- Email: [email protected]
Glucose Metabolic and Gluconeogenic Pathways Disturbance in the Intrauterine Growth Restricted Adult Male Rats
Chin Med Sci J December 2009
Vol. 24, No. 4 P. 208-212
CHINESE MEDICAL SCIENCES JOURNAL ORIGINAL ARTICLE
Glucose Metabolic and Gluconeogenic Pathways Disturbance in the Intrauterine Growth Restricted Adult Male RatsƸ Xiao-mei Liu1*, Jing Kong2, Wei-wei Song3, and Yan Lu1 1
Central Laboratory, 2Department of Surgery, 3Department of Gynaecology and Obstetrics, Shengjing Hospital, China Medical University, Shenyang 110004, China
Key words: intrauterine growth restriction; insulin resistance; gluconeogenesis Objective To explore the molecular mechanism of type 2 diabetes in intrauterine growth restricted adult rats through determination of blood glucose and expression of gluconeogenic enzymes in liver. Methods Male intrauterine growth restriction (IUGR) offspring induced by maternal proteinmalnutrition and normal controls were studied. The body weights of offspring rats were weighted from birth to 12 weeks of age. Fasting plasma glucose and insulin levels were determined by glucose oxidase method and enzyme-linked immunosorbent assay (ELISA) respectively at 1 week, 8 weeks, and 12 weeks. Peroxisome proliferator-activated receptor-Ȗ coactivator-1Į (PGC-1Į), phosphoenolpyruvate carboxykinase (PEPCK), and glucose-6-phosphatase (G6Pase) mRNA and protein levels in liver were measured by real time RT-PCR and Western blot in newborn rats (Week 1) and adult rats (Week 12). Results Birth weights of IUGR rats were significantly lower than those of controls until 4 weeks later, when IUGR rats caught up to controls. Between 8 and 12 weeks, the growth of IUGR rats surpassed that of controls. No significant differences were observed in blood glucose and insulin levels at newborn rats between the two groups. However, by the end of 8 weeks IUGR rats developed hyperinsulinemia and high insulin resistance index. At the age of 12 weeks, IUGR rats had mild fasting hyperglycemia. In addition, hepatic PGC-1Į mRNA and protein levels as well as hepatic mRNA levels of PEPCK and G6Pase at Week 1 and Week 12 in IUGR rats were all significantly higher than those of controls (P<0.05). Conclusions As a result of intrauterine malnutrition, the expression of gluconeogenic genes is exaggerated in offspring. This change stays through adulthood and may contribute to the pathogenesis of type 2 diabetes.
E
PIDEMIOLOGICAL studies in human have shown
monstrate evidence of adult metabolic disorders acquired
that various adult onset chronic diseases are
during fetal life.2 More recent studies have demonstrated
1
associated with perturbations during early life.
insulin resistance in infants and children who have suffered
Animal models examining this association de-
from intrauterine growth restriction (IUGR).3,4 The bio-
Received for publication June 4, 2009.
Corresponding author Tel: 86-24-83956257, E-mail: [email protected] ƸSupported by the National Natural Science Foundation of China (30672237).
chemical basis of insulin resistance originating from IUGR is not well defined. Increased hepatic glucose production due to gluconeogenesis is an important factor for insulin resistance in type 2 diabetes.5 The enzymes glucose6-phosphatase (G6Pase) and phosphoenolpyruvate car-
Vol. 24, No.4
CHINESE MEDICAL SCIENCES JOURNAL
boxykinase (PEPCK) determine the rate of gluconeogenesis.
209
IRI=(fasting plasma glucose×fasting insulin)/22.5.
Hepatic gene expression of these enzymes is controlled by peroxisome
proliferator-activated
receptor-DŽ coactiva-
6
Real time RT-PCR
tor-1Į (PGC-1Į). Liver is a major insulin sensitive organ
Total RNA was extracted from 100 mg frozen tissue using
besides skeletal muscle and it contributes to glucose in-
TRIzol (Invitrogen). The resulting total RNA was resus-
tolerance through increased glucose production. Increased
pended in 50 NjL diethylpyrocarbonate-treated water and
basal hepatic glucose production contributes to both
treated with RNase-Free DNaseI according to the protocol
fasting and postprandial hyperglycemia observed in dia-
to eliminate any genomic DNA contamination. Totally, 2 Njg
betes and impaired glucose tolerance. The present study
RNA was reversely transcribed with standard reagents
was performed in IUGR rats resulting from maternal pro-
(TaKaRa). The resulting cDNA was amplified with a Lighter
tein malnutrition. Hepatic mRNA levels of PEPCK, G6Pase,
Cycler (Roche) using the SYBR Green PCR kit (TaKaRa)
and transcription factor PGC-1Į which promoting gluco-
according to the manufacturer's instructions. Cycle pa-
genesis were determined in IUGR and control neonatal rats
rameters were as follows: 94°C for 20 seconds, and then
(Week 1) and adult rats (Week 12).
45 cycles of 94°C for 10 seconds, annealing elongation at 55-60°C for 20 seconds (the annealing temperature de-
MATERIALS AND METHODS
pended on the primer’s Tm)DŽSpecific primers for PGC-1Į (forward: TCTGGAACTGCAGGCCTAACTC; reverse: GCAA-
Animal model
GAGGGCTTCAGCTTTG; 55°C Tm; GenBank accession no.
Wistar rats (weight: 230-280 g) bred in our laboratory
AB025784); PEPCK (forward: CCCAGGAAGTGAGGAAGTT-
under controlled temperature and artificial dark-light (light
TGT; reverse: GGAGCCGTCGCAGATGTG; 57°C Tm; Gen-
from 7:00 to 19:00) were used in this study. Female rats
Bank accession no. K03243); G6Pase (forward: GAAGGCC-
were caged with male rats, and mating was confirmed by
AAGAGATGGTGTGA; reverse: TGCAGCTCTTGCGGTACATG;
the presence of spermatozoa in vaginal smears. Pregnant
60°C Tm; GenBank accession no. NM013098); GAPDH
rats were randomly divided into 2 groups: the control
(forward: CCGAGGGCCCACTAAAGG; reverse: TGCTGTTG-
group and the IUGR group. Rats in the control group were
AAGTCACAGGAGACA; 55°C Tm; GenBank accession no.
fed with standard rat chow (calorie 1583 kJ/100 g, protein
NM002046) were designed using Prime3 software (http://
23%); rats in the IUGR group low protein rat chow (calorie
www.prime3.com). Primer specificity was confirmed by the
1558 kJ/100 g, protein 8%) since 10 days of gestation
single melting curves obtained during each amplification.
(both intake 20-22 g daily). All the pregnant rats were
Negative controls (without template) were produced for
allowed to deliver spontaneously and the litter size was
each run. Experiments were performed in duplicate for
randomly reduced to eight at birth to assure uniformity of
each data point. Quantitative values were obtained from
litter size between IUGR and control groups. Newborn rats
the threshold cycle value (Ct), which is the point where a
were weighed on a scale with an accuracy of 0.01 g.
significant increase of fluorescence is first detected. Re-
Juvenal rats were weaned at 3 weeks of age, and then all
sults were calculated according to 2-
fed with standard rat chow. Only male offspring were used
pressed as N-fold difference (increase or decrease) in
because in the vast majority of studies on IUGR rats, ab-
target gene expression.7
ƸƸCT
method and ex-
normalities of glucose metabolism were found only in males. By the end of 1 week, 8 weeks, and 12 weeks, blood
Western blot
was drawn after 2 hours of fast for glucose and insulin
After tissue was homogenized in lysis buffer, protein was
determination. The rats were killed and their livers were
isolated by centrifugation. Samples were subjected to so-
rapidly removed, immediately frozen in liquid nitrogen, and
dium dodecyl sulphate (SDS) polyacrylamide gel electro-
stored at –70°C until use.
phoresis. Dissolved proteins were transferred onto an Immobilon-P (Millipore Corp) membrane and blocked in
Assays
5% dry milk powder in Tris Buffered Saline-0.1%
Blood glucose was determined in duplicate using the
Tween-20 (TBS-T) for 1 hour. Membranes were subse-
HemoCue blood glucose analyzer (Angelholm, Sweden).
quently incubated with antibodies speci¿c for PGC-1Į and
Plasma insulin was measured in duplicate by enzyme-
ǃ-actin (1Ή250 and 1Ή800, respectively) overnight at 4°C.
linked immunosorbent assay using rat insulin standard
All primary antibodies were purchased from Santa Cruz
(Linco, St. Louis, MO, USA). The value of insulin resistance
Technology and were diluted in TBS-T with 5% bovine
index (IRI) was calculated using the following formula:
serum albumin. The next day, membranes were washed
210
CHINESE MEDICAL SCIENCES JOURNAL
and incubated with goat anti-rabbit horse radishperoxi-
December 2009
than those of controls (P<0.05, Figs. 2,3).
dase-labelled secondary antibodies (0.16 mg/mL, Santa Cruz). Antibodies were detected by enhanced chemilumi-
Effect of intrauterine malnutrition on PEPCK and
nescence and photographed by G-BOX system (GENE
G6Pase mRNA levels
Corp).
Hepatic mRNA levels of G6Pase at Week 1 and Week 12 were significantly higher in the IUGR rats than in controls
Statistical analysis
(P<0.05). Similarly, hepatic mRNA levels of PEPCK at Week
Statistical analyses were performed with SPSS software
1 and Week 12 were significantly higher in the IUGR rats
version 11.0 for windows. Difference between two groups
(P<0.05 and P<0.01 respectively) (Fig.4). Moreover, when
was assessed by unpaired t test. A value of P<0.05 was
these increases were analyzed in comparison with the rise
considered statistically significant.
in PGC-1Į mRNA levels on a sample-to-sample basis, we found that the PEPCK (r=0.826, P<0.01) and G6Pase (r=0.714, P<0.01) mRNA levels correlated directly to
RESULTS
PGC-1Į mRNA levels.
Metabolic profile Birth weights of IUGR rats were significantly lower than those of controls (P<0.05) until 4 weeks of age, when IUGR rats caught up to controls. Between 8-12 weeks, the weight of IUGR rats surpassed that of controls (P<0.05, Fig.1). No significant differences were observed in blood glucose and insulin levels at newborn rats between the two groups. However, by the end of 8 weeks IUGR rats developed hyperinsulinemia and high IRI (P<0.05). At the age of 12 weeks, IUGR rats had mild fasting hyperglycemia (P<0.05, Table 1). Effect of intrauterine malnutrition on PGC-1Į ex-
Figure 1. Weights of IUGR and control rats from birth until 12
pression
weeks of age.
From Week 1 to Week 12, PGC-1Į mRNA and PGC-1Į
IUGR: intrauterine growth restriction.
protein levels were significantly higher in livers of IUGR rats
*
P<0.05, †P<0.01 compared with control.
Table 1. Serum glucose and insulin concentration of offspring rats§ Week 8
Week 12
Group
n
Glucose˄mmol/L˅
Insulin˄mU/L˅
IRI
Glucose˄mmol/L˅
Insulin˄mU/L˅
IRI
Control
8
5.08±0.66
39.39± 3.79
2.17±0.12
5.12±0.71
35.28±5.15
2.02±0.15
IUGR
8
5.39±0.67
75.45±13.61*
2.88±0.18*
7.83±1.02*
59.35±8.91*
3.14±0.47*
§: Plun-minus values are means ±SD. IRI: insulin resistance index. *
P<0.05 compared with control. C1W
I1W
C12W
I12W PGC-1Į (92 kD) ǃ-actin (42 kD)
Figure 2. Representative western blot of PGC-1Į protein in livers of IUGR (I) and control (C) newborn (1W) and adult
Figure 3. Quantification of PGC-1Į protein and mRNA in livers
rats (12W).
of IUGR and control newborn (1W) and adult rats
PGC-1Į: peroxisome proliferator-activated receptor-DŽ
(12W).
coactivator-1Į.
* P
P<0.05 compared with control. P
Vol. 24, No.4
CHINESE MEDICAL SCIENCES JOURNAL
211
bly similar to that observed in type 2 diabetes patients.10 In our study, a low protein diet fed to the pregnant rats also induced severe growth retardation in the offspring. Like the IUGR rats induced by uteroplacental insufficiency, the offspring of protein-restricted rats caught up with the controls in weight and subsequently surpassed the latter. IUGR offspring developed hyperinsulinemia and high IRI in adulthood. Since this IUGR model is similar to human growth retardation and subsequent disease states, the IUGR rat is quite useful in studying the impact of maternal Figure 4. Quantification of gluconeogenic enzymes mRNA in livers of IUGR and control newborn (1W) and adult rats (12W). PEPCK: phosphoenolpyruvate carboxykinase; G6Pase: glucose-6-phosphatase. *
P<0.05,
**
P<0.01 compared with control.
malnutrition on the evolution of diabetes in offspring. The liver plays an important role in maintaining blood glucose homeostasis by controlling hepatic glucose production (HGP).11 In type 2 diabetes, the high levels of HGP and the inability of insulin to adequately suppress hepatic glucose output contribute to high levels of both fasting and postprandial hyperglycemia. Increased HGP due to glyco-
DISCUSSION Maternal nutrition is important for the course and outcome of pregnancy. Several lines of evidences suggest that it may also have permanent consequence on the newborn. Epidemiological studies have revealed strong statistical links between poor fetal growth and the subsequent development of type 2 diabetes in adulthood.1,8 These observations have been made in a large number of populations worldwide. Barker9 conducted some of the earliest studies in England that explored the association of neonatal anthropometrics with later development of glucose intolerance and diabetes in individuals aged 50-64 years. They described a significant correlation of decreased birth weight with impaired glucose tolerance, hypertension, and diabetes independent of adult body mass. These findings have led to the “thrifty phenotype hypothesis” which postulates that these changes occur in order to limit the use of nutrients by certain tissues and ensure sufficient supply of the nutrients to the brain and other vital organs. Early-malnourished animals have reduced ǃ cell secretary responses and insulin resistance when normal food intake, overnutrition, or high-fat feeding, as shown in humans, are established later in life. Consequently, type 2 diabetes may develop. Data from animal models of IUGR induced by uteroplacental insufficiency support the opinion that poor fetal growth has permanent consequences in adulthood. The birth weights of IUGR animals induced by bilateral uterine artery ligation were significantly lower than those of controls. But the growth rate of IUGR rats surpassed that of controls, and IUGR rats were obese by 26 weeks of age. IUGR rats developed diabetes with a phenotype remarka-
genolysis and gluconeogenesis is an important component of insulin resistance in type 2 diabetes.12 In gluconeogenesis, the regulation of the rate-limiting (PEPCK) and the last committed (G6Pase) enzymes occurs mainly at the transcription level. In the current study, G6Pase mRNA levels at Week 1 and Week 12 significantly increased in the IUGR rats. Meanwhile, hepatic mRNA levels of PEPCK at Week 1 and Week 12 were higher in the IUGR rats than in control rats. Alterations of gluconeogenic enzymes have been reported in rat offspring born with IUGR due to alcohol exposure, placental ischemia, or glucocorticoid exposure.13,14 In the placental ischemia IUGR model, where newborn rats were also studied, hepatic PEPCK and G6Pase mRNA both increased, thereby predisposing adult offspring to glucose intolerance.13 In the alcohol-exposed model, G6Pase mRNA levels were not altered. PEPCK mRNA levels were suppressed in the alcohol-exposed offspring.14 These results suggested that IUGR programs an increase of gluconeogenesis resulting in an increased hepatic glucose output. It has been proved that the transcription factor PGC-1 modulates hepatic gluconeogenesis through an increase of PEPCK and G6Pase transcription.6 PGC-1 is a coactivator-like protein that interacts with peroxisome proliferator-activated receptor-DŽ (PPAR-DŽ), an orphan receptor found in the nucleus of fat cells which is the target of diabetes treatment with thiazolidinediones. PGC-1 has several isoforms, including PGC-1Į, PGC-1ǃ, and PGC-related coactivator. PGC-1Į is highly expressed in tissues with high metabolic rates such as heart, muscle, and brown adipose tissue, where it promotes mitochondrial biogenesis and energy expenditure.15 It is upregulated by cyclic AMP-dependent mechanisms and glucocorticoids, and
212
CHINESE MEDICAL SCIENCES JOURNAL
downregulated by insulin.16 Hepatic PGC-1Į overexpres-
7.
December 2009
Schmittgen TD, Livak KJ. Analyzing real-time PCR data by
sion increases glucose production and the transcription of
the comparative CT method. Nat Protocols 2008; 3:1101-
genes encoding gluconeogenic enzymes. PGC-1Į-deficient
8.
mice experience fasting hypoglycemia, whereas hepatic
8.
PGC-1Į expression is elevated in mice with type 2 diabetes.17,18 In our study, the significant correlation between PGC-1Į mRNA levels and the mRNA levels of G6Pase and PEPCK suggests that PGC-1Į is similarly contributing directly to the increased mRNA levels of these enzymes in this rat model of IUGR. Moreover, the finding of persistently increased PGC-1Į expression in livers of newborn and adult IUGR rats further suggests a molecular mechanism through which hepatic endogenous glucose production contributes to the peripheral insulin resistance.
Bazaes RA, Alegria A, Pittaluga E, et al. Determinants of insulin sensitivity and secretion in very-low-birth-weight children. J Clin Endocrinol Metab 2004; 89: 1267-72.
9.
Barker DJ. The developmental origins of adult disease. J Am Coll Nutr 2004; 23:588-95.
10. Patrica V, Elisabeth R, Bing L, et al. Hepatic insulin resistance precedes the development of diabetes in a model of intrauterine growth retardation. Diabetes 2004; 53: 2617-22. 11. Staehr P, Hother-Nielsen O, Beck-Nielsen H. The role of the liver in type 2 diabetes. Rev Endocr Metab Disord 2004; 5: 105-10.
In summary, our study suggests that an abnormal in-
12. Gastaldelli A, Toschi E, Pettiti M, et al. Effect of physio-
trauterine milieu leads to permanent changes in hepatic
logical hyperinsulinemia on gluconeogenesis in nondia-
glucose metabolism in the IUGR rat. In the livers of these rats, the expressions of the gluconeogenic enzymes PEPCK and G6Pase, as well as the transcription factor PGC-1Į, which regulates the expression of these enzymes, had a primary defect. These genetic and enzymatic alterations induced by intrauterine malnutrition are long last and have the potential to contribute to the pathogenesis of type 2 diabetes.
betic subjects and in type 2 diabetic patients. Diabetes 2001; 50:1807-12. 13. Lane RH., MacLennan NK, Hsu JL, et al. Increased hepatic peroxisome proliferators-activated receptor-DŽ coactivator-1 gene expression in a rat model of intrauterine growth retardation and subsequent insulin resistance. Endocrinology 2002; 143:2486-90. 14. Chen L, Zhang T, Nyomba BLG. Insulin resistance of gluconeogenic pathways in neonatal rats after prenatal ethanol exposure. Am J Physiol Regul Integr Comp Physiol
REFERENCES 1.
Barker DJ. The origins of the developmental origins theory. J Intern Med 2007;261:412-7.
2.
Martin-Gronert MS, Ozanne SE. Experimental IUGR and later diabetes. J Intern Med 2007;261:437-52.
3.
Cutfield WS, Hofman PL, Mitchell M, et al. Could epigenetics play a role in the developmental origins of health and disease? Pediatr Res 2007;61:68R-75R.
4.
Hovi P, Andersson S, Eriksson JG, et al. Glucose regulation in young adults with very low birth weight. N Engl J Med 2007; 356:2053-63.
5.
Song S, Andrikopoulos S, Filippis C, et al. Mechanism of fat-induced hepatic gluconeogenesis: effect of metformin. Am J Physiol Endocrinol Metab 2001; 281:275-82.
6.
Yoon JC, Puigserver P, Chen G, et al. Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature 2001; 413:131-8.
2004;286: 554-9. 15. Sadana P, Park EA. Characterization of the transactivation domain in the peroxisome-proliferator-activated receptor gamma coactivator (PGC-1). Biochem J 2007; 403: 511-8. 16. Puigserver P, Spiegelman BM. Peroxisome proliferatoractivated receptor-gamma coactivator 1 alpha (PGC-1): transcriptional coactivator and metabolic regulator. Endocr Rev 2003; 24: 78-90. 17. Koo SH, Satoh H, Herzig S, et al. PGC-1 promotes insulin resistance in liver through PPAR-alpha-dependent induction of TRB-3. Nat Med 2004; 10: 530-4. 18. Burgess SC, Leone TC, Wende AR, et al. Diminished hepatic gluconeogenesis via defects in tricarboxylic acid cycle flux in peroxisome proliferator-activated receptor gamma coactivator-1alpha (PGC-1alpha)-deficient mice. J Biol Chem 2006; 281: 19000-8.
Vol. 24, No. 4 P. 208-212
CHINESE MEDICAL SCIENCES JOURNAL ORIGINAL ARTICLE
Glucose Metabolic and Gluconeogenic Pathways Disturbance in the Intrauterine Growth Restricted Adult Male RatsƸ Xiao-mei Liu1*, Jing Kong2, Wei-wei Song3, and Yan Lu1 1
Central Laboratory, 2Department of Surgery, 3Department of Gynaecology and Obstetrics, Shengjing Hospital, China Medical University, Shenyang 110004, China
Key words: intrauterine growth restriction; insulin resistance; gluconeogenesis Objective To explore the molecular mechanism of type 2 diabetes in intrauterine growth restricted adult rats through determination of blood glucose and expression of gluconeogenic enzymes in liver. Methods Male intrauterine growth restriction (IUGR) offspring induced by maternal proteinmalnutrition and normal controls were studied. The body weights of offspring rats were weighted from birth to 12 weeks of age. Fasting plasma glucose and insulin levels were determined by glucose oxidase method and enzyme-linked immunosorbent assay (ELISA) respectively at 1 week, 8 weeks, and 12 weeks. Peroxisome proliferator-activated receptor-Ȗ coactivator-1Į (PGC-1Į), phosphoenolpyruvate carboxykinase (PEPCK), and glucose-6-phosphatase (G6Pase) mRNA and protein levels in liver were measured by real time RT-PCR and Western blot in newborn rats (Week 1) and adult rats (Week 12). Results Birth weights of IUGR rats were significantly lower than those of controls until 4 weeks later, when IUGR rats caught up to controls. Between 8 and 12 weeks, the growth of IUGR rats surpassed that of controls. No significant differences were observed in blood glucose and insulin levels at newborn rats between the two groups. However, by the end of 8 weeks IUGR rats developed hyperinsulinemia and high insulin resistance index. At the age of 12 weeks, IUGR rats had mild fasting hyperglycemia. In addition, hepatic PGC-1Į mRNA and protein levels as well as hepatic mRNA levels of PEPCK and G6Pase at Week 1 and Week 12 in IUGR rats were all significantly higher than those of controls (P<0.05). Conclusions As a result of intrauterine malnutrition, the expression of gluconeogenic genes is exaggerated in offspring. This change stays through adulthood and may contribute to the pathogenesis of type 2 diabetes.
E
PIDEMIOLOGICAL studies in human have shown
monstrate evidence of adult metabolic disorders acquired
that various adult onset chronic diseases are
during fetal life.2 More recent studies have demonstrated
1
associated with perturbations during early life.
insulin resistance in infants and children who have suffered
Animal models examining this association de-
from intrauterine growth restriction (IUGR).3,4 The bio-
Received for publication June 4, 2009.
Corresponding author Tel: 86-24-83956257, E-mail: [email protected] ƸSupported by the National Natural Science Foundation of China (30672237).
chemical basis of insulin resistance originating from IUGR is not well defined. Increased hepatic glucose production due to gluconeogenesis is an important factor for insulin resistance in type 2 diabetes.5 The enzymes glucose6-phosphatase (G6Pase) and phosphoenolpyruvate car-
Vol. 24, No.4
CHINESE MEDICAL SCIENCES JOURNAL
boxykinase (PEPCK) determine the rate of gluconeogenesis.
209
IRI=(fasting plasma glucose×fasting insulin)/22.5.
Hepatic gene expression of these enzymes is controlled by peroxisome
proliferator-activated
receptor-DŽ coactiva-
6
Real time RT-PCR
tor-1Į (PGC-1Į). Liver is a major insulin sensitive organ
Total RNA was extracted from 100 mg frozen tissue using
besides skeletal muscle and it contributes to glucose in-
TRIzol (Invitrogen). The resulting total RNA was resus-
tolerance through increased glucose production. Increased
pended in 50 NjL diethylpyrocarbonate-treated water and
basal hepatic glucose production contributes to both
treated with RNase-Free DNaseI according to the protocol
fasting and postprandial hyperglycemia observed in dia-
to eliminate any genomic DNA contamination. Totally, 2 Njg
betes and impaired glucose tolerance. The present study
RNA was reversely transcribed with standard reagents
was performed in IUGR rats resulting from maternal pro-
(TaKaRa). The resulting cDNA was amplified with a Lighter
tein malnutrition. Hepatic mRNA levels of PEPCK, G6Pase,
Cycler (Roche) using the SYBR Green PCR kit (TaKaRa)
and transcription factor PGC-1Į which promoting gluco-
according to the manufacturer's instructions. Cycle pa-
genesis were determined in IUGR and control neonatal rats
rameters were as follows: 94°C for 20 seconds, and then
(Week 1) and adult rats (Week 12).
45 cycles of 94°C for 10 seconds, annealing elongation at 55-60°C for 20 seconds (the annealing temperature de-
MATERIALS AND METHODS
pended on the primer’s Tm)DŽSpecific primers for PGC-1Į (forward: TCTGGAACTGCAGGCCTAACTC; reverse: GCAA-
Animal model
GAGGGCTTCAGCTTTG; 55°C Tm; GenBank accession no.
Wistar rats (weight: 230-280 g) bred in our laboratory
AB025784); PEPCK (forward: CCCAGGAAGTGAGGAAGTT-
under controlled temperature and artificial dark-light (light
TGT; reverse: GGAGCCGTCGCAGATGTG; 57°C Tm; Gen-
from 7:00 to 19:00) were used in this study. Female rats
Bank accession no. K03243); G6Pase (forward: GAAGGCC-
were caged with male rats, and mating was confirmed by
AAGAGATGGTGTGA; reverse: TGCAGCTCTTGCGGTACATG;
the presence of spermatozoa in vaginal smears. Pregnant
60°C Tm; GenBank accession no. NM013098); GAPDH
rats were randomly divided into 2 groups: the control
(forward: CCGAGGGCCCACTAAAGG; reverse: TGCTGTTG-
group and the IUGR group. Rats in the control group were
AAGTCACAGGAGACA; 55°C Tm; GenBank accession no.
fed with standard rat chow (calorie 1583 kJ/100 g, protein
NM002046) were designed using Prime3 software (http://
23%); rats in the IUGR group low protein rat chow (calorie
www.prime3.com). Primer specificity was confirmed by the
1558 kJ/100 g, protein 8%) since 10 days of gestation
single melting curves obtained during each amplification.
(both intake 20-22 g daily). All the pregnant rats were
Negative controls (without template) were produced for
allowed to deliver spontaneously and the litter size was
each run. Experiments were performed in duplicate for
randomly reduced to eight at birth to assure uniformity of
each data point. Quantitative values were obtained from
litter size between IUGR and control groups. Newborn rats
the threshold cycle value (Ct), which is the point where a
were weighed on a scale with an accuracy of 0.01 g.
significant increase of fluorescence is first detected. Re-
Juvenal rats were weaned at 3 weeks of age, and then all
sults were calculated according to 2-
fed with standard rat chow. Only male offspring were used
pressed as N-fold difference (increase or decrease) in
because in the vast majority of studies on IUGR rats, ab-
target gene expression.7
ƸƸCT
method and ex-
normalities of glucose metabolism were found only in males. By the end of 1 week, 8 weeks, and 12 weeks, blood
Western blot
was drawn after 2 hours of fast for glucose and insulin
After tissue was homogenized in lysis buffer, protein was
determination. The rats were killed and their livers were
isolated by centrifugation. Samples were subjected to so-
rapidly removed, immediately frozen in liquid nitrogen, and
dium dodecyl sulphate (SDS) polyacrylamide gel electro-
stored at –70°C until use.
phoresis. Dissolved proteins were transferred onto an Immobilon-P (Millipore Corp) membrane and blocked in
Assays
5% dry milk powder in Tris Buffered Saline-0.1%
Blood glucose was determined in duplicate using the
Tween-20 (TBS-T) for 1 hour. Membranes were subse-
HemoCue blood glucose analyzer (Angelholm, Sweden).
quently incubated with antibodies speci¿c for PGC-1Į and
Plasma insulin was measured in duplicate by enzyme-
ǃ-actin (1Ή250 and 1Ή800, respectively) overnight at 4°C.
linked immunosorbent assay using rat insulin standard
All primary antibodies were purchased from Santa Cruz
(Linco, St. Louis, MO, USA). The value of insulin resistance
Technology and were diluted in TBS-T with 5% bovine
index (IRI) was calculated using the following formula:
serum albumin. The next day, membranes were washed
210
CHINESE MEDICAL SCIENCES JOURNAL
and incubated with goat anti-rabbit horse radishperoxi-
December 2009
than those of controls (P<0.05, Figs. 2,3).
dase-labelled secondary antibodies (0.16 mg/mL, Santa Cruz). Antibodies were detected by enhanced chemilumi-
Effect of intrauterine malnutrition on PEPCK and
nescence and photographed by G-BOX system (GENE
G6Pase mRNA levels
Corp).
Hepatic mRNA levels of G6Pase at Week 1 and Week 12 were significantly higher in the IUGR rats than in controls
Statistical analysis
(P<0.05). Similarly, hepatic mRNA levels of PEPCK at Week
Statistical analyses were performed with SPSS software
1 and Week 12 were significantly higher in the IUGR rats
version 11.0 for windows. Difference between two groups
(P<0.05 and P<0.01 respectively) (Fig.4). Moreover, when
was assessed by unpaired t test. A value of P<0.05 was
these increases were analyzed in comparison with the rise
considered statistically significant.
in PGC-1Į mRNA levels on a sample-to-sample basis, we found that the PEPCK (r=0.826, P<0.01) and G6Pase (r=0.714, P<0.01) mRNA levels correlated directly to
RESULTS
PGC-1Į mRNA levels.
Metabolic profile Birth weights of IUGR rats were significantly lower than those of controls (P<0.05) until 4 weeks of age, when IUGR rats caught up to controls. Between 8-12 weeks, the weight of IUGR rats surpassed that of controls (P<0.05, Fig.1). No significant differences were observed in blood glucose and insulin levels at newborn rats between the two groups. However, by the end of 8 weeks IUGR rats developed hyperinsulinemia and high IRI (P<0.05). At the age of 12 weeks, IUGR rats had mild fasting hyperglycemia (P<0.05, Table 1). Effect of intrauterine malnutrition on PGC-1Į ex-
Figure 1. Weights of IUGR and control rats from birth until 12
pression
weeks of age.
From Week 1 to Week 12, PGC-1Į mRNA and PGC-1Į
IUGR: intrauterine growth restriction.
protein levels were significantly higher in livers of IUGR rats
*
P<0.05, †P<0.01 compared with control.
Table 1. Serum glucose and insulin concentration of offspring rats§ Week 8
Week 12
Group
n
Glucose˄mmol/L˅
Insulin˄mU/L˅
IRI
Glucose˄mmol/L˅
Insulin˄mU/L˅
IRI
Control
8
5.08±0.66
39.39± 3.79
2.17±0.12
5.12±0.71
35.28±5.15
2.02±0.15
IUGR
8
5.39±0.67
75.45±13.61*
2.88±0.18*
7.83±1.02*
59.35±8.91*
3.14±0.47*
§: Plun-minus values are means ±SD. IRI: insulin resistance index. *
P<0.05 compared with control. C1W
I1W
C12W
I12W PGC-1Į (92 kD) ǃ-actin (42 kD)
Figure 2. Representative western blot of PGC-1Į protein in livers of IUGR (I) and control (C) newborn (1W) and adult
Figure 3. Quantification of PGC-1Į protein and mRNA in livers
rats (12W).
of IUGR and control newborn (1W) and adult rats
PGC-1Į: peroxisome proliferator-activated receptor-DŽ
(12W).
coactivator-1Į.
* P
P<0.05 compared with control. P
Vol. 24, No.4
CHINESE MEDICAL SCIENCES JOURNAL
211
bly similar to that observed in type 2 diabetes patients.10 In our study, a low protein diet fed to the pregnant rats also induced severe growth retardation in the offspring. Like the IUGR rats induced by uteroplacental insufficiency, the offspring of protein-restricted rats caught up with the controls in weight and subsequently surpassed the latter. IUGR offspring developed hyperinsulinemia and high IRI in adulthood. Since this IUGR model is similar to human growth retardation and subsequent disease states, the IUGR rat is quite useful in studying the impact of maternal Figure 4. Quantification of gluconeogenic enzymes mRNA in livers of IUGR and control newborn (1W) and adult rats (12W). PEPCK: phosphoenolpyruvate carboxykinase; G6Pase: glucose-6-phosphatase. *
P<0.05,
**
P<0.01 compared with control.
malnutrition on the evolution of diabetes in offspring. The liver plays an important role in maintaining blood glucose homeostasis by controlling hepatic glucose production (HGP).11 In type 2 diabetes, the high levels of HGP and the inability of insulin to adequately suppress hepatic glucose output contribute to high levels of both fasting and postprandial hyperglycemia. Increased HGP due to glyco-
DISCUSSION Maternal nutrition is important for the course and outcome of pregnancy. Several lines of evidences suggest that it may also have permanent consequence on the newborn. Epidemiological studies have revealed strong statistical links between poor fetal growth and the subsequent development of type 2 diabetes in adulthood.1,8 These observations have been made in a large number of populations worldwide. Barker9 conducted some of the earliest studies in England that explored the association of neonatal anthropometrics with later development of glucose intolerance and diabetes in individuals aged 50-64 years. They described a significant correlation of decreased birth weight with impaired glucose tolerance, hypertension, and diabetes independent of adult body mass. These findings have led to the “thrifty phenotype hypothesis” which postulates that these changes occur in order to limit the use of nutrients by certain tissues and ensure sufficient supply of the nutrients to the brain and other vital organs. Early-malnourished animals have reduced ǃ cell secretary responses and insulin resistance when normal food intake, overnutrition, or high-fat feeding, as shown in humans, are established later in life. Consequently, type 2 diabetes may develop. Data from animal models of IUGR induced by uteroplacental insufficiency support the opinion that poor fetal growth has permanent consequences in adulthood. The birth weights of IUGR animals induced by bilateral uterine artery ligation were significantly lower than those of controls. But the growth rate of IUGR rats surpassed that of controls, and IUGR rats were obese by 26 weeks of age. IUGR rats developed diabetes with a phenotype remarka-
genolysis and gluconeogenesis is an important component of insulin resistance in type 2 diabetes.12 In gluconeogenesis, the regulation of the rate-limiting (PEPCK) and the last committed (G6Pase) enzymes occurs mainly at the transcription level. In the current study, G6Pase mRNA levels at Week 1 and Week 12 significantly increased in the IUGR rats. Meanwhile, hepatic mRNA levels of PEPCK at Week 1 and Week 12 were higher in the IUGR rats than in control rats. Alterations of gluconeogenic enzymes have been reported in rat offspring born with IUGR due to alcohol exposure, placental ischemia, or glucocorticoid exposure.13,14 In the placental ischemia IUGR model, where newborn rats were also studied, hepatic PEPCK and G6Pase mRNA both increased, thereby predisposing adult offspring to glucose intolerance.13 In the alcohol-exposed model, G6Pase mRNA levels were not altered. PEPCK mRNA levels were suppressed in the alcohol-exposed offspring.14 These results suggested that IUGR programs an increase of gluconeogenesis resulting in an increased hepatic glucose output. It has been proved that the transcription factor PGC-1 modulates hepatic gluconeogenesis through an increase of PEPCK and G6Pase transcription.6 PGC-1 is a coactivator-like protein that interacts with peroxisome proliferator-activated receptor-DŽ (PPAR-DŽ), an orphan receptor found in the nucleus of fat cells which is the target of diabetes treatment with thiazolidinediones. PGC-1 has several isoforms, including PGC-1Į, PGC-1ǃ, and PGC-related coactivator. PGC-1Į is highly expressed in tissues with high metabolic rates such as heart, muscle, and brown adipose tissue, where it promotes mitochondrial biogenesis and energy expenditure.15 It is upregulated by cyclic AMP-dependent mechanisms and glucocorticoids, and
212
CHINESE MEDICAL SCIENCES JOURNAL
downregulated by insulin.16 Hepatic PGC-1Į overexpres-
7.
December 2009
Schmittgen TD, Livak KJ. Analyzing real-time PCR data by
sion increases glucose production and the transcription of
the comparative CT method. Nat Protocols 2008; 3:1101-
genes encoding gluconeogenic enzymes. PGC-1Į-deficient
8.
mice experience fasting hypoglycemia, whereas hepatic
8.
PGC-1Į expression is elevated in mice with type 2 diabetes.17,18 In our study, the significant correlation between PGC-1Į mRNA levels and the mRNA levels of G6Pase and PEPCK suggests that PGC-1Į is similarly contributing directly to the increased mRNA levels of these enzymes in this rat model of IUGR. Moreover, the finding of persistently increased PGC-1Į expression in livers of newborn and adult IUGR rats further suggests a molecular mechanism through which hepatic endogenous glucose production contributes to the peripheral insulin resistance.
Bazaes RA, Alegria A, Pittaluga E, et al. Determinants of insulin sensitivity and secretion in very-low-birth-weight children. J Clin Endocrinol Metab 2004; 89: 1267-72.
9.
Barker DJ. The developmental origins of adult disease. J Am Coll Nutr 2004; 23:588-95.
10. Patrica V, Elisabeth R, Bing L, et al. Hepatic insulin resistance precedes the development of diabetes in a model of intrauterine growth retardation. Diabetes 2004; 53: 2617-22. 11. Staehr P, Hother-Nielsen O, Beck-Nielsen H. The role of the liver in type 2 diabetes. Rev Endocr Metab Disord 2004; 5: 105-10.
In summary, our study suggests that an abnormal in-
12. Gastaldelli A, Toschi E, Pettiti M, et al. Effect of physio-
trauterine milieu leads to permanent changes in hepatic
logical hyperinsulinemia on gluconeogenesis in nondia-
glucose metabolism in the IUGR rat. In the livers of these rats, the expressions of the gluconeogenic enzymes PEPCK and G6Pase, as well as the transcription factor PGC-1Į, which regulates the expression of these enzymes, had a primary defect. These genetic and enzymatic alterations induced by intrauterine malnutrition are long last and have the potential to contribute to the pathogenesis of type 2 diabetes.
betic subjects and in type 2 diabetic patients. Diabetes 2001; 50:1807-12. 13. Lane RH., MacLennan NK, Hsu JL, et al. Increased hepatic peroxisome proliferators-activated receptor-DŽ coactivator-1 gene expression in a rat model of intrauterine growth retardation and subsequent insulin resistance. Endocrinology 2002; 143:2486-90. 14. Chen L, Zhang T, Nyomba BLG. Insulin resistance of gluconeogenic pathways in neonatal rats after prenatal ethanol exposure. Am J Physiol Regul Integr Comp Physiol
REFERENCES 1.
Barker DJ. The origins of the developmental origins theory. J Intern Med 2007;261:412-7.
2.
Martin-Gronert MS, Ozanne SE. Experimental IUGR and later diabetes. J Intern Med 2007;261:437-52.
3.
Cutfield WS, Hofman PL, Mitchell M, et al. Could epigenetics play a role in the developmental origins of health and disease? Pediatr Res 2007;61:68R-75R.
4.
Hovi P, Andersson S, Eriksson JG, et al. Glucose regulation in young adults with very low birth weight. N Engl J Med 2007; 356:2053-63.
5.
Song S, Andrikopoulos S, Filippis C, et al. Mechanism of fat-induced hepatic gluconeogenesis: effect of metformin. Am J Physiol Endocrinol Metab 2001; 281:275-82.
6.
Yoon JC, Puigserver P, Chen G, et al. Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature 2001; 413:131-8.
2004;286: 554-9. 15. Sadana P, Park EA. Characterization of the transactivation domain in the peroxisome-proliferator-activated receptor gamma coactivator (PGC-1). Biochem J 2007; 403: 511-8. 16. Puigserver P, Spiegelman BM. Peroxisome proliferatoractivated receptor-gamma coactivator 1 alpha (PGC-1): transcriptional coactivator and metabolic regulator. Endocr Rev 2003; 24: 78-90. 17. Koo SH, Satoh H, Herzig S, et al. PGC-1 promotes insulin resistance in liver through PPAR-alpha-dependent induction of TRB-3. Nat Med 2004; 10: 530-4. 18. Burgess SC, Leone TC, Wende AR, et al. Diminished hepatic gluconeogenesis via defects in tricarboxylic acid cycle flux in peroxisome proliferator-activated receptor gamma coactivator-1alpha (PGC-1alpha)-deficient mice. J Biol Chem 2006; 281: 19000-8.