GLUT1 and GLUT3 gene expression in gerbil brain following brief ischemia: an in situ hybridization study

MOLECULAR BRAIN RESEARCH ELSEVIER

Molecular Brain Research 25 (1994) 313-322

,,

Research Report

GLUT1 and GLUT3 gene expression in gerbil brain following brief ischemia: an in situ hybridization study David Z. Gerhart a, Richard L. Leino b, William E. Taylor a, Nancy D. Borson a, Lester R. Drewes a,. a Department of Biochemistry and Molecular Biology, and b Department of Anatomy and Cell Biology, School of Medicine, University of Minnesota, Duluth, MN 55812, USA

Accepted 5 April 1994

Abstract GLUT1 and GLUT3 mRNAs in normal and post-ischemic gerbil brains were examined qualitatively and semi-quantitatively using in situ hybridization in conjunction with image analysis. Coronal brain sections at the level of the anterior hippocampus were prepared three hours, one day, and three days after animals were subjected to six min of ischemia. The sections were hybridized with vector- and PCR-generated R N A probes labeled with 35S. Microscopic evaluation of hybridized brain sections coated with autoradiographic emulsion indicated that GLUT1 m R N A was associated with brain microvessels, choroid plexus, and some ependymal cells. GLUT1 m R N A was not observed in neurons, except that one day following ischemia, this m R N A was induced in neurons of the dentate gyrus. GLUT3 m R N A was detected only in neurons. Image analysis of film autoradiograms revealed that both the GLUT1 and GLUT3 messages increased following ischemia but returned nearly to control levels by day three. In the CA1 region of the hippocampus the increase in GLUT3 m R N A was not statistically significant, and by day three the level had fallen significantly below the control, coinciding with the degeneration of the CA1 neurons. Our results suggest that the brain possesses mechanisms for induction and up-regulation of glucose transporter gene expression. Key words: Glucose transporter; Ischemia; Brain; Riboprobe; Gerbil; In situ hybridization

1. Introduction

Because of the critical role that brain glucose transporters play in supplying essential substrate for brain energy metabolism, it is important to characterize the control mechanisms for these proteins. Two brain glucose transporters have been identified. GLUT1 is present at the blood-brain barrier [5] and perhaps also in glial/neuronal cell membranes [20]. GLUT3 exists primarily in neurons [24]. Cerebral ischemia has been associated with changes in both glucose utilization (cerebral metabolic rate) [28,32] and transport [2,13]. Whether brief (5-10 min), transient ischemia induces regulatory responses in glucose transporter mRNAs has not been determined. Characterizing the dynamics

* Corresponding author. Department of Biochemistry and Molecular Biology, School of Medicine, University of Minnesota, Duluth, Duluth, MN 55812, USA. Fax: (218) 726-7559. 0169-328X/94/$07.00 © 1994 Elsevier Science B.V. All rights reserved SSDI 0169-328X(94)00079-T

of glucose transporter gene expression following ischemia may help to reveal or confirm potential regulatory mechanisms for brain glucose transport. In the present study, the bilateral carotid occlusion model was employed to observe changes in GLUT1 and GLUT3 gene expression in postischemic gerbil brain. Image analysis of film autoradiograms generated by in situ hybridizations was used to semi-quantitatively describe fluctuations in glucose transporter mRNA levels during a three-day period following ischemia. Transient increases in both GLUT1 and GLUT3 mRNA levels occurred during this period.

2. Materials and methods Gerbil brain mRNA was isolated using a Micro-Fast Track Kit (Invitrogen, San Diego, CA). RNA size standards were purchased from Gibco BRL/Life Technologies (Gaithersburg, MD). The polymerase chain reaction (PCR) was performed using a DNA Thermal Cycler and reagents from an AmpliTaq Kit purchased from Perkin-

314

I).Z. Gerharz et al , th)h'cMar Brain Research 25 (1q94)31.¢-322

Table I Partial sequences of gerbil GLUT1 and GLUT3 Transporter

Partial sequence

GLUT1

790 tgcatcctgttgcccttctgccccgagagcccccgcttcctgctcat¢eatcgaaatgaggag aa 854---934 cgtcagatgatgcgggagaagaaagtcacgatcctggagctgttccgctcct ccgcctaccaccaacccatcctcatcgctgtggtgctgcagctgtcccagcagctgtcc 1044

GLUT3

694 ccctgaaagtccaagattcttgctcattaacaagaaggaaeaaaaccgtgccaaggaga tcctccagcggttgtggggcacccaggacgtgg 785---822 ggatggcacaggagaagca ggtcaccgtgctggagctcttca_ogtcatctaactactt 879

The underlined sequences were used to design PCR primers. The base reference numbers are for mouse GLUT1 [11] and GLUT3 [24]. Elmer (Norwalk, CT). All primers for PCR were synthesized on a PCR-Mate Oligonucleotide Synthesizer manufactured by Applied Biosystems (Foster City, CA). PCR products were purified from agarose gels with GELase (Epicentre Technologies, Madison, WI). The plasmid pSGT containing the human Hep G2 GLUT1 sequence was obtained from the American Type Culture Collection (Rockville. MD); T4 DNA ligase, ligase buffer, and restriction enzyme Apa I were from United States Biochemical (Cleveland, OH). Cloning vector pBluescript II S K + and restriction enzyme Eco RI were obtained from Stratagene (La Jolla, CA). Plasmid DNA isolations were performed using a Circleprep Kit from BIO 101 (La Jolla, CA). Radioisotopes for probe labeling, [a-35S]CTP and -UTP, 800 Ci/mmol, were from Amersham (Arlington Heights, IL). Restriction enzyme Rsa I and transcription reagents, including T3 and T7 RNA polymerases, were from Promega (Madison, WI). Reagent grade chemicals for in situ hybridization were obtained from Sigma Chemical (St. Louis, MO). The autoradiography film was Hyperfilm-/3max (Amersham). 2.1. RNA probe preparation 2.1.1. Gerbil-specific PCR-generated probes for GLUT1 and GLUT3 Gerbil-specific GLUT1 and GLUT3 RNA probes approximately 150 bases in length were synthesized with T7 RNA polymerase and cDNA templates containing R N A polymerase initiation sites [19]. Because the gerbil GLUT1 and GLUT3 sequences were unknown, PCR techniques were used to synthesize gerbil-specific templates. Briefly, gerbil brain m R N A was isolated and used with reverse transcriptase to synthesize first-strand eDNA. The materials and methods for eDNA synthesis and sequence analysis have been described elsewhere [4]. PCR primers based on published sequences of mouse GLUT1 and GLUT3 [11,24] were designed and successfully used with gerbil eDNA to generate isoform-specific cDNAs approximately 580 bases in length for each of the two transporters. These cDNAs corresponded to nucleotides 711-t,292 of mouse GLUT1 and nucleotides 595-1,169 of mouse GLUT3. The PCR products were purified from agarose gels with GELase and subjected to partial sequence analysis using a modified dideoxynucleotide chaintermination method [4]. Based on the sequencing results (Table 1), four pairs of gerbil-specific primers, two pairs for GLUT1 and two pairs for GLUT3, were synthesized. Each of the eight primers

contained a sequence of 18-20 bases specific for a glucose transporter isoform. One primer of each primer pair also contained 23 bases encoding a T7 RNA polymerase initiation site and a 9-base extension on the 5' end. PCR reactions using these gerbil-specific primers and the 580-base GLUT1 and GLUT3 eDNA products as templates were then employed to produce antisense and sense templates for RNA transcription. After purification of these templates, transcription reactions were conducted with T7 R N A polymerase to incorporate 35S-CTP and 35S-UTP into the probes [3], which corresponded to nucleotides 823-1.007 of mouse GLUT1 and nucleotides 727-871 of mouse GLUT3. The probes were purified with spun columns (Sephadex G-50) followed by ethanol precipitation. The final probes had activities of approximately ]07 d p m / / z l ( 2 × 1 0 ' dpm//zg). 2.1.2. Plasmid vector-derived probe for GLUT1 A 186-base-pair (bp) fragment corresponding to bases 459-645 of the Hep G2 GLUT1 was obtained by digestion of the plasmid pSGT with EcoRI and Apal. The fragment was subcloned into pBluescript II SK+ vector to create the clone pBGT186. The E. coli bacterial strain XL-1 Blue was transformed with this clone and used to prepare plasmid DNA. The pBGT186 plasmid was linearized with restriction enzymes Rsal and EcoRI, and transcription reactions were conducted using T3 and T7 RNA polymerases to incorporate [3SS]CTP and [35S]UTP into sense and antisense R N A probes. respectively. Final activities were similar to the PCR-derived probes. 2.2. Ischemia experiments" All animal experiments followed a protocol approved by the University of Minnesota Animal Care Committee. Male gerbils 10-27 weeks old were anesthetized with 3% halothane and placed on a warming plate that maintained rectal temperature at 37°C. The common carotid arteries were exposed and both arteries were clamped for 6 min. Six control gerbils were sham-operated (the carotids were exposed but not clamped), and fifteen gerbils were subjected to ischemia. At 3 h. 1 day, and 3 days after surgery, two control and five ischemic brains were removed from the skull and snap-frozen at - 70°C in isopentane. Twelve-micron coronal sections at the level of the anterior hippocampus were cut in a cryostat, dried.

Fig. 1. Photomicrographs of gerbil brain sections following in situ hybridization with PCR-generated R N A antisense probe for GLUT1. Cerebral microvessels, including capillaries (A) and arterioles (B) were heavily labeled. C: staining of hybridized sections with periodic acid and basic fuschin in acid alcohol (a Schiff-like reagent) reduced probe labeling but allowed visualization of capillary basement membranes (arrows). This technique revealed that many labeled cells, previously thought to be glial based on their location and nuclear morphology, were actually vascular. D: GLUT1 m R N A was also detected in choroid plexus (arrows) and some ependymal cells. V: lateral ventricle. Bar = 40 ~m.

!

31~

I).Z. (h'rharx et a l / ,~lolec'alar Brain Research 25 (1994) 313-322

-'"

d

~ .~

" ~"

Fig. 2. Photomicrograph of dentate gyrus neurons, 1 day post-ischemia, hybridized with PCR-generated R N A antisense probe li)r GLUT1. The neurons are heavily labeled, indicating that ischemia induces GLUT1 gene expression in these cells. A labeled vascular cell (arrow) is also visible: Dentate gyrus neurons were not labeled in sham-operated control brains or in 3 h or 3 day postischemic brains. Bar = 20/xm.

fixed 20 min in 4% paraformaldehyde, dehydrated, and stored at 4°C.

two different sense probes directed to non-overlapping sequences of the gene were employed.

2.3. In situ hybridizations

2.4. Quantitation and statistics

Sections from all 21 gerbil brains were included in each hybridization incubation. The hybridization procedure has been described [31]. Briefly, the sections were incubated in PBS/0.1 M glycine and acetylated (0.25% acetic anhydride in 0.1 M triethanolamine). The 35S-labeled R N A probes were hybridized to the tissue sections overnight at 55°C in a hybridization solution containing 50% formamide. The sections were treated with RNase A (R-5250, Sigma), dried, and exposed to autoradiographic film for 6 days. Subsequently, the sections were coated with Kodak NBT-2 emulsion and exposed for 3 weeks in the dark at 4°C. After the emulsion was developed, the sections were counterstained with Cresyl violet or hematoxylin and eosin and examined with a microscope. Some GLUT1 sections were treated with periodic acid prior to emulsion coating and poststained with basic fuschin in acid alcohol (BFAA, a Schiff-like reagent) after the emulsion was developed [10,291. In situ hybridization controls included treatment of sections with RNase prior to hybridization with the R N A probes and incubation with a sense probe in place of each antisense probe. For GLUT1,

Film autoradiograms were analyzed using Image software (Na, tional Institutes of Health, Washington, DC). The autoradiograms from eight hybridization incubations (three incubations with the GLUT1 antisense probe, three with the G L U T 3 antisense probe, and one each with the G L U T I and G L U T 3 sense probes) were analyzed without knowledge of their identities. All images from an incdbation were captured at the same sitting a n d stored electronically. For quantitation, the outlines of the cerebral cortex were traced in each hemisphere, and average optical densities (ODs) were measured. The m e a s u r e m e n t s from the two h e m i s p h e r e s were averaged to yield a single value for each gerbil. Values for hippocampus (GLUT1 sections only) and thalamus were obtained similarly. For hippocampus in GLUT3-hybridized sections, O D s were measured along a line drawn through the neuronal cell nuclei of the CA1 and CA3 regions. O D s for the dentate gyrus granule cells w e r e also determined in this manner. Film background O D was subtracted from all readings. All O D s were expressed as percentages of the m e a n control value for that hybridization incubation; An analysis of variance was performed and the Scheffe F-test applied to detect

Fig. 3. Film autoradiograms of in situ hybridizations showing distribution of glucose transporter m R N A s in gerbil brain. A: GLUT1 m R N A was primarily associated with cerebral blood vessels, but was also present in the choroid plexus (arrow) and some ependymal cells. Inset; 1 day following ischemia, G L U T 1 m R N A is induced in neurons of the dentate gyrus (arrow). B: G L U T 3 m R N A was associated with neurons. A sham-operated control brain is shown. C: 1 day following 6 min of ischemia, most brain regions exhibited elevated levels of G L U T 3 m R N A . Inset: 3 days following ischemia, G L U T 3 m R N A in the hippocampal CA1 region (arrow) was nearly absent.

D.Z. Gerhart et al. / Molecular Brain Research 25 (1994) 313-322

317

I).Z. (;erhart et a/.

,~lo/ccular Brain Research 2.5 (1094) 313-322

differences between the control group and the 3 h, I day, and 3 day sample groups. Differences were judged to be significant at t' < 0.05. The GLUT3 data were treated similarly.

postischemia. By the 3rd day following ischemia. ODs had declined to near control values.

3.3. GLUT3 3. Results

3.1. Specificity controls The plasmid vector-derived and PCR-generated GLUT1 antisense probes, although directed to different sequences, yielded identical results, thus validating the specificity of these probes for GLUT1 m R N A . Both the GLUT1 and G L U T 3 sense (control) probes exhibited little binding to the sections. The film images obtained with these probes were only slightly darker than film background. On the emulsion-coated slides, the silver grains which were present were randomly scattered across the sections. When tissue was treated with RNase prior to hybridization with the antisense probes, the specific GLUT1 and G L U T 3 hybridization patterns were abolished, and few silver grains were present on the sections.

Emulsion-coated sections which had been hybridized to the G L U T 3 antisense probe showed labeling of neurons (Fig. 5). Binding of this probe to other cell types or structures was not detected.

200

GLUT1 160

Emulsion-coated sections (Fig. 1) revealed extensive probe hybridization to arterioles, venules, and capillaries. Choroid plexus, some ependymal cells, and unidentified cells with small oval or round nuclei were also labeled. Staining of hybridized sections with periodic acid-BFAA reduced probe labeling but allowed visualization of capillary basement membranes. This technique revealed that many of the unidentified labeled cells were associated with blood vessels. There were also many cells with small nuclei that were not labeled. These were not associated with blood vessels and were considered to be glial cells. Neurons of the dentate gyrus were labeled in three of the five brains collected 1 day after ischemia (Fig. 2) but not in other ischemic or control animals. Film autoradiograms obtained with the PCR-generated GLUT1 antisense probe (Fig. 3A) indicated a rather homogeneous distribution of this transporter m R N A in brain. Images of large blood vessels were visible as dark spots (vessels in cross section) or streaks (longitudinal section), and poorly vascularized regions such as hippocampus were lighter gray than other brain regions. Neuron-rich areas of the dentate gyrus were clearly visible on the autoradiograms of three of the five brains collected 1 day following ischemia. Image analysis of the GLUT1 autoradiograms (Fig. 4A) demonstrated elevated GLUT1 m R N A levels in ischemic gerbils relative to those in sham-operated controls. In individual hybridizations, measured OD values were as high as 175% of control values at 1 day

*

• Cerebral Cortex ~J Thalamus

140

[]

Hippocampus

120 • 100 3 hours

1 day

3 days

o C O

3.2. GLUT1

A

180

,,~

170

160 150

B

140

GLUT3

130 ~,

120

t,,,(D O

100

m O ~.

80

• []

Cerebral Cortex Thalamus

110 g0 3 hours

1 day

3 days

O 35O

3oo

~t

C

200 * 150 10050

.

.

.

.

.

•

CA1

~ []

CA3 Dentate Gyrus

.

0 3 hours

Time

1 day

After

3 days

Ischemla

Fig. 4. Relative amounts of glucose transporter mRNAs in specific gerbil brain regions following 6 min of ischemia. Optical densities were measured by image analysis of film autoradiograms, Asterisks indicate a significant (P<0.05) difference from mRNA levels in sham-operated controls. Error bars represent S.E.M. A: GLUTI mRNA levels in cerebral cortex, thalamus, and hippocampus were elevated 1 day after ischemia. The results of one hybridization incubation are shown. B,C: GLUT3 mRNA levels in cerebral cortex, thalamus, and the hippocampal CA3 region exhibited postischemic changes similar to those observed for GLUT1. with maximum levels occurring 1 day after ischemia. In the hippocampal CAt the increase in GLUT3 at day 1 was not statistically significant, and by day 3 this mRNA was barely detectable. In the dentate gyrus, peak levels of GLUT3 mRNAoccurred 3 h after ischemia. The combined results of three hybridization incubations are shown.

D.Z. Gerhart et al. / Molecular Brain Research 25 (1994) 313-322

Film images obtained with the GLUT3 antisense probe reflected the distribution of neuron cell bodies in brain (Fig. 3B,C) and were distinctly different from

319

those obtained with the GLUT1 probe. Thus, areas rich in neuronal cell bodies such as cerebral cortex and thalamic nuclei were evident as labeled (dark) areas,

Fig. 5. Photomicrographs of gerbil brain sections following in situ hybridization with PCR-generated RNA antisense probe for GLUT3. A: 1 day following 6 rain of ischemia, neurons were heavily labeled, including those in the hippocampal CA1 region (shown). B: 3 days after ischemia, CA1 neurons were degenerating, and labeling was sparse. Cresyl violet. Bar = 40/zm.

320

D.Z. (;eHlart ut al.

,lloh'cular BraiH Re.~'earch 25 (1994) .713-322

and regions of hippocampus (CA1, etc.) and dentate gyrus containing densely packed neurons appeared as heavily-labeled lines. Cerebral white matter exhibited the least labeling. Image analysis of the G L U T 3 autoradiograms (Fig. 4B,C) revealed postischemic increases in GLUT3 m R N A in all brain regions. These increases were statistically significant except in the hippocampal CAl. In cerebral cortex, hippocampal CA1 and CA3, and thalamus, G L U T 3 m R N A levels were maximal 1 day after ischemia. In the dentate gyrus, however, the peak response occurred 3 h after ischemia. At this time the measured O D in the dentate gyrus was 2.5 times the control value. Three days after ischemia, G L U T 3 m R N A levels had declined to near control levels, except in the CA1 region where extensive degeneration of pyramidal cells was observed (Fig. 5B). In this region measured ODs were only 27% of controls.

4. Discussion The present study documents increases in glucose transporter mRNAs in gerbil brain following 6 min of ischemia produced by bilateral carotid occlusion. These findings are consistent with reported G L U T m R N A increases following middle cerebral artery occlusion in the rat [18]. All brain regions except the hippocampal CA1 showed significant increases 1 day after ischemia. The response of dentate gyrus neurons to ischemia was notable both because of the early increase in GLUT3 m R N A at 3 h and the induction of G L U T I mRNA at 1 day. On the 3rd day GLUT1 and G L U T 3 m R N A levels were not significantly different from those of sham-operated control animals, except for the near total loss of G L U T 3 m R N A in the selectively vulnerable CAI region of hippocampus. This loss coincided with the degeneration of the selectively vulnerable CA1 neurons [14] which we observed in Cresyl violet-stained sections and is in agreement with observations of postischemic losses of other mRNAs in the CA1 region [22,36]. The percentage increases in ODs observed in this study are probably underestimates of the actual increases in the m R N A content of individual cells. In part, this is because of the difficulty of obtaining measurements of non specific binding by glucose transporter m R N A probes. Correcting for non-specific binding would result in higher estimates of postischemic glucose transporter m R N A increases. Moreover, when ODs are averaged over a large area of tissue, these measurements will underestimate increases in mRNAs associated with individual cell types (e.g., neurons or endothelial cells), which constitute only a portion of the area [33]. Localization of GLUT1 m R N A in cerebral microvessels and choroid plexus is consistent with earlier

studies describing the distributkm of the G L U T I protein [6,9,27] and mRNA [3,27]. A 45 kDa l'o~m t~l G L U T I has also been identified in ncuronal/glial membranes using Western blotting techniques [20]. In the present study, we observed cells with small oval nuclei which were labeled by the G L U T I antisensc probes. A histochemical stain, periodic acid-BFAA. was used to locate microvessels in brain sections hybridized to these probes. This technique stained capillary basement membranes and allowed identification of vascular cells which were not identifiablc in hematoxylin and eosin or Cresyl violet-stained sections. The BFAA-stained sections demonstrated that many, and perhaps all, of the small, labeled nuclei were associated with the microvasculature. Although we found no convincing evidence for GLUT1 mRNA in glial cells, we cannot exclude this possibility. Neuronal expression of GLUT1 m R N A was observed in neurons of the dentate gyrus, but only following ischemia. This finding is in agreement with a recent study of middle cerebral artery occlusion in the rat [18]. That postischemic neuronal GLUT1 was less extensive and less pronounced in our study may be related to the relatively short (6 rain) ischemic period we employed versus permanent middle cerebral artery occlusion [18]. The localization of GLUT3 mRNA in neurons is also consistent with previous in situ hybridization studies [3,24]. In contrast to our previous report using immunocytochemical methods [8], we were unable to detect G L U T 3 in association with brain microvessels or the blood-brain barrier. Our present results are therefore compatible with a Western blot study [20] that failed to detect GLUT3 in brain microvessel preparations. In the case of human brain, studies using Western blots [20] and immunocytochemical techniques [21] disagree on whether GLUT3 is present in cerebral microvessels. Our results (unpublished) and those of others [30] suggest that immunocytochemical studies with antibodies raised to the carboxyl-terminus of human GLUT3 may cross react with other molecular species and lead to false positive results. Total RNA synthesis in the postischemic gerbil brain is quantitatively similar to that in normal brain: however, individual RNAs may increase or decrease [16]. Therefore, the observed postischemic increases in glucose transporter mRNAs are not simply part of a general increase in gene expression following ischemia. However, a previous immunocytochemical study of GLUT1 in our laboratory found no postischemic increase in transporter protein [7]. Other workers have also found that there is a dissociation between RNA and protein synthesis activities in postischemic brain [36]. During early reperfusion, some newly synthesized mRNAs accumulate at the same time as protein synthesis is suppressed [16,34,37]. These observations suggest that certain posttran~riptional cellular functions

D.Z. Gerhart et al. / Molecular Brain Research 25 (1994) 313-322

have been disrupted. These functions may include nuclear R N A processing, translocation of R N A from the nucleus to the cytoplasm, association of mRNA with the cytoplasmic cytoskeleton, or formation of the translation initiation complex [16]. Thus the lack of an increase in GLUT1 protein may be related to failure of the cellular transcription-translation system. Intracellular signaling pathways may be involved in postischemic increases in glucose transporter mRNAs. For example, protein kinase C activity and gene transcription may both increase in the postischemic gerbil brain [17,25]. Since the fll forrfl of protein kinase C has been shown to increase the ability of phorbol ester to induce GLUT1 mRNA [23], the level of protein kinase C expression could be an important control factor for glucose transporter gene expression. Increases in transcriptional activator proteins following ischemia could also account for increases in particular mRNAs. Recent studies have demonstrated that ischemia induces mRNA for both the c-los and c-jun protooncogenes [12,26]. Analysis of the c-FOS and c-JUN proteins after ischemia demonstrated an increase in the formation of the AP-1 complex and binding of this complex to D N A promoter sequences. In addition, the src oncogene has been shown to regulate glucose transporters in chicken embryo fibroblasts [35]. Whether these or other activator proteins are involved in glucose transporter mRNA regulation after ischemia remains to be determined. Brief ischemic periods of 5-10 min duration have been reported to depress glucose utilization in rats and gerbils [1,15,32]. Our observations of postischemic increases in GLUT1 and GLUT3 mRNAs indicate that the reported declines are not a consequence of reduced amounts of glucose transporter mRNAs. On the contrary, our data suggest that the brain possesses the capacity for up-regulation of glucose transporter gene expression. Similar regulatory mechanisms may function to alter glucose transporter protein expression in other physiological or pathophysiological conditions including diabetes and epilepsy.

Acknowledgement This work was supported by the National Institutes of Health, NS 27229.

References [1] Beck, T., Wree, A. and Schleicher, A., Glucose utilization in rat hippoeampus after long-term recovery from ischemia, Z Cereb. Blood Flow Metab., 10 (1990) 542-549. [2] Betz, A.L., Iannotti, F. and Hoff, J.T., Ischemia reduces bloodto-brain glucose transport in the gerbil, J. Cereb. Blood Flow Metab., 3 (1983) 200-206.

321

[3] Bondy, C.A., Lee, W.-H. and Zhou, J., Ontogeny and cellular distribution of brain glucose transporter gene expression, Mol. Cell. Neurosci., 3 (1992) 305-314. [4] Borson, N.D., Salo, W.L. and Drewes, L.R., A lock-docking oligo(dT) primer for 5' and 3' RACE PCR, PCR Methods Appl., 2 (1992) 144-148. [5] Dick, A.P.K., Harik, S.I., Klip, A. and Walker, D.M., Identification and characterization of the glucose transporter of the blood-brain barrier by cytochalasin B binding and immunological reactivity, Proc. Natl. Acad. Sci. USA, 81 (1984) 7233-7237. [6] Gerhart, D.Z., LeVasseur, R.J., Broderius, M.A. and Drewes, L.R., Glucose transporter localization in brain using light and electron immunocytochemistry, J. Neurosci. Res., 22 (1989) 464472. [7] Gerhart, D.Z., Djuricic, B. and Drewes, L.R., Quantitative immunocytochemistry (image analysis) of glucose transporters in the normal and postischemic rodent hippocampus, J. Cereb. Blood Flow Metab., 11 (1991) 440-448. [8] Gerhart, D.Z., Broderius, M.A., Borson, N.D. and Drewes, L.R., Neurons and microvessels express the brain glucose transporter protein GLUT3, Proc. Natl. Acad. Sci. USA, 89 (1992) 733-737. [9] Harik, S.I., Kalaria, R.N., Andersson, L., Lundahl, P. and Perry, G., Immunocytochemical localization of the erythroid glucose transporter: abundance in tissues with barrier functions, J. Neurosci., 10 (1990) 3,862-3,872. [10] Horobin, R.W. and KeviU-Davies, I.M., Basic fuchsin in acid alcohol: a simplified alternative to Schiff Reagent, Stain Technol., 46 (1971) 53-58. [11] Kaestner, K.H., Christy, R.J., McLenithan, J.C., Braiterman, L.T., Cornelius, P., Pekala, P.H. and Lane, M.D., EMBL/GenBank data base No. M23384 (1989). [12] Kindy, M.S., Carney, J.P., Dempsey, R.J. and Carney, J.M., Ischemic induction of protooncogene expression in gerbil brain, J. Mol. Neurosci., 2 (1991) 217-228. [13] Kintner, D., Costello, D.J., Levin, A.B. and Gilboe, D.D., Brain metabolism after 30 minutes of hypoxic or anoxic perfusion or ischemia, Am. J. Physiol., 239 (1980) E501-E509. [14] Kirino, T., Delayed neuronal death in the gerbil hippocampus following ischemia, Brain Res., 239 (1982) 57-69. [15] Kozuka, M., Smith, M.-L. and Siesj6, B.K., Preischemic hyperglycemia enhances postischemic depression of cerebral metabolic rate, J. Cereb. Blood Flow Metab., 9 (1989) 478-490. [16] Krause, G.S. and Tiffany, B.R., Suppression of protein synthesis in the reperfused brain, Stroke, 24 (1993) 747-755. [17] Kumar, K., Savithiry, S. and Madhukar, B., Expression of protein kinase C in postischemic brain: an in situ hybridization study, Metab. Brain D/s., 7 (1992) 93-100. [18] Lee, W.-H. and Bondy, C.A., Ischemic injury induces brain glucose transporter gene expression, Endocrinology, 133 (1993) 2540-2544. [19] Logel, J., Dill, D. and Leonard, S., Synthesis of cRNA probes from PCR-generated DNA, BioTechniques, 13 (1992) 604-610. [20] Maher, F., Vannucci, S.J. and Simpson, I.A., Glucose transporter isoforms in brain: absence of GLUT3 from the bloodbrain barrier, J. Cereb. Blood Flow Metab., 13 (1993) 342-345. [21] Mantych, G.J., James, D.E., Chung, H.D. and Devaskar, S.U., Cellular localization and characterization of Glut 3 glucose transporter isoform in human brain, Endocrinology, 131 (1992) 1,270-1,278. [22] Maruno, M. and Yanagihara, T., Progressive loss of messenger RNA and delayed neuronal death following transient cerebral ischemia in gerbils, Neurosci. Lett., 115 (1990) 155-160. [23] Mountjoy, K.G., Housey, G.M. and Flier, J.S., Overproduction of the /31 form of protein kinase C enhances phorbol ester induction of glucose transporter mRNA, Mol. Endocrinot, 3 (1989) 2018-2027.

322

D.Z. (;erhart et al..' '~h)lecular Brain Research 25 Iit1941 313-322

[24] Nagamatsu, S., Kornhauser, J.M., Burant, C.F., Seino, S., Mayo, K.E. and Bell, G.I., Glucose transporter expression in brain: cDNA sequence of mouse GLUT3, the brain facilitative glucose transporter isoform, and identification ol sites of expression by in situ hybridisation, J. Biol. Chem., 267 (t992) 467--472. [25] Ol~ih, Z., lkeda, J., Anderson, W.B. and Jo6, F., Altered protein kinase C activity in different subfields of hippocampus following cerebral ischemia, Neurochem. Res., 15 (1990) 515-518. [26] Onodera, H., Kogure, K., Ono, Y., Igarashi, K., Kiyota, Y. and Nagaoka, A.. Proto-oncogene c-los is transiently induced in the rat cerebral cortex after forebrain ischemia. Neurosei. l,ett., 98 (1989) 101--104. [27] Pardridge, W.M., Boado, R.J. and Farrell, C.R., Brain-type glucose transporter (GLUT-I) is selectively localized to the blood-brain barrier. Studies with quantitative Western blotting and in situ hybridization, J. BioL Chem., 265 (199(t) 18,(135-

18,(14(1. [28] Pulsinelli, W.A., Levy, D.E. and Duffy, T.E., Regional cerebral blood flow and glucose metabolism following transient forebrain ischemia, Ann. Neurol., 11 (1982)499-5(19. [29] Sawicki, W. and Rowinski, J., Periodic acid-Schiff reaction combined with quantitative autoradiography of 3H-thymidine- or 3SS-sulfate-labeled epithelial cells of colon, Histochemie, 19 (1969) 288-294. [30] Shepherd, P.R., Gould, G.W., Colville, C.A., McCoid, S.C., Gibbs, E.M. and Kahn, B.B., Distribution of GLUT3 glucose transporter protein in human tissues, Biochem. Biophys. Res. Commun., 188 (1992) 149-154.

[31] Simmons, D.M., Arriza, J.L. and Swanson, L.W., A complete protocol tot in situ hybridization of messenger RNAs in brain and other tissues with radiolabeled single-stranded RNA probes, J. Histotech., 12 (1989) 169-181. [32] Suzuki, R., Yamaguchi, T., Kirino, T., Orzi, t:, and Klatzo, I., The effects of 5-minute isc:hemia in Mongolian gerbils: 1. Blood-brain barrier, cerebral blood flow, and local cerebral glucose utilization changes, Acta Neuropalhol., 60 (1983) 207-21~. [33] Swanson, L.W. and Simmons, D.M., Differential steroid hormone and neural influences on peptide mRNA levels in CRH cells of the paraventricular nucleus: a hybridization histochemical study in the rat, J. Comp. NeuroL, 285 (19891 413-435. [34] Thilmann, R., Xie, Y., Kleihues, P. and Kiessling, M., Persistent inhibition of protein synthesis precedes delayed neuronal death in postischemic gerbil hippocampus, Acta NeuropathoL. 71 ( 19861 88-93. [35] White, M.K., Rail, T.B. and Weber, M.J., Differential regulation of glucose transporter isoforms by the .~rc oncogene in chicken embryo fibroblasts, Mol. CelL BioL. 11 (1991) 4,4484,454. [36] Xie, Y., Herget, T., Hallmayer, J., Starzinski-Powitz, A. and Hossmann, K.-A., Determination of RNA content in postischemic gerbil brain by in situ hybridization, MetaboL Brain Dis., 4 (1989) 239-251. [37] Yanagihara, T., Cerebral ischemia in gerbils: differential vulnerability of protein, RNA, and lipid syntheses. Stroke, 7 (1976) 260-263.