Glucose-dependent insulinotropic peptide signaling pathways in endothelial cells

Peptides 21 (2000) 1427–1432

Short communication

Glucose-dependent insulinotropic peptide signaling pathways in endothelial cells Q. Zhonga, R. J. Bollaga, D. T. Dransfielda,b, J. Gasalla-Herraiza, K.-H. Dinga, L. Mina, C. M. Isalesa,b,* a

Institute of Molecular Medicine and Genetics, Dept. of Medicine, Medical College of Georgia, Augusta, GA 30912, USA b Augusta VAMC, Augusta, GA 30912, USA Received 28 March 2000; accepted 1 June 2000

Abstract Glucose-dependent insulinotropic peptide (GIP) potentiates glucose-induced insulin secretion. In addition, GIP has vasoconstrictive or vasodilatory properties depending on the vascular bed affected. In order to assess whether this effect could be related to differences in GIP receptor expression, several different endothelial cell types were examined for GIP receptor expression. GIP receptor splice variants were detected and varied depending on the endothelial cell type. Furthermore, stimulation of these cells with GIP led to cell type dependent differences in activation of the calcium and cAMP signaling pathways. To our knowledge this is the first physiological characterization of receptors for GIP in endothelial cells. © 2000 Elsevier Science Inc. All rights reserved. Keywords: Endothelium; Glucose-dependent insulinotropic polypeptide; Peptide hormone receptors; Splice variants

1. Introduction Glucose-dependent insulinotropic peptide (GIP) is secreted from the small intestine in response to nutrients and is known to potentiate glucose-induced insulin secretion [5]. In addition GIP may maximize nutrient absorption by modulating portal blood flow. GIP has been reported to both increase hepatic portal venous flow and induce vasoconstriction of the hepatic artery [9], suggesting a direct vascular effect. The GIP receptor is widely distributed, displaying expression in the endothelium, intestine, brain, heart, adipose tissue and inner layers of the adrenal cortex, although no receptors are present on smooth muscle [16]. The receptor for GIP is a member of a family of seven transmembrane domain G-protein coupled receptors that includes those for calcitonin, corticotrophin releasing factor, glucagon, glucagon-like peptide 1, pituitary adenylate cyclase activating polypeptide, vasoactive intestinal peptide, secretin and growth hormone releasing hormone [16]. Only a single GIP receptor gene has been reported, which raises the question of the mechanism by which GIP induces both

* Corresponding author. Tel.: ⫹1-706- 721-0692; fax: ⫹1-706-721-7915. E-mail address: [email protected] (C.M. Isales).

vasoconstriction and vasodilatation in different vascular beds. To evaluate whether these differences in vascular response could be related to differences in the GIP receptor itself or to differences in GIP activation of signal transduction pathways, we used human endothelial cells from various vascular beds. We report, for the first time, that signal transduction pathways in different endothelial cell types are activated to different extents by GIP, which may account for some of the paradoxical effects of GIP on blood flow in vivo.

2. Methods 2.1. Reagents GIP was from Bachem, Inc. (Torrance, CA). Fura 2-AM was purchased from Molecular Probes (Eugene, OR). [32P]8-N3-cAMP was from ICN (Costa Mesa, CA). 2.2. Cell culture For these studies, we used the immortalized human umbilical vein endothelial cell line ECV 304 (ATCC, Gaithersburg, MD) [15], as well as endothelial cells from normal human umbilical vein (HUVEC), pulmonary vein (HPAEC)

0196-9781/00/$ – see front matter © 2000 Elsevier Science Inc. All rights reserved. PII: S 0 1 9 6 - 9 7 8 1 ( 0 0 ) 0 0 2 8 7 - 4

1428

Q. Zhong et al. / Peptides 21 (2000) 1427–1432

and aortic (HAEC) vessels (Clonetics, San Diego, CA). Cells were grown to confluence in Medium 199 (Whittaker biologic products, San Diego, CA) or EGM (endothelial growth medium, Clonetics, San Diego, CA), supplemented with 10% or 2% fetal calf serum (FCS) (v:v), respectively (HyClone Laboratories, Inc., Logan, UT), penicillin (100 U/ml), streptomycin (100 mg/ml), and amphotericin B (3 mg/ml). 2.3. RNA isolation, reverse transcriptase polymerase chain reaction (PCR) and southern blotting Endothelial cells (EC) were washed with phosphatebuffered saline (PBS, pH 7.4) buffer and RNA extracted using Trizol (Life Technologies, Gaithersburg, MD). Optical density (260/280 nm) was measured for RNA quantitation and assessment. A coupled reverse transcriptase PCR (RT-PCR) was utilized [3]. The sense (CTGCCTGCCGCAC-GGCCCAGAT) and antisense (GCGAGCCAGCCTCAGCCGGTAA) oligonucleotide primers for the GIP receptor (GIPR) were synthesized based on its reported sequence (accession number U39231). Briefly, reverse transcription of 2 ␮g total RNA for GIPR was performed using the Moloney murine leukemia virus reverse transcriptase (Life Technologies, Gaithersburg, MD). The resulting GIP cDNA samples were then amplified by the PCR utilizing 0.025 U/␮l AmpliTaq (Perkin Elmer, Norwalk, CT), 200 ␮M deoxyribonucleotides and 0.2 ␮M of sense and antisense primers for GIPR in a thermocycler (Perkin Elmer-Cetus). The PCR products were fractionated by electrophoresis on a 1.5% agarose gel and then transferred overnight to a nylon membrane (Zetabind, American Bioanalytical, Natick, MA). The membranes were probed for GIPR using a cloned PCR fragment amplified with the GIPR primers and verified by sequence analysis. The probe was labeled with 32P by random primer labeling (Amersham Pharmacia Biotech, Piscataway, NJ). 2.4. Western analyses A polyclonal antibody was generated in rabbit to a synthetic oligopeptide, SKGQTAGELYQRWERYRREC, corresponding to an extracellular region of the human GIP receptor protein sequence and tested as described [1]. Confluent EC cells (500,000/pair of lanes) were scraped into ice-cold PBS and disrupted by sonication for 60 s in ice-cold homogenization buffer (60 mM Tris buffer, pH 7.4, 0.25 M sucrose, 10 mM EGTA, 2 mM EDTA, 10 mM ␤-mercaptoethanol, and protease inhibitors). Proteins were placed in sample buffer (0.5 M Tris, pH 6.8, 4% SDS, 20% glycerol, 0.1% bromophenol blue) and boiled. The denatured proteins were separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) (SDS-PAGE) and incubated with affinity-purified

GIP receptor antibody at 1:250 dilution. Immunoreactive bands were visualized with a horseradish peroxidase-conjugated secondary goat anti-rabbit serum and developed with ECL (Pierce, Rockford, IL). 2.5. Intracellular calcium measurements Intracellular calcium was measured as previously described [6]. Briefly, endothelial cells were loaded with the calcium sensitive dye fura-2AM (1 ␮M for 45 min at room temperature) in modified Krebs-Ringer bicarbonate (KRB) buffer. The cells were washed placed in KRB for an additional 30 min and then centrifuged and placed in a dual-wavelength spectrophotometer (Photon Technologies International, South Brunswick, New Jersey). Fluorescence was then measured using excitation wavelengths of 340 and 380 nm and an emission wavelength of 510 nm. Autofluorescence was measured in unloaded cells and this value subtracted from all the measurements. Free intracellular calcium concentration was calculated using the equation: [Ca2⫹] ⫽ Kd x b(R- Rmin)/(Rmax - r) with a Kd assumed to be 135 nM [7]. 2.6. Photoaffinity labeling with [32P]8-azidoadenosine 3⬘:5⬘-mono phosphate (8-N3cAMP) This reagent was used to label the Protein kinase A regulatory subunits and thus provide an indirect measurement of kinase activity and isoform specificity [4]. Briefly, cells were incubated with the appropriate agonist and the reaction was stopped by addition of a lysis buffer and the cell homogenate separated into membrane and cytosolic fractions by centrifugation. Cell extracts (10␮g) were then labeled with 1␮Ci 8-N3-cAMP in 50 mM HEPES, pH 7.0, 10 mM MgCl2 and 100␮M IBMX for 3 min on ice with gentle shaking. The labeled samples were then subjected to UV crosslinking (60% full power) for 30 s in a Stratalinker (Stratagene, La Jolla, CA), prior to being resolved on a 10% SDS-PAGE gel and visualized by autoradiography. Densitometry was performed using a Molecular Dynamics PhosphorImager (n ⫽ 4). 2.7. Statistics Results are expressed as mean ⫾ SEM. Experiments were performed in triplicate except where noted. Data were analyzed using either ANOVA or unpaired t tests, where appropriate, with a commercial statistical package (Instat, Graphpad Inc., San Diego, CA). 3. Results 3.1. GIPR message and protein are present in endothelial cells Initial experiments on GIP receptor PCR-amplified message in the 383 bp region between nts 740 and 1122 (cDNA

Q. Zhong et al. / Peptides 21 (2000) 1427–1432

1429

Fig. 1. Endothelial cells possess GIP receptor transcripts and protein A. Southern blot- Total RNAs obtained from different endothelial cells were reverse transcribed and the cDNAs were amplified using GIP receptor-specific primers. The gel was blotted and hybridized with a specific GIP receptor probe. Lane1 - primary rat islets of Langerhans, 2 - ECV 304, 3 -primary human umbilical vein endothelial cells, 4 - human primary pulmonary artery endothelial cells, 5 - human primary aortic endothelial cells. Not shown are controls showing that no fragments are obtained without input of cDNA. As confirmed by sequence analysis, expected product size is 383 bp. B. Western blot- An affinity-purified polyclonal GIP receptor (GIPR) antibody was utilized for Western blot analysis. As a positive control, we generated a recombinant bacterially expressed protein corresponding to the amino terminus of the GIPR fused to GST. A single immunoreactive band was present in ECV and normal human umbilical vein (HUV), human aortic (HA) and human pulmonary artery (HPA) endothelial cells. Tissue homogenate from mouse heart (HRT), a tissue known to contain the GIPR was positive.

of GenBank accession number U39231) revealed that several splice variants were present, and that these splice variants differed depending on the type of EC studied (Fig. 1A). While all cells contained the expected 383 bp band, HUVEC contained only two bands in contrast to the ECV 304, which contained four bands. Both the HPAEC and the HAEC contained three similar bands. Based on sequence analysis, the informative splice variants corresponded to usage of alternative donor and acceptor splice sequences in the region of intron 8/exon 9 (genomic sequence of GenBank accession number AC006132) within the fourth trans-

membrane domain. These ostensibly result in truncation of the protein within transmembrane domain 4 as described by Volz et al. [17]. To further evaluate the GIPR in these cells, an affinitypurified polyclonal antibody to a peptide comprising part of the N-terminal extracellular domain of the human GIP receptor was generated and used for western blot analysis. The four endothelial cell lines (ECV 304, HUVEC, HPAEC and HAEC) contain a single immunoreactive band that corresponds to the predicted size of the GIP receptor (Fig. 1B). This same 50 kDa immunoreactive band was observed

1430

Q. Zhong et al. / Peptides 21 (2000) 1427–1432

Fig. 2. GIP increases [Ca2⫹]i and PKA activity in vascular endothelial cells. A. Endothelial cells were loaded with the calcium sensitive probe, Fura-2 and stimulated with increasing concentrations of GIP. Shown in the upper panel are the means ⫾ SEM of changes in cytosolic calcium over baseline induced by GIP in either (ECV), human umbilical vein (HUVEC) or human pulmonary artery (HPAEC) endothelial cells. The changes in cytosolic calcium induced by GIP were much smaller for ECV 304 than those for HUVEC. * ⫽ P ⬍ 0.01; ⫹ ⫽ P ⬍ 0.001. B. Various endothelial cell types, as indicated below, were incubated at a concentration of 7 ⫻ 106 cells/ml in the presence or absence of 10 nM GIP for 10 min. ECV 304 (panel 1), primary human umbilical vein endothelial cells (panel 2), primary human pulmonary artery endothelial cells (panel 3) and primary human aortic endothelial cells (panel 4). C, cytosol; M membrane. In each panel the first two lanes represent control and the next two lanes represent stimulation with GIP (10 nM for 10 min).

Q. Zhong et al. / Peptides 21 (2000) 1427–1432

in normal rat heart, which is known to contain the GIPR [16]. 3.2. GIP induces an increase in intracellular calcium and activates protein kinase A Prior reports had implicated both the calcium and adenylate cyclase second messenger pathways as being involved in GIP’s mechanism of action in stimulating insulin secretion [11,12]. Thus we first examined the effect of GIP on cytosolic calcium concentration. GIP was found to dose dependently stimulate increases in [Ca2⫹]i but the magnitude of the response varied depending on the endothelial cell studied (Fig. 2A). For HUVEC and HPAEC the rise in intracellular calcium was consistent with mobilization from intracellular stores. In contrast, ECV 304 cells had a much smaller rise in intracellular calcium and the pattern of elevation of [Ca2⫹]i suggested a mechanism consistent with influx of extracellular calcium. This latter pattern of elevation in intracellular calcium is more similar to that reported for GIP effects on the hamster insulin tumor (HIT) cell line [11,12]. We next examined the effect of GIP on the PKA pathway. The relative contents of the two general forms of the regulatory subunits of PKA, RI and RII were initially examined in various cell types. In addition, using the 8-azidocAMP method direct protein kinase A activation was examined to determine which form of protein kinase A is activated under different experimental conditions. We found that GIP did not activate protein kinase A in the transformed umbilical vein endothelial cell line (ECV 304), or in the pulmonary artery and aortic endothelial cells. In contrast, GIP did activate protein kinase A in the umbilical vein endothelial cells. As can be seen in Fig. 2B, ECV 304 cells (2B.1.) contain a significant amount of RI subunit of PKA, consistent with the data that RI may be involved in proliferation, since ECV 304 is a transformed cell line. In addition, when we examined the effect of GIP on RII redistribution, only in the HUVEC did we observe a decrease in the membrane content of RII. As can be seen, GIP significantly decreased the 32 P label partitioning with the membrane fraction (lane 4) of panel 2 (primary HUVEC) signaling an increase in cAMP. GIP did not appear to have any effect on PKA activation in the other endothelial cells tested (n ⫽ 4). Changes in RI and RII redistribution were quantified by densitometry and were significant only for the HUVEC cells. These changes did not become significant until the higher doses of GIP (10–7M) were used: [1] RI: 84.5 ⫾ 0.5 vs. 99.5 ⫾ 1.5; % redistribution from control (100%); P ⬍ 0.01 HUVE vs. ECV 304 and [2] RII: 87.5 ⫾ 1.5 vs. 99.5 ⫾ 0.1; % redistribution from control (100%); P ⬍ 0.01 HUVE vs. ECV. 4. Discussion In their initial report of the cloning of the GIP receptor, Usdin et al. [16] reported the presence of the GIP receptor

1431

in the cardiac endothelium and in the large vessel endothelium. In other tissues (gastric parietal cells, adrenal cortex, islet ␤-cells and fat cells) [2,10,13,14,18] GIP seems to modulate the interaction of these target cells with other hormones (e.g., GIP modulates the effect of glucose on insulin secretion). There are intriguing reports of GIP infusion in dogs eliciting apparently opposite effects on the vasculature. In one study, the authors demonstrate an increase in superior mesenteric blood flow with no change in celiac blood flow [8]. In a subsequent study the authors demonstrate an increase in portal venous flow and a decrease in hepatic arterial flow [9]. This would suggest that GIP can modulate blood flow in different ways depending on the vascular bed. The data presented here clearly demonstrate that GIP can activate both the cAMP and the PI-PLC-calcium signaling pathways in endothelium. However, there are distinct differences between the GIP responses in ECV 304 (a spontaneously transformed human umbilical vein endothelial cell line) and normal human umbilical vein endothelial cells. Although the data presented do not prove that these differences in signal transduction pathway activation are related to differences in receptor splice variants, it is interesting that these two cell lines have differences in both number and kind of splice variants. Whether GIP plays an important physiologic role in blood flow modulation is not known. However, in view of the fact that GIP secretion appears to be limited to the small intestine and that the reported vasomodulatory effects are in the portal system, one could postulate that this may be a physiologic response to meal ingestion. Conceivably, when GIP is secreted in response to meal ingestion, increased blood flow in some vascular beds and decreased blood flow in other vascular beds may benefit digestion and nutrient absorption.

Acknowledgments Supported by a grant from the National Institutes of Health grant DK19813 to CMI and HD34149 to RJB. CMI is a recipient of an American Heart Association Southeast affiliate Grant in aid.

References [1] Bollag RJ, Zhong Q, Phillips P, Min L, Zhong L, Cameron R, Mulloy AL, Rasmussen H, Qin F, Ding KH, Isales CM. Osteoblast-derived cells express functional glucose-dependent insulinotropic peptide receptors. Endocrinology 2000;141:1228 –35. [2] Brown JC, Mutt V, Pederson RA. Further purification of a polypeptide demonstrating enterogastrone activity. J Physiol 1970;209:57– 64. [3] Diamond S, Sharefkin J, Dieffenbach C, Frasier-Scott K, McIntire L, Eskin S. Tissue plasminogen activator messenger RNA levels increase in cultured human endothelial cells exposed to laminar shear stress. J Cell Physiol 1990;143:364 –71.

1432

Q. Zhong et al. / Peptides 21 (2000) 1427–1432

[4] Dransfield DT, Bradford AJ, Goldenring JR. Distribution of A-kinase anchoring proteins in parietal cells. Biochim Biophys Acta 1995; 1269:215–20. [5] Fehmann HC, Goke R, Goke B. Cell and molecular biology of the incretin hormones glucagon-like peptide-I and glucose-dependent insulin releasing polypeptide. Endo Rev 1995;16:390 – 410. [6] Gasalla-Herraiz J, Rhee S, Isales CM. Calcium-sensitive probes for the measurement of intracellular calcium: effects of buffer system and magnesium concentration. Biochem Biophys Res Commun 1995; 214:373– 88. [7] Grynkiewicz G, Poenie M, Tsien R. A new generation of Ca2⫹ indicators with greatly improved fluorescence properties. J Biol Chem 1985;260:3440 –50. [8] Kogire M, Inoue K, Sumi S, Doi R, Takaori K, Yun M, Fuji N, Yajima H, Tobe T. Effects of synthetic human gastric inhibitory polypeptide on splanchnic circulation in dogs. Gastroenterology 1988;95:1636 – 40. [9] Kogire M, Inoue K, Sumi S, Doi R, Yun M, Kaji H, Tobe T. Effects of gastric-inhibitory polypeptide and glucagon on portal venous and hepatic arterial flow in conscious dogs. Dig Dis Sci 1992;37:1666 –70. [10] Lacroix A, Bolte E, Tremblay J, Dupre J, Poitras P, Fournier H, Garon J, Garrel D, Bayard G, Taillefer R, Flanagan RJ, Hamet P. Gastric Inhibitory Polypeptide-dependent cortisol hypersecretiona new cause of Cushing’s syndrome. N Engl J Med 1992;327: 974 – 80.

[11] Lu M, Wheeler MB, Leng XH, Boyd AE. The role of the free cytosolic calcium level in ␤-cell signal transduction by gastric inhibitory polypeptide and glucagon-like peptide I(7–37). Endocrinology 1993;132:94 –100. [12] Montrose-Rafizadeh C, Egan JM, Roth J. Incretin hormones regulate glucose-dependent insulin secretion in RIN 1046 –38 cells: mechanisms of action. Endocrinology 1994;135:589 –94. [13] Pedersen L, Thaysen EH. The effect of porcine calcitonin upon gastric acid secretion and serum gastrin in man. Scand J Gastroenterol 1976;42(Suppl):43– 47. [14] Reznik Y, Allali-Zerah V, Chayvialle JA, Leroyer R, Leymarie P, Travert G, Lebrethon M-C, Budi I, Balliere A-M, Mahoudeau J. Food-dependent Cushing’s syndrome mediated by an aberrant adrenal sensitivity to gastric inhibitory polypeptide. N Engl J Med 1992; 327:981– 6. [15] Takahashi K, Sawasaki Y, Hata J. Spontaneous transformation and immortalization of human endothelial cells. In Vitro Cell Dev Bio 1990;25:265–74. [16] Usdin TB, Mezey E, Button DC, Brownstein MJ, Bonner TI. Gastric inhibitory polypeptide receptor, a member of the secretin- vasoactive intestinal peptide receptor family, is widely distributed in peripheral organs and the brain. Endocrinology 1993;133:2861–70. [17] Yip RG, Boylan MO, Kieffer TJ, Wolfe MM. Functional GIP receptors are present on adipocytes. Endocrinology 1998;139:4004 –7.