Global distribution of mating types shows limited opportunities for mating across populations of fungi causing boxwood blight disease

Fungal Genetics and Biology 131 (2019) 103246

Contents lists available at ScienceDirect

Fungal Genetics and Biology journal homepage: www.elsevier.com/locate/yfgbi

Global distribution of mating types shows limited opportunities for mating across populations of fungi causing boxwood blight disease

T

Martha Malapi-Wighta,1, Daniel Veltria,b,2, Bjorn Gehesquièrec,3, Kurt Heungensc, ⁎ Yazmín Riveraa,d,4, Catalina Salgado-Salazara,b, Jo Anne Croucha, a

United States Department of Agriculture, Agricultural Research Service, Mycology and Nematology Genetic Diversity and Biology Laboratory, Beltsville, MD, USA Oak Ridge Institute for Science and Education, ARS Research Participation Program, Oak Ridge, TN, USA c Institute for Agricultural and Fisheries Research (ILVO), Plant Sciences Unit, Merelbeke, Belgium d Department of Plant Biology & Pathology, Rutgers University, New Brunswick, NJ, USA b

ARTICLE INFO

ABSTRACT

Keywords: Boxwood Calonectria Mating type Synteny MAT1 architecture

Boxwood blight is a disease threat to natural and managed landscapes worldwide. To determine mating potential of the fungi responsible for the disease, Calonectria pseudonaviculata and C. henricotiae, we characterized their mating-type (MAT) loci. Genomes of C. henricotiae, C. pseudonaviculata and two other Calonectria species (C. leucothoes, C. naviculata) were sequenced and used to design PCR tests for mating-type from 268 isolates collected from four continents. All four Calonectria species have a MAT locus that is structurally consistent with the organization found in heterothallic ascomycetes, with just one idiomorph per individual isolate. Mating type was subdivided by species: all C. henricotiae isolates possessed the MAT1-1 idiomorph, whereas all C. pseudonaviculata isolates possessed the MAT1-2 idiomorph. To determine the potential for divergence at the MAT1 locus to present a barrier to interspecific hybridization, evolutionary analysis was conducted. Phylogenomic estimates showed that C. henricotiae and C. pseudonaviculata diverged approximately 2.1 Mya. However, syntenic comparisons, phylogenetic analyses, and estimates of nucleotide divergence across the MAT1 locus and proximal genes identified minimal divergence in this region of the genome. These results show that in North America and parts of Europe, where only C. pseudonaviculata resides, mating is constrained by the absence of MAT1-1. In regions of Europe where C. henricotiae and C. pseudonaviculata currently share the same host and geographic range, it remains to be determined whether or not these two recently diverged species are able to overcome species barriers to mate.

1. Introduction The filamentous ascomycetes Calonectria henricotiae and C. pseudonaviculata are the closely related fungal pathogens responsible for boxwood blight, a devastating disease of temperate-zone boxwood plants (Buxus spp.) in built landscapes, natural ecosystems and the horticultural industry (LeBlanc et al., 2018). The factors underlying the emergence and global spread of boxwood blight are currently undetermined. The disease was first reported in the United Kingdom

(U.K.) in 1994 (Henricot and Culham, 2002), followed by outbreaks in New Zealand during 1998 (Crous et al., 2002). Subsequently, boxwood blight spread rapidly throughout continental Europe and western Asia (LeBlanc et al., 2018). In the United States (U.S.) boxwood blight was first reported in 2011 almost simultaneously from two states on the east coast, separated by ∼ 900 miles (Ivors et al., 2012). In a matter of months, additional North American outbreaks occurred in the U.S. Pacific Northwest, throughout the U.S. Northeast and mid-Atlantic regions, and at three cross-continental sites in Canada, with the disease

Corresponding author at: USDA-ARS, 10300 Baltimore Avenue, Building 010A, Beltsville, MD 20705, USA. E-mail address: [email protected] (J.A. Crouch). 1 Present address: United States Department of Agriculture, Animal and Plant Health Inspection Service, Plant Protection and Quarantine, Plant Germplasm Quarantine Program, Beltsville, MD, USA. 2 Present address: Bioinformatics and Computational Biosciences Branch, Office of Cyber Infrastructure and Computational Biology, National Institute of Allergy and Infectious Diseases, NIH, Rockville, MD, USA. 3 Present address: CRI Labo Medische Analyse, Gent, Belgium. 4 Present address: United States Department of Agriculture, Animal and Plant Health Inspection Service, Plant Protection and Quarantine, Center for Plant Health Science and Technology, Beltsville MD, USA. ⁎

https://doi.org/10.1016/j.fgb.2019.103246 Received 28 November 2018; Received in revised form 23 May 2019; Accepted 19 June 2019 Available online 27 June 2019 1087-1845/ © 2019 Elsevier Inc. All rights reserved.

Fungal Genetics and Biology 131 (2019) 103246

M. Malapi-Wight, et al.

now reported from 25 states (LeBlanc et al., 2018). Originally boxwood blight outbreaks were attributed to a single species, C. pseudonaviculata (Cps; synonyms = Cylindrocladium pseudonaviculatum, Cy. buxicola), which is documented globally from all regions where the disease has been observed since 1994 (Gehesquière et al., 2016; Henricot and Culham, 2002; LeBlanc et al., 2019). However, since at least 2005, five European countries are now afflicted with a second boxwood blight pathogen, C. henricotiae (Che; Gehesquière et al., 2016; LeBlanc et al., 2019). The two species are discriminated from each other based on phylogenetic distinctiveness and the application of genealogical concordance species recognition criteria (Gehesquière et al., 2016). Differentiation of Che and Cps is also observed from genome-wide SSR sequence profiles, with interspecific length polymorphisms occurring at 39% of 1359 loci assessed (LeBlanc et al., 2019). Phenotypic differences between the two species are also documented, most notably in the ability of Che—but not Cps—to survive exposure to high temperatures, chemical sterilants and some classes of fungicides (Gehesquière et al., 2016; Miller et al., 2018; Shishkoff, 2016). The rapid spread of boxwood blight across new continental habitats shows that once the disease gains a foothold in an area, the pathogen is capable of quickly dispersing across a wide geographic range (LeBlanc et al., 2018). Latent infections of less susceptible boxwood cultivars or fungicide-treated plants may have allowed movement of the pathogen via asymptomatic plants to go undetected (Ganci, 2014; Gehesquière et al., 2013; LeBlanc et al., 2018). Cps also infects and causes disease of other plants in the Buxaceae family—Sarcoccocca and Pachysandra—providing another potential route for inoculum production and transmission (Kong et al., 2017a, 2017b; Kong and Hong, 2018; LaMondia et al., 2012; LaMondia and Li, 2013; Malapi-Wight et al., 2016b). Air sampling experiments show that wind dispersal of Cps via asexual spores is extremely rare (Gehesquière et al., 2013), perhaps due to physical limitations imposed by relatively large conidia (∼60 μm long) that are held fast within a thick liquid matrix associated with the asexual fruiting structure (Henricot and Culham, 2002; Gehesquière et al., 2016). The trajectory of boxwood blight disease may also have been influenced by other elements of the pathogens’ life cycles, although at present, the biology of these fungi is only beginning to be resolved (LeBlanc et al., 2018). The mode of reproduction used by fungal pathogens plays a significant biological role in disease epidemiology, and in turn, provides clues about the management practices and breeding tactics most likely to provide sustainable control (McDonald and Linde, 2002). Sexual reproduction has the effect of increasing and maintaining genotypic diversity through homologous recombination during meiosis, often resulting in increased virulence, or rapid adaptation to host resistance genes or fungicides (McDonald and Linde, 2002). Dispersal patterns are also altered by sexual reproduction for many ascomycetes, as the forcible ejection of sexually generated ascospores into air currents can propel an otherwise sessile organism over great physical distances (Roper et al., 2010; Trail, 2007; Yafetto et al., 2008). Perithecia of Calonectria species are often produced in great abundance on plant tissue at the soil line or just below the soil surface, and forcibly propel their ascospore contents far beyond the area immediately surrounding the fruiting body (Linderman, 1974; Vitale and Polizzi, 2007). It is unknown how or if sexual reproduction influences boxwood blight outbreaks. Multilocus SSR genotypes indicate that Cps and Che populations are clonal in Europe and North America, suggesting a limited role for mating (LeBlanc et al., 2019). Furthermore, only vegetative structures (hyphae and microsclerotia) and conidia are documented from the boxwood blight fungi (Gehesquière et al., 2016; Henricot and Culham, 2002). However, the potential for random mating to occur in populations of Che and Cps has never been assessed. Fungal mating type (MAT) genes function as primary regulators of the ascomycete sexual cycle, encoding for transcription factors (TFs) with conserved DNA binding motifs that determine mating compatibility between individuals (Coppin et al., 1997; Shiu and Glass, 2000).

Although the MAT genes are not the only factor governing fungal mating, their biallelic make-up allows for indirect molecular assessment of mating potential, providing the first step towards understanding pathogen life cycles and reproductive capability. Two alternate forms of MAT have been characterized in the fungal kingdom, referred to as idiomorphs rather than alleles due to the absence of any obvious sequence similarity (Metzenberg and Glass, 1990; Ni et al., 2011). Depending on the fungal species, the MAT locus contains either a gene encoding a TF with a characteristic α DNA binding motif (typically MAT1-1), a gene encoding a TF with high mobility group (HMG) domain (typically MAT1-2), or both genes together (Ni et al., 2011). For mating to commence, both idiomorphs must be present. Homothallic individuals possess both idiomorphs in their genomes and are therefore self-fertile. Heterothallic individuals are self-incompatible, as they harbor just one of the two idiomorphs and require the participation of a second individual of the opposite mating type in order for mating to proceed (Ni et al., 2011). The mating type system of the two boxwoodassociated Calonectria species has not been determined. The MAT1-2 HMG domain is known from 32 isolates of C. pseudonaviculata, but it is undetermined whether or not the genomes of these isolates also carry the MAT1-1 idiomorph (Gehesquière et al., 2016; Henricot and Culham, 2002). To date, attempts to determine the mating type of Che using PCR primers designed to amplify the Calonectria MAT1-2 HMG domain have been unsuccessful (Gehesquière et al., 2016). Given the demonstrated ability of the Calonectria MAT1-2 HMG domain PCR primers to amplify from species across the entire genus (e.g. Lombard et al., 2010a), these findings suggest that the 12 surveyed isolates of Che are likely heterothallic, and may only carry the MAT1-1 idiomorph. Attempts to mate isolates of Cps with other isolates of the same species or with Che failed to produce either protoperithecia or perithecia (Gehesquière et al., 2016; Henricot and Culham, 2002). It is unknown whether the failure to mate these isolates was due to incomplete pairs of MAT1 idiomorphs, or the result of some other factor(s) that precluded the completion of the sexual cycle. For example, lack of physiological or environmental requirements during experiments, the absence of a fertile female/male partner, divergent adaptation or some other reproductive barrier(s) may have served to limit mating (e.g. Dettman et al., 2008; Giraud et al., 2008; Turner et al., 2011). Given the potential for sexual reproduction to influence population diversity and allow longer distance dispersal, understanding the mating potential of the two Calonectria species causing boxwood blight holds strong implications for disease epidemiology, risk assessment and the development of effective control strategies. Therefore, the aim of this study was to investigate the MAT locus mating determinants of Che and Cps, facilitated by whole genome sequencing of these fungi and two additional Calonectria species. We evaluated the distribution of these MAT genes from a global sample of the two species that cause boxwood blight, and used these data to assess the potential impact of sexual reproduction on the disease. In addition, using comparative genomicbased approaches, we estimated the divergence times between the two species that cause boxwood blight disease, and investigated the evolutionary forces that shaped the MAT genes and adjacent non-reproductive genes to learn if there were unique constraints operating on the MAT locus. 2. Materials and methods 2.1. Fungal isolates, media, and nucleic acid manipulation Two hundred and thirty-seven Cps and 31 Che isolates collected from different Buxus species and cultivars were used for this study. Isolates were selected to provide a broad global representation of the pathogens that have been collected between 1994 and 2014, with the sample including isolates made from most of the major outbreak sites. The isolates originated from 15 countries in continental Europe, Asia, North America and New Zealand; details are summarized in 2

Fungal Genetics and Biology 131 (2019) 103246

M. Malapi-Wight, et al.

Table 1 Summary of the four primary Calonectria genome assemblies generated as part of this study. Species Isolate Mating type NCBI accession #

C. henricotiae CBS 138,102 MAT1-1 PGWR00000000

C. pseudonaviculata CBS 139,707 MAT1-2 JYJY00000000.1

C. leucothoes CBS 109,166 MAT1-1 NAJI00000000

C. naviculata CBS 101,121 MAT1-2 NAGG00000000

Coverage Genome size (Mb) GC (%) # Scaffolds/Contigs # Scaffolds/Contigs ≥ 50 kb N50 (kb) Max. scaffold length (Mb) Number of genes predicted # N's per 100 kb BUSCO, eukaryote (%)c BUSCO, fungi (%) d

70× 53.7 48.9 9,527 46 15.4 0.9 14,924 4.6 95.2 98.6

83×a 55.0 46.4 27 22 3,534.4 5.6 16,304b 2,117.1 95.6 99.4

124× 63.1 49.5 3,371 270 253.3 1.3 18,609 59.3 96.0 99.3

84× 65.7 50.5 5,768 350 790.0 0.8 16,865 5.5 95.8 98.3

a

Coverage calculation is based on Illumina reads only. Calonectria pseudonaviculata predicted using CodingQuarry due to availability of RNA-Seq data; all other gene model sets based on AUGUSTUS software prediction. c 429 BUSCO groups searched from the eukaryote ortholog dataset. d 1,438 BUSCO groups searched from the fungal ortholog dataset. b

Supplementary Table 1. Isolates were identified to species level as previously described using real-time PCR and/or using Sanger sequencing of the internal transcribed spacer (ITS) and beta tubulin 2 (TUB2) DNA regions as described (Gehesquière et al., 2016), either as part of previous studies (Crous et al., 2002; Henricot and Culham, 2002; Ivors et al., 2012; Malapi-Wight et al., 2014; Gehesquière et al., 2016) or in the present work. Genomic DNA (gDNA) was extracted and purified as previously described (Malapi-Wight et al., 2015). Cps total RNA was extracted using the ZR Fungal/Bacteria RNA Mini Prep Kit (Zymo Research, Irvine, CA) following the manufacturer’s protocol.

et al., 2012). The Cps CBS 139,707 ALLPATHS-LG assembly was improved using Pilon v.1.18 (Walker et al., 2014), where both the PacBio and Illumina reads helped to extend, correct, and fill gaps within scaffolds. Transposable element (TE) identification was performed using the REPET v.2.52 (Flutre et al., 2011) de novo and annotation pipelines. Each program was used with default settings, following the pipeline outlined in Rivera et al. (2018).

2.2. Next generation sequencing, genome assemblies and data summaries

Local BLAST databases were created from genome assemblies in the CLC Genomics Workbench. MAT1 idiomorphs were identified using the Cps MAT1-2 HMG-box sequence (GenBank accession KP757723) as the query in BLASTn searches, or the amino acid sequence of MAT1-1 from Fusarium graminearum (Yun et al., 2000) as a query in tBLASTn searches. On contigs/scaffolds where putative mating type genes were resident, gene models were predicted using the AUGUSTUS webserver (http//bioinf.uni-greifswald.de/augustus/submission) using F. graminearum gene models. Blast2GO (Conesa et al., 2005) was used to perform BLASTx searches of the NCBI non-redundant database to summarize GO functions and annotate predicted genes. Motifs were identified and associated with GO terms using the MEME Suite (Bailey et al., 2009). To provide PCR-based identification of the MAT1-1 idiomorph, primers (Che_mat-1F and Che_mat-1R) were designed from the genome assembly of Che CBS 138,102 to amplify a 583 bp amplicon of the α box DNA binding domain. For the PCR-based identification of the MAT1-2 idiomorph, primers (Cps_mat-2F and Cps_mat-2R) were designed to amplify a 452 bp amplicon of the HMG box DNA binding domain from the genome assembly of Cps CBS 139,707 (Fig. 1). Primers were designed using the OligoAnalyzer 3.1 program (Integrated Data Technologies [IDT], Coralville. IA) and synthesized by IDT. Duplexed PCR was performed in a C1000 Thermal Cycler (Bio-Rad Laboratories Inc., Hercules, CA) with the following conditions: 2 min denaturation at 94 °C, followed by 35 cycles of 45 s at 94 °C, 45 s at 58 °C, 1 min at 72 °C and a final extension of 10 min at 72 °C. Reaction mixtures (20 μl) included 12 ng of gDNA (as determined using a NanoDrop ND-1000 spectrophotometer), 10 μmol of each primer, 0.5 μl MgCl2 (25 mmol) and 10 μl MangoMix (Bioline, Taunton, MA). PCR products were visualized on a QIAxcel capillary gel electrophoresis instrument using the QIAxcel High Resolution Analysis kit (QIAGEN). Amplicons were treated with ExoSap-It (Affymetrix, Cleveland, OH) and sequenced bi-

2.3. Identification, prediction, and annotation of mating type genes

Draft genome sequence assemblies were generated for one representative isolate each for Che, Cps, C. leucothoes and C. naviculata (Table 1) using Illumina sequencing technology (Illumina, Inc., San Diego, CA). Five additional isolates of Cps and three additional isolates of Che were also sequenced (Supplementary Table 2), and published genome assemblies from two additional isolates of Cps were also included (Malapi-Wight et al., 2016b). Single- and dual-indexed sequencing libraries were constructed from gDNA using Nextera XT or TruSeq DNA PCR-Free kits (Illumina, Inc.). Nextera Mate Pair libraries were generated for Che CBS 138,102 and Cps CBS 139707. Cps CBS 139,707 RNA libraries were constructed using the TruSeq RNA LT preparation kit (Illumina, Inc.) All Illumina libraries were quantified and sequenced as previously described (Malapi-Wight et al., 2016a, 2016b). Read trimming and genome assembly for Che CBS 138102, C. naviculata CBS 101121, and C. leucothoes CBS 109,166 was performed using CLC Genomics Workbench v.7.5.1 (QIAGEN, Inc., Gaithersburg, MD). The assembly for Cps CBS 139,707 was generated with ALLPATHS-LG (Gnerre et al., 2011) to produce contigs and perform scaffolding. ALLPATHS-LG was used to trim and error correct the fragment libraries, while NxTrim v.0.4.0 (O’Connell et al., 2015) was used (default settings) to pre-process the mate pairs and filter lower quality mates into separate paired or single read files. To further improve the genome assemblies for Che CBS 138,102 and Cps CBS 139707, gDNA was sequenced by single molecule real-time (SMRT; Pacific Biosciences; Seattle, WA) by the University of Washington PacBio Sequencing Services. Four SMRT cells were used per isolate to provide approximately 10x coverage for the purpose of improving the Illumina-based assemblies. For Che CBS 138102, PacBio reads of insert ≥ 500 bp were aligned to the initial CLC assembly to extend and correct contigs using the PB Jelly pipeline v.14.7.14 using recommended settings (English 3

Fungal Genetics and Biology 131 (2019) 103246

M. Malapi-Wight, et al.

Fig. 1. Phylogenetic relationships and estimated divergence times among the boxwood blight pathogens, Calonectria henricotiae and C. pseudonaviculata, and other ascomycete fungi. The maximum likelihood tree was constructed from the combined single copy ortholog protein dataset shared among all eleven taxa. Branch lengths are proportional to divergence time. Mean divergence times are plotted above branches, and given as millions of years ago (Mya). Bootstrap values are listed below branches.

directionally using Sanger technology using the same PCR primers described above. Sequences were assembled in Sequencher v5.0 (Gene Codes Corporation, Ann Arbor MI).

visualized in FigTree v.1.3.1 (http://tree.bio.ed.ac.uk/software/ figtree/). Using the ML phylogenies constructed from coding regions and their corresponding alignments, rates of synonymous and non-synonymous changes (dN = rate of non-synonymous substitutions and dS = rate of synonymous substitutions) were calculated using the CODEML module in PAML v.4.8 (Yang, 2007) for the MAT1 idiomorphs and the 12 MAT1-proximal genes in Calonectria. Syntenic analyses and figures were generated using the SimpleSynteny v.1.3 command line scripts (Veltri et al., 2016). Genes adjacent to MAT1 were mapped to the genome assemblies of the four Calonectria species. MAT1 and MAT1-proximal genes were mapped against other ascomycete fungi using coding sequences or proteins taken from Cps and Che to highlight gene similarities, differences and rearrangements. Divergence dates between Calonectria species were estimated through a phylogenomic analysis of a single copy ortholog dataset. Proteomes were predicted from Calonectria genome assemblies using the AUGUSTUS web server as described in section 2.3, with expressed sequenced tags generated from Cps CT01 used as evidence to support the gene prediction process. Publically available predicted proteomes for six additional ascomycete species were downloaded from NCBI Genbank Genome database (https://www.ncbi.nlm.nih.gov/genbank/) for use in the analysis, and were selected based on the availability of divergence date estimates that could be used to calibrate the tree (http://timetree.org; Hedges et al., 2015). These species include F. graminearum PH-1 (Cuomo et al., 2007), M. oryzae 70-15 (Dean et al., 2010), N. crassa (Galagan et al., 2005), S. sclerotiorum 1980 UF-70 (Amselem et al., 2011), T. reesei RUT C-30 (Koike et al., 2013) and V. dahliae JR2 (de Jonge et al., 2012). The 3001 single copy orthologs present in all eleven proteomes were identified using OrthoFinder v.2.2.6, with multiple sequence alignments generated using MAFFT v.6.903 (Katoh and Standley, 2013) and ML trees generated using FastTree (Price et al., 2010), with S. sclerotiorum used to root the tree. Bootstrap support was determined from 100 replicates performed in RAxML (Stamatakis, 2006). Alignments of single copy orthologs were concatenated, followed by removal of ambiguously aligned regions using Gblocks v.0.91b (Talavera and Castresana, 2007). To obtain temporal information on divergence events, the RelTime method (Tamura et al., 2012; Mello, 2018) as implemented in MEGA v.7 (Kumar et al., 2016) was used to infer the relative age of each node of the ML tree. We used three confidence intervals obtained from the TimeTree database (http://timetree.org; Hedges et al., 2015) as

2.4. Evolutionary analyses Predicted protein and nucleotide sequences from mating type genes and genes proximal to the MAT1 locus were extracted from the Calonectria genome assemblies and used to identify homologues from published fungal genomes in the Ascomycota. Fungi included for comparative analyses were selected to provide a representative sample of different groups from across the filamentous Ascomycota. Predicted proteins and nucleotide sequences from genes of interest were analyzed from Aspergillus fumigatus Af293, A. niger CBS 513.88, A. nidulans FGSC A4, A. terreus NIH 2624, Chaetomium globosum CBS 148.51, Colletotrichum graminicola M1.001, F. graminearum PH-1, F. oxysporum 4287; F. verticilloides 7600; Magnaporthe oryzae 70–15, Fusarium solani (synonym = Nectria haematococca) 77–13-4, Neurospora crassa OR74A, Phaeospaeria nodorum strain SN15, Pyrenophora tritici-repentis Pt-1CBFP, Sclerotinia sclerotiorum 1980, Trichoderma reesei (JGI v.2.0), Verticillium alfalfae strain VaMs.102, and Zymoseptorium tritici strain STIR04_2.2.1 downloaded from the genome portal of the U.S. Department of Energy Joint Genome Institute (JGI; www.genome.jgi.doe.gov) or Broad Institute (www.broadinstitute.org) genome web interfaces. All downloaded genome sequences were from published datasets (Amselem et al., 2011; Arnaud et al., 2012; Coleman et al., 2009; Cuomo et al., 2015; Dean et al., 2005; Galagan et al., 2003, 2005; Hane et al., 2007; Klosterman et al., 2011; Ma et al., 2010; Manning et al., 2013; Martinez et al., 2008; Nierman et al., 2005; Ohm et al., 2012; Stukenbrock, 2013). Amino acid-based distance trees were constructed using maximum likelihood in CLC Genomics Workbench (QIAGEN, Inc.) from sequence alignments generated in Clustal Omega (Sievers et al., 2011), with P. tritici-repentis used as outgroup to root the tree. Nucleotide sequence alignments from Calonectria species were generated using MUSCLE (Edgar, 2004). Phylogenies were constructed using maximum likelihood in CLC Genomics Workbench (QIAGEN, Inc.), using the HKY substitution model with estimated rate variation along eight categories, and an estimated Gamma distribution parameter. Calonectria leucothoes was used as the outgroup to root the nucleotide sequence trees, as this species was identified as the earliest evolving lineage based on evolutionary relationships identified in the amino acid-based phylogenetic trees (this study). All trees were 4

Fungal Genetics and Biology 131 (2019) 103246

M. Malapi-Wight, et al.

of coverage of 70× and 83×, respectively (Table 1). Both Che and Cps possessed average-sized genomes relative to other members of the Ascomycota, with a 53.0 Mb assembly derived from Cps CBS 138,102 and a 55.6 Mb assembly derived from Che CBS 139707. Genome assemblies generated from C. leucothoes CBS 109,166 and C. naviculata CBS 101,121 and (84 × and 124 × coverage) were larger than those of Che CBS 138,102 and Cps CBS 139707, measuring 63.1 Mb and 65.7 Mb, respectively. The larger genome assemblies for C. leucothoes and C. naviculata were similar to the recently reported genome assembly generated for C. pseudoreteaudii isolate YA51 (63.7 Mb; Ye et al., 2017). Although the number of contigs/scaffolds varied between the four Calonectria species based on the sequencing strategy employed (between 27 and 9,527; Table 1), each of the four assemblies contained between 98.3 and 99.4% of the 1,438 BUSCO single copy fungal orthologs, and scaffold accumulation curves (length accumulation curve of scaffold and contig size distribution) reached plateaus (not shown), consistent with a comprehensive assembly of the complete gene space. Phylogenetic relationships and divergence estimates using the single copy ortholog dataset from the Calonectria species and six additional ascomycete species are shown in the time-calibrated tree in Fig. 1. All branches were supported by bootstrap values of 100. The time interval for the divergence of Che and Cps was estimated at ∼ 2.1 million years ago (Mya). The split between the boxwood blight fungi and C. naviculata was estimated at ∼ 26.5 Mya (Fig. 1). Calonectria leucothoes and C. pseudoreteaudii were identified as basal species to Che, Cps and C. naviculata, with the estimated diversification from the Naviculate Calonectria group (Che, Cps, C. naviculata) calculated at ∼ 40.2 Mya. 3.2. Characterization of MAT1 revealed that the boxwood blight fungi are heterothallic From each of the 14 genome assemblies corresponding to the four Calonectria species sequenced for this study (Supplementary Table 2), a single MAT locus was identified, designated MAT1. A single mating type idiomorph was found at the MAT1 locus from all genomes, consistent with heterothallic species. The MAT1-1 idiomorph, identified from the genomes of Che CBS 138102, C. naviculata CBS 101,121 and the partial assemblies of Che isolates CB077, NL009 and NL017, consisted of the typical ascomycete gene arrangement reported for this idiomorph (Yun et al., 2000; Amselem et al., 2011; Ni et al., 2011). MAT1-1 contained a predicted protein with an α DNA binding domain (MAT1-1-1), a predicted protein containing a PPF domain (MAT1-1-2) and a predicted protein containing an HMG domain (MAT1-1-3), located within a 4.2-kb region in both species (Fig. 2; Table 2). No intraspecific nucleotide variation was identified in comparisons of the MAT1-1 genes from the genomes of the four Che isolates analyzed in this study. Pairwise nucleotide comparison between the MAT1-1 genes

Fig. 2. Schematic organization of Calonectria henricotiae, C. leucothoes, C. naviculata, and C. pseudonaviculata MAT1 loci. A, C. henricotiae and B, C. naviculata MAT1-1 loci compromised genes encoding an α DNA binding domain (MAT1-11), a PPF domain (MAT1-1-2), and a HMG domain (MAT1-1-3). C, C. leucothoes, and D, C. pseudonaviculata MAT1-2 loci compromised a HMG domain (MAT1-21) and an open reading frame with unknown function (MAT1-2-2). Solid bars represent DNA regions used as targets for MAT1 screening.

minimum and maximum times to convert the relative times into absolute times and calibrate divergence points across the tree topology: F. graminearum and N. crassa = 314–414 Mya; F. graminearum and T. reesei = 179–294 Mya; and F. graminearum and V. dahliae = 193–294 Mya). Time estimates were performed using ML branch length, local clocks, a LG + I matrix-based model (Lee and Gascuel, 2008) and a discrete Gamma distribution among sites (five categories). 2.5. Data resources

Table 2 Characteristics of the MAT1 locus in four Calonectria species.

Datasets and images generated from this research, including sequences of MAT1 genes, MAT1 proximal genes, whole-genome gene model predictions, re-sequenced genome datasets, sequence alignments, tree files and high-quality photo images are available through the National Agricultural Library AgData Commons (Crouch et al., 2017). Draft genome assemblies are also available through NCBI GenBank under accession numbers given in Table 1.

Species C. henricotiae MAT1-1-1 MAT1-1-2 MAT1-1-3 C. naviculata MAT1-1-1 MAT1-1-2 MAT1-1-3 C. leucothoes MAT1-2-1 MAT1-2-2 C. pseudonaviculata MAT1-2-1 MAT1-2-2

3. Results 3.1. Genome assemblies and divergence time estimates To determine the mating system utilized by the boxwood blight pathogens—homothallic or heterothallic—the genomes of Che CBS 138,102 and Cps CBS 139,707 were sequenced as references to a depth 5

Length (bp)

Sense

Number of introns

843 1,439 365

– – +

2 4 1

1,218 1,375 736

– – +

2 3 3

818 915

– +

2 1

832 917

+ –

2 0

MAT1 locus size (kb) 4.2

4.2

3.3 3.3

Fungal Genetics and Biology 131 (2019) 103246

M. Malapi-Wight, et al.

(including exons and introns) of Che and C. naviculata showed that MAT1-1-1 and MAT1-1-2 shared the greatest identity between species (81.9% and 69.3%, respectively), while MAT1-1-3 only shared 38.6% identity. The conserved α DNA binding domain located in MAT1-1-1 showed 73% similarity on the nucleotide level between F. graminearum and Che. The MAT1-2 idiomorph, identified from the genomes of all eight Cps isolates and C. leucothoes, consisted of a predicted protein containing an HMG box DNA binding domain (MAT1-2-1), and a predicted protein with an unknown function (MAT1-2-2) located within a 3.3 kb region in both species (Fig. 2; Table 2); similar to what is described from other filamentous ascomycetes (Debuchy and Turgeon 2006; Ni et al., 2011). No intraspecific nucleotide variation was identified in comparisons of the MAT1-2 genes from the draft genome assemblies of the eight Cps isolates. Pairwise nucleotide comparison between the MAT1-2 genes (including exons and introns) in Cps and C. leucothoes showed that the MAT1-2-1 and MAT1-2-2 sequences shared 72.3% and 62.5% identity between the two species, respectively. The conserved HMG domain located in MAT1-2-1 shared 70% identity between F. graminearum and Cps.

Table 4 Summary of the geographic distribution of the MAT1 locus in Calonectria henricotiae and C. pseudonaviculata. All sampled isolates with the MAT1-1 idiomorph are from the species C. henricotiae, all sampled isolates with the MAT1-2 idiomorph are from the species C. pseudonaviculata. Country/State

Asia Iran Turkey Europe Belgium Croatia France Germany Italy Republic of Georgia Slovenia Spain Switzerland the Netherlands United Kingdom North America United States Connecticut Delaware Maryland New Jersey New York North Carolina Ohio Oregon Zealandia New Zealand

3.3. Population screening showed the presence of just one idiomorph from each of the two boxwood blight pathogen species PCR primers were designed to amplify different size fragments for MAT1-1 and MAT1-2 (583 and 452 bp, respectively) from the two boxwood-associated Calonectria species to facilitate rapid screening of the mating type in populations (Table 3; Supplementary Fig. 1). Visualization of PCR products showed that the two mating type determinants were divided according to species: the MAT1-1 idiomorph was identified exclusively from Che isolates, while the MAT1-2 idiomorph was identified exclusively from Cps isolates (Table 4; Supplementary Table 1). Sequence analysis of the amplification products confirmed the data generated from size visualization. There was no intraspecific nucleotide variation between isolates: nucleotide sequences of the 31 MAT1-1 isolates of Che shared 100% identity, as did the 237 MAT1-2 isolates of Cps (data not shown). Primer sets Che_mat-1F/Che_mat-1R and Cps_mat-2F/Cps_mat-2R were also tested for MAT1 identification in C. leucothoes and C. naviculata. The C. naviculata MAT1-1 gene was identified by the amplification of a 650 bp region, larger by 67 bp than the amplicon produced by Che MAT1-1, and consistent with genome sequence data. No amplification was observed from the C. leucothoes MAT1-2 locus. Sequence alignment between Cps and C. leucothoes MAT1-2 loci showed extensive polymorphism in the regions where PCR primers Cps_mat-2F /Cps_mat2R were designed to anneal (data not shown).

To characterize the architecture of the genes proximal to MAT1 in the genus Calonectria and determine whether the region was stable or underwent gene reordering, we mapped 22 genes that were adjacent to MAT1 in the genome assemblies of Che CBS 138102, C. leucothoes CBS 109166, C. naviculata CBS 101121, Cps CBS 139,707 and the publically available genome assembly of C. pseudoreteaudii YA51 (NCBI accession GCA_001879505; Ye et al., 2017), which we found to have the MAT1-2 Table 3 PCR primers designed in this study. Primer name

Sequence (5′ → 3′)

MAT1-1 MAT1-1 MAT1-2 MAT1-2

Che_mat-1F Che_mat-1R Cps_mat-2F Cps_mat-2R

GCAAGGGATGAGGTTGGTAA ACTGTTCTCGGCCTCAGTGT CCAATCCTTCTCCTGCTGAG CGTCGTTGGAGTCATCATTG

Mating type

Year collected

MAT1-1

MAT1-2

21 10

0 0

21 10

2012–2013 2012

86 1 3 14 1 1 5 1 2 23 43

8 0 0 10 0 0 3 0 0 6 4

78 1 3 4 1 1 2 1 2 17 39

2001–2013 2009 2006–2010 2005–2011 2008 2012 2008–2011 2010 2009 2005–2011 1999–2012

50 21 3 12 2 6 3 1 2

0 0 0 0 0 0 0 0 0

50 21 3 12 2 6 3 1 2

2011–2014 2011–2012 2013 2013–2014 2013 2013 2012 2012 2011

7

0

7

1999–2008

idiomorph. Several within-genus alterations in gene order surrounding MAT1 were detected among the five Calonectria species (Figs. 3, 4). Comparison of the earliest diverging Calonectria species—C. leucothoes and C. pseudoreteaudii—with the closest outgroup relation, F. graminearum, showed minimal reorganization of the MAT1 proximal region (Fig. 3). The Naviculate Calonectria species (Cps, Che, and C. naviculata) possessed a different orientation of the conserved SLA2, COX13 and APN2 genes relative to C. leucothoes, C. pseudoreteaudii, F. graminerum and C. graminicola (Fig. 4). Orientation of the MAT1-2-1 gene was identified in a reversed direction in Cps, relative to C. leucothoes and C. pseudoreteaudii. Together, these indicate that the region directly surrounding MAT1 (SLA2/MAT1/APN2/COX13) underwent an inversion event prior to the diversification of C. naviculata, Che and Cps. A relocation of the AMI1/TEX2 gene block was identified from the otherwise conserved position of these genes downstream of MAT1 relative to other fungal genomes examined, including C. leucothoes and C. pseudoreteaudii (Fig. 4). The association of S4/S9/L21e as a gene block was maintained within the Calonectria genus, but with an inversion in C. naviculata and C. pseudoreteaudii compared to Che and Cps and C. leucothoes. Comparisons between Che and Cps showed minimal alteration in synteny across the region, with gene order conserved except an inversion of a calmodulin gene and TEX2, and a reversal of gene orientation of two individual genes. To evaluate if the disruption of the MAT1 environment observed within the genus Calonectria might have been influenced by transposition events, we used the REPET pipeline to identify the presence of transposable elements (TEs) on the contigs/scaffolds where MAT1 and the MAT1-proximal genes were located. No TEs were identified on target contigs/scaffolds in Che, Cps and C. naviculata. In C. leucothoes, a gene encoding a putative reverse transcriptase (RT) was located in contig 42, adjacent to the KPR-motif gene. The presence of an RT is usually an indication of a retrotransposon (Wicker et al., 2007). For a retrotransposon to be mobile and autonomous, it needs specific flanking

3.4. Evolution of Calonectria MAT1 and MAT1-proximal genes

Assay

Number of Isolates

6

Fungal Genetics and Biology 131 (2019) 103246

M. Malapi-Wight, et al.

Fig. 3. Syntenic analysis of the MAT1 regions among five Calonectria species. Genes share a color across species and contig segments are numbered with start/end nucleotide basepair numbers. Arrows represent changes in gene direction. MAT1 and MAT1-proximal genes are shown for: C. pseudonaviculata, C. henricotiae, C. naviculata, C. leucothoes and C. pseudoreteaudii. Genes were drawn by using C. pseudonaviculata and C. henricotiae nucleotide and/or protein representations and mapping them with tBLASTn (E-value threshold = 0.001).

polyprotein genes such as aspartic proteinase, integrase, RNaseH, capsid protein and others (Wicker et al., 2007; Muszewska et al., 2011). None of these proteins were adjacent to the RT in C. leucothoes MAT1 region, indicating that the element is non-autonomous.

To evaluate whether the genes proximal to MAT1 were associated with evolutionary histories that differed from organismal evolution, phylogenetic analyses were performed from the MAT1 proximal gene cohort on the amino acid and nucleotide levels (Supplementary Tables

Fig. 4. Syntenic analysis of the MAT1 region for eight taxa within the Ascomycota. Individual genes share the same color across species. Contigs/scaffold segments are numbered with start/end nucleotide bp numbers. Arrows represent changes in gene direction. Genes are drawn by using the predicted protein representations from Calonectria pseudonaviculata and C. henricotiae genes and mapping them to other taxa using tBLASTn (E-value threshold = 0.001). Shown are the following species: C. pseudonaviculata (Cps), C. henricotiae (Ch), C. naviculata (Cn), C. leucothoes (Cl), Fusarium graminearum (Fg), Colletotrichum graminicola (Cg), Trichoderma reesei (Tr), and Aspergillus flavus (Afl). 7

Fungal Genetics and Biology 131 (2019) 103246

M. Malapi-Wight, et al.

3, 4). Phylogenies constructed from 11,771 predicted amino acid bases from 12 MAT1-proximal genes showed Calonectria species grouping together as a single clade in all trees and reflected the evolutionary relationships recovered from analysis of the combined single copy ortholog dataset (Fig. 1; Supplementary Fig. 3). Six of the phylogenetic trees possessed fully congruent topologies, and four gene trees harbored topology changes that only affected species relationships outside of the genus Calonectria (APC5, ATG3, COX13, L21e). The S4/9 and SLU7 gene trees were incongruent with the other gene trees and the combined ortholog tree (Fig. 1), with C. leucothoes clustered with Che and Cps, and C. naviculata placed as the basal species in the genus. Nucleotide sequence analysis of 14 MAT1-proximal genes (30,314 bp) and the five MAT1 genes (MAT1-1 = 3,398 bp; MAT12 = 1,751 bp) between the four Calonectria species also resulted in phylogenetic tree topologies congruent with each other and the organismal phylogeny (Supplementary Tables 3, 4; Fig. 1) with only one exception. The only exception was the SLU7 nucleotide-based phylogeny, which placed C. naviculata and Che as sister taxa, with Cps as basal to the group. All other phylogenetic trees reflected organismal evolution and the amino acid phylogenies. Che and Cps shared substantial nucleotide identity in this region, averaging 98.4%. The previously reported diversification between Che and Cps was supported by the 14 MAT1 and MAT1-proximal gene trees, where both organisms were recovered as unique lineages. Only one gene—CIA30—shared less than 97% similarity in pairwise comparisons between Che and Cps, possessing just 87.7% nucleotide identity between the two species (Supplementary Table 4). Overall, codon substitution rates for MAT1 genes (4,411 codon sites) were greater than those observed from the 13 MAT1-proximal genes, but not at significant levels (Student’s T-test, P = 0.07; Supplementary Table 5). Non-synonymous base substitutions were not observed in any of the MAT1 or MAT1-proximal genes across the ten sequenced Cps isolates, relative to the reference isolate Cps CBS 139,707 (data not shown). Non-synonymous substitutions were only detected from the APN2 and REV3 genes of two re-sequenced isolates of Che (CB077, NL017; Supplementary Table 5) relative to the reference isolate Che CBS 138102. Pairwise assessments of the relative rates of synonymous and nonsynonymous substitutions (ω = dN/dS) from the 14 non-reproductive MAT1-proximal genes (29,647 codon sites) calculated average values that ranged between 0.03 ± 0.05 (C. leucothoes vs. C. naviculata) and 0.19 ± 0.24 (Che vs. Cps; Supplementary Table 5).

globally distributed and included representatives from across all affected regions, as with any population sampling for newly emergent fungal pathogens, we cannot know if the sample evaluated in the present study is entirely exhaustive. Therefore, if species-level diagnosis is required, cross-validation of mating type data should be conducted using species-specific assays based on PCR-RFLP, LAMP or real-time PCR, or through sequence analysis of diagnostic molecular markers (Gehesquière et al., 2016; Malapi-Wight et al., 2016a,b). The Cps isolates used in the current study overlapped with those recently used to study Cps population diversity from global disease outbreaks using simple sequence repeat (SSR) markers (LeBlanc et al., 2019). In the U.S., these Cps isolates (n = 50) were collected throughout the first three years of disease expansion at major outbreak sites (2011 to 2014; Delaware, Connecticut, Maryland, North Carolina, New Jersey, New York, Ohio, Oregon). The U.S. Cps populations were characterized by a low level of genetic diversity, linkage disequilibrium, and were made up of just two closely related SSR genotypes, with no evidence of sexual recombination (LeBlanc et al., 2019). In agreement with those findings, the fact that the U.S. Cps populations only have the MAT1-2 idiomorph supports the hypothesis that the initial U.S. spread and expansion of Cps is due to the dispersal of clonal lineages. If mating is constrained by the absence of MAT1-1, then sexual reproduction is unlikely to have impacted these initial U.S. populations of Cps. However, since 2014, Cps has expanded its geographic range in the U.S., with new reports of the disease from at least 20 new states (LeBlanc et al., 2018). Future surveys of Cps will be useful in determining whether or not populations continue to exhibit low levels of diversity and a single MAT1 idiomorph as the pathogen becomes established and increasingly widespread in the U.S., and to monitor for potential changes in mating type distribution that might alter the genetic makeup of Cps populations on this continent. Populations of Cps have resided in the U.K. and many parts of continental Europe for up to 20 years or more (Gehesquière et al., 2016). The sample of Cps screened in this study reflects the known distribution of the pathogen in Europe and Asia, with isolates collected from 11 countries —Belgium, Croatia, France, Italy, Iran, the Republic of Georgia, Germany, Spain, Switzerland, Turkey and the U.K.—between 1994 and 2014 (n = 179), and including members of 14 distinct SSR genotypic groups (LeBlanc et al., 2019). As with the U.S. populations, only the MAT1-2 idiomorph was found in the European Cps populations, even in countries like Belgium and the U.K. where the sampling was most heavily concentrated (n = 57 and n = 39, respectively). Overall, the low level of genetic diversity of Cps in this part of the world spanning 20 years, combined with the lack of evidence of genetic exchange between molecular types (LeBlanc et al., 2019) is consistent with a population history built on clonal reproduction and restricted mating due to a single mating type. Both Che and Cps—each with different mating types—were found to inhabit five countries in continental Europe and the U.K. (Gehesquière et al., 2016; this study). In these locales, both Che and Cps occupy the same host niche and an overlapping geographic range. Given the observed subdivision of the two mating type idiomorphs along species lines, at present, the most likely way for heterothallic mating to occur in the boxwood blight pathosystem would be through interspecific hybridization between Che and Cps in areas where the two species are sympatric, or through self-fertilization by isolates marked as self-incompatible at the MAT1 locus. Partial levels of interfertility are often retained after speciation in the fungal kingdom due to the lack of premating barriers (Giraud et al., 2008), although interspecific crosses may be barren (Shiu et al., 2001). Several distantly related Calonectria species are capable of interspecific mating, albeit with low levels of hybrid viability (Lombard et al., 2010b). If hybridization can occur between Che and Cps, from a purely geographic standpoint, there appears to be ample opportunity for hybridization to take place in European populations. Che has co-existed in sympatry with Cps in Germany and the Netherlands for at least 10 years, and for a minimum of three to six

4. Discussion In this study, we analyzed the distribution and evolution of mating type genes in the two fungal species responsible for boxwood blight disease worldwide. Our data show that both Che and Cps have a single MAT locus that is structurally similar to other heterothallic ascomycetes, based on the genes encoded within the sole mating type locus, MAT1. A single MAT1 idiomorph is present in each of 268 isolates tested from a global collection made between 1999 and 2014, including the first boxwood blight samples made from Belgium, France, Iran, Italy, New Zealand, Spain, Turkey, the U.K. and the U.S., and on a regional basis within the U.S. throughout the first years of disease expansion in North America (LeBlanc et al., 2018, 2019). The MAT1-1 idiomorph was uniquely identified from isolates of Che, while MAT1-2 was limited to isolates of Cps. Ongoing investigations of boxwood blight can make use of the PCR assay developed in this study, as it provides a simple and effective tool to continually monitor mating type in populations as blight outbreaks occur. Likewise, the assay would allow for early detection of the MAT1-1 genotype should it appear in North America. The segregation of MAT1 idiomorphs according to species boundaries also suggests the mating type assay as a method to discriminate between isolates of Che and Cps, but we caution against independent diagnosis of the MAT1-1 idiomorph as a proxy for species identification. Despite the fact that our population was relatively large, 8

Fungal Genetics and Biology 131 (2019) 103246

M. Malapi-Wight, et al.

years in Belgium, Slovenia and the U.K. To date, we are unaware of any occurrence of both species on a single plant, but the level of overlapping range on the local level is currently unknown. Interspecific hybridization could undermine current resistance breeding efforts and potentially lead to rapid changes in pathogen populations. There are many well-documented cases where hybridization between closely related species of plant pathogenic fungi and oomycetes has generated offspring exhibiting new traits of major consequence, particularly in circumstances where the species are sympatric (Schardl and Craven, 2003). Although interspecific hybrids are not exclusively altered in traits impacting plant diseases, pathogenicity-related phenotypes are among those most commonly reported. They include traits such as enhanced virulence, accelerated or altered host adaptation and reduced sensitivity to chemical controls (Brasier et al., 1999; Brasier and Kirk, 2010; Farrer et al., 2011). As an alternative scenario, with only molecular data currently available, it is unknown whether or not Che and Cps might be capable of overcoming self-incompatibility through a unique mechanism of homothallism known as unisexual reproduction (Roach et al., 2014). This non-canonical strategy allows fungi to engage in homothallic sexual reproduction without the presence of an opposite mating type (Roach et al., 2014). Some filamentous ascomycetes are capable of unisexual reproduction, including Cryphonectria parasitica, Huntiella moniliformis, Neurospora africana and related species, and members of the genus Colletotrichum (Glass and Smith, 1994; Marra and Milgroom, 2001; O’Connell et al., 2012; Roach et al., 2014; Wilson et al., 2015), as well as the bipolar basidiomycete yeast, Cryptococcus neoformans (Roach and Heitman, 2014). Unisexuality is poorly understood, and the genetic mechanisms have not been defined. It is also unknown whether or not this reproductive strategy is widespread or frequent in the fungal kingdom (Roach et al., 2014). One of the most intriguing outcomes of unisexual reproduction is the effect it can have on organismal fitness and virulence, allowing for recombination and allowing deleterious mutations to be purged from progeny (Roach and Heitman, 2014). In small, genetically isolated asexual populations, unisexual reproduction could provide a means for the population to avoid the inevitable accumulation of deleterious changes (Muller’s rachet) that degrades the genomes of asexual lineages and may leads to extinction over time (Roach and Heitman, 2014). For Che and Cps, where genetic diversity is very low, unisexuality could provide a significant mechanism for the long-term persistence and success of otherwise clonal populations in the absence of the opposite mating type. Further research would be needed to determine whether unisexuality is a factor in the lifecycle of the boxwood blight pathogens. We used the comparative data generated from the MAT1 locus and surrounding genes to consider whether this region might be a source of genetic incompatibilities between Che and Cps, which we estimated to have diverged approximately 2.1 million years ago. In general, reproductive genes evolve at an accelerated rate relative to non-reproductive genes in many organismal groups, including fungi (Poggeler, 1999; Clark et al., 2006; Wik et al., 2008). In Neurospora, for example, positive selection drives rapid divergence of MAT genes in heterothallic individuals (Wik et al., 2008). In contrast, MAT genes and pheromone recognition systems in homothallic Neurospora undergo accelerated diversification due to the absence of any selective constraints, often leading to complete degeneration and lack of function (Wik et al., 2008; Nygren et al., 2012). Diversifying natural selection on genes involved in mate recognition such as MAT1 is one of several wellknown pre-zygotic barriers to reproduction and gene flow between species (Swanson and Vacquier, 2002; Stukenbrock, 2013). From the comparisons of the MAT1 regions of the Che and Cps genomes, we found no evidence to indicate that the genes encoded within the region could serve as a barrier to reproduction. On the contrary, the overall pattern of evolution documented from this region of the genome indicates little quantifiable change between these sister species that would indicate established or nascent reproductive barriers. The region is

characterized by minimal nucleotide diversification, and our data showed no discernable signs of accelerated evolution of the mating determinants relative to the neighboring genes. Across the four Calonectria species, the rates of non-synonymous nucleotide substitutions for both the MAT1 and the MAT1-proximal genes were extremely low. Although ω rates less than 1 are sometimes interpreted as evidence for evolution under conditions of purifying selection, it was impossible to test this prediction by likelihood-based modeling of variable selective pressure among codon sites using programs such as PAML (Yang, 2007), as such estimates are not informative for clonal populations (Grünwald et al., 2016), and the sample was not sufficiently variable to support valid χ2 approximations (Anisimova et al., 2002). We also addressed how the genes within and around the MAT1 locus were organized between Che and Cps. It is well established that reordering of the genomic landscape can be a potent source of recombination suppression, serving to reduce gene flow, facilitating the accumulation of genetic incompatibilities and often contributing to reproductive isolation and speciation (e.g. Noor et al., 2001; Rieseberg, 2001; McGaugh and Noor, 2012). For many filamentous fungi, the MAT1 genes and adjacent region are subject to ongoing and dynamic rearrangements, sometimes even occurring between one generation and the next (e.g. Chitrampalam et al., 2013). However, except for a single change in the gene order between the calmodulin and TEX2 genes, there was no evidence of gene reordering between Che and Cps in the ∼ 100 Mb region surrounding the MAT1 locus. On the contrary, the MAT1 region is co-linear between the two blight species, indicating that genome architecture in this region is unlikely to serve as a pre-zygotic barrier to reproduction between Che and Cps. The mystery surrounding the emergence of boxwood blight disease outbreaks in Europe and North America is an open question, and uncertainties regarding the origin(s) of Che and Cps still needs to be addressed in future research. The observed distribution of Che and Cps mating types and low genetic diversity across global populations is suggestive of strict clonal reproduction (LeBlanc et al., 2019; this study). However, given the interspecific subdivision of the two mating idiomorphs, and the extreme level of conservation exerted on the MAT1 region and genes contained within, our data supports the hypothesis that under the right circumstances, mating might occur between the two Calonectria species causing boxwood blight disease. In the five European countries where Che and Cps are sympatric, this may represent a very real threat to the commercial boxwood industry and native stands of boxwood alike. From a practical standpoint, these findings highlight the need for continued vigilance in North America and other regions where Che does not currently reside, to prevent the invasion of a MAT1-1 genotype that might initiate a sexual component to the boxwood blight pathosystem. Funding sources This work was funded by the USDA-APHIS Farm Bill Sections 10,021 and 10,007 Programs; USDA-ARS project 8042-22000-298, and the USDA-ARS Floriculture and Nursery Research Initiative; IWT, Flanders, Belgium (project 080519); MMW was supported by a Class of 2013 USDA-ARS Headquarters Research Associate Award to JAC. This research was supported in part by an appointment to the Agricultural Research Service (ARS) Research Participation Program administered by the Oak Ridge Institute for Science and Education (ORISE) through an interagency agreement between the U.S. Department of Energy (DOE) and the U.S. Department of Agriculture. ORISE is managed by ORAU under DOE contract number DE-AC05-06OR23100. Declaration of Competing Interest None 9

Fungal Genetics and Biology 131 (2019) 103246

M. Malapi-Wight, et al.

Acknowledgements

Cuomo, C.A., Güldener, U., Xu, J.R., Trail, F., Turgeon, B.G., Di Pietro, A., Walton, J.D., Ma, L.J., Baker, S.E., Rep, M., Adam, G., Antoniw, J., Baldwin, T., Calvo, S., Chang, Y.L., Decaprio, D., Gale, L.R., Gnerre, S., Goswami, R.S., Hammond-Kosack, K., Harris, L.J., Hilburn, K., Kennell, J.C., Kroken, S., Magnuson, J.K., Mannhaupt, G., Mauceli, E., Mewes, H.W., Mitterbauer, R., Muehlbauer, G., Münsterkötter, M., Nelson, D., O'Donnell, K., Ouellet, T., Qi, W., Quesneville, H., Roncero, M.I., Seong, K.Y., Tetko, I.V., Urban, M., Waalwijk, C., Ward, T.J., Yao, J., Birren, B.W., Kistler, H.C., 2007. The Fusarium graminearum genome reveals a link between localized polymorphism and pathogen specialization. Science 317, 1400–1402. Cuomo, C.A., Untereiner, W.A., Ma, L.J., Grabherr, M., Birren, B.W., 2015. Draft genome sequence of the cellulolytic fungus Chaetomium globosum. Genome Announc. 3, e00021–e115. Dean, R.A., Talbot, N.J., Ebbole, D.J., Farman, M.L., Mitchell, T.K., Orbach, M.J., Thon, M., Kulkarni, R., Xu, J.R., Pan, H., Read, N.D., Lee, Y.H., Carbone, I., Brown, D., Oh, Y.Y., Donofrio, N., Jeong, J.S., Soanes, D.M., Djonovic, S., Kolomiets, E., Rehmeyer, C., Li, W., Harding, M., Kim, S., Lebrun, M.H., Bohnert, H., Coughlan, S., Butler, J., Calvo, S., Ma, L.J., Nicol, R., Purcell, S., Nusbaum, C., Galagan, J.E., Birren, B.W., 2005. The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 434, 980–986. Debuchy, R., Turgeon, B.G., 2006. Mating-type structure, evolution, and function in euascomycetes. In: The Mycota I. Springer-Verlag, Berlin, pp. 293–323. de Jonge, R., van Esse, H.P., Maruthachalam, K., Bolton, M.D., Santhanam, P., Saber, M.K., Zhang, Z., Usami, T., Lievens, B., Subbarao, K.V., Thomma, B.P., 2012. Tomato immune receptor Ve1 recognizes effector of multiple fungal pathogens uncovered by genome and RNA sequencing. Proc. Nat. Acad Sci. USA 109, 5110–5115. Dettman, J.R., Anderson, J.B., Kohn, L.M., 2008. Divergent adaptation promotes reproductive isolation among experimental populations of the filamentous fungus Neurospora. BMC Evol. Biol. 8, 35. Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucl. Acids Res. 32, 1792–1797. English, A.C., Richards, S., Han, Y., Wang, M., Vee, V., Qu, J., Qin, X., Muzny, D.M., Reid, J.G., Worley, K.C., Gibbs, R.A., 2012. Mind the gap: upgrading genomes with Pacific Biosciences RS long-read sequencing technology. PLoS One 7, e47768. Farrer, R.A., Weinert, L.A., Bielby, J., Garner, T.W.J., Balloux, F., Clare, F., Bosch, J., Cunnigham, A.A., Weldon, C., du Preez, L.H., Anderson, L., Pond, S.L., Shahar-Golan, R., Henk, D.A., Fisher, M.A., 2011. Multiple emergences of genetically diverse amphibian-infecting chytrids include a globalized hypervirulent recombinant lineage. Proc. Natl. Acad. Sci. USA 108, 18732–18736. Flutre, T., Duprat, E., Feuillet, C., Quesneville, H., 2011. Considering transposable element diversification in de novo annotation approaches. PLoS One 6, e16526. Galagan, J.E., Calvo, S.E., Borkovich, K.A., Selker, E.U., Read, N.D., Jaffe, D., FitzHugh, W., Ma, L.J., Smirnov, S., Purcell, S., Rehman, B., Elkins, T., Engels, R., Wang, S., Nielsen, C.B., Butler, J., Endrizzi, M., Qui, D., Ianakiev, P., Bell-Pedersen, D., Nelson, M.A., Werner-Washburne, M., Selitrennikoff, C.P., Kinsey, J.A., Braun, E.L., Zelter, A., Schulte, U., Kothe, G.O., Jedd, G., Mewes, W., Staben, C., Marcotte, E., Greenberg, D., Roy, A., Foley, K., Naylor, J., Stange-Thomann, N., Barrett, R., Gnerre, S., Kamal, M., Kamvysselis, M., Mauceli, E., Bielke, C., Rudd, S., Frishman, D., Krystofova, S., Rasmussen, C., Metzenberg, R.L., Perkins, D.D., Kroken, S., Cogoni, C., Macino, G., Catcheside, D., Li, W., Pratt, R.J., Osmani, S.A., DeSouza, C.P., Glass, L., Orbach, M.J., Berglund, J.A., Voelker, R., Yarden, O., Plamann, M., Seiler, S., Dunlap, J., Radford, A., Aramayo, R., Natvig, D.O., Alex, L.A., Mannhaupt, G., Ebbole, D.J., Freitag, M., Paulsen, I., Sachs, M.S., Lander, E.S., Nusbaum, C., Birren, B., 2003. The genome sequence of the filamentous fungus Neurospora crassa. Nature 422, 859–868. Galagan, J.E., Calvo, S.E., Cuomo, C., Ma, L.J., Wortman, J.R., Batzoglou, S., Lee, S.I., Basturkmen, M., Spevak, C.C., Clutterbuck, J., Kapitonov, V., Jurka, J., Scazzocchio, C., Farman, M., Butler, J., Purcell, S., Harris, S., Braus, G.H., Draht, O., Busch, S., D'Enfert, C., Bouchier, C., Goldman, G.H., Bell-Pedersen, D., Griffiths-Jones, S., Doonan, J.H., Yu, J., Vienken, K., Pain, A., Freitag, M., Selker, E.U., Archer, D.B., Penalva, M.A., Oakley, B.R., Momany, M., Tanaka, T., Kumagai, T., Asai, K., Machida, M., Nierman, W.C., Denning, D.W., Caddick, M., Hynes, M., Paoletti, M., Fischer, R., Miller, B., Dyer, P., Sachs, M.S., Osmani, S.A., Birren, B.W., 2005. Sequencing of Aspergillus nidulans and comparative analysis with A. fumigatus and A. oryzae. Nature 438, 1105–1115. Ganci, M.L., 2014. Investigation of host resistance in Buxus species to the fungal plant pathogen Calonectria pseudonaviculata (=Cylindrocladium buxicola), the causal agent of boxwood blight and determination of overwinter pathogen survival. M.S. thesis, North Carolina State University, Raleigh, 137pp. Gehesquière, B., D'Haeyer, S., Pham, K.T.K., Van Kuik, A.J., Maes, M., Gobin, B., Höfte, M., Heungens, K., 2013. qPCR assays for the detection of Cylindrocladium buxicola in plant, water, and air samples. Plant Dis. 97, 1082–1090. Gehesquière, B., Crouch, J.A., Marra, R.E., Van Poucke, K., Rys, F., Maes, M., Gobin, B., Höfte, M., Heungens, K., 2016. Characterization and taxonomic re-assessment of the box blight pathogen Calonectria pseudonaviculata, introducing Calonectria henricotiae sp. nov. Plant Pathol. 65, 37–52. Giraud, T., Refregier, G., Le Gac, M., de Vienne, D.M., Hood, M.E., 2008. Speciation in fungi. Fung. Genet. Biol. 45, 791–802. Glass, N.L., Smith, M.L., 1994. Structure and function of a mating-type gene from the homothallic species Neurospora Africana. Mol. Gen. Genet. 244, 401–409. Gnerre, S., Maccallum, I., Przybylski, D., Ribeiro, F.J., Burton, J.N., Walker, B.J., Sharpe, T., Hall, G., Shea, T.P., Sykes, S., Aird, D., Costello, M., Daza, R., Williams, L., Nicol, R., Gnirke, A., Nusbaum, C., Lander, E.S., Jaffe, D.B., 2011. High-quality draft assemblies of mammalian genomes from massively parallel sequence data. Proc. Nat. Acad Sci. USA 108, 1513–1518. Grünwald, N.J., McDonald, B.A., Milgroom, M.G., 2016. Population Genomics of Fungal and Oomycete Pathogens. Annu. Rev. Phytopathol. 54, 323–346. Hane, J.K., Lowe, R.G., Solomon, P.S., Tan, K.C., Schoch, C.L., Spatafora, J.W., Crous,

We thank Cristi Palmer of the IR4 Project and Greg Parra of USDAAPHIS-PPQ for leadership, collaboration and ongoing partnerships in boxwood blight research, and AmericanHort and Jill Calabro for their ongoing support of these projects. We are indebted to M. Daughtrey, S. Douglas, K. Ivors, R. Marra, U. Brielmaier-Liebetanz, T. Cech, H.T. Dogmus, R. Engesser, J.R. Fisher, M. Ganci, P. Gannibal, B. Henricot, M. Heupel, W. Ho, T. Hollinger, T. Hsiang, S. Inghelbrecht, K. Ivors, A. Van Kuik, M. Mirabolfathy, A. Pérez Sierra, K. Rosendahl-Peeters, M. Saracchi, C. Saurat, M. Vincent, S. Werres and M. Zerjav for providing many of the cultures used in this study; and R. Buckley, M. Daughtery, N. Gregory, K. Rane, and S. Tirpak for providing infected boxwood plants used to isolate fungi. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture (USDA). USDA is an equal opportunity provider and employer. Appendix A. Supplementary material Supplementary data to this article can be found online at https:// doi.org/10.1016/j.fgb.2019.103246. References Amselem, J., Cuomo, C.A., van Kan, J.A.L., Viaud, M., Benito, E.P., Couloux, A., Coutinho, P.M., de Vries, R.P., Dyer, P.S., Fillinger, S., Fournier, E., Gout, L., Hahn, M., Kohn, L., Lapalu, N., Plummer, K.M., Pradier, J.M., Quévillon, E., Sharon, A., Simon, A., ten Have, A., Tudzynski, B., Tudzynski, P., Wincker, P., Andrew, M., Anthouard, V., Beever, R.E., Beffa, R., Benoit, I., Bouzid, O., Brault, B., Chen, Z., Choquer, M., Collémare, J., Cotton, P., Danchin, E.G., Da Silva, C., Gautier, A., Giraud, C., Gonzlez, C., Grossetet, S., Güldener, U., Henrissat, B., Howlett, B.J., Kodira, C., Kretschmer, M., Lappartient, A., Leroch, M., Levis, C., Mauceli, E., Nevéglise, C., Oeser, B., Pearson, M., Poulain, J., Poussereau, N., Quesneville, H., Rascle, C., Schumacher, J., Séguren, B., Sexton, A., Silva, E., Sirven, C., Soanes, D.M., Talbot, N.J., Templeton, M., Yandava, C., Yarden, O., Zeng, Q., Rollins, J.A., Lebrun, M.H., Dickman, M., 2011. Genomic analysis of the necrotrophic fungal pathogens Sclerotinia sclerotiorum and Botrytis cinerea. PLoS Genet. 7, e1002230. Anisimova, M., Bielawski, J.P., Yang, Z., 2002. Accuracy and power of Bayesian prediction of amino acid sites under positive selection. Mol. Biol. Evol. 19, 950–958. Arnaud, M.B., Cerqueira, G.C., Inglis, D.O., Skrzypek, M.S., Binkley, J., Chibucos, M.C., Crabtree, J., Howarth, C., Orvis, J., Shah, P., Wymore, F., Binkley, G., Miyasato, S.R., Simison, M., Sherlock, G., Wortman, J.R., 2012. The Aspergillus Genome Database (AspGD): recent developments in comprehensive multispecies curation, comparative genomics and community resources. Nucl. Acids Res. 40, D653–D659. Bailey, T.L., Boden, M., Buske, F.A., Frith, M., Grant, C.E., Clementi, L., Ren, J., Li, W.W., Noble, W.S., 2009. MEME Suite: tools for motif discovery and searching. Nucl. Acids Res. 37, W202–W208. Brasier, C.M., Cooke, D.E.L., Duncan, J.M., 1999. Origin of a new Phytophthora pathogen through interspecific hybridization. Proc. Natl. Acad. Sci. USA 96, 587–5883. Brasier, C.M., Kirk, S.A., 2010. Rapid emergence of hybrids between the two subspecies of Ophiostoma novo-ulmi with a high level of pathogenic fitness. Plant Pathol. 59, 186–199. Chitrampalam, P., Inderbitzin, P., Maruthachalam, K., Wu, B.-M., Subbarao, K.V., 2013. The Sclerotinia sclerotiorum mating type locus (MAT) contains a 3.6-kb region that is inverted in every meiotic generation. PLoS One 8, e56895. Clark, N.L., Aagaard, J.E., Swanson, W.J., 2006. Evolution of reproductive proteins from animals and plants. Reproduction 131, 11–22. Coleman, J.J., Rounsley, S.D., Rodriguez-Carres, M., Kuo, A., Wasmann, C.C., Grimwood, J., Schmutz, J., Taga, M., White, G.J., Zhou, S., Schwartz, D.C., Freitag, M., Ma, L.J., Danchin, E.G., Henrissat, B., Coutinho, P.M., Nelson, D.R., Straney, D., Napoli, C.A., Barker, B.M., Gribskov, M., Rep, M., Kroken, S., Molnar, I., Rensing, C., Kennell, J.C., Zamora, J., Farman, M.L., Selker, E.U., Salamov, A., Shapiro, H., Pangilinan, J., Lindquist, E., Lamers, C., Grigoriev, I.V., Geiser, D.M., Covert, S.F., Temporini, E., Vanetten, H.D., 2009. The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene expansion. PLoS Genet. 5, e1000618. Conesa, A., Götz, S., Garcia-Gómez, J., Terol, M.J., Talón, M., Robles, M., 2005. Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 21, 3674–3676. Coppin, E., Debuchy, R., Arnaise, S., Picard, M., 1997. Mating types and sexual development in filamentous ascomycetes. Microbiol. Mol. Biol. Rev. 61, 411–428. Crouch, J.A., Malapi-Wight, M., Rivera, Y., Salgado-Salazar, C., Veltri, D., 2017. Genome datasets for Calonectria henricotiae and C. pseudonaviculata causing boxwood blight disease and related fungal species. Ag Data Commons. Crous, P.W., Groenewald, J.Z., Hill, C.F., 2002. Cylindrocladium pseudonaviculatum sp. nov. from New Zealand, and new Cylindrocladium records from Vietnam. Sydowia 54, 23–34.

10

Fungal Genetics and Biology 131 (2019) 103246

M. Malapi-Wight, et al. P.W., Kodira, C., Birren, B.W., Galagan, J.E., Torriani, S.F., McDonald, B.A., Oliver, R.P., 2007. Dothideomycete plant interactions illuminated by genome sequencing and EST analysis of the wheat pathogen Stagonospora nodorum. Plant Cell 19, 3347–3368. Hedges, S.B., Marin, J., Suleski, M., Paymer, M., Kumar, S., 2015. Tree of life reveals clock-like speciation and diversification. Mol. Biol. Evol. 32, 835–845. Henricot, B., Culham, A., 2002. Cylindrocladium buxicola, a new species affecting Buxus spp., and its phylogenetic status. Mycologia 94, 980–997. Ivors, K.L., Lacey, L.W., Milks, D.C., Douglas, S.M., Inman, M.K., Marra, R.E., LaMondia, J.A., 2012. First report of boxwood blight caused by Cylindrocladium pseudonaviculatum in the United States. Plant Dis. 96, 1070. Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 30, 772–780. Klosterman, S.J., Subbarao, K.V., Kang, S., Veronese, P., Gold, S.E., Thomma, B.P., Chen, Z., Henrissat, B., Lee, Y.H., Park, J., Garcia-Pedrajas, M.D., Barbara, D.J., Anchieta, A., de Jonge, R., Santhanam, P., Maruthachalam, K., Atallah, Z., Amyotte, S.G., Paz, Z., Inderbitzin, P., Hayes, R.J., Heiman, D.I., Young, S., Zeng, Q., Engels, R., Galagan, J., Cuomo, C.A., Dobinson, K.F., Ma, L.J., 2011. Comparative genomics yields insights into niche adaptation of plant vascular wilt pathogens. PLoS Pathog. 7, e1002137. Koike, H., Aerts, A., LaButti, K., Grigoriev, I.V., Baker, S.E., 2013. Comparative genomics analysis of Trichoderma reesei strains. Ind. Biotechnol. 9, 352–367. Kong, P.T., Hong, C.X., 2018. Host responses and impact on the boxwood blight pathogen, Calonectria pseudonaviculata. Planta. https://doi.org/10.1007/s00425-018-3041-4. Kong, P.T., Likins, M., Hong, C.X., 2017a. First report of Pachysandra terminalis leaf spot by Calonectria pseudonaviculata in Virginia. Plant Dis. 101, 509. Kong, P.T., Likins, M., Hong, C.X., 2017b. First report of blight of Sarcococca hookeriana var. humilis by Calonectria pseudonaviculata in Virginia. Plant Dis. 101, 247. Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. LaMondia, J.A., Li, D.W., Marra, R.E., Douglas, S.M., 2012. First report of Cylindrocladium pseudonaviculatum causing leaf spot of Pachysandra terminalis. Plant Dis. 96, 1069. LaMondia, J.A., Li, D.W., 2013. First report of Cylindrocladium pseudonaviculatum causing leaf spot and stem blight of Pachysandra procumbens. Plant. Health Prog. https://doi. org/10.1094/PHP-2013-0226-01-BR. LeBlanc, N., Gehesquière, B., Salgado-Salazar, C., Heungens, K., Crouch, J.A., 2019. SSRs identify limited genetic diversity across pathogen populations responsible for the global emergence of boxwood blight. Plant Pathol. 68, 861–868. LeBlanc, N., Salgado-Salazar, C., Crouch, J.A., 2018. Boxwood blight: an ongoing threat to ornamental and native boxwood. Appl. Microbiol. Biotechnol. 102, 4371–4380. Lee, S.Q., Gascuel, O., 2008. An improved general amino acid replacement matrix. Mol. Biol. Evol. 25, 1307–1320. Linderman, R.G., 1974. Ascospore discharge from perithecia of Calonectria theae, C. crotalariae, and Calonectria kyotensis. Phytopathology 64, 567–569. Lombard, L., Crous, P.W., Wingfield, B.D., Wingfield, M.J., 2010a. Phylogeny and systematics of the genus Calonectria. Stud. Mycol. 66, 31–69. Lombard, L., Crous, P.W., Wingfield, B.D., Wingfield, M.J., 2010b. Species concepts in Calonectria (Cylindrocladium). Stud. Mycol. 66, 1–13. Ma, L.J., van der Does, H.C., Borkovich, K.A., Coleman, J.J., Daboussi, M.J., Di Pietro, A., Dufresne, M., Freitag, M., Grabherr, M., Henrissat, B., Houterman, P.M., Kang, S., Shim, W.B., Woloshuk, C., Xie, X., Xu, J.R., Antoniw, J., Baker, S.E., Bluhm, B.H., Breakspear, A., Brown, D.W., Butchko, R.A., Chapman, S., Coulson, R., Coutinho, P.M., Danchin, E.G., Diener, A., Gale, L.R., Gardiner, D.M., Goff, S., HammondKosack, K.E., Hilburn, K., Hua-Van, A., Jonkers, W., Kazan, K., Kodira, C.D., Koehrsen, M., Kumar, L., Lee, Y.H., Li, L., Manners, J.M., Miranda-Saavedra, D., Mukherjee, M., Park, G., Park, J., Park, S.Y., Proctor, R.H., Regev, A., Ruiz-Roldan, M.C., Sain, D., Sakthikumar, S., Sykes, S., Schwartz, D.C., Turgeon, B.G., Wapinski, I., Yoder, O., Young, S., Zeng, Q., Zhou, S., Galagan, J., Cuomo, C.A., Kistler, H.C., Rep, M., 2010. Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature 464, 367–373. Malapi-Wight, M., Hébert, J.B., Buckley, R., Daughtrey, M.L., Gregory, N.F., Rane, K., Tirpak, S., Crouch, J.A., 2014. First report of boxwood blight caused by Calonectria pseudonaviculata in Delaware, Maryland, New Jersey, and New York. Plant Dis. 98, 698. Malapi-Wight, M., Salgado-Salazar, C., Demers, J.E., Veltri, D., Crouch, J.A., 2015. Draft genome sequence of Dactylonectria macrodidyma, a plant pathogenic fungus in the Nectriaceae. Genome Announc. 3, e00278–e315. Malapi-Wight, M., Demers, J.E., Veltri, D., Marra, R.E., Crouch, J.A., 2016a. LAMP detection assays for boxwood blight pathogens: a comparative genomics approach. Sci. Rep. 6, 26140. Malapi-Wight, M., Salgado-Salazar, C., Demers, J.E., Clement, D.E., Rane, K., Crouch, J.A., 2016b. Sarcococca blight: Use of whole genome sequencing as a strategy for fungal disease diagnosis. Plant Dis. 100, 1093–1100. Manning, V.A., Pandelova, I., Dhillon, B., Wilhelm, L.J., Goodwin, S.B., Berlin, A.M., Figueroa, M., Freitag, M., Hane, J.K., Henrissat, B., Holman, W.H., Kodira, C.D., Martin, J., Oliver, R.P., Robbertse, B., Schackwitz, W., Schwartz, D.D., Spatafora, J. W., Turgeon, B.G., Yandava, C., Young, S., Zhou, S., Zeng, Q., Grigoriev, I.V., Ma, L.J., Ciufetti, L.M., 2013. Comparative genomics of a plant-pathogenic fungus, Pyrenophora tritici-repentis, reveals transduplication and the impact of repeat elements on pathogenicity and population divergence, G3. 3, pp. 41–63. Marra, R.E., Milgroom, M.G., 2001. The mating system of the fungus Cryphonectria parasitica: selfing and self-incompatibility. Heredity 86, 134–143. Martinez, D., Berka, R.M., Henrissat, B., Saloheimo, M., Arvas, M., Baker, S.E., Chapman, J., Chertkov, O., Coutinho, P.M., Cullen, D., Danchin, E.G., Grigoriev, I.V., Harris, P., Jackson, M., Kubicek, C.P., Han, C.S., Ho, I., Larrondo, L.F., de Leon, A.L., Magnuson, J.K., Merino, S., Misra, M., Nelson, B., Putnam, N., Robbertse, B., Salamov, A.A., Schmoll, M., Terry, A., Thayer, N., Westerholm-Parvinen, A., Schoch, C.L., Yao, J., Barabote, R., Nelson, M.A., Detter, C., Bruce, D., Kuske, C.R., Xie, G., Richardson, P.,

Rokhsar, D.S., Lucas, S.M., Rubin, E.M., Dunn-Coleman, N., Ward, M., Brettin, T.S., 2008. Genome sequencing and analysis of the biomass-degrading fungus Trichoderma reesei (syn. Hypocrea jecorina). Nat. Biotechnol. 26, 553–560. McDonald, B.A., Linde, C., 2002. Pathogen population genetics, evolutionary potential, and durable resistance. Annu. Rev. Phytopathol. 40, 349–379. McGaugh, S.E., Noor, M.A.F., 2012. Genomic impacts of chromosomal inversions in parapatric Drosophila species. Philos. Trans. R. Soc. Lond. Biol. Sci. 367, 422–429. Mello, B., 2018. Estimating timetrees with MEGA and the TimeTree resource. Mol. Biol. Evol. 35, 2334–2342. Metzenberg, R.L., Glass, N.L., 1990. Mating type and mating strategies in Neurospora. Bioessays 12, 3–59. Miller, M.E., Shiskoff, N., Cubeta, M.A., 2018. Thermal sensitivity of Calonectria henricotiae and Calonectria pseudonaviculata conidia and microsclerotia. Mycologia 110, 546–558. Muszewska, A., Hoffman-Sommer, M., Grynberg, M., 2011. LTR retrotransposons in fungi. PLoS One 6, e29425. Nierman, W.C., Pain, A., Anderson, M.J., Wortman, J.R., Kim, H.S., Arroyo, J., Berriman, M., Abe, K., Archer, D.B., Bermejo, C., Bennett, J., Bowyer, P., Chen, D., Collins, M., Coulsen, R., Davies, R., Dyer, P.S., Farman, M., Fedorova, N., Fedorova, N., Feldblyum, T.V., Fischer, R., Fosker, N., Fraser, A., Garcia, J.L., Garcia, M.J., Goble, A., Goldman, G.H., Gomi, K., Griffith-Jones, S., Gwilliam, R., Haas, B., Haas, H., Harris, D., Horiuchi, H., Huang, J., Humphray, S., Jimenez, J., Keller, N., Khouri, H., Kitamoto, K., Kobayashi, T., Konzack, S., Kulkarni, R., Kumagai, T., Lafon, A., Latge, J.P., Li, W., Lord, A., Lu, C., Majoros, W.H., May, G.S., Miller, B.L., Mohamoud, Y., Molina, M., Monod, M., Mouyna, I., Mulligan, S., Murphy, L., O'Neil, S., Paulsen, I., Penalva, M.A., Pertea, M., Price, C., Pritchard, B.L., Quail, M.A., Rabbinowitsch, E., Rawlins, N., Rajandream, M.A., Reichard, U., Renauld, H., Robson, G.D., Rodriguez de Cordoba, S., Rodriguez-Pena, J.M., Ronning, C.M., Rutter, S., Salzberg, S.L., Sanchez, M., Sanchez-Ferrero, J.C., Saunders, D., Seeger, K., Squares, R., Squares, S., Takeuchi, M., Tekaia, F., Turner, G., Vazquez de Aldana, C.R., Weidman, J., White, O., Woodward, J., Yu, J.H., Fraser, C., Galagan, J.E., Asai, K., Machida, M., Hall, N., Barrell, B., Denning, D.W., 2005. Genomic sequence of the pathogenic and allergenic filamentous fungus Aspergillus fumigatus. Nature 438, 1151–1156. Ni, M., Feretzaki, M., Sun, S., Wang, X.Y., Heitman, J., 2011. Sex in fungi. Annu. Rev. Genet. 45, 405–430. Noor, M.A.F., Grams, K.L., Bertucci, L.A., Reiland, J., 2001. Chromosomal inversions and the reproductive isolation of species. Proc. Natl. Acad. Sci. USA 98, 12084–12088. Nygren, K., Strandberg, R., Gioti, A., Karlsson, M., Johannesson, H., 2012. Deciphering the relationship between mating system and the molecular evolution of the pheromone and receptor genes in Neurospora. Mol. Biol. Evol. 29, 3827–3842. O’Connell, J., Schulz-Trueglaff, O., Calrson, E., Hims, M.M., Gormley, N.A., Cox, A.J., 2015. NxTrim: optimized trimming of Illumina mate-pair reads. Bioinformatics 31, 2035–2037. O’Connell, R.J., Thon, M.R., Hacquard, S., van Themaat, E., Amyotte, S., Kleeman, J., Torres-Quintero, M., Damm, U., Buiate, E., Epstein, L., Alkan, N., Altmuller, J., Alvarado-Balderrama, L., Bauser, C., Becker, C., Birren, B., Chen, Z., Crouch, J.A., Duvick, J., Farman, M., Gan, P., Heiman, D., Henrissat, B., Howard, R., Kabbage, M., Koch, C., Kubo, Y., Law, A., Lebrun, M.-H., Lee, Y., Miyara, I., Moore, N., Neumann, U., Pannaccione, D., Panstruga, R., Place, M., Proctor, R., Prusky, D., Rech, G., Reinhardt, R., Rollins, J., Rounsley, S., Schardl, C., Schwartz, D., Shenoy, N., Shirasu, K., Stuber, K., Sukno, S., Sweigard, J., Takano, Y., Takahara, H., van der Does, H., Voll, L., Will, I., Young, S., Zeng, Q., Zhang, J., Zhou, S., Dickman, M., Schulze-Lefert, P., Ma, L., Vaillancourt, L., 2012. Life-style transitions in plant pathogenic Colletotrichum fungi defined by genome and transcriptome analyses. Nat. Genet. 44, 1060–1065. Ohm, R.A., Feau, N., Henrissat, B., Schoch, C.L., Horwitz, B.A., Barry, K.W., Condon, B.J., Copeland, A.C., Dhillon, B., Glaser, F., Hesse, C.N., Kosti, I., LaButti, K., Lindquist, E.A., Lucas, S., Salamov, A.A., Bradshaw, R.E., Ciuffetti, L., Hamelin, R.C., Kema, G.H., Lawrence, C., Scott, J.A., Spatafora, J.W., Turgeon, B.G., de Wit, P.J., Zhong, S., Goodwin, S.B., Grigoriev, I.V., 2012. Diverse lifestyles and strategies of plant pathogenesis encoded in the genomes of eighteen Dothideomycetes fungi. PLoS Pathog. 8, e1003037. Poggeler, S., 1999. Phylogenetic relationships between mating-type sequences from homothallic and heterothallic ascomycetes. Curr. Genet. 36, 222–231. Price, M.N., Dehal, P.S., Arkin, A.P., 2010. FastTree 2 – approximately maximum-likelihood trees for large alignments. PLoS ONE 5, e9490. Rieseberg, L.H., 2001. Chromosomal rearrangements and speciation. Trends Ecol. Evol. 16, 351–358. Rivera, Y., Salgado-Salazar, C., Veltri, D., Malapi-Wight, M., Crouch, J.A., 2018. Genome analysis of the ubiquitous boxwood pathogen Pseudonectria foliicola. PeerJ 6, e5401. Roach, K.C., Feretzaki, M., Sun, S., Heitman, J., 2014. Unisexual reproduction. Adv. Genet. 85, 255–305. Roach, K.C., Heitman, J., 2014. Unisexual reproduction reverse Mullers’ rachet. Genetics 198, 1059–1069. Roper, M., Seminara, A., Bandi, M.M., Cobb, A., Dillard, H.R., Pringle, A., 2010. Dispersal of fungal spores on a cooperatively generated wind. Proc. Natl. Acad. Sci. USA 107, 17474–17479. Schardl, C.L., Craven, K.D., 2003. Interspecific hybridization in plant-associated fungi and oomycetes: a review. Mol. Ecol. 12, 2861–2873. Shiu, P.K.T., Glass, N.L., 2000. Cell and nuclear recognition mechanisms mediated by mating type in filamentous ascomycetes. Curr. Opin. Microbiol. 3, 183–188. Shiu, P.K.T., Raju, N.B., Zickler, D., Metzenberg, R.L., 2001. Meiotic silencing by unpaired DNA. Cell 107, 905–916. Shishkoff, N., 2016. Survival of microsclerotia of Calonectria pseudonaviculata and C. henricotiae exposed to sanitizers. Plant Health Progr. 17, 13–17. Sievers, F., Wilm, A., Dineen, D., Gibson, T.J., Karplus, K., Li, W., Lopez, R., McWilliam,

11

Fungal Genetics and Biology 131 (2019) 103246

M. Malapi-Wight, et al. H., Remmer, M., Söding, J., Thompson, J.D., Higgins, D.G., 2011. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 7, 539. Stamatakis, A., 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688–2690. Stukenbrock, E.H., 2013. Evolution, selection and isolation: a genomic view of speciation in fungal plant pathogens. New Phytol. 199, 895–907. Swanson, W.J., Vacquier, V.D., 2002. The rapid evolution of reproductive proteins. Nat. Rev. Genet. 3, 137–144. Talavera, G., Castresana, J., 2007. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol. 56, 564–577. Tamura, K., Battistuzzi, F.U., Billing-Ross, P., Murillo, O., Filipski, A., Kumar, S., 2012. Estimating divergence times in large molecular phylogenies. Proc. Nat. Acad. Sci. USA 109, 19333–19338. Trail, F., 2007. Fungal cannons: explosive spore discharge in the Ascomycota. FEMS Microbiol. Lett. 276, 12–18. Turner, E., Jacobson, D.J., Taylor, J.W., 2011. Genetic architecture of a reinforced, postmating, reproductive isolation barrier between Neurospora species indicates evolution via natural selection. PLoS Genet. 7, e1002204. Veltri, D., Malapi-Wight, M., Crouch, J.A., 2016. SimpleSynteny: a web-based tool for visualization of microsynteny across multiple species. Nucl. Acids Res. 44, W41–W45. Vitale, A., Polizzi, G., 2007. First record of the perfect stage Calonectria pauciramosa on mastic tree in Italy. Plant Dis. 91, 328. Walker, B.J., Abeel, T., Shea, T., Priest, M., Abouelliel, A., Sakthikumat, S., Cuomo, C.A.,

Zeng, Q., Wortman, J., Young, S.K., Earl, A.M., 2014. Pilon: an integrated tool for comprehensive microbial variant detection and genome assembly improvement. PLoS One 19, e112963. Wicker, T., Sabot, F., Hua-Van, A., Bennetzen, J.L., Capy, P., Chalhoub, B., Flavell, A., Leroy, P., Morgante, M., Panaue, O., Paux, E., SanMiguel, P., Schulman, A.H., 2007. A unified classification system for eukaryotic transposable elements. Nat. Rev. Genet. 8, 973–982. Wik, L., Karlsson, M., Johannesson, H., 2008. The evolutionary trajectory of the matingtype (MAT) genes in Neurospora relates to reproductive behavior of taxa. BMC Evol. Biol. 8, 109. Wilson, A.M., Godlonton, T., van der Nest, M.A., Wilken, P.M., Wingfield, M.J., Wingfield, B.D., 2015. Unisexual reproduction in Huntiella moniliformis. Fung. Genet. Biol. 80, 1–9. Yafetto, L., Carroll, L., Cui, Y.L., Davis, D.J., Fischer, M.W.F., Henterly, A.C., Kessler, J.D., Kilroy, H.A., Shidler, J.L., Sugawara, Z., Money, N.P., 2008. The fastest flights in nature: high-speed spore discharge mechanisms among fungi. PLoS One 3, e3237. Yang, Z., 2007. PAML 4: phylogenetic analysis by maximum likelihood. Mol. Biol. Evol. 24, 1586–1591. Ye, X., Liu, H., Jin, Y., Guo, M., Huang, A., Chen, Q., Guo, W., Zhang, F., Feng, L., 2017. Transcriptomic analysis of Calonectria pseudoreteaudii during various stages of Eucalyptus infection. PloS One 12, e0169598. Yun, S.H., Arie, T., Kaneko, I., Yoder, O.C., Turgeon, B.G., 2000. Molecular organization of mating type loci in heterothallic, homothallic, and asexual Gibberella/Fusarium species. Fung. Genet. Biol. 31, 7–20.

12