- Email: [email protected]
Glucagon-like peptide-1 improves β-cell dysfunction by suppressing the miR-27a-induced downregulation of ATP-binding cassette transporter A1
Biomedicine & Pharmacotherapy 96 (2017) 497–502
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Original article
Glucagon-like peptide-1 improves β-cell dysfunction by suppressing the miR-27a-induced downregulation of ATP-binding cassette transporter A1 Yue Yaoa,b, Yi Xub, Wei Wanga, Jinchao Zhanga, Qiang Lia, a b
MARK
⁎
Department of Endocrinology and Metabolism, Second Affiliated Hospital of Harbin Medical University, Xuefu Road No. 246, Harbin, Heilongjiang 150086, China The Key Laboratory of Myocardial Ischemia, Harbin Medical University, Ministry of Education, Heilongjiang Province 150086, China
A R T I C L E I N F O
A B S T R A C T
Keywords: Glucagon-like peptide-1 Cholesterol ATP-binding cassette transporter A1 miR-27a β-cell dysfunction
Lipotoxicity is considered one of the main causes of deterioration in β-cells function. Glucagon-like peptide-1 (GLP-1) has been revealed to protect and improve pancreatic β-cell function against lipotoxicity. However, the mechanism behind these is largely unknown. The aim of this study was to investigate the effects of GLP-1 on cholesterol-induced lipotoxicity in INS-1 cells and examine the underlying mechanisms. The cell viability was determined, and caspase-3 was used to assess the effects of GLP-1 on cholesterol-induced apoptosis. The alterations of miR-27a and ABCA1 resulting from incubation with cholesterol or GLP-1 were detected by real-time PCR and western blot. The inhibition and overexpression of miR-27a were established to explore the effects of a GLP-1-mediated decrease in miR-27a. Further, Oil red O staining and cholesterol measurement were used to detect lipid accumulation. The β-cells function was measured in glucose-stimulated insulin secretion. Our data shows that cholesterol significantly attenuated cell viability, promoted cell apoptosis, facilitated lipid accumulation, and impaired β-cells function, and these effects were significantly reversed by GLP-1. Furthermore, the results demonstrated that GLP-1 decreased miR-27a expression and increased the expression of ABCA1. In conclusion, GLP-1 may affect cholesterol accumulation and β-cells dysfunction by regulating the expression of miR-27a and ABCA1.
1. Introduction Type 2 diabetes mellitus (T2DM) is characterized by insulin resistance and a gradual deterioration in β-cell function. Lipotoxicity in which toxic lipids accumulate, is considered one of the major causes for the degradation in β-cell function [1,2]. Most studies examining the link between lipotoxicity and T2DM have focused on free fatty acids (FFAs), but the role of cholesterol in regulating β-cell function and survival is poorly understood [3,4]. ATP binding cassette transporter A1 (ABCA1) is an integral membrane protein, that transports intracellular cholesterol and phospholipid to apolipoprotein acceptors by using ATP as energy [5,6]. Hypercholesterolemic apolipoprotein E (apoE) knockout mice display impairment in insulin secretion associated with decreased islet ABCA1 expression and increased islet cholesterol [7]. Mice with a β-cell-specific inactivation of ABCA1 had notably impaired glucose tolerance and defective insulin secretion but normal insulin sensitivity [3,8]. Consequently, ABCA1-mediated cholesterol efflux is a pivotal determinant of the appropriate maintenance of both cholesterol levels and insulin secretion [9]. In this study, we investigate how GLP-1 contributes to
⁎
increasing cholesterol efflux by regulating ABCA1. Glucagon-like peptide 1 (GLP-1) as a new treatment for T2DM, not only has hypoglycemic effect, but also plays a significant role in regulating lipid metabolism [10,11]. GLP-1 plays a unique role in modulating lipid metabolism via lipid assimilation and transport, fat formation and decomposition, hepatic lipid metabolism,and cholesterol transport [12]. The apolipoprotein A-I (apo A-I) gene is considered to encode for the primary anti-atherogenic factor in high-density lipoprotein (HDL) particle. Apo A-I secretion was enhanced in both GLP-1 and exendin-4-treated HepG2 cells, and this was combined with similar changes in the ABCA1 mRNA levels [13]. Activation of the CaMKK/ CaMKIV cascade by exendin-4 promoted ABCA1 gene transcription,suggesting that exendin-4 plays a crucial role in cholesterol content and insulin secretion in β-cells [14–16]. However, the mechanism by which GLP-1 improves β-cell dysfunction via ABCA1 in INS1 cells remains unclear. MicroRNAs (miRNAs) are a class of small (22 -nt) non-coding RNAs that are involved in the post-transcriptional regulation of their target genes in a sequence-specific manner. MiRNAs are key regulators of lipid synthesis, fatty acid oxidation and lipoprotein formation and secretion.
Corresponding author. E-mail address: [email protected] (Q. Li).
http://dx.doi.org/10.1016/j.biopha.2017.10.049 Received 17 June 2017; Received in revised form 21 September 2017; Accepted 9 October 2017 0753-3322/ © 2017 Published by Elsevier Masson SAS.
Biomedicine & Pharmacotherapy 96 (2017) 497–502
Y. Yao et al.
shown below: microRNA-27a mimics, sense 5′- UUCACAGUGGCUAAGUUCCGC -3′; antisense 5′- GGAACUUAGCCACUGUGAAUU -3′; microRNA-27a inhibitor, 5′- GCGGAACUUAGCCACUGUGAA -3′; microRNA NC-FAM, sense 5′- UUCUCCGAACGUGUCACGUTT -3′; antisense 5′- ACGUGACACGUUCGGAGAATT -3′.
Emerging evidence suggests that miRNAs are involved in lipid metabolism, including miR-33, miR-122, miR27a/b, miR378, miR-34a, miR370 and miR-21 [17–20]. MiR-27a/b targets the 3′UTR of ABCA1 and downregulates the expression of this gene [21]. Many studies have identified significant roles for miR-27a/b in lipid metabolism [22,23], inflammation [24], adipogenesis, oxidative stress and insulin resistance, which play important roles in T2DM [25]. This study investigates the efficacy of GLP-1 on improving β-cells cholesterol metabolism and secretion function through miR-27a/ABCA1 in INS-1 cells.
2.6. RNA extraction and quantitative PCR Total RNA was extracted from INS-1 cells using the Trizol reagent (Invitrogen, Waltham, USA). Reverse transcription was performed using a Transcriptor First Strand cDNA Synthesis Kit (Roche, Germany). qRT-PCR reactions were carried out using the Fast Start Universal SYBR Green Master (Roche, Germany) with CFX96 real time PCR detection system (Bio-Rad, USA). U6 small RNA and GAPDH were used as the reference gene. Each reaction was carried out in triplicate, and the qRTPCR results were calculated using the 2−ΔΔCt method [27]. The primer sequences were as follows: ABCA1, forward (5′- AATGGTCAATGGGAGGTTCA -3') and reverse (5′- TGGACAGGCTTTAGGTCAGG -3'); GAPDH, forward (5′- GCCAGCCGAGCCACAT -3') and reverse (5′- GGATCTCGCTCC TGGAAGAT -3'); rno-miR-27a, RT primer (5′GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCGG AA −3'), forward (5′- ATTGGCGGTTCACAGTGGCTAAG −3') and reverse (5′- ATCCAGTGCAGGGTCCGAGG −3'); U6, RT primer (5′- CGCTTCACGAATTTGCGTGTCAT −3'), forward (5′- GCTTCGGCAGCA CATATACTAAAAT -3') and reverse (5′- CGCTTCACGAATTTGCGT GTC AT -3').
2. Materials and methods 2.1. Cell culture The INS-1 pancreatic β-cell line derived from rat insulinoma (purchased from the basic medical institute of Chinese Academy of Medical Sciences,China) was cultured as previously described [26], in RPMI 1640 medium (HyClone, USA) containing 11.1 mM glucose and supplemented with 10% foetal bovine serum (GIBCO, USA), 10 mmol/L HEPES, 2 mmol/L L-glutamine,1 mmol/L sodium pyruvate, 55 mol/L beta-mercaptoethanol, 100 IU/ml penicillin, and 100 g/ml streptomycin. The cells were cultured at 37 °C in a 5% CO2 environment. 2.2. Lipotoxicity and GLP-1 incubation The cells were cultured after 12 h, treated or not treated with 5 mmol/L soluble cholesterol (Sigma, USA) medium to exert a lipotoxicity effect for 24 h, and then maintained with or without 10 nmol/L GLP-1 (Sigma, USA) for 24 h.
2.7. Protein extraction and Western blotting For protein extraction, the INS-1 cells were lysed with 200 μl of modified RIPA Lysis Buffer (Beyotime institute of Biotechnology, China) containing 1% PMSF (Beyotime institute of Biotechnology, China) on ice. The proteins were quantified using the BCA method. Subsequently, 30 μg of proteins were fractionated by sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) electrophoresis and transferred to polyvinylidene fluoride (PVDF) membranes (GE Healthcare, USA). The membrane was incubated with primary antibodies to ABCA1 (1:500, ab18180) or GAPDH (1:10000, ab181602) (Abcam, USA). After the secondary antibody (Cell Signaling Technology, Danvers, USA) was probed for 2 h, the blots were developed using an enhanced chemiluminescence kit (Beyotime institute of Biotechnology, China).
2.3. Measurement with the cell counting kit-8 (CCK-8) This assay was assessed by cultivating INS-1 cells in 96-well plates at a density of 5000 cells/well for 24 h. The cells were exposed to various concentrations of cholesterol (1.0, 2.5, 5 and 10 mmol/L), with or without 10 nmol/L GLP-1 for 24 h. After replacing the RPMI 1640 medium, 10 μl of CCK-8 reagent (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) was added to each well, and the 96-well plate was incubated in the dark at 37 °C for 2 h. The absorbance was measured at 450 nm in a microplate reader. 2.4. Caspase 3 analysis
2.8. Oil red O staining
The expression of caspase-3 is enhanced when cell apoptosis occurs and represents the degree of apoptosis to some extent. The activation level of caspase-3 was detected to explore cholesterol-induced apoptosis using the caspase-3 Activity Kit (Solarbio, China). In brief, after extraction of total cell proteins of each group, 10 μl protein was incubated with 90 μl of provided reaction buffer and 10 μl Ac-DEVD-pNA (2 mM) in 96-well plates at 37 °C for 2 h. Then, the reaction mixtures were measured at 405 nm in a microplate reader.
For lipid droplets observation, the INS-1 cells were plated in 6-well plates. After stimulation with cholesterol and GLP-1 for 24 h, each group was rinsed three times in PBS, fixed in 4% paraformaldehyde for 30 min, stained in freshly diluted oil red O for 15 min, decolorized in 70% ethanol solution for 15 s, re-dyed in haematoxylin staining solution for 30 s and rinsed in PBS twice. Finally, the intracellular lipid droplets were observed and photographed with an inverted microscope (Leica, Germany).
2.5. MiRNA transfection
2.9. Cholesterol manipulation
The INS-1 cells were plated until they were 50% confluent at the time of transfection. Oligonucleotide analogue and inhibitor which were chemically modified and synthesized were used to increase and decrease the expression of miR-27a in INS-1 cells. The microRNA-27a inhibitor, microRNA-27a mimics, microRNA NC-FAM (GenePharm Co. Ltd, China) and lipofectamine™ 3000 (Invitrogen, USA) were diluted in serum-free RPMI 1640 without antibiotics prior to being incubated at room temperature for 5 min. Then, diluted microRNAs were added to each tube of diluted Lipofectamine™ 3000 Reagent (1:1 ratio) separately. The oligonucleotide-lipo complexes were added to the cells for 24 h. Then cholesterol and GLP-1 were taken every other 24 h before further analysis. The sequences of mimics and inhibitors used are
The cholesterol content was quantitated in INS-1 cells using a cholesterol quantitation kit (BioVision, USA) according to the manufacturer's instructions. Briefly, 1 × 106 cells were extracted with 200 μl of chloroform: isopropanol: NP-40 (7:11:0.1) by a microhomogenizer. These lipid extracts were dried for 30 min in a vacuum and the residues were dissolved in 200 μl of cholesterol assay buffer by vortexing until the solution became cloudy. The reactions containing the cholesterol probe, enzyme mix, esterase, assay buffer and samples or standards were incubated at 37 °C for 1 h. Then the absorbance of extraction was measured at 570 nm in a microplate reader [28]. 498
Biomedicine & Pharmacotherapy 96 (2017) 497–502
Y. Yao et al.
Fig. 1. GLP-1 treatment protected INS-1 cells against cholesterol (CHO)-mediated apoptosis. (Fig. 1A) The cells were treated with 1.0, 2.5, 5.0 or 10.0 mmol/L cholesterol for 24 h, and cell viability was used to perform the CCK-8 assay. (Fig. 1B) To detect the therapeutic effect of GLP-1 on cells suffering from lipotoxicity, the INS-1 cells were co-incubated with 5.0 mmol/ L or 10.0 mmol/L cholesterol concentrations and 10 nmol/L GLP-1 for 24 h.The relative cell viability was detected by CCK-8. (Fig. 1C) The relative activation of caspase 3 was determined in cells exposed to 5 nmol/L cholesterol with or without GLP-1 treatment for 24 h. The data are shown as the mean ± SD (n = 3). * P < 0.05, ** P < 0.01, *** P < 0.001.
in the expression of miR-27a were assessed by quantitative PCR. As shown in Fig. 2A and B, miR-27a expression was significantly reduced in INS-1 cells exposed to GLP-1 for 24 h. When the INS-1 cells were exposed to high cholesterol together with GLP-1, there was a significant reduction in the expression of miR-27a compared with the cells exposed to high cholesterol alone.
2.10. Glucose-stimulated insulin secretion measurements (GSIS) For insulin secretion, INS-1 cells were cultivated in 48-well plates. The INS-1 cells were preincubated for 1 h in Krebs-Ringer bicarbonate buffer, then incubated for 1 h in Krebs-Ringer bicarbonate buffer containing basal (2.8 mmol/L) or stimulatory (16.7 mmol/L) concentrations of glucose. The insulin levels were measured according to the rat insulin radioimmunoassay according to the manufacturer's protocol. The insulin secretion measurements were adjusted for the intracellular protein content [29].
3.3. The effect of GLP-1 treatment on ABCA1 expression The effect of GLP-1 on ABCA1 expression in INS-1 cells was determined by exposing the cells to 10 nmol/L of GLP-1 for 24 h. The results showed an increase in the abundance of the ABCA1 mRNA (Fig. 2C and D) and protein (Fig. 2E), regardless of whether the cells were in the normal or high cholesterol group. This finding was consistent with its stimulatory effect on the activity of the ABCA1 promoter [14].
2.11. Statistics The data were obtained from at least three independent experiments, presented as the mean ± standard deviation (SD), and analyzed using SPSS version 20.0 (SPSS Inc, Chicago, IL, USA). To compare the significance of two groups, Student’s t-test was performed. A P < 0.05 value was considered statistically significant.
3.4. The regulation of ABCA1 mRNA and protein expression by miR-27a
3. Results
To further investigate the interplay between GLP-1, miR-27a and ABCA1, miR-27a inhibition and overexpression experiments were established to explore the effects of GLP-1-mediated reduction in miR-27a on the mediators of cholesterol transport: ABCA1. To manipulate the expression of miR-27a in INS-1 cells, a miR-27a inhibitor, miR-27a mimics and a negative control (miRNA-NC-FAM) were used for transfection. Fluorescence microscopy was applied to observe and count green fluorescent cells to calculate transfection efficiency, which was greater than 65% in the cells (Fig. 3A and B). As shown in Fig. 3C–E, exposure of INS-1 cells to miR-27a-inhibitor resulted in a significant (P < 0.05) increase in both the expression of ABCA1 mRNA and protein. In contrast, INS-1 cells exposed to miR-27a-mimics showed a significant (P < 0.05) reduction in ABCA1 expression. These results indicate that GLP-1 reduces miR-27a expression and enhances the expression of ABCA1.
3.1. The toxicity of cholesterol accumulation and the effect of GLP-1 treatment on cell apoptosis To evaluate the toxic effect of cholesterol accumulation on INS-1 cells, the cells were incubated with different concentrations including 1.0, 2.5, 5.0, or 10.0 mmol/L for 24 h. With the increase of cholesterol concentration, the cell viability gradually decreased (Fig. 1A). To detect the therapeutic and protective effects of GLP-1 on cells suffering from lipotoxicity, the INS-1 cells were co-incubated with 5.0 mmol/L or 10.0 mmol/L cholesterol concentrations and with or without 10 nmol/L GLP-1 for 24 h. We found that cell viability was substantially increased after GLP-1 treatment except the 10 mmol/L cholesterol group. (Fig. 1B). We further explored the potential impact of cholesterol accumulation and GLP-1 treatment on the apoptosis of INS-1 cells by analysis of caspase-3 activity. We found that relative activities of caspase-3 was significantly increased in cholesterol group compared to the negative control, whereas the cholesterol group was markedly decreased after co-incubation with 5 mmol/L cholesterol and 10 nmol/L GLP-1 for 24 h (Fig. 1C).
3.5. The effect of GLP-1 on lipid accumulation and β-cell function INS-1 cells were cultured in RPMI-1640 containing 5 mmol/L cholesterol for 24 h and then stained with oil red O. We observed a large quantity of red lipid droplets in the INS-1 cells in high cholesterol group, whereas after the high cholesterol group was treated with GLP-1, the lipid accumulation displayed a significant reduction in the number of visible droplets. However, almost no lipid droplets were detected in the INS-1 cells in the negative control and GLP-1 group (Fig. 4A and B). As shown in Fig. 4C, the intracellular cholesterol level was significantly higher in the cholesterol group than in the normal group, whereas the
3.2. GLP-1 treatment contributes to changes in miR-27a expression To investigate the relationship between GLP-1 and miR-27a, the INS-1 cells were cultivated in media containing either normal cholesterol or high cholesterol alone or with GLP-1 for 24 h, and the changes 499
Biomedicine & Pharmacotherapy 96 (2017) 497–502
Y. Yao et al.
Fig. 2. Effect of GLP-1 treatment on the expression level of miR-27a and ABCA1. (Fig. 2A, B) The expression of miR-27a after treatment with 10 nmol/L GLP-1 in the presence of a normal concentration or 5 mmol/L cholesterol for 24 h. (Fig. 2C–E) The relative expression of ABCA1 mRNA and protein after incubated with 10 nmol/L GLP-1 in the presence of a normal concentration or 5 mmol/L cholesterol for 24 h. The real-time quantitative PCR results are presented as 2−ΔΔCT normalized to GAPDH expression (mean ± SD). * P < 0.05, ** P < 0.01.
similar results. As previously reported [30], GLP-1 attenuates FFA-induced lipotoxic oxidative stress in the pancreas via a mechanism that involves the regulation of microRNAs. However, it is not known whether miR-27a mediates the protective effects of GLP-1 on ABCA1 expression and β-cell function in hypercholesterolemia. As shown in Fig. 4E, at the basal (2.8 mmol/L) concentration of glucose, insulin secretion was reduced in the cholesterol group, whereas a 4.1-fold increase was observed following GLP-1 treatment. At the stimulatory
level of intracellular cholesterol in the cholesterol group was markedly decreased after incubation with 10 nmol/L GLP-1 for 24 h. We further investigated the effects of GLP-1 on lipid accumulation in INS-1 cells with an inhibition or overexpression of miR-27a. As shown in Fig. 4D, exposuring the INS-1 cells to the miR-27a-inhibitor resulted in a significant reduction in cholesterol measurement. In contrast, the INS-1 cells that were exposed to miR-27a-mimics showed a significant increase. The Oil red O staining and cholesterol measurement showed
Fig. 3. Expressions of ABCA1 transfected with the miR-27a inhibitor or mimics. (Fig. 3A) Images of the INS-1 cells were captured using a fluorescence microscope and a conventional microscope after being transfected with lipo3000 and miRNA-NC-FAM. (Fig. 3B) The relative expression of miR-27a was measured after transfection by real-time quantitative PCR. (Fig. 3C–E) The mRNA (C,D) and protein (E) expression of ABCA1 were analyzed after overexpression and inhibition of miR-27a by transfection. * P < 0.05, ** P < 0.01.
500
Biomedicine & Pharmacotherapy 96 (2017) 497–502
Y. Yao et al.
Fig. 4. Effect of GLP-1 on lipid accumulation and GSIS. (Fig. 4A) INS-1 cells were exposed to 5.0 mmol/L cholesterol with or without 10 nmol/L GLP-1 for 24 h and stained with oil red O (×200). (Fig. 4B) MiR-27a mimics and miR-27a inhibitor on the impact of lipid droplets in INS-1 cells (×200). (Fig. 4C) The relative expression intracellular cholesterol in INS-1 cells. (Fig. 4D) MiR-27a mimics and miR-27a inhibitor on the impact of intracellular cholesterol. * P < 0.05, ** P < 0.01, *** P < 0.001.
survival rate could also cannot be rescued. This phenomenon may indicate that when treating patients with serious lipid metabolism disorder, both a more adequate dose of therapeutic drugs and early intervention are necessary. Furthermore, we demonstrated that the apoptosis-related factor caspase-3 was activated, suggesting that cholesterol induced INS-1 cell apoptosis via intrinsic pathways. Our results are consistent with previous studies on Rin-m5f cells and SH-SY5Y cells [32,33]. In recent studies, some miRNAs have been identified to be involved in the regulation of lipid accumulation. Of those, the expression of miR27 was found to be increased in fat tissue of obese mice. Importantly, the expression of miR-27 inhibited the expression of PPAR-γand C/EBPα, the two master regulators of adipogenesis [34,35]. It has been reported that GLP-1 participates in lipid metabolism through various mechanisms. Therefore, our studies showed the relationship between GLP-1 and miR-27a in lipid metabolism. The results suggest that treatment with GLP-1 may decrease the expression of miR-27a, with or without cholesterol. Therefore, GLP-1 may play a significant role by inhibiting miR-27a, which acts as a new therapeutic approach for metabolic diseases aimed at decreasing the lipid accumulation. ABCA1 is a plasma membrane protein that regulates the efflux of intracellular cholesterol and phospholipids to an apolipoprotein acceptor. Because non-hepatic cells are unable to degrade cholesterol, ABCA1 plays an important role in modulating intracellular cholesterol homeostasis. ABCA1 knockoff mice displayed defects glucose tolerance but had normal insulin sensitivity, suggesting that the β-cell function of these mice was impaired. Therefore, ABCA1 in pancreaticβ-cells influences insulin secretion and glucose homeostasis [8,15,16]. In this study, we explored not only the effect of GLP-1 on the improvement of ABCA1, but also the interaction between ABCA1 and miR-27a. Subsequently, we also explored the impact of miR-27a knockdown and overexpression on
(16.7 mmol/L) concentration of glucose, GLP-1 still had a significant effect on insulin secretion. However, the cholesterol group showed a remarkable reduction in GSIS.
4. Discussion T2DM is often combined with disordered blood lipid and lipoprotein levels which is also termed as diabetic dyslipidaemia. However, most studies on the link between dyslipideamia and T2DM have focused on free fatty acids (FFAs). Hao et al. established a cholesterol overload model by incubating pancreatic β-cells with 10 mmol/L soluble cholesterol [4]. In this study, the INS-1 cells were treated with 5 mmol/L soluble cholesterol, which was higher than normal culture medium, and this did not lead to rapid cell death or damage than 10 mmol/L cholesterol. Our results suggest that redundant intracellular cholesterol plays an important role in β-cell dysfunction and may be a key factor in the progression of T2DM. In addition, using GLP-1 as a therapy for treating T2DM, not only improves β-cell function, but also regulates lipid metabolism in numerous ways [12,31]. The level of plasma cholesterol often increases in T2DM patients except FFAs. However, the mechanism of GLP-1 in improving hypercholesterolemia from pancreatic β-cells is not fully clear. GLP-1 has been revealed to protect pancreatic β-cells against lipotoxicity. This study showed the protective effects of GLP-1 against cholesterol-induced lipotoxicity at different concentration via the CCK8 assay. The apoptotic rate of INS-1 cells treated with cholesterol was higher than cholesterol together with GLP-1, which suggests that GLP-1 acts as a defender against apoptosis. With an increasing concentration of cholesterol, the cell survival rate decreased gradually. It is worth noting, however, that when the concentration of cholesterol reached 10 mmol/L and the cells were treated with 10 nM GLP-1, the cell 501
Biomedicine & Pharmacotherapy 96 (2017) 497–502
Y. Yao et al.
Med. 13 (2007) 340–347. [9] M.R. Rickels, E.S. Goeser, C. Fuller, et al., Loss-of-function mutations in ABCA1 and enhanced β-cell secretory capacity in young adults, Diabetes 64 (2015) 193–199. [10] C. Xiao, S. Dash, C. Morgantini, et al., Gut peptides are novel regulators of intestinal lipoprotein secretion: experimental and pharmacological manipulation of lipoprotein metabolism, Diabetes 64 (2015) 2310–2318. [11] A.K. Sharma, P.V. Thanikachalam, S.K. Rajput, Albiglutide is a better hope against diabetes mellitus? Biomed. Pharmacother. 77 (2016) 120–128. [12] V.J. Patel, A.A. Joharapurkar, G.B. Shah, et al., Effect of GLP-1 based therapies on diabetic dyslipidemia, Curr. Diabetes Rev. 10 (2014) 238–250. [13] J.M. Chehade, R. Alcalde, E. Naem, et al., Induction of apolipoprotein A-I gene expression by glucagon-like peptide-1 and exendin-4 in hepatocytes but not intestinal cells, Metabolism 62 (2013) 265–274. [14] Y. Miyai, K. Murao, H. Imachi, et al., Exendin-4 regulates the expression of the ATPbinding cassette transporter A1 via transcriptional factor PREB in the pancreatic β cell line, Endocrinol. Invest. 34 (2011) e268–274. [15] A.M. Mostafa, N.M. Hamdy, H.O. El-Mesallamy, et al., Glucagon-like peptide 1 (GLP-1)-based therapy upregulates LXR-ABCA1/ABCG1 cascade in adipocytes, Biochem. Biophys. Res. Commun. 468 (2015) 900–905. [16] J. Li, K. Murao, H. Imachi, et al., Exendin-4 regulates pancreatic ABCA1 transcription via CaMKK/CaMKIV pathway, Cell Mol. Med. 14 (2010) 1083–1087. [17] Z. Yang, T. Cappello, L. Wang, et al., Emerging role of microRNAs in lipid metabolism, Acta. Pharm. Sin. B 5 (2015) 145–150. [18] J. Sacco, K. Adeli, MicroRNAs: emerging roles in lipid and lipoprotein metabolism, Curr. Opin. Lipidol. 23 (2012) 220–225. [19] C. Wang, Q. Li, W. Wang, et al., GLP-1 contributes to increases in PGC-1a expression by downregulating miR-23a to reduce apoptosis, Biochem. Biophys. Res. Commun. 466 (2015) 33–39. [20] N. Wijesekara, L.H. Zhang, M.H. Kang, et al., MiR-33a modulates ABCA1 expression, cholesterol accumulation, and insulin secretion in pancreatic islets, Diabetes 61 (2012) 653–658. [21] M. Zhang, J.F. Wu, W.J. Chen, et al., MicroRNA-27a/b regulates cellular cholesterol efflux, influx and esterification/hydrolysis in THP-1 macrophages, Atherosclerosis 234 (2014) 54–64. [22] F.M. Perez-Campo, I. De Castro-Oros, A. Noriega, et al., Functional analysis of new 3’untranslated regions genetic variants in genes associated with genetic hypercholesterolemias, J. Clin. Lipidol. 11 (2017) 532–542. [23] M.L. Alvarez, M. Khosroheidari, E. Eddy, et al., MicroRNA-27a decreases the level and efficiency of the LDL receptor and contributes to the dysregulation of cholesterol homeostasis, Atherosclerosis 242 (2015) 595–604. [24] W. Xie, L. Li, M. Zhang, et al., MicroRNA-27 prevents atherosclerosis by suppressing lipoprotein lipase-induced lipid accumulation and inflammatory response in apolipoprotein E knockout mice, PLoS One 11 (2016) e0157085. [25] C. Jennewein, A. von Knethen, T. Schmid, et al., MicroRNA-27b contributes to lipopolysaccharide-mediated peroxisome proliferator-activated receptor gamma (PPARgamma) mRNA destabilization, J. Biol. Chem. 285 (2010) 11846–11853. [26] M. Asfari, D. Janjic, P. Meda, et al., Establishment of 2-mercaptoethanol-dependent differentiated insulin-secreting cell lines, Endocrinology 130 (1992) 167–178. [27] T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative C(T) method, Nat. Protoc. 3 (2008) 1101–1108. [28] R. Dubey, R. Chhabra, N. Saini, Small interfering RNA against transcription factor STAT6 leads to increased cholesterol synthesis in lung cancer cell lines, PLoS One 6 (2011) e28509. [29] S. Del Guerra, R. Lupi, L. Marselli, et al., Functional and molecular defects of pancreatic islets in human type 2 diabetes, Diabetes 54 (2005) 727–735. [30] Z. Zhang, H. Liu, Q. Li, Glucagon-like peptide-1 effects lipotoxic oxidative stress by regulating the expression of microRNAs, Biochem. Biophys. Res. Commun. 482 (2017) 1462–1468. [31] J. Seufert, B. Gallwitz, The extra-pancreatic effects of GLP-1 receptor agonists: a focus on the cardiovascular, gastrointestinal and central nervous systems, Diabetes Obes. Metab. 16 (2014) 673–688. [32] C. Gleizes, G. Kreutter, M. Abbas, et al., β-cell membrane remodelling and procoagulant events occur in inflammation-driven insulin impairment: a GLP -1 receptor dependent and independent control, J. Cell Mol Med 20 (2016) 231–242. [33] X.Y. Liu, L.X. Wang, Z. Chen, et al., Liraglutide prevents beta-amyloid-induced neurotoxicity in SH-SY5Y cells via a PI3K-dependent signaling pathway, Biochem. Biophys. Res. Commun. 468 (2015) 900–905. [34] L. Sun, M. Trajkovski, MiR-27 orchestrates the transcriptional regulation of brown adipogenesis, Metabolism 63 (2014) 272–282. [35] Q. Lin, Z. Gao, R.M. Alarcon, et al., A role of miR-27 in the regulation of adipogenesis, FEBS J. 276 (2009) 2348–2358.
ABCA1 expression in INS-1 cells. It was shown that miR-27a may directly controlled the expression of ABCA1 mRNA and protein. The results demonstrated that GLP-1 may increase the expression of ABCA1 by suppressing miR-27a in INS-1 cells, then attenuated the intracellular lipid accumulation and improved β-cell function in GSIS. The progression of β-cell dysfunction is highly related to the disorder of lipid metabolism. MiR-27a can inhibit cholesterol efflux by suppressing the expression of ABCA1 [21]. In the present work, we demonstrated that GLP-1 effects cholesterol accumulation and β-cells dysfunction probably by regulating the expression of miR-27a and ABCA1. Our data point to miR-27a as an upstream regulator of the transcriptional network involved in lipid mechanism, and suggest miR27a inhibition as a new therapeutic method for diabetes-associated dyslipidaemia with the view of increasing the expression of ABCA1. It also shows that the modulation of intracellular cholesterol may be a potential target for therapy aimed at improving GSIS function in β-cells. In summary, our studies provide mechanistic evidence that therapeutic intervention with GLP-1 decreases hypercholesterolemia-associated impairment, possibly by the regulating of miR-27a levels, which in turn enhance ABCA1 expression, thus shedding more light on potential novel therapeutic approaches to reverse lipid mechanism disorder. However, our understanding of the relationship between miR-27a and GLP-1 is still at an early stage. A better understanding of the mechanisms whereby miR-27a regulates the lipid metabolism by targeting different signaling pathways may enable the development of miR-27amediated therapy. Conflict of interests The authors declare that they have no conflict of interests. Acknowledgment This study was supported by “National Natural Science Foundation of China (NSFC)” (No. 81370902) References [1] V. Poitout, R.P. Robertson, Minireview Secondary beta-cell failure in type 2 diabetes-a convergence of glucotoxicity and lipotoxicity, Endocrinology 143 (2002) 339–342. [2] M. Cnop, N. Welsh, J.C. Jonas, et al., Mechanisms of pancreatic beta-cell death in Type 1 and Type 2 diabetes: many differences few similarities, Diabetes 54 (Suppl) (2005) 97–107. [3] L.R. Brunham, J.K. Kruit, C.B. Verchere, et al., Cholesterol in islet dysfunction and type 2 diabetes, Clin. Invest. 118 (2008) 403–408. [4] M. Hao, W.S. Head, S.C. Gunawardana, et al., Direct effect of cholesterol on insulin secretion: a novel mechanism for pancreatic beta-cell dysfunction, Diabetes 56 (2007) 2328–2338. [5] J.F. Oram, R.M. Lawn, ABCA1. The gatekeeper for eliminating excess tissue cholesterol, Lipid Res. 42 (2001) 1173–1179. [6] X.W. He, D. Yu, W.L. Li, et al., Anti- atherosclerotic potential of baicalin mediated by promoting cholesterol efflux from macrophages via the PPARgamma-LXRalphaABCA1/ABCG1 pathway, Biomed. Pharmacother. 83 (2016) 257–264. [7] J.K. Kruit, P.H. Kremer, L. Dai, et al., Cholesterol efflux via ATP- binding cassette transporter A1 (ABCA1) and cholesterol uptake via the LDL receptor in fluences cholesterol-induced impairment of beta cell function in mice, Diabetologia 53 (2010) 1110–1119. [8] L.R. Brunham, J.K. Kruit, T.D. Pape, et al., Beta-cell ABCA1 influences insulin secretion, glucose homeostasis and response to thiazolidinedione treatment, Nat.
502
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Original article
Glucagon-like peptide-1 improves β-cell dysfunction by suppressing the miR-27a-induced downregulation of ATP-binding cassette transporter A1 Yue Yaoa,b, Yi Xub, Wei Wanga, Jinchao Zhanga, Qiang Lia, a b
MARK
⁎
Department of Endocrinology and Metabolism, Second Affiliated Hospital of Harbin Medical University, Xuefu Road No. 246, Harbin, Heilongjiang 150086, China The Key Laboratory of Myocardial Ischemia, Harbin Medical University, Ministry of Education, Heilongjiang Province 150086, China
A R T I C L E I N F O
A B S T R A C T
Keywords: Glucagon-like peptide-1 Cholesterol ATP-binding cassette transporter A1 miR-27a β-cell dysfunction
Lipotoxicity is considered one of the main causes of deterioration in β-cells function. Glucagon-like peptide-1 (GLP-1) has been revealed to protect and improve pancreatic β-cell function against lipotoxicity. However, the mechanism behind these is largely unknown. The aim of this study was to investigate the effects of GLP-1 on cholesterol-induced lipotoxicity in INS-1 cells and examine the underlying mechanisms. The cell viability was determined, and caspase-3 was used to assess the effects of GLP-1 on cholesterol-induced apoptosis. The alterations of miR-27a and ABCA1 resulting from incubation with cholesterol or GLP-1 were detected by real-time PCR and western blot. The inhibition and overexpression of miR-27a were established to explore the effects of a GLP-1-mediated decrease in miR-27a. Further, Oil red O staining and cholesterol measurement were used to detect lipid accumulation. The β-cells function was measured in glucose-stimulated insulin secretion. Our data shows that cholesterol significantly attenuated cell viability, promoted cell apoptosis, facilitated lipid accumulation, and impaired β-cells function, and these effects were significantly reversed by GLP-1. Furthermore, the results demonstrated that GLP-1 decreased miR-27a expression and increased the expression of ABCA1. In conclusion, GLP-1 may affect cholesterol accumulation and β-cells dysfunction by regulating the expression of miR-27a and ABCA1.
1. Introduction Type 2 diabetes mellitus (T2DM) is characterized by insulin resistance and a gradual deterioration in β-cell function. Lipotoxicity in which toxic lipids accumulate, is considered one of the major causes for the degradation in β-cell function [1,2]. Most studies examining the link between lipotoxicity and T2DM have focused on free fatty acids (FFAs), but the role of cholesterol in regulating β-cell function and survival is poorly understood [3,4]. ATP binding cassette transporter A1 (ABCA1) is an integral membrane protein, that transports intracellular cholesterol and phospholipid to apolipoprotein acceptors by using ATP as energy [5,6]. Hypercholesterolemic apolipoprotein E (apoE) knockout mice display impairment in insulin secretion associated with decreased islet ABCA1 expression and increased islet cholesterol [7]. Mice with a β-cell-specific inactivation of ABCA1 had notably impaired glucose tolerance and defective insulin secretion but normal insulin sensitivity [3,8]. Consequently, ABCA1-mediated cholesterol efflux is a pivotal determinant of the appropriate maintenance of both cholesterol levels and insulin secretion [9]. In this study, we investigate how GLP-1 contributes to
⁎
increasing cholesterol efflux by regulating ABCA1. Glucagon-like peptide 1 (GLP-1) as a new treatment for T2DM, not only has hypoglycemic effect, but also plays a significant role in regulating lipid metabolism [10,11]. GLP-1 plays a unique role in modulating lipid metabolism via lipid assimilation and transport, fat formation and decomposition, hepatic lipid metabolism,and cholesterol transport [12]. The apolipoprotein A-I (apo A-I) gene is considered to encode for the primary anti-atherogenic factor in high-density lipoprotein (HDL) particle. Apo A-I secretion was enhanced in both GLP-1 and exendin-4-treated HepG2 cells, and this was combined with similar changes in the ABCA1 mRNA levels [13]. Activation of the CaMKK/ CaMKIV cascade by exendin-4 promoted ABCA1 gene transcription,suggesting that exendin-4 plays a crucial role in cholesterol content and insulin secretion in β-cells [14–16]. However, the mechanism by which GLP-1 improves β-cell dysfunction via ABCA1 in INS1 cells remains unclear. MicroRNAs (miRNAs) are a class of small (22 -nt) non-coding RNAs that are involved in the post-transcriptional regulation of their target genes in a sequence-specific manner. MiRNAs are key regulators of lipid synthesis, fatty acid oxidation and lipoprotein formation and secretion.
Corresponding author. E-mail address: [email protected] (Q. Li).
http://dx.doi.org/10.1016/j.biopha.2017.10.049 Received 17 June 2017; Received in revised form 21 September 2017; Accepted 9 October 2017 0753-3322/ © 2017 Published by Elsevier Masson SAS.
Biomedicine & Pharmacotherapy 96 (2017) 497–502
Y. Yao et al.
shown below: microRNA-27a mimics, sense 5′- UUCACAGUGGCUAAGUUCCGC -3′; antisense 5′- GGAACUUAGCCACUGUGAAUU -3′; microRNA-27a inhibitor, 5′- GCGGAACUUAGCCACUGUGAA -3′; microRNA NC-FAM, sense 5′- UUCUCCGAACGUGUCACGUTT -3′; antisense 5′- ACGUGACACGUUCGGAGAATT -3′.
Emerging evidence suggests that miRNAs are involved in lipid metabolism, including miR-33, miR-122, miR27a/b, miR378, miR-34a, miR370 and miR-21 [17–20]. MiR-27a/b targets the 3′UTR of ABCA1 and downregulates the expression of this gene [21]. Many studies have identified significant roles for miR-27a/b in lipid metabolism [22,23], inflammation [24], adipogenesis, oxidative stress and insulin resistance, which play important roles in T2DM [25]. This study investigates the efficacy of GLP-1 on improving β-cells cholesterol metabolism and secretion function through miR-27a/ABCA1 in INS-1 cells.
2.6. RNA extraction and quantitative PCR Total RNA was extracted from INS-1 cells using the Trizol reagent (Invitrogen, Waltham, USA). Reverse transcription was performed using a Transcriptor First Strand cDNA Synthesis Kit (Roche, Germany). qRT-PCR reactions were carried out using the Fast Start Universal SYBR Green Master (Roche, Germany) with CFX96 real time PCR detection system (Bio-Rad, USA). U6 small RNA and GAPDH were used as the reference gene. Each reaction was carried out in triplicate, and the qRTPCR results were calculated using the 2−ΔΔCt method [27]. The primer sequences were as follows: ABCA1, forward (5′- AATGGTCAATGGGAGGTTCA -3') and reverse (5′- TGGACAGGCTTTAGGTCAGG -3'); GAPDH, forward (5′- GCCAGCCGAGCCACAT -3') and reverse (5′- GGATCTCGCTCC TGGAAGAT -3'); rno-miR-27a, RT primer (5′GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCGG AA −3'), forward (5′- ATTGGCGGTTCACAGTGGCTAAG −3') and reverse (5′- ATCCAGTGCAGGGTCCGAGG −3'); U6, RT primer (5′- CGCTTCACGAATTTGCGTGTCAT −3'), forward (5′- GCTTCGGCAGCA CATATACTAAAAT -3') and reverse (5′- CGCTTCACGAATTTGCGT GTC AT -3').
2. Materials and methods 2.1. Cell culture The INS-1 pancreatic β-cell line derived from rat insulinoma (purchased from the basic medical institute of Chinese Academy of Medical Sciences,China) was cultured as previously described [26], in RPMI 1640 medium (HyClone, USA) containing 11.1 mM glucose and supplemented with 10% foetal bovine serum (GIBCO, USA), 10 mmol/L HEPES, 2 mmol/L L-glutamine,1 mmol/L sodium pyruvate, 55 mol/L beta-mercaptoethanol, 100 IU/ml penicillin, and 100 g/ml streptomycin. The cells were cultured at 37 °C in a 5% CO2 environment. 2.2. Lipotoxicity and GLP-1 incubation The cells were cultured after 12 h, treated or not treated with 5 mmol/L soluble cholesterol (Sigma, USA) medium to exert a lipotoxicity effect for 24 h, and then maintained with or without 10 nmol/L GLP-1 (Sigma, USA) for 24 h.
2.7. Protein extraction and Western blotting For protein extraction, the INS-1 cells were lysed with 200 μl of modified RIPA Lysis Buffer (Beyotime institute of Biotechnology, China) containing 1% PMSF (Beyotime institute of Biotechnology, China) on ice. The proteins were quantified using the BCA method. Subsequently, 30 μg of proteins were fractionated by sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) electrophoresis and transferred to polyvinylidene fluoride (PVDF) membranes (GE Healthcare, USA). The membrane was incubated with primary antibodies to ABCA1 (1:500, ab18180) or GAPDH (1:10000, ab181602) (Abcam, USA). After the secondary antibody (Cell Signaling Technology, Danvers, USA) was probed for 2 h, the blots were developed using an enhanced chemiluminescence kit (Beyotime institute of Biotechnology, China).
2.3. Measurement with the cell counting kit-8 (CCK-8) This assay was assessed by cultivating INS-1 cells in 96-well plates at a density of 5000 cells/well for 24 h. The cells were exposed to various concentrations of cholesterol (1.0, 2.5, 5 and 10 mmol/L), with or without 10 nmol/L GLP-1 for 24 h. After replacing the RPMI 1640 medium, 10 μl of CCK-8 reagent (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) was added to each well, and the 96-well plate was incubated in the dark at 37 °C for 2 h. The absorbance was measured at 450 nm in a microplate reader. 2.4. Caspase 3 analysis
2.8. Oil red O staining
The expression of caspase-3 is enhanced when cell apoptosis occurs and represents the degree of apoptosis to some extent. The activation level of caspase-3 was detected to explore cholesterol-induced apoptosis using the caspase-3 Activity Kit (Solarbio, China). In brief, after extraction of total cell proteins of each group, 10 μl protein was incubated with 90 μl of provided reaction buffer and 10 μl Ac-DEVD-pNA (2 mM) in 96-well plates at 37 °C for 2 h. Then, the reaction mixtures were measured at 405 nm in a microplate reader.
For lipid droplets observation, the INS-1 cells were plated in 6-well plates. After stimulation with cholesterol and GLP-1 for 24 h, each group was rinsed three times in PBS, fixed in 4% paraformaldehyde for 30 min, stained in freshly diluted oil red O for 15 min, decolorized in 70% ethanol solution for 15 s, re-dyed in haematoxylin staining solution for 30 s and rinsed in PBS twice. Finally, the intracellular lipid droplets were observed and photographed with an inverted microscope (Leica, Germany).
2.5. MiRNA transfection
2.9. Cholesterol manipulation
The INS-1 cells were plated until they were 50% confluent at the time of transfection. Oligonucleotide analogue and inhibitor which were chemically modified and synthesized were used to increase and decrease the expression of miR-27a in INS-1 cells. The microRNA-27a inhibitor, microRNA-27a mimics, microRNA NC-FAM (GenePharm Co. Ltd, China) and lipofectamine™ 3000 (Invitrogen, USA) were diluted in serum-free RPMI 1640 without antibiotics prior to being incubated at room temperature for 5 min. Then, diluted microRNAs were added to each tube of diluted Lipofectamine™ 3000 Reagent (1:1 ratio) separately. The oligonucleotide-lipo complexes were added to the cells for 24 h. Then cholesterol and GLP-1 were taken every other 24 h before further analysis. The sequences of mimics and inhibitors used are
The cholesterol content was quantitated in INS-1 cells using a cholesterol quantitation kit (BioVision, USA) according to the manufacturer's instructions. Briefly, 1 × 106 cells were extracted with 200 μl of chloroform: isopropanol: NP-40 (7:11:0.1) by a microhomogenizer. These lipid extracts were dried for 30 min in a vacuum and the residues were dissolved in 200 μl of cholesterol assay buffer by vortexing until the solution became cloudy. The reactions containing the cholesterol probe, enzyme mix, esterase, assay buffer and samples or standards were incubated at 37 °C for 1 h. Then the absorbance of extraction was measured at 570 nm in a microplate reader [28]. 498
Biomedicine & Pharmacotherapy 96 (2017) 497–502
Y. Yao et al.
Fig. 1. GLP-1 treatment protected INS-1 cells against cholesterol (CHO)-mediated apoptosis. (Fig. 1A) The cells were treated with 1.0, 2.5, 5.0 or 10.0 mmol/L cholesterol for 24 h, and cell viability was used to perform the CCK-8 assay. (Fig. 1B) To detect the therapeutic effect of GLP-1 on cells suffering from lipotoxicity, the INS-1 cells were co-incubated with 5.0 mmol/ L or 10.0 mmol/L cholesterol concentrations and 10 nmol/L GLP-1 for 24 h.The relative cell viability was detected by CCK-8. (Fig. 1C) The relative activation of caspase 3 was determined in cells exposed to 5 nmol/L cholesterol with or without GLP-1 treatment for 24 h. The data are shown as the mean ± SD (n = 3). * P < 0.05, ** P < 0.01, *** P < 0.001.
in the expression of miR-27a were assessed by quantitative PCR. As shown in Fig. 2A and B, miR-27a expression was significantly reduced in INS-1 cells exposed to GLP-1 for 24 h. When the INS-1 cells were exposed to high cholesterol together with GLP-1, there was a significant reduction in the expression of miR-27a compared with the cells exposed to high cholesterol alone.
2.10. Glucose-stimulated insulin secretion measurements (GSIS) For insulin secretion, INS-1 cells were cultivated in 48-well plates. The INS-1 cells were preincubated for 1 h in Krebs-Ringer bicarbonate buffer, then incubated for 1 h in Krebs-Ringer bicarbonate buffer containing basal (2.8 mmol/L) or stimulatory (16.7 mmol/L) concentrations of glucose. The insulin levels were measured according to the rat insulin radioimmunoassay according to the manufacturer's protocol. The insulin secretion measurements were adjusted for the intracellular protein content [29].
3.3. The effect of GLP-1 treatment on ABCA1 expression The effect of GLP-1 on ABCA1 expression in INS-1 cells was determined by exposing the cells to 10 nmol/L of GLP-1 for 24 h. The results showed an increase in the abundance of the ABCA1 mRNA (Fig. 2C and D) and protein (Fig. 2E), regardless of whether the cells were in the normal or high cholesterol group. This finding was consistent with its stimulatory effect on the activity of the ABCA1 promoter [14].
2.11. Statistics The data were obtained from at least three independent experiments, presented as the mean ± standard deviation (SD), and analyzed using SPSS version 20.0 (SPSS Inc, Chicago, IL, USA). To compare the significance of two groups, Student’s t-test was performed. A P < 0.05 value was considered statistically significant.
3.4. The regulation of ABCA1 mRNA and protein expression by miR-27a
3. Results
To further investigate the interplay between GLP-1, miR-27a and ABCA1, miR-27a inhibition and overexpression experiments were established to explore the effects of GLP-1-mediated reduction in miR-27a on the mediators of cholesterol transport: ABCA1. To manipulate the expression of miR-27a in INS-1 cells, a miR-27a inhibitor, miR-27a mimics and a negative control (miRNA-NC-FAM) were used for transfection. Fluorescence microscopy was applied to observe and count green fluorescent cells to calculate transfection efficiency, which was greater than 65% in the cells (Fig. 3A and B). As shown in Fig. 3C–E, exposure of INS-1 cells to miR-27a-inhibitor resulted in a significant (P < 0.05) increase in both the expression of ABCA1 mRNA and protein. In contrast, INS-1 cells exposed to miR-27a-mimics showed a significant (P < 0.05) reduction in ABCA1 expression. These results indicate that GLP-1 reduces miR-27a expression and enhances the expression of ABCA1.
3.1. The toxicity of cholesterol accumulation and the effect of GLP-1 treatment on cell apoptosis To evaluate the toxic effect of cholesterol accumulation on INS-1 cells, the cells were incubated with different concentrations including 1.0, 2.5, 5.0, or 10.0 mmol/L for 24 h. With the increase of cholesterol concentration, the cell viability gradually decreased (Fig. 1A). To detect the therapeutic and protective effects of GLP-1 on cells suffering from lipotoxicity, the INS-1 cells were co-incubated with 5.0 mmol/L or 10.0 mmol/L cholesterol concentrations and with or without 10 nmol/L GLP-1 for 24 h. We found that cell viability was substantially increased after GLP-1 treatment except the 10 mmol/L cholesterol group. (Fig. 1B). We further explored the potential impact of cholesterol accumulation and GLP-1 treatment on the apoptosis of INS-1 cells by analysis of caspase-3 activity. We found that relative activities of caspase-3 was significantly increased in cholesterol group compared to the negative control, whereas the cholesterol group was markedly decreased after co-incubation with 5 mmol/L cholesterol and 10 nmol/L GLP-1 for 24 h (Fig. 1C).
3.5. The effect of GLP-1 on lipid accumulation and β-cell function INS-1 cells were cultured in RPMI-1640 containing 5 mmol/L cholesterol for 24 h and then stained with oil red O. We observed a large quantity of red lipid droplets in the INS-1 cells in high cholesterol group, whereas after the high cholesterol group was treated with GLP-1, the lipid accumulation displayed a significant reduction in the number of visible droplets. However, almost no lipid droplets were detected in the INS-1 cells in the negative control and GLP-1 group (Fig. 4A and B). As shown in Fig. 4C, the intracellular cholesterol level was significantly higher in the cholesterol group than in the normal group, whereas the
3.2. GLP-1 treatment contributes to changes in miR-27a expression To investigate the relationship between GLP-1 and miR-27a, the INS-1 cells were cultivated in media containing either normal cholesterol or high cholesterol alone or with GLP-1 for 24 h, and the changes 499
Biomedicine & Pharmacotherapy 96 (2017) 497–502
Y. Yao et al.
Fig. 2. Effect of GLP-1 treatment on the expression level of miR-27a and ABCA1. (Fig. 2A, B) The expression of miR-27a after treatment with 10 nmol/L GLP-1 in the presence of a normal concentration or 5 mmol/L cholesterol for 24 h. (Fig. 2C–E) The relative expression of ABCA1 mRNA and protein after incubated with 10 nmol/L GLP-1 in the presence of a normal concentration or 5 mmol/L cholesterol for 24 h. The real-time quantitative PCR results are presented as 2−ΔΔCT normalized to GAPDH expression (mean ± SD). * P < 0.05, ** P < 0.01.
similar results. As previously reported [30], GLP-1 attenuates FFA-induced lipotoxic oxidative stress in the pancreas via a mechanism that involves the regulation of microRNAs. However, it is not known whether miR-27a mediates the protective effects of GLP-1 on ABCA1 expression and β-cell function in hypercholesterolemia. As shown in Fig. 4E, at the basal (2.8 mmol/L) concentration of glucose, insulin secretion was reduced in the cholesterol group, whereas a 4.1-fold increase was observed following GLP-1 treatment. At the stimulatory
level of intracellular cholesterol in the cholesterol group was markedly decreased after incubation with 10 nmol/L GLP-1 for 24 h. We further investigated the effects of GLP-1 on lipid accumulation in INS-1 cells with an inhibition or overexpression of miR-27a. As shown in Fig. 4D, exposuring the INS-1 cells to the miR-27a-inhibitor resulted in a significant reduction in cholesterol measurement. In contrast, the INS-1 cells that were exposed to miR-27a-mimics showed a significant increase. The Oil red O staining and cholesterol measurement showed
Fig. 3. Expressions of ABCA1 transfected with the miR-27a inhibitor or mimics. (Fig. 3A) Images of the INS-1 cells were captured using a fluorescence microscope and a conventional microscope after being transfected with lipo3000 and miRNA-NC-FAM. (Fig. 3B) The relative expression of miR-27a was measured after transfection by real-time quantitative PCR. (Fig. 3C–E) The mRNA (C,D) and protein (E) expression of ABCA1 were analyzed after overexpression and inhibition of miR-27a by transfection. * P < 0.05, ** P < 0.01.
500
Biomedicine & Pharmacotherapy 96 (2017) 497–502
Y. Yao et al.
Fig. 4. Effect of GLP-1 on lipid accumulation and GSIS. (Fig. 4A) INS-1 cells were exposed to 5.0 mmol/L cholesterol with or without 10 nmol/L GLP-1 for 24 h and stained with oil red O (×200). (Fig. 4B) MiR-27a mimics and miR-27a inhibitor on the impact of lipid droplets in INS-1 cells (×200). (Fig. 4C) The relative expression intracellular cholesterol in INS-1 cells. (Fig. 4D) MiR-27a mimics and miR-27a inhibitor on the impact of intracellular cholesterol. * P < 0.05, ** P < 0.01, *** P < 0.001.
survival rate could also cannot be rescued. This phenomenon may indicate that when treating patients with serious lipid metabolism disorder, both a more adequate dose of therapeutic drugs and early intervention are necessary. Furthermore, we demonstrated that the apoptosis-related factor caspase-3 was activated, suggesting that cholesterol induced INS-1 cell apoptosis via intrinsic pathways. Our results are consistent with previous studies on Rin-m5f cells and SH-SY5Y cells [32,33]. In recent studies, some miRNAs have been identified to be involved in the regulation of lipid accumulation. Of those, the expression of miR27 was found to be increased in fat tissue of obese mice. Importantly, the expression of miR-27 inhibited the expression of PPAR-γand C/EBPα, the two master regulators of adipogenesis [34,35]. It has been reported that GLP-1 participates in lipid metabolism through various mechanisms. Therefore, our studies showed the relationship between GLP-1 and miR-27a in lipid metabolism. The results suggest that treatment with GLP-1 may decrease the expression of miR-27a, with or without cholesterol. Therefore, GLP-1 may play a significant role by inhibiting miR-27a, which acts as a new therapeutic approach for metabolic diseases aimed at decreasing the lipid accumulation. ABCA1 is a plasma membrane protein that regulates the efflux of intracellular cholesterol and phospholipids to an apolipoprotein acceptor. Because non-hepatic cells are unable to degrade cholesterol, ABCA1 plays an important role in modulating intracellular cholesterol homeostasis. ABCA1 knockoff mice displayed defects glucose tolerance but had normal insulin sensitivity, suggesting that the β-cell function of these mice was impaired. Therefore, ABCA1 in pancreaticβ-cells influences insulin secretion and glucose homeostasis [8,15,16]. In this study, we explored not only the effect of GLP-1 on the improvement of ABCA1, but also the interaction between ABCA1 and miR-27a. Subsequently, we also explored the impact of miR-27a knockdown and overexpression on
(16.7 mmol/L) concentration of glucose, GLP-1 still had a significant effect on insulin secretion. However, the cholesterol group showed a remarkable reduction in GSIS.
4. Discussion T2DM is often combined with disordered blood lipid and lipoprotein levels which is also termed as diabetic dyslipidaemia. However, most studies on the link between dyslipideamia and T2DM have focused on free fatty acids (FFAs). Hao et al. established a cholesterol overload model by incubating pancreatic β-cells with 10 mmol/L soluble cholesterol [4]. In this study, the INS-1 cells were treated with 5 mmol/L soluble cholesterol, which was higher than normal culture medium, and this did not lead to rapid cell death or damage than 10 mmol/L cholesterol. Our results suggest that redundant intracellular cholesterol plays an important role in β-cell dysfunction and may be a key factor in the progression of T2DM. In addition, using GLP-1 as a therapy for treating T2DM, not only improves β-cell function, but also regulates lipid metabolism in numerous ways [12,31]. The level of plasma cholesterol often increases in T2DM patients except FFAs. However, the mechanism of GLP-1 in improving hypercholesterolemia from pancreatic β-cells is not fully clear. GLP-1 has been revealed to protect pancreatic β-cells against lipotoxicity. This study showed the protective effects of GLP-1 against cholesterol-induced lipotoxicity at different concentration via the CCK8 assay. The apoptotic rate of INS-1 cells treated with cholesterol was higher than cholesterol together with GLP-1, which suggests that GLP-1 acts as a defender against apoptosis. With an increasing concentration of cholesterol, the cell survival rate decreased gradually. It is worth noting, however, that when the concentration of cholesterol reached 10 mmol/L and the cells were treated with 10 nM GLP-1, the cell 501
Biomedicine & Pharmacotherapy 96 (2017) 497–502
Y. Yao et al.
Med. 13 (2007) 340–347. [9] M.R. Rickels, E.S. Goeser, C. Fuller, et al., Loss-of-function mutations in ABCA1 and enhanced β-cell secretory capacity in young adults, Diabetes 64 (2015) 193–199. [10] C. Xiao, S. Dash, C. Morgantini, et al., Gut peptides are novel regulators of intestinal lipoprotein secretion: experimental and pharmacological manipulation of lipoprotein metabolism, Diabetes 64 (2015) 2310–2318. [11] A.K. Sharma, P.V. Thanikachalam, S.K. Rajput, Albiglutide is a better hope against diabetes mellitus? Biomed. Pharmacother. 77 (2016) 120–128. [12] V.J. Patel, A.A. Joharapurkar, G.B. Shah, et al., Effect of GLP-1 based therapies on diabetic dyslipidemia, Curr. Diabetes Rev. 10 (2014) 238–250. [13] J.M. Chehade, R. Alcalde, E. Naem, et al., Induction of apolipoprotein A-I gene expression by glucagon-like peptide-1 and exendin-4 in hepatocytes but not intestinal cells, Metabolism 62 (2013) 265–274. [14] Y. Miyai, K. Murao, H. Imachi, et al., Exendin-4 regulates the expression of the ATPbinding cassette transporter A1 via transcriptional factor PREB in the pancreatic β cell line, Endocrinol. Invest. 34 (2011) e268–274. [15] A.M. Mostafa, N.M. Hamdy, H.O. El-Mesallamy, et al., Glucagon-like peptide 1 (GLP-1)-based therapy upregulates LXR-ABCA1/ABCG1 cascade in adipocytes, Biochem. Biophys. Res. Commun. 468 (2015) 900–905. [16] J. Li, K. Murao, H. Imachi, et al., Exendin-4 regulates pancreatic ABCA1 transcription via CaMKK/CaMKIV pathway, Cell Mol. Med. 14 (2010) 1083–1087. [17] Z. Yang, T. Cappello, L. Wang, et al., Emerging role of microRNAs in lipid metabolism, Acta. Pharm. Sin. B 5 (2015) 145–150. [18] J. Sacco, K. Adeli, MicroRNAs: emerging roles in lipid and lipoprotein metabolism, Curr. Opin. Lipidol. 23 (2012) 220–225. [19] C. Wang, Q. Li, W. Wang, et al., GLP-1 contributes to increases in PGC-1a expression by downregulating miR-23a to reduce apoptosis, Biochem. Biophys. Res. Commun. 466 (2015) 33–39. [20] N. Wijesekara, L.H. Zhang, M.H. Kang, et al., MiR-33a modulates ABCA1 expression, cholesterol accumulation, and insulin secretion in pancreatic islets, Diabetes 61 (2012) 653–658. [21] M. Zhang, J.F. Wu, W.J. Chen, et al., MicroRNA-27a/b regulates cellular cholesterol efflux, influx and esterification/hydrolysis in THP-1 macrophages, Atherosclerosis 234 (2014) 54–64. [22] F.M. Perez-Campo, I. De Castro-Oros, A. Noriega, et al., Functional analysis of new 3’untranslated regions genetic variants in genes associated with genetic hypercholesterolemias, J. Clin. Lipidol. 11 (2017) 532–542. [23] M.L. Alvarez, M. Khosroheidari, E. Eddy, et al., MicroRNA-27a decreases the level and efficiency of the LDL receptor and contributes to the dysregulation of cholesterol homeostasis, Atherosclerosis 242 (2015) 595–604. [24] W. Xie, L. Li, M. Zhang, et al., MicroRNA-27 prevents atherosclerosis by suppressing lipoprotein lipase-induced lipid accumulation and inflammatory response in apolipoprotein E knockout mice, PLoS One 11 (2016) e0157085. [25] C. Jennewein, A. von Knethen, T. Schmid, et al., MicroRNA-27b contributes to lipopolysaccharide-mediated peroxisome proliferator-activated receptor gamma (PPARgamma) mRNA destabilization, J. Biol. Chem. 285 (2010) 11846–11853. [26] M. Asfari, D. Janjic, P. Meda, et al., Establishment of 2-mercaptoethanol-dependent differentiated insulin-secreting cell lines, Endocrinology 130 (1992) 167–178. [27] T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative C(T) method, Nat. Protoc. 3 (2008) 1101–1108. [28] R. Dubey, R. Chhabra, N. Saini, Small interfering RNA against transcription factor STAT6 leads to increased cholesterol synthesis in lung cancer cell lines, PLoS One 6 (2011) e28509. [29] S. Del Guerra, R. Lupi, L. Marselli, et al., Functional and molecular defects of pancreatic islets in human type 2 diabetes, Diabetes 54 (2005) 727–735. [30] Z. Zhang, H. Liu, Q. Li, Glucagon-like peptide-1 effects lipotoxic oxidative stress by regulating the expression of microRNAs, Biochem. Biophys. Res. Commun. 482 (2017) 1462–1468. [31] J. Seufert, B. Gallwitz, The extra-pancreatic effects of GLP-1 receptor agonists: a focus on the cardiovascular, gastrointestinal and central nervous systems, Diabetes Obes. Metab. 16 (2014) 673–688. [32] C. Gleizes, G. Kreutter, M. Abbas, et al., β-cell membrane remodelling and procoagulant events occur in inflammation-driven insulin impairment: a GLP -1 receptor dependent and independent control, J. Cell Mol Med 20 (2016) 231–242. [33] X.Y. Liu, L.X. Wang, Z. Chen, et al., Liraglutide prevents beta-amyloid-induced neurotoxicity in SH-SY5Y cells via a PI3K-dependent signaling pathway, Biochem. Biophys. Res. Commun. 468 (2015) 900–905. [34] L. Sun, M. Trajkovski, MiR-27 orchestrates the transcriptional regulation of brown adipogenesis, Metabolism 63 (2014) 272–282. [35] Q. Lin, Z. Gao, R.M. Alarcon, et al., A role of miR-27 in the regulation of adipogenesis, FEBS J. 276 (2009) 2348–2358.
ABCA1 expression in INS-1 cells. It was shown that miR-27a may directly controlled the expression of ABCA1 mRNA and protein. The results demonstrated that GLP-1 may increase the expression of ABCA1 by suppressing miR-27a in INS-1 cells, then attenuated the intracellular lipid accumulation and improved β-cell function in GSIS. The progression of β-cell dysfunction is highly related to the disorder of lipid metabolism. MiR-27a can inhibit cholesterol efflux by suppressing the expression of ABCA1 [21]. In the present work, we demonstrated that GLP-1 effects cholesterol accumulation and β-cells dysfunction probably by regulating the expression of miR-27a and ABCA1. Our data point to miR-27a as an upstream regulator of the transcriptional network involved in lipid mechanism, and suggest miR27a inhibition as a new therapeutic method for diabetes-associated dyslipidaemia with the view of increasing the expression of ABCA1. It also shows that the modulation of intracellular cholesterol may be a potential target for therapy aimed at improving GSIS function in β-cells. In summary, our studies provide mechanistic evidence that therapeutic intervention with GLP-1 decreases hypercholesterolemia-associated impairment, possibly by the regulating of miR-27a levels, which in turn enhance ABCA1 expression, thus shedding more light on potential novel therapeutic approaches to reverse lipid mechanism disorder. However, our understanding of the relationship between miR-27a and GLP-1 is still at an early stage. A better understanding of the mechanisms whereby miR-27a regulates the lipid metabolism by targeting different signaling pathways may enable the development of miR-27amediated therapy. Conflict of interests The authors declare that they have no conflict of interests. Acknowledgment This study was supported by “National Natural Science Foundation of China (NSFC)” (No. 81370902) References [1] V. Poitout, R.P. Robertson, Minireview Secondary beta-cell failure in type 2 diabetes-a convergence of glucotoxicity and lipotoxicity, Endocrinology 143 (2002) 339–342. [2] M. Cnop, N. Welsh, J.C. Jonas, et al., Mechanisms of pancreatic beta-cell death in Type 1 and Type 2 diabetes: many differences few similarities, Diabetes 54 (Suppl) (2005) 97–107. [3] L.R. Brunham, J.K. Kruit, C.B. Verchere, et al., Cholesterol in islet dysfunction and type 2 diabetes, Clin. Invest. 118 (2008) 403–408. [4] M. Hao, W.S. Head, S.C. Gunawardana, et al., Direct effect of cholesterol on insulin secretion: a novel mechanism for pancreatic beta-cell dysfunction, Diabetes 56 (2007) 2328–2338. [5] J.F. Oram, R.M. Lawn, ABCA1. The gatekeeper for eliminating excess tissue cholesterol, Lipid Res. 42 (2001) 1173–1179. [6] X.W. He, D. Yu, W.L. Li, et al., Anti- atherosclerotic potential of baicalin mediated by promoting cholesterol efflux from macrophages via the PPARgamma-LXRalphaABCA1/ABCG1 pathway, Biomed. Pharmacother. 83 (2016) 257–264. [7] J.K. Kruit, P.H. Kremer, L. Dai, et al., Cholesterol efflux via ATP- binding cassette transporter A1 (ABCA1) and cholesterol uptake via the LDL receptor in fluences cholesterol-induced impairment of beta cell function in mice, Diabetologia 53 (2010) 1110–1119. [8] L.R. Brunham, J.K. Kruit, T.D. Pape, et al., Beta-cell ABCA1 influences insulin secretion, glucose homeostasis and response to thiazolidinedione treatment, Nat.
502