma tissue of 10 patients. The glioma cells were stimulated by PMA in the culture for 48 h; the cell extracts were analyzed by qRT-PCR and Western blotting. (A) The bars indicate the levels of PlGF mRNA. (B) The immune blots indicate the proteins of PlGF. (C) The bars indicate the integrated density of the immune blots of B. The data of bars are presented as mean ± SD. *p < 0.01, compared with the dose “0”. The data are representatives of 10 independent experiments.
Fig. 2. Glioma cell-derived exosomes carry PlGF. The glioma cells were cultured in no serum medium overnight. The exosomes were purified and analyzed by electron microscopy and Western blotting. (A) A representative electron photomicrograph of exosomes (×300,000). (B) The immune blots indicate the LAMP1 proteins in the exosomes lysates. (C) The immune blots indicate the PlGF protein levels in the lysates of exosomes. The data are a representative of three independent experiments.
3.2. Glioma cell-derived exosomes carry PlGF Published data indicate that glioma-derived exosomes carry immune regulatory information (Garnier et al., 2013). We next purified exosomes from the culture supernatant of glioma cells (Fig. 2A). The lysates of the exosomes were analyzed by Western blotting. The lysates were LAMP1 positive (Fig. 2B), indicating that the purified products were exosomes. PlGF was also detected in the lysates, which was markedly increased in the samples collected from the culture of glioma cells exposed to PMA (Fig. 2C). The results indicate that the glioma-derived exosomes carry PlGF that can be up regulated after the glioma cell activation. 3.3. PlGF-carrying exosomes induce TGF-ˇ expression in B cells B cells are one of the antigen presenting cells as well as effector immune cells. Since glioma cells release PlGF-carrying exosomes, it is possible that the interactions between B cells and the exosomes alter the properties of the B cells. To test the hypothesis, we purified exosomes from the primary glioma cell culture supernatant; the exosomes were added to the naïve B cell culture for 6 h or 6 days. The B cells were collected and analyzed. The data of flow cytometry (Fig. 3A–E) showed that naïve B cells captured the exosomes in the culture, which was confirmed by confocal microscopy data (Fig. 3F and G). The results of qRT-PCR (Fig. 3H) and Western blotting (Fig. 3I and J) showed that the exposure to the exosomes induced the expression of TGF- in the B cells. Since TGF-+ B cells have immune regulatory functions (Liu et al., 2013b), the results indicate that exposure to glioma-derived exosomes can induce Bregs. We next took a further insight into the mechanism by which the glioma-derived exosomes induce Bregs. It is reported that PlGF has immune suppressor functions (Lin et al., 2007); we inferred that PlGF was responsible for the increases in TGF- expression in B cells. To test the hypothesis, in the same experimental procedures above, a PlGF inhibitor was added to the culture. Indeed, the expression of TGF- was abolished (Fig. 3H–J). The results indicate that PlGF does increase the expression of TGF- in B cells. To confirm the results, we exposed naïve B cells to recombinant PlGF in the culture for 6 days, the expression of TGF- was up regulated (Fig. 3H–J); the control protein (BSA) did not induce appreciable
expression of TGF- in the B cells (Fig. 3H–J). The results indicate that PlGF induces TGF- expression in B cells. 3.4. Glioma-derived exosomes induced Bregs are glioma-specific As being components of glioma, the glioma-derived exosomes may carry the antigenic information of glioma. Therefore, the induced Bregs may be glioma specific. To test the inference, we generated Bregs as described in Fig. 3. The Bregs were re-exposed to the glioma-tissue extracts and analyzed by flow cytometry. About 60.8% Bregs proliferated (Fig. 4A–C). The results indicate that a portion of the B cells were glioma specific Bregs. The results also implicate that the glioma specific Bregs may exist in glioma tissue as well as in the peripheral system of patients with glioma. To test the inference, we isolated CD19+ B cells from glioma tissue; the B cells were cultured in the presence of the glioma-derived exosomes for 3 days. As shown by flow cytometry data, 91.2% intra-tumor B cells and 8.41% peripheral B cells proliferated. 3.5. Glioma-specific Bregs suppress glioma-specific CD8+ T cell activities The results of Figs. 3 and 4 implicate that the induced Bregs have the potential to suppress the glioma specific effector T cells. To test the hypothesis, we isolated CD8+ CD25− T cells and DC from PBMC, extracted proteins from the glioma tissue, purified exosomes from the culture supernatant of glioma cells and generated glioma specific Bregs. The CD8+ T cells were cultured with DC in the presence of glioma tissue extracts for 3 days. The results showed that in the gated CFSE-labeled cells (Fig. 5A and G), about 2.1% CD8+ T cells proliferated when cultured in medium (containing BSA) (Fig. 5B and G), a fraction (23.1%) of CD8+ T cells proliferated markedly (Fig. 5C and G), indicating a portion of the CD8+ T cells is glioma specific, which was suppressed by the presence of glioma specific iBregs (Fig. 5D and G), but not by naïve B cells (Fig. 5E and G). To clarify if the cell–cell contact is necessary for iBregs to suppress CD8+ T cells, in separate experiments, the iBregs and CD8+ T cells/DC were separately cultured in the same Transwells, which did not alter the suppressor function of iBregs (Fig. 5F and G). After exposure to glioma extracts, CD8+ T cells from glioma patients released granzyme B and perforin into the culture, which was suppressed
66
S. Han et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 63–68
Fig. 3. Glioma-derived exosomes induce Bregs. CD19+ IL-7R+ CD45+ naïve B cells were prepared. (A–E) naïve B cells were cultured with CFSE-labeled exosomes for 6 h and analyzed by flow cytometry. The histograms indicate the frequency of exosome-carrying B cells (A–D). (E) The bars indicate the summarized data of A–D. (F and G) Representative confocal images indicate the CFSE-labeled exosomes are inside of B cells (F). Panel G is a negative control image. (H–J) Naïve B cells were cultured in the presence of exosomes (as denoted above each histogram of A–D) and anti-CD40 (20 ng/ml) for 6 days. The cells were collected at the end of culture and analyzed. (H) The bars indicate the mRNA levels of TGF- in the B cell extracts. (I) The immune blots indicate the protein levels of TGF- in the B cell extracts. (J) The bars indicate the integrated density of the immune blots of G. aPlGF: PlGF inhibitor, TB-403 (RO5323441) (1 g/ml). rPlGF: recombinant PlGF (1 g/ml), BSA (1 g/ml). The data of bars are presented as mean ± SD. *p < 0.01, compared with group A. The data are a representative of three independent experiments.
Fig. 4. Assessment of glioma-specific Bregs. Induced Bregs (A and B), intro-glioma CD19+ B cells (D and E) and peripheral CD19+ B cells (G and H) were labeled with CFSE, cultured in the presence of glioma extracts (10 g/ml) (A, D, G), or BSA (B, E, H; 10 g/ml), for 3 days. The cells were analyzed by flow cytometry. The histograms indicate the frequency of proliferated cells. The bars indicate the summarized data of the histograms of groups as denoted on the X-axes. The data of bars are presented as mean ± SD. *p < 0.01, compared with group A (C), or group D (F), or group G (I). The specimens were collected from 10 patients with glioma and processed separately. The data are a representative of 10 independent experiments.
S. Han et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 63–68
67
Fig. 5. Bregs suppress glioma specific CD8+ T cell activities. The inducible Bregs (iBreg), CD8+ CD25− T cells, DCs and glioma extracts were prepared from the same patients (10 patients in total). The experimental design is denoted in the table. The CD8+ T cells were labeled with CFSE; the cells were collected at the end of the experiments and analyzed by flow cytometry. (A) The CFSE-labeled CD8+ T cells were gated. (B–F) The histograms indicate the frequency of proliferated CD8+ T cells (by CFSE dilution assay) in the gated cells of A. (G–I) The bars indicate the summarized data of proliferated cells of B–F (G), the levels of perforin (H) and granzyme B (I) in the culture supernatant. The data are a representative of 10 independent experiments.
by the presence of Bregs (Fig. 5H and I). The results indicate that there is a portion of glioma specific CD8+ T cells in the peripheral blood stream, which can be suppressed by glioma specific Bregs. 4. Discussion The present data indicate that glioma-derived exosomes contain PlGF. B cells capture the PlGF-carrying exosomes to differentiate into glioma-specific Bregs; the latter suppresses the glioma-specific CD8+ T cell activities. The intratumor immune cells play important roles in the pathogenesis of malignant tumors. Tumor-associated macrophages correlate with vascular space invasion and myometrial invasion in endometrial carcinoma (Soeda et al., 2008). The intratumor Tregs facilitate tumor cells to evade the anti-tumor T-cell immunity in the cancer microenvironment; such as to suppress cytotoxic CD8+ T cells (Wang et al., 2011). The inhibition of Tregs can improve the suppressor effect on the anti-tumor immunity (Schaer et al., 2013). The present data add novel information that the glioma-associating Bregs are also involved in the suppression of the anti-tumor immunity. PlGF belongs the growth factor family. Published data indicate a number of growth factors can induce immune regulatory cells. In the early 2000s, Zheng et al. (2002) and Chen et al. (2003) indicate that TGF- can induce Tregs. Other growth factors are also involved in the generation of immune regulatory cells; such as Yang et al. indicate that insulin-like growth factor is associated with the generation of Tregs (Yang et al., 2014); Geng et al. (2014) indicate that insulin-like growth factor is also related to the generation of antigen specific Bregs. Our data indicate that PlGF can generate immune regulatory cells. The glioma protein extracts were used as a specific antigen to activate the glioma specific CD8+ T cells and Bregs. The proliferation of CD8+ T cells and Bregs in response to the exposure to the glioma extracts demonstrates that the protein extracts contain
the specific antigens of glioma. This is in line with some other antigen preparations using in the clinic and laboratory studies; such as the raw extracts of mite, which contain a large number of variable molecules, are used in the diagnosis (Jeong et al., 2014), immunotherapy (Calderon et al., 2013) and induction of mite allergy animal models (Allen, 2013). Cytotoxic CD8+ T cells are one of the major anti-tumor immune cells to fulfill the immune surveillance in the body. The present data show that there is a fraction of glioma-specific CD8+ T cells in the peripheral system, implicating the anti-tumor immunity is still active in the body, but dysfunction because the glioma grow out. Further evidence indicates that the glioma-specific Bregs can suppress the glioma-specific CD8+ T cell activities. The data indicate that the specific Bregs may be a new target in anti-tumor immunity. Acknowledgement The study was suported by the National Natural Science Foundation of China (No. 81172413). References Allen IC. Induction of allergic airway disease using house dust mite allergen. Methods Mol Biol 2013;1032:159–72. Calderon MA, Casale TB, Nelson HS, Demoly P. An evidence-based analysis of house dust mite allergen immunotherapy: a call for more rigorous clinical studies. J Allergy Clin Immunol 2013;132:1322–36. Carnevale D, Lembo G. Placental growth factor and cardiac inflammation. Trends Cardiovasc Med 2012;22:209–12. Chen W, Jin W, Hardegen N, Lei KJ, Li L, Marinos N, McGrady G, Wahl SM. Conversion of peripheral CD4+CD25− naive T cells to CD4+CD25+ regulatory T cells by TGFbeta induction of transcription factor Foxp3. J Exp Med 2003;198:1875–86. Chen X, Song CH, Feng BS, Li TL, Li P, Zheng PY, Chen XM, Xing Z, Yang PC. Intestinal epithelial cell-derived integrin alphavbeta6 plays an important role in the induction of regulatory T cells and inhibits an antigen-specific Th2 response. J Leukoc Biol 2011;90:751–9. Garnier D, Jabado N, Rak J. Extracellular vesicles as prospective carriers of oncogenic protein signatures in adult and paediatric brain tumours. Proteomics 2013;13:1595–607.
68
S. Han et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 63–68
Geng XR, Yang G, Li M, Song JP, Liu ZQ, Qiu S, Liu Z, Yang PC. Insulin-like growth factor-2 enhances functions of Ag specific regulatory B cells. J Biol Chem 2014. Humphries W, Wei J, Sampson JH, Heimberger AB. The role of Tregs in gliomamediated immunosuppression: potential target for intervention. Neurosurg Clin N Am 2010;21:125–37. Jeong KY, Lee JH, Kim EJ, Lee JS, Cho SH, Hong SJ, Park JW. Current status of standardization of inhalant allergen extracts in Korea. Allergy Asthma Immunol Res 2014;6:196–200. Kaur G, Han SJ, Yang I, Crane C. Microglia and central nervous system immunity. Neurosurg Clin N Am 2010;21:43–51. Kerber M, Reiss Y, Wickersheim A, Jugold M, Kiessling F, Heil M, Tchaikovski V, Waltenberger J, Shibuya M, Plate KH, Machein MR. Flt-1 signaling in macrophages promotes glioma growth in vivo. Cancer Res 2008;68:7342– 51. Lin YL, Liang YC, Chiang BL. Placental growth factor down-regulates type 1 T helper immune response by modulating the function of dendritic cells. J Leukoc Biol 2007;82:1473–80. Liu Y, Chen Y, Li Z, Han Y, Sun Y, Wang Q, Liu B, Su Z. Role of IL-10-producing regulatory B cells in control of cerebral malaria in Plasmodium berghei infected mice. Eur J Immunol 2013a;43:2907–18. Liu ZQ, Wu Y, Song JP, Liu X, Liu Z, Zheng PY, Yang PC. Tolerogenic CX3CR1+ B cells suppress food allergy-induced intestinal inflammation in mice. Allergy 2013b;68:1241–8. Ribatti D. The discovery of the placental growth factor and its role in angiogenesis: a historical review. Angiogenesis 2008;11:215–21.
Schaer DA, Budhu S, Liu C, Bryson C, Malandro N, Cohen A, Zhong H, Yang X, Houghton AN, Merghoub T, Wolchok JD. GITR pathway activation abrogates tumor immune suppression through loss of regulatory T-cell lineage stability. Cancer Immunol Res 2013;1:320–31. Snuderl M, Batista A, Kirkpatrick ND, Ruiz de Almodovar C, Riedemann L, Walsh EC, Anolik R, Huang Y, Martin JD, Kamoun W, et al. Targeting placental growth factor/neuropilin 1 pathway inhibits growth and spread of medulloblastoma. Cell 2013;152:1065–76. Soeda S, Nakamura N, Ozeki T, Nishiyama H, Hojo H, Yamada H, Abe M, Sato A. Tumor-associated macrophages correlate with vascular space invasion and myometrial invasion in endometrial carcinoma. Gynecol Oncol 2008;109:122–8. Wang BQ, Zhang CM, Gao W, Wang XF, Zhang HL, Yang PC. Cancer-derived matrix metalloproteinase-9 contributes to tumor tolerance. J Cancer Res Clin Oncol 2011;137:1525–33. Yang G, Geng XR, Song JP, Wu Y, Yan H, Zhan Z, Yang L, He W, Liu ZQ, Qiu S, Liu Z, Yang PC. Insulin-like growth factor 2 enhances regulatory T-cell functions and suppresses food allergy in an experimental model. J Allergy Clin Immunol 2014;133:1702–8. Yang I, Han SJ, Kaur G, Crane C, Parsa AT. The role of microglia in central nervous system immunity and glioma immunology. J Clin Neurosci 2010;17:6–10. Zheng SG, Gray JD, Ohtsuka K, Yamagiwa S, Horwitz DA. Generation ex vivo of TGF-beta-producing regulatory T cells from CD4+CD25− precursors. J Immunol 2002;169:4183–9.
Contents lists available at ScienceDirect
The International Journal of Biochemistry & Cell Biology journal homepage: www.elsevier.com/locate/biocel
Glioma cell-derived placental growth factor induces regulatory B cells Song Han a,b , Sizhe Feng b , Mingliang Ren a , Enlong Ma c , Xiaonan Wang c , Lunshan Xu a,∗ , Minhui Xu a,∗ a b c
Department of Neurosurgery, Research Institute of Field Surgery, Daping Hospital, Third Military Medical University, Chongqing 400042, China Department of Neurosurgery, General Hospital of Shenyang Military Area Command of Chinese PLA, Shenyang, Liaoning 110016, China Department of Pharmacology, Shenyang Pharmaceutical University, Shenyang 110016, China
a r t i c l e
i n f o
Article history: Received 8 June 2014 Received in revised form 27 September 2014 Accepted 4 October 2014 Keywords: Glioma Placental growth factor B lymphocyte Immune regulation
a b s t r a c t Tumor specific immune regulatory cells play an important role in the pathogenesis of glioma. The mechanisms have not been fully understood yet. It is suggested that placenta growth factor (PlGF) is involved in the generation of immune regulatory cells. This study aims to investigate the role of glioma cell-derived PlGF in the generation of regulatory B cells (Breg). Glioma cells were isolated from surgically removed glioma tissue. Cytokines were measured by enzyme-linked immunosorbent assay, quantitative real time RT-PCR and Western blotting. Immune suppressor functions of Bregs were assessed by T cell proliferation assay. The results showed that glioma cells expressed PlGF, which was increased after a non-specific activation. Naïve B cells captured the PlGF to differentiate into transforming growth factor- positive Bregs. The Bregs were activated upon exposure to protein extracts of glioma tissue to suppress the CD8+ T cell proliferation and the release of perforin and granzyme B. We conclude that glioma cell-released PlGF can induce Bregs to suppress CD8+ T cell activities. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction The malignant gliomas (glioma, in short) include two subtypes, the anaplastic astrocytoma and the glioblastoma multiforme. The pathogenesis of glioma is to be further understood. It is accepted that glioma is associated with the dysregulation of immune function (Yang et al., 2010). It is unknown how glioma cells escape from the immune surveillance, grow out in a potently immunosuppressive tumor microenvironment, and efficiently evade the host anti-tumor response (Kaur et al., 2010). Published data indicate that the intra-tumor immune regulatory cells are responsible for the deficiency of anti-tumor functions of the host (Humphries et al., 2010). The mechanism of the development of tumor specific immune regulatory cells is incompletely understood yet. Immune regulatory cells mainly include regulatory T cells (Treg) and regulatory B cells (Bregs). Several phenotypes of Bregs have been described including interleukin (IL)-10+ Bregs (Liu et al., 2013a) and transforming growth factor (TGF)-+ Bregs (Liu et al., 2013b). The development of IL-10+ Bregs has been described by a number of investigators (Liu et al., 2013a). The knowledge of the
development of TGF-+ Bregs is still limited. Whether Bregs are associated with the pathogenesis of glioma is unknown. Placenta growth factor (PlGF) is a member of the vascular endothelial growth factor sub-family; it is a key molecule in angiogenesis and vasculogenesis. The placental trophoblast is the main source of PlGF during pregnancy (Ribatti, 2008). Besides its major role in pregnancy, PlGF is also involved in other physiological processes and the pathogenesis of some diseases, such as acting as angiogenic cytokine to control angiogenic functions and recruiting monocyte/macrophage lineage cells in inflammatory sites (Carnevale and Lembo, 2012). Recent reports indicate that PlGF is also involved in the pathogenesis of glioma (Snuderl et al., 2013) and immune regulation (Lin et al., 2007). Thus, we hypothesize that PlGF regulates Bregs in glioma to suppress the anti-tumor immune function. To test the hypothesis, we isolated glioma cells from surgically removed glioma tissue. The glioma cell-released exosomes induced Bregs; the latter efficiently suppressed gliomaspecific CD8+ T cell activities. 2. Materials and methods 2.1. Reagents
∗ Corresponding authors. Tel.: +86 23 68757976; fax: +86 23 68757979. E-mail address: [email protected] (L. Xu). http://dx.doi.org/10.1016/j.biocel.2014.10.005 1357-2725/© 2014 Elsevier Ltd. All rights reserved.
PlGF inhibitor, TB-403 (RO5323441), was purchased from BioInvent International (Lund, Sweden). Antibodies of PlGF, LAMP1
64
S. Han et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 63–68
and TGF- were purchased from Santa Cruz Biotech (Shanghai, China). The immune cell isolation kits were purchased from Miltenyi Biotech (Shanghai, China). The reagents of real time RT-PCR were purchased from Invitrogen (Shanghai, China). The ELISA kits of perforin and granzyme B were purchased from R&D Systems (Shanghai, China). The collagenase IV and PMA was purchased from Sigma–Aldrich (Shanghai, China). 2.2. Collection of human glioma tissue Surgically removed glioma tissue was collected from 30 patients (18 males, 12 females). The glioma tissue was proved by a pathologist. The use of human tissue in the present study was approved by the Human Research Ethic Committee at the Third Military Medical University. An informed, written consent was obtained from each patient. 2.3. Preparation of glioma cells The glioma tissue was cut into small pieces (2 mm × 2 mm × 2 mm) and incubated in RPMI1640 medium containing collagenase IV (0.5 g/ml) for 1 h at 37 ◦ C with mild stirring. The cells were filtered through cell strainer-1 (100 m) and followed by cell strainer-2 (40 m). The immune cells, including CD11c+ DCs, CD3+ T cells and CD19+ B cells, were isolated out by magnetic cell sorting with commercial reagent kits following the manufacturer’s instructions. The negatively selected glioma cells contained less than 1% immune cells as checked by flow cytometry.
density of immune blots was analyzed with PhotoShop software (version CS5). 2.7. Cell culture The cells were cultured in Dulbecco’s modified eagle medium complemented with 10% fetal calf serum, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 2 mM l-glutamin. The cell viability was assessed by Trypan blue exclusion assay. 2.8. Purification of exosomes After confluence, the glioma cells were cultured in the no-serum medium overnight. The supernatant was collected and centrifuged at 1000 × g, 8000 × g, 60,000 × g and 100,000 × g respectively. The isolated exosomes were resuspended in PBS and filtered twice through 0.22-m filters. Sample exosomes were processed for electron microscopy following published procedues (Chen et al., 2011). 2.9. Induction of TGF-ˇ expressing Bregs CD19+ IL-7R+ CD45+ naïve B cells were isolated from PBMC by MACS. The cells were cultured in RPMI1640 medium complemented with 10% fetal calf serum, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 2 mM l-glutamin in the presence of the gliomaderived exosomes (10 g/ml), anti-CD40 (20 ng/ml) and anti-IgM (20 ng/ml). The medium with the reagents was changed on day 3. The cells were used in further experiments after day 6. The cell viability was assessed by Trypan blue exclusion assay.
2.4. Immune cell isolation 2.10. Assessment of exosome capture by Bregs The peripheral blood was collected from glioma patients as well as healthy subjects (20 ml/person). The peripheral blood mononuclear cells (PBMC) were isolated by gradient density centrifugation. The immune cells, including DCs, CD19+ B cells and CD8+ CD25− T cells, were isolated by magnetic cell sorting with commercial reagent kits following the manufacturer’s instructions. As checked by flow cytometry, the purity of the isolated immune cells was greater than 98%. 2.5. Quantitative real time RT-PCR (qRT-PCR) The total RNA was extracted from cells with the TRIzol reagents. The cDNA was synthesized with a reverse transcription kit. Realtime RT-PCR was performed with the SYBR Green Master Mix and gene-specific primers (see below) on an EcoTM Real-Time PCR System (Shanghai, China). The primers using in the present study include: PlGF, forward, CAGTGCCTTCAACAACGTGA; reverse, TGAGGCCCAAGAACAGGTAG. TGF-, forward, GCAGCTGTCCAACATGATCG; reverse, GAGATCCGCAGTCCTCTCTC. -actin, forward, CGCAAAGACCTGTATGCCAA; reverse, CACACAGAGTACTTGCGCTC. The results were calculated with the 2−Ct method, and expressed as the percentage of the internal control -actin.
The exosomes were labeled with CFSE. Bregs were cultured in the presence of CFSE-labeled exosomes (10 g/ml). The cells were collected 6 h later and analyzed by flow cytometry and confocal microscopy. 2.11. Assessment of suppressor function of Bregs Bregs, DCs, CD8+ CD25− T cells (labeled with CFSE) and gliomaextracts were obtained from the same patients with glioma. The cells were cultured at a ratio of 1:1 (Breg:T cell) in the presence of DC (1:10; DC:T cell) and glioma extracts (10 g/ml) for 3 days. The cells were analyzed by the CFSE-dilution assay. 2.12. Statistical analysis A Student’s t test was performed to compare means between two groups, an ANOVA analysis with a Tukey–Kramer post hoc test was used to compare means between more than two groups; a p < 0.05 was considered significant. 3. Results
2.6. Western blotting 3.1. Assessment of expression of PlGF in glioma cells The total proteins were extracted from the cells, fractioned by SDS-PAGE and transferred onto a PVDF membrane. After blocking with 5% skim milk for 30 min, the membranes were incubated with the primary antibodies (0.1–0.5 g/ml) overnight at 4 ◦ C, and followed by incubation with the second antibodies (labeled with horseradish peroxidase) for 1 h. Washing with TBST was performed after each incubation. The membranes were blotted with the ECL system. The results were recorded with X-ray films. The integrated
It is reported that glioma cells express PlGF (Kerber et al., 2008). In this study, we firstly assessed the expression of PlGF in glioma cells from surgically removed glioma tissue. As shown by qRT-PCR and Western blotting, PlGF was detected in the cellular extracts of glioma cells at both mRNA levels (Fig. 1A) and protein levels (Fig. 1B and C), which were increased after activation by PMA. The results indicate that glioma cells produce PlGF upon activation.
S. Han et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 63–68
65
Fig. 1. Glioma cells express PlGF. Glioma cells were isolated from surgically removed glioma tissue of 10 patients. The glioma cells were stimulated by PMA in the culture for 48 h; the cell extracts were analyzed by qRT-PCR and Western blotting. (A) The bars indicate the levels of PlGF mRNA. (B) The immune blots indicate the proteins of PlGF. (C) The bars indicate the integrated density of the immune blots of B. The data of bars are presented as mean ± SD. *p < 0.01, compared with the dose “0”. The data are representatives of 10 independent experiments.
Fig. 2. Glioma cell-derived exosomes carry PlGF. The glioma cells were cultured in no serum medium overnight. The exosomes were purified and analyzed by electron microscopy and Western blotting. (A) A representative electron photomicrograph of exosomes (×300,000). (B) The immune blots indicate the LAMP1 proteins in the exosomes lysates. (C) The immune blots indicate the PlGF protein levels in the lysates of exosomes. The data are a representative of three independent experiments.
3.2. Glioma cell-derived exosomes carry PlGF Published data indicate that glioma-derived exosomes carry immune regulatory information (Garnier et al., 2013). We next purified exosomes from the culture supernatant of glioma cells (Fig. 2A). The lysates of the exosomes were analyzed by Western blotting. The lysates were LAMP1 positive (Fig. 2B), indicating that the purified products were exosomes. PlGF was also detected in the lysates, which was markedly increased in the samples collected from the culture of glioma cells exposed to PMA (Fig. 2C). The results indicate that the glioma-derived exosomes carry PlGF that can be up regulated after the glioma cell activation. 3.3. PlGF-carrying exosomes induce TGF-ˇ expression in B cells B cells are one of the antigen presenting cells as well as effector immune cells. Since glioma cells release PlGF-carrying exosomes, it is possible that the interactions between B cells and the exosomes alter the properties of the B cells. To test the hypothesis, we purified exosomes from the primary glioma cell culture supernatant; the exosomes were added to the naïve B cell culture for 6 h or 6 days. The B cells were collected and analyzed. The data of flow cytometry (Fig. 3A–E) showed that naïve B cells captured the exosomes in the culture, which was confirmed by confocal microscopy data (Fig. 3F and G). The results of qRT-PCR (Fig. 3H) and Western blotting (Fig. 3I and J) showed that the exposure to the exosomes induced the expression of TGF- in the B cells. Since TGF-+ B cells have immune regulatory functions (Liu et al., 2013b), the results indicate that exposure to glioma-derived exosomes can induce Bregs. We next took a further insight into the mechanism by which the glioma-derived exosomes induce Bregs. It is reported that PlGF has immune suppressor functions (Lin et al., 2007); we inferred that PlGF was responsible for the increases in TGF- expression in B cells. To test the hypothesis, in the same experimental procedures above, a PlGF inhibitor was added to the culture. Indeed, the expression of TGF- was abolished (Fig. 3H–J). The results indicate that PlGF does increase the expression of TGF- in B cells. To confirm the results, we exposed naïve B cells to recombinant PlGF in the culture for 6 days, the expression of TGF- was up regulated (Fig. 3H–J); the control protein (BSA) did not induce appreciable
expression of TGF- in the B cells (Fig. 3H–J). The results indicate that PlGF induces TGF- expression in B cells. 3.4. Glioma-derived exosomes induced Bregs are glioma-specific As being components of glioma, the glioma-derived exosomes may carry the antigenic information of glioma. Therefore, the induced Bregs may be glioma specific. To test the inference, we generated Bregs as described in Fig. 3. The Bregs were re-exposed to the glioma-tissue extracts and analyzed by flow cytometry. About 60.8% Bregs proliferated (Fig. 4A–C). The results indicate that a portion of the B cells were glioma specific Bregs. The results also implicate that the glioma specific Bregs may exist in glioma tissue as well as in the peripheral system of patients with glioma. To test the inference, we isolated CD19+ B cells from glioma tissue; the B cells were cultured in the presence of the glioma-derived exosomes for 3 days. As shown by flow cytometry data, 91.2% intra-tumor B cells and 8.41% peripheral B cells proliferated. 3.5. Glioma-specific Bregs suppress glioma-specific CD8+ T cell activities The results of Figs. 3 and 4 implicate that the induced Bregs have the potential to suppress the glioma specific effector T cells. To test the hypothesis, we isolated CD8+ CD25− T cells and DC from PBMC, extracted proteins from the glioma tissue, purified exosomes from the culture supernatant of glioma cells and generated glioma specific Bregs. The CD8+ T cells were cultured with DC in the presence of glioma tissue extracts for 3 days. The results showed that in the gated CFSE-labeled cells (Fig. 5A and G), about 2.1% CD8+ T cells proliferated when cultured in medium (containing BSA) (Fig. 5B and G), a fraction (23.1%) of CD8+ T cells proliferated markedly (Fig. 5C and G), indicating a portion of the CD8+ T cells is glioma specific, which was suppressed by the presence of glioma specific iBregs (Fig. 5D and G), but not by naïve B cells (Fig. 5E and G). To clarify if the cell–cell contact is necessary for iBregs to suppress CD8+ T cells, in separate experiments, the iBregs and CD8+ T cells/DC were separately cultured in the same Transwells, which did not alter the suppressor function of iBregs (Fig. 5F and G). After exposure to glioma extracts, CD8+ T cells from glioma patients released granzyme B and perforin into the culture, which was suppressed
66
S. Han et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 63–68
Fig. 3. Glioma-derived exosomes induce Bregs. CD19+ IL-7R+ CD45+ naïve B cells were prepared. (A–E) naïve B cells were cultured with CFSE-labeled exosomes for 6 h and analyzed by flow cytometry. The histograms indicate the frequency of exosome-carrying B cells (A–D). (E) The bars indicate the summarized data of A–D. (F and G) Representative confocal images indicate the CFSE-labeled exosomes are inside of B cells (F). Panel G is a negative control image. (H–J) Naïve B cells were cultured in the presence of exosomes (as denoted above each histogram of A–D) and anti-CD40 (20 ng/ml) for 6 days. The cells were collected at the end of culture and analyzed. (H) The bars indicate the mRNA levels of TGF- in the B cell extracts. (I) The immune blots indicate the protein levels of TGF- in the B cell extracts. (J) The bars indicate the integrated density of the immune blots of G. aPlGF: PlGF inhibitor, TB-403 (RO5323441) (1 g/ml). rPlGF: recombinant PlGF (1 g/ml), BSA (1 g/ml). The data of bars are presented as mean ± SD. *p < 0.01, compared with group A. The data are a representative of three independent experiments.
Fig. 4. Assessment of glioma-specific Bregs. Induced Bregs (A and B), intro-glioma CD19+ B cells (D and E) and peripheral CD19+ B cells (G and H) were labeled with CFSE, cultured in the presence of glioma extracts (10 g/ml) (A, D, G), or BSA (B, E, H; 10 g/ml), for 3 days. The cells were analyzed by flow cytometry. The histograms indicate the frequency of proliferated cells. The bars indicate the summarized data of the histograms of groups as denoted on the X-axes. The data of bars are presented as mean ± SD. *p < 0.01, compared with group A (C), or group D (F), or group G (I). The specimens were collected from 10 patients with glioma and processed separately. The data are a representative of 10 independent experiments.
S. Han et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 63–68
67
Fig. 5. Bregs suppress glioma specific CD8+ T cell activities. The inducible Bregs (iBreg), CD8+ CD25− T cells, DCs and glioma extracts were prepared from the same patients (10 patients in total). The experimental design is denoted in the table. The CD8+ T cells were labeled with CFSE; the cells were collected at the end of the experiments and analyzed by flow cytometry. (A) The CFSE-labeled CD8+ T cells were gated. (B–F) The histograms indicate the frequency of proliferated CD8+ T cells (by CFSE dilution assay) in the gated cells of A. (G–I) The bars indicate the summarized data of proliferated cells of B–F (G), the levels of perforin (H) and granzyme B (I) in the culture supernatant. The data are a representative of 10 independent experiments.
by the presence of Bregs (Fig. 5H and I). The results indicate that there is a portion of glioma specific CD8+ T cells in the peripheral blood stream, which can be suppressed by glioma specific Bregs. 4. Discussion The present data indicate that glioma-derived exosomes contain PlGF. B cells capture the PlGF-carrying exosomes to differentiate into glioma-specific Bregs; the latter suppresses the glioma-specific CD8+ T cell activities. The intratumor immune cells play important roles in the pathogenesis of malignant tumors. Tumor-associated macrophages correlate with vascular space invasion and myometrial invasion in endometrial carcinoma (Soeda et al., 2008). The intratumor Tregs facilitate tumor cells to evade the anti-tumor T-cell immunity in the cancer microenvironment; such as to suppress cytotoxic CD8+ T cells (Wang et al., 2011). The inhibition of Tregs can improve the suppressor effect on the anti-tumor immunity (Schaer et al., 2013). The present data add novel information that the glioma-associating Bregs are also involved in the suppression of the anti-tumor immunity. PlGF belongs the growth factor family. Published data indicate a number of growth factors can induce immune regulatory cells. In the early 2000s, Zheng et al. (2002) and Chen et al. (2003) indicate that TGF- can induce Tregs. Other growth factors are also involved in the generation of immune regulatory cells; such as Yang et al. indicate that insulin-like growth factor is associated with the generation of Tregs (Yang et al., 2014); Geng et al. (2014) indicate that insulin-like growth factor is also related to the generation of antigen specific Bregs. Our data indicate that PlGF can generate immune regulatory cells. The glioma protein extracts were used as a specific antigen to activate the glioma specific CD8+ T cells and Bregs. The proliferation of CD8+ T cells and Bregs in response to the exposure to the glioma extracts demonstrates that the protein extracts contain
the specific antigens of glioma. This is in line with some other antigen preparations using in the clinic and laboratory studies; such as the raw extracts of mite, which contain a large number of variable molecules, are used in the diagnosis (Jeong et al., 2014), immunotherapy (Calderon et al., 2013) and induction of mite allergy animal models (Allen, 2013). Cytotoxic CD8+ T cells are one of the major anti-tumor immune cells to fulfill the immune surveillance in the body. The present data show that there is a fraction of glioma-specific CD8+ T cells in the peripheral system, implicating the anti-tumor immunity is still active in the body, but dysfunction because the glioma grow out. Further evidence indicates that the glioma-specific Bregs can suppress the glioma-specific CD8+ T cell activities. The data indicate that the specific Bregs may be a new target in anti-tumor immunity. Acknowledgement The study was suported by the National Natural Science Foundation of China (No. 81172413). References Allen IC. Induction of allergic airway disease using house dust mite allergen. Methods Mol Biol 2013;1032:159–72. Calderon MA, Casale TB, Nelson HS, Demoly P. An evidence-based analysis of house dust mite allergen immunotherapy: a call for more rigorous clinical studies. J Allergy Clin Immunol 2013;132:1322–36. Carnevale D, Lembo G. Placental growth factor and cardiac inflammation. Trends Cardiovasc Med 2012;22:209–12. Chen W, Jin W, Hardegen N, Lei KJ, Li L, Marinos N, McGrady G, Wahl SM. Conversion of peripheral CD4+CD25− naive T cells to CD4+CD25+ regulatory T cells by TGFbeta induction of transcription factor Foxp3. J Exp Med 2003;198:1875–86. Chen X, Song CH, Feng BS, Li TL, Li P, Zheng PY, Chen XM, Xing Z, Yang PC. Intestinal epithelial cell-derived integrin alphavbeta6 plays an important role in the induction of regulatory T cells and inhibits an antigen-specific Th2 response. J Leukoc Biol 2011;90:751–9. Garnier D, Jabado N, Rak J. Extracellular vesicles as prospective carriers of oncogenic protein signatures in adult and paediatric brain tumours. Proteomics 2013;13:1595–607.
68
S. Han et al. / The International Journal of Biochemistry & Cell Biology 57 (2014) 63–68
Geng XR, Yang G, Li M, Song JP, Liu ZQ, Qiu S, Liu Z, Yang PC. Insulin-like growth factor-2 enhances functions of Ag specific regulatory B cells. J Biol Chem 2014. Humphries W, Wei J, Sampson JH, Heimberger AB. The role of Tregs in gliomamediated immunosuppression: potential target for intervention. Neurosurg Clin N Am 2010;21:125–37. Jeong KY, Lee JH, Kim EJ, Lee JS, Cho SH, Hong SJ, Park JW. Current status of standardization of inhalant allergen extracts in Korea. Allergy Asthma Immunol Res 2014;6:196–200. Kaur G, Han SJ, Yang I, Crane C. Microglia and central nervous system immunity. Neurosurg Clin N Am 2010;21:43–51. Kerber M, Reiss Y, Wickersheim A, Jugold M, Kiessling F, Heil M, Tchaikovski V, Waltenberger J, Shibuya M, Plate KH, Machein MR. Flt-1 signaling in macrophages promotes glioma growth in vivo. Cancer Res 2008;68:7342– 51. Lin YL, Liang YC, Chiang BL. Placental growth factor down-regulates type 1 T helper immune response by modulating the function of dendritic cells. J Leukoc Biol 2007;82:1473–80. Liu Y, Chen Y, Li Z, Han Y, Sun Y, Wang Q, Liu B, Su Z. Role of IL-10-producing regulatory B cells in control of cerebral malaria in Plasmodium berghei infected mice. Eur J Immunol 2013a;43:2907–18. Liu ZQ, Wu Y, Song JP, Liu X, Liu Z, Zheng PY, Yang PC. Tolerogenic CX3CR1+ B cells suppress food allergy-induced intestinal inflammation in mice. Allergy 2013b;68:1241–8. Ribatti D. The discovery of the placental growth factor and its role in angiogenesis: a historical review. Angiogenesis 2008;11:215–21.
Schaer DA, Budhu S, Liu C, Bryson C, Malandro N, Cohen A, Zhong H, Yang X, Houghton AN, Merghoub T, Wolchok JD. GITR pathway activation abrogates tumor immune suppression through loss of regulatory T-cell lineage stability. Cancer Immunol Res 2013;1:320–31. Snuderl M, Batista A, Kirkpatrick ND, Ruiz de Almodovar C, Riedemann L, Walsh EC, Anolik R, Huang Y, Martin JD, Kamoun W, et al. Targeting placental growth factor/neuropilin 1 pathway inhibits growth and spread of medulloblastoma. Cell 2013;152:1065–76. Soeda S, Nakamura N, Ozeki T, Nishiyama H, Hojo H, Yamada H, Abe M, Sato A. Tumor-associated macrophages correlate with vascular space invasion and myometrial invasion in endometrial carcinoma. Gynecol Oncol 2008;109:122–8. Wang BQ, Zhang CM, Gao W, Wang XF, Zhang HL, Yang PC. Cancer-derived matrix metalloproteinase-9 contributes to tumor tolerance. J Cancer Res Clin Oncol 2011;137:1525–33. Yang G, Geng XR, Song JP, Wu Y, Yan H, Zhan Z, Yang L, He W, Liu ZQ, Qiu S, Liu Z, Yang PC. Insulin-like growth factor 2 enhances regulatory T-cell functions and suppresses food allergy in an experimental model. J Allergy Clin Immunol 2014;133:1702–8. Yang I, Han SJ, Kaur G, Crane C, Parsa AT. The role of microglia in central nervous system immunity and glioma immunology. J Clin Neurosci 2010;17:6–10. Zheng SG, Gray JD, Ohtsuka K, Yamagiwa S, Horwitz DA. Generation ex vivo of TGF-beta-producing regulatory T cells from CD4+CD25− precursors. J Immunol 2002;169:4183–9.