Global transcriptional analysis of model of persistent FMDV infection reveals critical role of host cells in persistence

Veterinary Microbiology 162 (2013) 321–329

Contents lists available at SciVerse ScienceDirect

Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic

Global transcriptional analysis of model of persistent FMDV infection reveals critical role of host cells in persistence Hu Zhang, Yong Li, Xuan Huang, Congyi Zheng * State Key Lab of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, China

A R T I C L E I N F O

A B S T R A C T

Article history: Received 28 June 2012 Received in revised form 1 September 2012 Accepted 5 September 2012

With the aid of ammonium chloride, we established a model for persistent foot-andmouth disease virus (FMDV) infection of BHK-21 cells (Huang et al., 2011). Distinctive to a previously established model, the persistently infected cell line acquired new features including more rounded morphology, resistance to wild type FMDV infection, consistent replication efficiency in late passages, etc. To elucidate the mechanism of establishment of persistence, we performed systematically microarray analysis of gene expression profiles of acute and persistent infections and real-time quantitative PCR validation of key genes. Our results showed 12 common genes were found to be up-regulated in acute infection while down-regulated in persistent infection. Gene expression analysis indicated differences in the KEGG pathway, revealing important roles of host factors in the maintenance of symbiotic environment. The results suggest that, in contrast to previous viral persistence system, the critical element in establishment of the persistence in our lab is the evolution of host cells which regulate genome transcription to defy the lytic effects of FMDV infection. ß 2012 Elsevier B.V. All rights reserved.

Keywords: FMDV Microarray Persistent infection Mechanism Host gene expression QRT-PCR

1. Introduction Foot-and-mouth disease is a highly contagious viral disease of cloven-hoofed livestock. Its causative agent, footand-mouth disease virus (FMDV), is a member of the Picornaviridae family and contains a single stranded positive-sense-strand RNA genome of about 8300 nucleotides (Boothroyd et al., 1981; Forss et al., 1984; Kurz et al., 1981). In domestic livestock, the disease tends to cause acute and short-lived infections, and the immune system often fails to clear virus, which can linger as a persistent infection in so-called ‘‘carrier’’ animals for up to 2 years and from which transmission is thought to be relatively rare (Cottam et al., 2006; Grubman and Baxt, 2004; Jackson et al., 2007). Persistently infected animals show only low-level excretion of FMDV from the pharynx of ruminants, for

* Corresponding author. Tel.: +86 027 68754001; fax: +86 027 68754833. E-mail address: [email protected] (C. Zheng). 0378-1135/$ – see front matter ß 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetmic.2012.09.007

periods that are species and virus lineage associated. Although transmission of FMDV from carrier animals to susceptible hosts under field conditions has so far been shown only for African buffaloes to cattle and impala (Klein, 2009), under experimental conditions, saliva obtained from carrier animals injected into cattle and pigs has caused infection (Bao et al., 2011). However, it remains to be elucidated the mechanism of FMDV persistent infection. To elucidate the mechanisms of persistent infection by foot-and-mouth disease virus, an in vitro model of persistent infection was needed. Early in 1985, cell lines persistently infected with foot-and-mouth disease virus have been established by growth of BHK-21 (c-13) or IBRS2 (c-26) that survived standard cytolytic infections with FMDV (de la Torre et al., 1985). Subsequent investigations indicated a co-evolution of virus and host cells was involved during persistence in vitro (de la Torre et al., 1988; Martin Hernandez et al., 1994). Thus, genetic features of both virus and host cells or organisms could attribute to the long-term survival of infected cells during viral persistence. Following the establishment of persistence,

322

H. Zhang et al. / Veterinary Microbiology 162 (2013) 321–329

and upon serial passage of the carrier cells, the resident FMDV became progressively more virulent for BHK-21 cells than its parental FMDV C-S8cl (Baranowski et al., 1998; Diez et al., 1990; Escarmis et al., 1992; MartinezSalas et al., 1993). The carrier cells, in turn, evolved to become increasingly resistant to FMDV but not to other RNA viruses, suggesting a coevolution of cells and their resident viruses (de la Torre et al., 1988, 1989). Previous model of persistence was established by growing the cells that survived a cytolytic infection. By using completely different approach, our lab established an in vitro model of the persistent infection with FMDV serotype O (FMDV O) in BHK-21 cells at the cellular level facilitated by ammonium chloride (Huang et al., 2011). The persistently infected cell line acquired new features including more rounded morphology, resistance to wild type FMDV infection, consistent replication efficiency in late passages, etc. Our results suggested that ammonium chloride exerted its primary effect on the host cell rather than the virus in the process of viral persistence establishment (Huang et al., 2011). Host cell mechanisms of adaption to the acidic environment prevented the lytic infection caused by FMDV and led to initiation of persistence. To investigate the underlying mechanism of the persistence of FMDV O infected BHK-21 established by our lab, we performed systematic functional genomics studies using microarray technology on differences in gene expression of BHK-21 during acute and persistent FMDV infections. We examined the expression patterns of about 41,000 unique human genes and transcripts probes, using a whole human genome oligo microarray. Our results indicated that gene expression pattern showed apparent differences in persistently infected cells from acutely infected cells. Pathway analysis mapped out unique biological progresses possibly used by persistent infection to assist establishment of persistence. Analysis of fold-change genes in acute and persistent infection suggested 12 key genes might be directly related to persistence. Overall our results revealed that in the model of persistence, host cells play a great role by regulating gene expression which may contribute to the maintaining of the symbiotic environment. 2. Materials and methods 2.1. Cells and viruses The virus strains of serotype O (Akesu/58/2002, GenBank accession no. AF511039) FMDV used in the present study were obtained from the Lanzhou Veterinary Research Institute, Chinese Academy of Agriculture Sciences. BHK-21 cells were provided by the China Center for Type Culture Collection (CCTCC). Persistently infected BHK-21 cells line (PI53) was provided by Doc. Huang. Cells were cultured in Minimum Essential Medium (MEM, GiBCO, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (GiBCO, USA) at 37 8C with 5% CO2. 2.2. Virus infection and RNA extraction Total RNA was extracted from acutely infected cells and persistently infected cells respectively. Cells were

harvested and the complete RNAs were extracted using Trizol reagent (Life Technologies, Carlsbad, USA) according to the manufacturer’s instructions. RNA was purified with RNasey Mini Kit (Qiagen p/n 74104) and treated with baseline-ZERO DNase (EPICENTRE, Cat. Nos. DB0711K). Its quality was monitored by agarose gel electrophoresis, and the quantity was determined spectrophotometrically (Ependorf). 2.3. Microarray hybridization 1 mg purified RNA was used as a template for cDNA preparation prior to hybridization to Agilent 4  44 K whole human genome arrays. The cDNA of normal BHK-21 was labeled with Cy3-dUTP as a reference control, while the cDNA of FMDV acutely infected and persistently infected BHK-21 were labeled with Cy5-dUTP using the Agilent low RNA input linear amplification kit, respectively. Hybridization was performed overnight at 65 8C to Agilent 4  44 K whole human genome arrays using Agilent Gene Expression Hybridization Kit (Agilent p/n 5188–5242). Arrays were washed and scanned using an Agilent scanner (Agilent Technologies, Santa Clara, CA). 2.4. Data analysis The hybridization slides were scanned and analyzed by Agilent Microarray Scanner (Agilent p/n G2565BA). Data were extracted by Agilent Feature Extraction (FE) software. Added the images (.tif) to be extracted to the FE Project. Then set FE Project Properties and checked the Extraction Set Configuration. After that saved the FE Project (.fep) and started extracting and exported data to txt. The microarrays were then normalized in Agilent Feature Extraction Software (mainly LOWESS normalization), and then genes marked present or marginal in all samples (‘‘All Targets Value’’) were chosen for further analysis. Differentially expressed genes were identified through fold-change screening. To identify genes with significantly altered expression levels for further analysis, cutoff values for expression level ratios 2.0 and 0.5 were used to filter genes with changes (n-fold) greater than 2.0 in two different infection methods, even though a 1.5-fold cutoff has recently been reported as biologically significant (Hughes et al., 2000; Smoot et al., 2001). 2.5. Real-time quantitative PCR (qPCR) Reverse transcription with 2 mg of total RNA, 1 mg of Oligo (dT) 15 primers, 4 ml 5 RT buffer, 2 ml 10 mM dNTP mix, 40 U RNasin (Takara) and 200 U Moloney murine leukemia virus reverse transcriptase (Promega) was performed firstly to obtain cDNA. Gene specific primers (Table 3) were designed both in the same extron or one strode over the next extron against the complete nucleotide sequence (Table 3), as deposited on GenBank, using the software of Primer Premier 5.0 (Primer, Canada) and Oligo 6.0 (MBI, Cascade, CO). Real-time quantitative PCR was performed using SYBR green dye (Invitrogen), Premix Taq (Promega) and primers designed above (Table 3). The amplification was performed in CFX96TM real-time PCR

H. Zhang et al. / Veterinary Microbiology 162 (2013) 321–329

detection system (BIO-RAD) using 40 cycles of a two-step PCR (15 s at 95 8C and 60 s at 60 8C) after an initial activation step (95 8C for 10 min). Melting curves from 60 8C to 90 8C were served to generate melting curves. Amplification of BHK-21 GAPDH mRNA as an endogenous control was used to standardize the amount of sample added to the reactions. For each amplification run, the calculated threshold cycle (Ct) for each gene amplicon was normalized to the Ct of the GAPDH gene amplified from the corresponding sample before the gene fold and relative changes were calculated as described (Livak and Schmittgen, 2001; Schmittgen et al., 2000). Serial dilutions of purified amplicons served to generate standard melting curve. 3. Results 3.1. PI57 (persistently infected BHK-21 after 57 passages) acquired resistance to FMDV infection To investigate the infectivity of residual virus in persistently infected PI57, BHK-21 was infected with lytic products of PI57 cells. Consistent with previous report (de la Torre et al., 1985), our result was that residual viruses in cells and supernatant were both infectious (data not shown). To figure out whether the cells in persistence were susceptible to wild type (WT) FMDV, PI57 and BHK-21 were incubated with the WT virus according to standard infection protocol. At 36 h post-infection (hpi), BHK-21 showed obvious cytopathic effect (CPE) while PI57 did not show any sign of CPE compared to the mock (Fig. 1). To further examine the details, we collected cell samples of PI57 and detected virus RNA (vRNA) number in both cells and supernatant. No matter PI57 were infected with FMDV at MOI of 3  106 or 3  107 (very high titers of virus induced

323

Table 1 Resistance of PI57 to the infection by WT FMDV. PI57 were incubated or mock incubated with WT FMDV at MOI of 3  106 and 3  107, and cell samples were collected at 36 hpi and 48 hpi respectively. cDNA of FMDV 3D sequence was prepared from three independent BHK-21 cultures and used in qRT-PCR experiments. The results (mean  S.D.) are the average of three determinations. vRNA copies/ml MOI 3  106 PI57 infected by FMDV PI57 Mock infected

MOI 3  107 8

(9.63  0.41)  10 (1.06  0.11)  109

(3.09  0.32)  109 (7.46  0.35)  109

rapid death of cells), the total copies of virus RNA of positive and mock did not show significant difference to each other (Table 1), indicating that WT virus could not cause largescale replication of progeny viruses in PI57 cells. Therefore, it can be concluded that cells in persistence could resist to normal lytic infection caused by WT FMDV. The cells in persistence acquired the ability to resist the infection of FMDV, while the resident virus in persistence was still infectious, implying that something must have changed in the host cells. We analyzed and compared the sequences of full cDNA clone of FMDV WT and PI48, and no significant mutations were found in structure proteins (Huang et al., 2011), which was distinctive to the previous studies (Diez et al., 1990; Escarmis et al., 1998). Therefore, further investigations were needed to identify the host cell proteins of factors pertaining to FMDV persistence in BHK21 cell. 3.2. Differences between acute and persistent infection in the results of microarray In this study we analyzed gene expression profiles upon FMDV acute and persistent infections of BHK-21. In acute

Fig. 1. Persistently infected PI57 is resistant to infection by WT FMDV. BHK-21 was infected with WT FMDV at MOI of 3  106, and PI57 were incubated with or without WT FMDV at the same MOI. At 36 hpi, BHK-21 showed significant CPE, while PI57 incubated with FMDV did not show significant morphological difference from PI57 incubated without virus.

324

H. Zhang et al. / Veterinary Microbiology 162 (2013) 321–329

Fig. 2. Analysis of differentially expressed genes between acute and persistent infections. ‘‘The absolute value of log2 ratio  1’’ was used as the threshold to judge the significance of gene expression difference. (A) Summary of the numbers of differentially expressed genes in the FMDV infected BHK-21 cells (acute and persistent respectively). Horizontal axis represents the ratio of gene expression of FMDV infected BHK-21 versus normal BHK-21. (B) Fold change distribution of differentially expressed genes.

infection, cells were infected with FMDV at MOI of 3  107 (lower titers of virus induced more stable response of infection). Samples collected at 48 hpi were used for microarray analysis because the cell monolayer did not show any sign of CPE until then. RNA extracted from mock infected cells served as a calibration for indirect comparison between acute and persistent infection. We analyzed the differentially expressed genes (DEGs) between the mock infected and the FMDV infected BHK-21 (acute and persistent respectively). In total, 1676 DEGs (fold changes 2, P value  0.05) were found with 827 upregulated and 849 genes down-regulated in acute infection BHK-21 versus normal BHK-21 (Fig. 2A). And in persistent infection, only 808 DEGs were found with 121 upregulated and 687 down-regulated (Fig. 2A). It seemed that in persistent infection, genes expression in host cells were more inclined to down-regulated, while in acute infection genes expression regulation distributed equally on both sides. The detected fold changes (log2 ratio) of gene expression ranged from 7.0 to 5.0, and more than 90% of the genes (1537 for acute infection and 758 for persistent infection) were up- or down-regulated between 1.0- and 2.0-fold for both acute and persistent infected BHK-21 cells (Fig. 2B). The most notable difference in distribution of fold changes (log2 ratio) is that the percentage distributes almost equally from 2.0 to 2.0 in acute infection, while the percentage in ‘‘2.0 to 1.0’’ is almost 10 times in ‘‘1.0 to 2.0’’ in persistent infection. 3.3. Pathway analysis for gene expression in acutely and persistently infected BHK-21 cells by FMDV These DEGs were uploaded to DAVID bioinformatics resources (Huang da et al., 2009b), and the resulting 1676 DEGs in acute infection BHK-21 and 808 DEGs in persistent BHK-21 were mapped to Kyoto Encyclopedia of Genes and

Genomes (KEGG) pathway maps provided by the website (Fig. 3). The parameter ‘‘count’’ threshold is 2 and the ‘‘EASE’’ is 0.1. Common pathways in both patterns of infection include ribosome, cancer related and glutathione metabolism. And cancer related pathway has the highest value of ‘‘% count in total’’ (Fig. 3). It is strongly related to FMDV infection in BHK-21. And the rest pathways in acute infection such as spliceosome, wnt signaling, base excision repair, lysosome and renal cell carcinoma (Fig. 3A) may be implicated in the virus replication, package and cytolysis. Pathways unique to persistent infection showed obvious difference from ones unique to acute infection. Regulation pathways such as GnRH signaling, gap junction and VEGF signaling, are implicated in cell proliferation and growth (Fig. 3B), which seem to help host cells to survive lytic infection. The different pathway analysis output between acute and persistent infected BHK-21 indicate a unique mechanism taken by the establishment of FMDV persistent infection. 3.4. Genes expression changed in both acute and persistent infections Of all the genes expression changed in FMDV infected cells versus mock infected cells, the ones involved in both acute and persistent infections with significantly expression changed genes were particularly interesting. 33 genes were found on the fold-change gene lists of both acute and persistent infections (Table 2). Among the 33 genes, 21 genes, which were both up-regulated and both downregulated ones, were related with FMDV infection no matter acute or persistent infection pattern. The rest 12 genes, up-regulated in acute infection while downregulated in persistent infection were key genes that help to depend which infection pattern, acute or persistent, taken by virus-host symbiotic system.

H. Zhang et al. / Veterinary Microbiology 162 (2013) 321–329

325

Fig. 3. The top KEGG pathways influenced by FMDV acute and persistent infection in BHK-21 cells. The top KEGG signaling pathways in BHK-21, determined by DAVID bioinformatics resources, that were significantly up-regulated or down-regulated by FMDV and acute persistent infection, are shown. The 1676 DEGs in acute and 808 DEGs in persistent infection BHK-21 cells were mapped to KEGG database. The significance P-values that determine the probability that the association between the genes in the dataset and the KEGG pathway is by chance alone were calculated by EASE Score, a new calculating formula modified from Fisher exact P-value (Huang da et al., 2009a,b), are expressed as ‘‘log (P-value)’’. For analysis, the parameter ‘‘count’’ threshold is 2 and the ‘‘EASE’’ is 0.1. (A) The top 8 pathways with enriched significantly changed genes in acute infection. (B) The top 15 pathways with enriched significantly changed genes in persistent infection. Gray columns: pathways influenced by FMDV infections. Black squares (% count in total): ratio of the number of DEGs the map to a specific KEGG pathway divided by total number of genes that make up that pathway.

3.5. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) To corroborate the results obtained with the microarray analysis, we performed qRT-PCR on a selected group of DEGs. Similar to the microarray analysis, we observed transcriptional regulation of APEX2, EBP, P4HA2, RPL34 and RPS23 (Table 4). As for the first three genes APEX2, EBP, and P4HA2, the fold changes tested by qRT-PCR, no matter in acute infection or in persistent infection, were almost consistent with the results in microarray. As for RPL34 and RPS23, although the results came out in persistent infection showed a little difference from the data in microarray, the fold induction values followed the same pattern in acute infection in both assays. And it can be concluded that APEX2, EBP, and P4HA2 play significant roles in the establishment of persistence. 4. Discussion Persistence of FMDV in cell culture (de la Torre et al., 1985) has been studied as a strong and reproducible model to understand virus–cell coevolution (de la Torre et al., 1989; Gebauer et al., 1988; Herrera et al., 2008; Martin Hernandez et al., 1994; Saiz and Domingo, 1996; Toja et al., 1999). Previous work focused on the genetic variation of

viruses and phenotypic heterogeneity of cells. Martin et al. pointed out that BHK-21 cells’ ability to vary genetically was the determinant element in initiating FMDV persistence (Martin Hernandez et al., 1994). However, in the model established in our lab, ammonium chloride exerted its primary effect on the host cell rather than the virus in the process of viral persistence establishment. In this study, using the newly developed technology microarray, we analyzed persistence at a global transcriptional level of the host cells with comparison with acute infection. Our results revealed critical role of gene expression of host cells in initiating FMDV persistence. Our lab has previously established a persistence of FMDV O in cell culture by the help of ammonium chloride (Huang et al., 2011), which is different from traditional of Torre’s method (de la Torre et al., 1985). As expected for a virus with an endosomal entry pathway (such as FMDV), ammonium chloride neutralized the acidic endolysosome compartments, blocking an early step in virus infection, reducing the yield of virus replication at all time-points detected. The new method in establishment of FMDV persistence may lead to completely different mechanism of persistence. We analyzed and compared the sequences of full cDNA clone of FMDV WT and FMDV-Op48 (persistently infected BHK-21 after 48 passages). Protein sequence comparison and analysis revealed that all the

H. Zhang et al. / Veterinary Microbiology 162 (2013) 321–329

326

Table 2 Fold change expression genes common in both acute and persistent infections. Accession number

Both up-regulated NM_203481 NM_006455 Both down-regulated NM_006388 NM_006755 NM_005229 NM_001032289 NM_002796 NM_002461 NM_005412 NM_033301 NM_005735 NM_033082 NM_001746 NM_000801 NM_015203 NM_080748 NM_014713 BC036557 AL035301 NM_032603 NM_015549

Gene symbol

MGC70870 SC65

Gene description

Fold change

C-terminal binding protein 2 pseudogene Synaptonemal complex protein SC65

HTATIP TALDO1 ELK1 SLC35A2 PSMB4 MVD SHMT2 RPL8 ACTR1B CIP29 CANX FKBP1A KIAA0460 C20orf52 LAPTM4A KIAA1394 PIGC LOXL3 PLEKHG3

K(lysine) acetyltransferase 5 Transaldolase 1 ELK1, member of ETS oncogene family Solute carrier family 35 (UDP-galactose transporter), member A2 Proteasome (prosome, macropain) subunit, beta type, 4 Mevalonate (diphospho) decarboxylase Serine hydroxymethyltransferase 2 (mitochondrial) Ribosomal protein L8; ribosomal protein L8 pseudogene 2 ARP1 actin-related protein 1 homolog B, centractin beta (yeast) SAP domain containing ribonucleoprotein Calnexin FK506 binding protein 1A, 12 kDa Regulation of nuclear pre-mRNA domain containing 2 Reactive oxygen species modulator 1 Lysosomal protein transmembrane 4 alpha ATP-grasp domain containing 1 Phosphatidylinositol glycan anchor biosynthesis, class C Lysyl oxidase-like 3 Pleckstrin homology domain containing, family G (with RhoGef domain) member 3 Up-regulated in acute infection and down-regulated in persistent infection NM_001025 RPS23 Ribosomal protein S23 NM_004199 P4HA2 Prolyl 4-hydroxylase, alpha polypeptide II NM_000597 IGFBP2 Insulin-like growth factor binding protein 2, 36 kDa NM_016303 WBP5 WW domain binding protein 5 NM_014481 APEX2 APEX nuclease (apurinic/apyrimidinic endonuclease) 2 NM_006579 EBP Emopamil binding protein (sterol isomerase) NM_003691 STK16 Serine/threonine kinase 16 NM_033625 RPL34 Ribosomal protein L34 NM_199444 COPE Coatomer protein complex, subunit epsilon NM_001288 CLIC1 Chloride intracellular channel 1 NM_020836 KIAA1446 Brain-enriched guanylate kinase-associated homolog (rat) NM_017885 HCFC1R1 Host cell factor C1 regulator 1 (XPO1 dependent)

Acute infection

Persistent infection

2. 39 2. 46

3. 53 3. 52

0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0.

0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0.

49 38 31 35 48 48 34 46 46 37 32 45 24 43 15 41 41 40 33

2. 02 2. 15 2. 16 2.21 2. 27 2. 30 2. 38 2. 42 2. 43 2. 74 3.00 3. 12

45 40 35 23 37 24 41 35 34 41 49 44 47 50 45 41 47 37 41

0. 31 0. 24 0. 47 0.13 0. 43 0. 43 0. 35 0. 27 0. 30 0. 45 0. 42 0. 47

Table 3 Primers used for real time RT-PCR. Gene

Forward primer (50 !30 )

Reverse primer (50 !30 )

Length (bbp)

APEX2 EBP P4HA2 RPL34 RPS23 GAPDH 3D

CGTCTGTCTCCAGGAAACCA ACTGTCCCTGTGCTGGTTTG GGGACAGCCCGCACATCGTC CAGCGTTTGACATACCG CAGGATGGGCAAGTGTC AAGGCCATCACCATCTTCCA GAACACATTCTTTACACCAGGAT

GCGGCTGAAGCTGAAATAGG GATGTATCGGCTGTCTCCCT TCACGAACGGTGGCTCGTGC GCTTTCCCAACCTTCTTG TTTGGCTGTTTGGCTTC GCCAGTAGACTCCACAACATAC CATATCTTTGCCAATCAACATCAG

94 148 106 118 192 87 121

amino acid mutations were located in nonstructural proteins rather than structural proteins, which is distinctive to previous reports (Baranowski et al., 1998; Escarmis et al., 1998; Fares et al., 2001; Gebauer et al., 1988). And the recognition of cell receptors of the persistent viruses were not influenced and the persistent viruses can bind to the cell surfaces and enter into the host cells as wild type viruses, which is consistent with our results (Fig. 1). Following experiment figured out that ammonium chloride exerted its primary effect on the host cell but not on the virus itself in the process of viral

persistence establishment. Thus, further investigations were undertaken to identity host cell proteins of factors pertaining to FMDV persistence in BHK-21 cell. DNA microarrays enable researchers to conduct largescale quantitative experiments on gene expression, which can elucidate the mechanisms and predict biological processes, assign functions to previously un-annotated genes, group genes into functional pathways, and predict the activities of new compounds (Stoughton, 2005). However, microarray platforms for numerous species, particularly some mammals, have yet to be fully developed

H. Zhang et al. / Veterinary Microbiology 162 (2013) 321–329

327

Table 4 Confirmation of array results by real time RT-PCR. cDNA of was prepared from three independent BHK-21 cultures and used in qRT-PCR experiments using the SYBR green method and specific primers for homologous sequences of human and mouse. qRT-PCR levels of RNA for a given gene were normalized against the housekeeping gene GAPDH, and levels in FMDV infected samples expressed relative to the expression level in the corresponding mock infected samples. Mean relative expression levels of triplication experiments using two independent RNA samples are shown. The mean expression ratios from the corresponding microarray data are also indicated. Genes

APEX2 EBP P4HA2 RPL34 RPS23

Acute infection

Persistent infection

Microarray

RT-PCR

Microarray

RT-PCR

2.27 2.30 2.15 2.42 2.02

1.88  0.26 2.24  0.29 1.60  0.20 2.37  0.52 1.77  0.31

0.43 0.43 0.24 0.27 0.31

0.53  0.13 0.47  0.07 0.32  0.05 1.09  0.23 1.38  0.22

(Grigoryev et al., 2005; Klener et al., 2006; Park et al., 2011). Recently, cross-species microarray hybridization (CSH) has become a popular approach for gene expression profiling in less-annotated genomes, in particular for comparative genomics analyses of gene expression (Bar-Or et al., 2007; Gilad and Borevitz, 2006). The idea is to use a microarray platform designed for one species (e.g. humans) on a second (closely related) species (e.g. hamster), for which a standard microarray platform is not available. Since there is no such specific-specific hybridization (SSH) platform for hamster, we speculated that conserved interspecies genetic sequences can be experimentally detected by CSH. Indeed it seems that biologically meaningful information may be obtained from CSH over cDNA microarrays (Chitko-McKown et al., 2004; Donaldson et al., 2005; Held et al., 2004; Jimenez et al., 2003; Renn et al., 2004). However, some CSH studies have demonstrated spurious results for CSH performed on cDNA arrays, even for closely related species (Donaldson et al., 2005; Gilad et al., 2005). A major issue with cross-species microarray hybridization is the effect of sequence divergence on probe affinity. How can valid biological results be derived from CSH? As reviewed by Carmiya (Bar-Or et al., 2007), the level of confidence of CSH can be increased by taking care in choosing the microarray platform and type of probes, the experimental design and data analysis. Here, the whole human and mouse genome Agilent microarray platform which have about 41,000 unique transcripts probes (60 oligomer) are available. Since the genomic data of target species hamster are not available, a direct evaluation of sequence matching between the target and the reference species is impossible. To overcome the inherently lower signal of CSH, two different approaches of comparative hybridization were designed to strengthen CSH results. CSH performance of the RNA from the target species hamster is compared between two different reference species platforms (i.e. human and mouse (data not shown) CSH results are compared by cross-platform hybridizations). This kind of method had been taken by many researchers and the feasibility was also clarified (Brodsky et al., 2005; Chalmers et al., 2005; Gilad et al., 2005; Held et al., 2004; Ji et al., 2004; Nagpal et al., 2004; Neufeld et al., 2006; Nowrousian et al., 2005; Nuzhdin et al., 2004; Rifkin et al., 2003; Saetre et al., 2004; Walker et al., 2006).

We exploited a functional genomics approach with microarray technology to determine if a global control mechanism was involved to assist the establishment of persistent infection. 41,000 gene probes were analyzed to verify differences in host gene expressions between BHK21 cells acutely and persistently infected by FMDV. Samples of acute infection at 48 hpi provide late response information about relatively steady effects on host transcription. Despite the fact that hamster genome was not an exact match to humans’, we found that 1676 and 808 genes were significantly changed in acute and persistent infection respectively (Fig. 2). In persistent infection, the majority of fold-change genes were downregulated in contrast to acute infection which had almost equivalent side-regulated gene number. Different genes products usually network with each other to exercise their biological functions. Pathway-based analysis helps in further understanding the biological functions of genes. By the help of DAVID bioinformatics resources (Huang da et al., 2009a,b), we uploaded the 1676 and 808 DEGs to DAVID website for KEGG pathway analysis. The results indicated there were 8 top pathways in acute and the 15 top pathways in persistent infection BHK-21. The three pathways ribosome, pathways in cancer and glutathione metabolism were found both in acute and persistent infection pattern, which told us that the three pathways, especially cancer related could be involved in the process of virus infection. Pathways unique to persistent infection showed obvious difference with ones unique to acute infection. Regulation pathways such as GnRH signaling, gap junction and VEGF signaling (Fig. 3B), are implicated in cell proliferation and growth. The different pathway analysis output between acute and persistent infected BHK-21 may indicate a unique mechanism taken by the establishment of FMDV persistent infection. Important criteria for evaluating any microarray system include the reproducibility of the data, the specificity of detection, and the validity of the results that identify differences in gene expression. In our research qRT-PCR was used as a tool for verification. We chose 17 genes (12 genes were up-regulated in acute infection and downregulated in persistent infection) (Table 4), and 5 genes were of great fold-changes, designed primers upon the homologous sequences of mouse and human, and verified the feasibility of the primers. However, the result came out

328

H. Zhang et al. / Veterinary Microbiology 162 (2013) 321–329

that only 5 pairs of primers were fairly useful (Table 3). The five genes were tested both in circumstances of acute and persistent infection (Table 4). Even through further functional investigation is needed, our results indicated that APEX2, EBP, and P4HA2 play significant roles in the establishment of persistence. Host cell factors regulate genome transcription to defy the lytic effects of persistent FMDV infection. Acknowledgements The authors gratefully acknowledge KangChen Bio-tech (Shanghai, China) for the technique help. They also thank Dr. Zhou, Tongqing (National Institutes of Health, Bethesda, MD 20892, USA) and Dr. Wang, Wei for critical reading of the manuscript. This work was supported by National ‘‘973’’ Program of China (grant no. 2011CB504800) and National Infrastructure of Natural Resources for Science and Technology Program (grant no. 2011-572). References Bao, H.F., Li, D., Sun, P., Zhou, Q., Hu, J., Bai, X.W., Fu, Y.F., Lu, Z.J., Liu, Z.X., 2011. The infectivity and pathogenicity of a foot-and-mouth disease virus persistent infection strain from oesophageal–pharyngeal fluid of a Chinese cattle in 2010. Virol. J. 8, 536. Bar-Or, C., Czosnek, H., Koltai, H., 2007. Cross-species microarray hybridizations: a developing tool for studying species diversity. Trends Genet. 23, 200–207. Baranowski, E., Sevilla, N., Verdaguer, N., Ruiz-Jarabo, C.M., Beck, E., Domingo, E., 1998. Multiple virulence determinants of foot-andmouth disease virus in cell culture. J. Virol. 72, 6362–6372. Boothroyd, J.C., Highfield, P.E., Cross, G.A., Rowlands, D.J., Lowe, P.A., Brown, F., Harris, T.J., 1981. Molecular cloning of foot and mouth disease virus genome and nucleotide sequences in the structural protein genes. Nature 290, 800–802. Brodsky, L.I., Jacob-Hirsch, J., Avivi, A., Trakhtenbrot, L., Zeligson, S., Amariglio, N., Paz, A., Korol, A.B., Band, M., Rechavi, G., Nevo, E., 2005. Evolutionary regulation of the blind subterranean mole rat, Spalax, revealed by genome-wide gene expression. Proc. Natl. Acad. Sci. U.S.A. 102, 17047–17052. Chalmers, A.D., Goldstone, K., Smith, J.C., Gilchrist, M., Amaya, E., Papalopulu, N., 2005. A Xenopus tropicalis oligonucleotide microarray works across species using RNA from Xenopus laevis. Mech. Dev. 122, 355–363. Chitko-McKown, C.G., Fox, J.M., Miller, L.C., Heaton, M.P., Bono, J.L., Keen, J.E., Grosse, W.M., Laegreid, W.W., 2004. Gene expression profiling of bovine macrophages in response to Escherichia coli O157:H7 lipopolysaccharide. Dev. Comp. Immunol. 28, 635–645. Cottam, E.M., Haydon, D.T., Paton, D.J., Gloster, J., Wilesmith, J.W., Ferris, N.P., Hutchings, G.H., King, D.P., 2006. Molecular epidemiology of the foot-and-mouth disease virus outbreak in the United Kingdom in 2001. J. Virol. 80, 11274–11282. de la Torre, J.C., Davila, M., Sobrino, F., Ortin, J., Domingo, E., 1985. Establishment of cell lines persistently infected with foot-and-mouth disease virus. Virology 145, 24–35. de la Torre, J.C., Martinez-Salas, E., Diez, J., Domingo, E., 1989. Extensive cell heterogeneity during persistent infection with foot-and-mouth disease virus. J. Virol. 63, 59–63. de la Torre, J.C., Martinez-Salas, E., Diez, J., Villaverde, A., Gebauer, F., Rocha, E., Davila, M., Domingo, E., 1988. Coevolution of cells and viruses in a persistent infection of foot-and-mouth disease virus in cell culture. J. Virol. 62, 2050–2058. Diez, J., Davila, M., Escarmis, C., Mateu, M.G., Dominguez, J., Perez, J.J., Giralt, E., Melero, J.A., Domingo, E., 1990. Unique amino acid substitutions in the capsid proteins of foot-and-mouth disease virus from a persistent infection in cell culture. J. Virol. 64, 5519–5528. Donaldson, L., Vuocolo, T., Gray, C., Strandberg, Y., Reverter, A., McWilliam, S., Wang, Y., Byrne, K., Tellam, R., 2005. Construction and validation of a bovine innate immune microarray. BMC Genomics 6, 135.

Escarmis, C., Carrillo, E.C., Ferrer, M., Arriaza, J.F., Lopez, N., Tami, C., Verdaguer, N., Domingo, E., Franze-Fernandez, M.T., 1998. Rapid selection in modified BHK-21 cells of a foot-and-mouth disease virus variant showing alterations in cell tropism. J. Virol. 72, 10171–10179. Escarmis, C., Toja, M., Medina, M., Domingo, E., 1992. Modifications of the 50 untranslated region of foot-and-mouth disease virus after prolonged persistence in cell culture. Virus Res. 26, 113–125. Fares, M.A., Moya, A., Escarmis, C., Baranowski, E., Domingo, E., Barrio, E., 2001. Evidence for positive selection in the capsid protein-coding region of the foot-and-mouth disease virus (FMDV) subjected to experimental passage regimens. Mol. Biol. Evol. 18, 10–21. Forss, S., Strebel, K., Beck, E., Schaller, H., 1984. Nucleotide sequence and genome organization of foot-and-mouth disease virus. Nucleic Acids Res. 12, 6587–6601. Gebauer, F., de la Torre, J.C., Gomes, I., Mateu, M.G., Barahona, H., Tiraboschi, B., Bergmann, I., de Mello, P.A., Domingo, E., 1988. Rapid selection of genetic and antigenic variants of foot-and-mouth disease virus during persistence in cattle. J. Virol. 62, 2041–2049. Gilad, Y., Borevitz, J., 2006. Using DNA microarrays to study natural variation. Curr. Opin. Genet. Dev. 16, 553–558. Gilad, Y., Rifkin, S.A., Bertone, P., Gerstein, M., White, K.P., 2005. Multispecies microarrays reveal the effect of sequence divergence on gene expression profiles. Genome Res. 15, 674–680. Grigoryev, D.N., Ma, S.F., Simon, B.A., Irizarry, R.A., Ye, S.Q., Garcia, J.G., 2005. In vitro identification and in silico utilization of interspecies sequence similarities using GeneChip technology. BMC Genomics 6, 62. Grubman, M.J., Baxt, B., 2004. Foot-and-mouth disease. Clin. Microbiol. Rev. 17, 465–493. Held, M., Gase, K., Baldwin, I.T., 2004. Microarrays in ecological research: a case study of a cDNA microarray for plant–herbivore interactions. BMC Ecol. 4, 13. Herrera, M., Grande-Perez, A., Perales, C., Domingo, E., 2008. Persistence of foot-and-mouth disease virus in cell culture revisited: implications for contingency in evolution. J. Gen. Virol. 89, 232–244. Huang da, W., Sherman, B.T., Lempicki, R.A., 2009a. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 37, 1–13. Huang da, W., Sherman, B.T., Lempicki, R.A., 2009b. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 4, 44–57. Huang, X., Li, Y., Fang, H., Zheng, C., 2011. Establishment of persistent infection with foot-and-mouth disease virus in BHK-21 cells. Virol. J. 8, 169. Hughes, T.R., Marton, M.J., Jones, A.R., Roberts, C.J., Stoughton, R., Armour, C.D., Bennett, H.A., Coffey, E., Dai, H., He, Y.D., Kidd, M.J., King, A.M., Meyer, M.R., Slade, D., Lum, P.Y., Stepaniants, S.B., Shoemaker, D.D., Gachotte, D., Chakraburtty, K., Simon, J., Bard, M., Friend, S.H., 2000. Functional discovery via a compendium of expression profiles. Cell 102, 109–126. Jackson, A.L., O’Neill, H., Maree, F., Blignaut, B., Carrillo, C., Rodriguez, L., Haydon, D.T., 2007. Mosaic structure of foot-and-mouth disease virus genomes. J. Gen. Virol. 88, 487–492. Ji, W., Zhou, W., Gregg, K., Yu, N., Davis, S., 2004. A method for crossspecies gene expression analysis with high-density oligonucleotide arrays. Nucleic Acids Res. 32, e93. Jimenez, J.L., Mitchell, M.P., Sgouros, J.G., 2003. Microarray analysis of orthologous genes: conservation of the translational machinery across species at the sequence and expression level. Genome Biol. 4, R4. Klein, J., 2009. Understanding the molecular epidemiology of foot-andmouth-disease virus. Infect. Genet. Evol. 9, 153–161. Klener, P., Szynal, M., Cleuter, Y., Merimi, M., Duvillier, H., Lallemand, F., Bagnis, C., Griebel, P., Sotiriou, C., Burny, A., Martiat, P., Van den Broeke, A., 2006. Insights into gene expression changes impacting B-cell transformation: cross-species microarray analysis of bovine leukemia virus tax-responsive genes in ovine B cells. J. Virol. 80, 1922–1938. Kurz, C., Forss, S., Kupper, H., Strohmaier, K., Schaller, H., 1981. Nucleotide sequence and corresponding amino acid sequence of the gene for the major antigen of foot and mouth disease virus. Nucleic Acids Res. 9, 1919–1931. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25, 402–408. Martin Hernandez, A.M., Carrillo, E.C., Sevilla, N., Domingo, E., 1994. Rapid cell variation can determine the establishment of a persistent viral infection. Proc. Natl. Acad. Sci. U.S.A. 91, 3705–3709. Martinez-Salas, E., Saiz, J.C., Davila, M., Belsham, G.J., Domingo, E., 1993. A single nucleotide substitution in the internal ribosome entry site of

H. Zhang et al. / Veterinary Microbiology 162 (2013) 321–329 foot-and-mouth disease virus leads to enhanced cap-independent translation in vivo. J. Virol. 67, 3748–3755. Nagpal, S., Karaman, M.W., Timmerman, M.M., Ho, V.V., Pike, B.L., Hacia, J.G., 2004. Improving the sensitivity and specificity of gene expression analysis in highly related organisms through the use of electronic masks. Nucleic Acids Res. 32, e51. Neufeld, J.D., Mohn, W.W., de Lorenzo, V., 2006. Composition of microbial communities in hexachlorocyclohexane (HCH) contaminated soils from Spain revealed with a habitat-specific microarray. Environ. Microbiol. 8, 126–140. Nowrousian, M., Ringelberg, C., Dunlap, J.C., Loros, J.J., Kuck, U., 2005. Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora. Mol. Genet. Genomics 273, 137–149. Nuzhdin, S.V., Wayne, M.L., Harmon, K.L., McIntyre, L.M., 2004. Common pattern of evolution of gene expression level and protein sequence in Drosophila. Mol. Biol. Evol. 21, 1308–1317. Park, E.S., Kim, S.J., Kim, S.W., Yoon, S.L., Leem, S.H., Kim, S.B., Kim, S.M., Park, Y.Y., Cheong, J.H., Woo, H.G., Mills, G.B., Fidler, I.J., Lee, J.S., 2011. Cross-species hybridization of microarrays for studying tumor transcriptome of brain metastasis. Proc. Natl. Acad. Sci. U.S.A. 108, 17456– 17461. Renn, S.C., Aubin-Horth, N., Hofmann, H.A., 2004. Biologically meaningful expression profiling across species using heterologous hybridization to a cDNA microarray. BMC Genomics 5, 42.

329

Rifkin, S.A., Kim, J., White, K.P., 2003. Evolution of gene expression in the Drosophila melanogaster subgroup. Nat. Genet. 33, 138–144. Saetre, P., Lindberg, J., Leonard, J.A., Olsson, K., Pettersson, U., Ellegren, H., Bergstrom, T.F., Vila, C., Jazin, E., 2004. From wild wolf to domestic dog: gene expression changes in the brain. Brain Res. Mol. Brain Res. 126, 198–206. Saiz, J.C., Domingo, E., 1996. Virulence as a positive trait in viral persistence. J. Virol. 70, 6410–6413. Schmittgen, T.D., Zakrajsek, B.A., Mills, A.G., Gorn, V., Singer, M.J., Reed, M.W., 2000. Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: comparison of endpoint and realtime methods. Anal. Biochem. 285, 194–204. Smoot, L.M., Smoot, J.C., Graham, M.R., Somerville, G.A., Sturdevant, D.E., Migliaccio, C.A., Sylva, G.L., Musser, J.M., 2001. Global differential gene expression in response to growth temperature alteration in group A Streptococcus. Proc. Natl. Acad. Sci. U.S.A. 98, 10416–10421. Stoughton, R.B., 2005. Applications of DNA microarrays in biology. Annu. Rev. Biochem. 74, 53–82. Toja, M., Escarmis, C., Domingo, E., 1999. Genomic nucleotide sequence of a foot-and-mouth disease virus clone and its persistent derivatives. Implications for the evolution of viral quasispecies during a persistent infection. Virus Res. 64, 161–171. Walker, S.J., Wang, Y., Grant, K.A., Chan, F., Hellmann, G.M., 2006. Long versus short oligonucleotide microarrays for the study of gene expression in nonhuman primates. J. Neurosci. Methods 152, 179–189.