Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics

Article

Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics Graphical Abstract

Authors Xiucong Bao, Zheng Liu, Wei Zhang, ..., Jason Wing Hon Wong, Karen Wing Yee Yuen, Xiang David Li

Correspondence [email protected] (J.W.H.W.), [email protected] (K.W.Y.Y.), [email protected] (X.D.L.)

In Brief Bao et al. identify H4 Lys91 glutarylation (H4K91glu) as a new histone mark for active gene expression. H4K91glu is ‘‘written’’ and ‘‘erased’’ by KAT2A and Sirt7, respectively. Sirt7-catalyzed removal of H4K91glu is associated with chromatin condensation during mitosis and in response to DNA damage.

Highlights d

H4K91glu is a new histone mark enriched at promoters of highly expressed genes

d

H4K91glu destabilizes nucleosome by affecting (H2A/H2B) and (H3/H4)2 interaction

d

H4K91glu is regulated by KAT2A and Sirt7 as its ‘‘writer’’ and ‘‘eraser,’’ respectively

d

H4K91glu regulates chromatin structure and dynamics in response to DNA damage

Bao et al., 2019, Molecular Cell 76, 1–16 November 21, 2019 ª 2019 Elsevier Inc. https://doi.org/10.1016/j.molcel.2019.08.018

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

Molecular Cell

Article Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics Xiucong Bao,1 Zheng Liu,1,5 Wei Zhang,2,5 Kornelia Gladysz,3,5 Yi Man Eva Fung,1,4 Gaofei Tian,1 Ying Xiong,1 Jason Wing Hon Wong,3,* Karen Wing Yee Yuen,2,* and Xiang David Li1,6,* 1Department

of Chemistry, University of Hong Kong, Pokfulam Road, Hong Kong, China of Biological Sciences, University of Hong Kong, Pokfulam Road, Hong Kong, China 3School of Biomedical Sciences, University of Hong Kong, Pokfulam Road, Hong Kong, China 4The State Key Laboratory on Synthetic Chemistry, University of Hong Kong, Pokfulam Road, Hong Kong, China 5These authors contributed equally 6Lead Contact *Correspondence: [email protected] (J.W.H.W.), [email protected] (K.W.Y.Y.), [email protected] (X.D.L.) https://doi.org/10.1016/j.molcel.2019.08.018 2School

SUMMARY

Histone posttranslational modifications (PTMs) regulate chromatin structure and dynamics during various DNA-associated processes. Here, we report that lysine glutarylation (Kglu) occurs at 27 lysine residues on human core histones. Using semi-synthetic glutarylated histones, we show that an evolutionarily conserved Kglu at histone H4K91 destabilizes nucleosome in vitro. In Saccharomyces cerevisiae, the replacement of H4K91 by glutamate that mimics Kglu influences chromatin structure and thereby results in a global upregulation of transcription and defects in cell-cycle progression, DNA damage repair, and telomere silencing. In mammalian cells, H4K91glu is mainly enriched at promoter regions of highly expressed genes. A downregulation of H4K91glu is tightly associated with chromatin condensation during mitosis and in response to DNA damage. The cellular dynamics of H4K91glu is controlled by Sirt7 as a deglutarylase and KAT2A as a glutaryltransferase. This study designates a new histone mark (Kglu) as a new regulatory mechanism for chromatin dynamics. INTRODUCTION In eukaryotic cells, chromatin is involved in the regulation of various cellular processes requiring access to DNA, including gene transcription, DNA replication, and DNA damage repair (Ehrenhofer-Murray, 2004; Groth et al., 2007; Venkatesh and Workman, 2015; Voss and Hager, 2014). Nucleosome is the fundamental repeating unit of chromatin, in which 147 bp of DNA tightly wrap around an octameric complex of two copies of each of the core histones H2A, H2B, H3, and H4. The structures of nucleosomes and chromatin are highly dynamic during various nuclear processes. The changes in the dynamic structure of chromatin involve the formation or disruption of inter-

and intra-nucleosomal DNA-histone and histone-histone interactions (Ridgway and Almouzni, 2001; Sewitz et al., 2017). One primary mechanism that controls chromatin dynamics is through posttranslational modifications (PTMs) of histones such as acetylation, methylation, and ubiquitylation (Bowman and Poirier, 2015; Zentner and Henikoff, 2013). Increasing evidence suggests that these histone modifications modulate every distinct step in the organization of chromatin, including histone folding, assembly of DNA and histones into nucleosomes, and compaction of nucleosomes into higher-order structures of chromatin. There are two structurally distinct domains in a histone octamer: the unstructured tails and the globular domain, which forms the nucleosomal core (Luger et al., 1997). Although it was long thought that histone modifications were mainly distributed in the flexible tails, recently, many histone PTMs have been discovered on the histone core, and their regulatory roles in chromatin structure and dynamics have just begun to be unraveled (Tessarz and Kouzarides, 2014; Tropberger and Schneider, 2013). Among the best-known histone core modifications is lysine acetylation (Kac) that neutralizes the positively charged lysine side chain and can thereby greatly affect inter- and intranucleosomal interactions. For example, the acetylation of Lys56 in histone H3 (H3K56), which is located at the DNA entry-exit site, was reported to affect the compaction state of chromatin by enhancing the unwrapping and accessibility of DNA (Chen et al., 2008; Li et al., 2008; Masumoto et al., 2005). The acetylation of H3K122 (Tropberger et al., 2013) and H3K64 (Di Cerbo et al., 2014) on the lateral surface of the histone octamer destabilizes the nucleosomal structure by affecting a DNA-histone interaction, which leads to the eviction of the nucleosome from promoters during transcriptional activation. Another example that links histone core acetylation to intra-nucleosomal interaction comes from studies of histone H4K91, a residue positioned at the interface between the H3-H4 tetramer and the H2A-H2B dimers. The H4K91A mutation mimicking the loss-of-charge state of H4K91 acetylation results in defects in the chromatin assembly (Ye et al., 2005). Besides acetylation, a variety of lysine acyl modifications have recently been discovered (Hirschey and Zhao, 2015). Lysine malonylation (Kmal) (Du et al., 2011; Peng et al., 2011), succinylation (Ksucc) (Du et al., 2011; Zhang et al., 2011), and glutarylation Molecular Cell 76, 1–16, November 21, 2019 ª 2019 Elsevier Inc. 1

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

Figure 1. Detection of Histone Lysine Glutarylation by Chemical Reporter (A) The hypothesized enzymatic reactions for lysine (de)glutarylation. (B) Chemical structure of the chemical reporter GluAM-yne. (C) Strategy for detection and identification of glutarylated protein substrates using chemical reporter. (D) HeLa S3 cells were labeled with 200 mM GluAM-yne in the presence of a series of an indicated concentration of GluAM as a competitor. (E) Quantitative analysis of in-gel fluorescence results in (D). Error bars indicate means ± SEs, n = 3. The p values are based on the Student’s t test: *p < 0.05, **p < 0.01, ***p < 0.001. (F) Immunoblotting analysis showing the enrichment of two known substrates of lysine glutarylation, CPS1 and GAPDH. (legend continued on next page)

2 Molecular Cell 76, 1–16, November 21, 2019

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

(Kglu) (Tan et al., 2014) are three newly identified lysine acylations that were first discovered in various mitochondrial proteins. Increasing evidence suggests that these acylations are involved in the regulation of a variety of metabolic processes (Du et al., 2015; Nishida et al., 2015; Park et al., 2013; Yang et al., 2015). In addition, Kmal and Ksucc have been found to occur at many different residues in histone tail and core regions (Xie et al., 2012). Although Kglu was also identified at three lysine residues of histone H2A (Tan et al., 2014), a systematic mapping of histone Kglu is still lacking. Due to the presence of a negatively charged carboxylate group, Kmal, Ksucc, and Kglu induce more dramatic changes in the physicochemical properties of the modified lysine residues when compared with the well-studied Kac. These negatively charged acylations are expected to greatly challenge chromatin stability and therefore affect chromatin-associated nuclear processes (Sabari et al., 2017). However, it remains poorly understood whether and how these modifications could regulate chromatin structure and dynamics. RESULTS Labeling of Histones by a Chemical Reporter for Lysine Glutarylation To facilitate the study of Kglu (Figure 1A), we developed a chemical reporter, GluAM-yne (Figure 1B; Supplemental Information), for the detection and identification of glutarylated protein substrates in cells. The design of GluAM-yne was based on glutarate, a precursor of Kglu. Inspired by our previous experience in the development of a chemical reporter for Kmal (Bao et al., 2013) and Khmg (Bao et al., 2018), we modified glutarate by installing a terminal alkyne to facilitate a bioorthogonal conjugation of the labeled proteins for fluorescence imaging and affinity enrichment and two acetoxymethyl (AM) groups that mask the negative carboxylates of glutarate to improve cell permeability (Figure 1C). As expected, GluAM-yne metabolically labeled cellular proteins with an optimal concentration of 200 mM, which is comparable to the metabolic labeling of malonylated proteins using MalAM-yne. The pattern of protein labeled with GluAM-yne did not resemble that with the other tested lysine acylation reporters, including 4-pentynoic acid (Thinon and Hang, 2015; Yang et al., 2010), long-chain fatty acid (Wilson et al., 2011), and even MalAM-yne (Bao et al., 2013), a structural homolog of GluAM-yne (Figure S1A). This result suggests that Kglu may have a substrate profile that differs from other lysine acyl modifications. The labeling of proteins with GluAM-yne was significantly inhibited by an excessive amount of glutarate, but not by succinate, malonate, or crotonate (Figures 1D, 1E, S1B, and S1C), indicating that the chemical reporter labels the proteins targeted by the Kglu precursor. In addition, the ability of GluAM-yne to identify glutarylated proteins was further validated by efficient and specific enrichment of two known Kglu sub-

strates, carbamoyl phosphate synthase 1 (CPS1) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Tan et al., 2014) (Figure 1F). We next used GluAM-yne to investigate the cellular localization of glutarylated proteins. The click chemistry-assisted fluorescence cell imaging suggested that the reporter-labeled proteins were mainly localized in the nucleus (Figure 1G). In line with this result, in-gel fluorescence imaging of different cellular fractions also revealed the labeling of nuclear proteins by GluAM-yne (Figure 1H). Notably, two protein bands labeled by GluAM-yne had a molecular mass of approximately 15 kDa. We speculated that the labeled proteins may be histones. By isolating histones from cells, we observed a robust labeling of all of the core histones by GluAM-yne (Figure 1I). Identification and Validation of Histone Lysine Glutarylation To map the sites of histone Kglu, we extracted core histones from HeLa cells followed by in-solution trypsin digestion and mass spectrometry (MS) analysis. To gain high sequence coverage, the histone proteolytic peptides were generated for liquid chromatography-tandem MS (LC-MS/MS) analysis by three parallel methods according to a previously reported methodology for systematic analysis of histone PTMs (Tan et al., 2011). The acquired MS/MS spectra were analyzed by MaxQuant software to identify potential glutarylated lysine residues by setting Kglu (C5H6O3, mass shift +114.0317 Da) as a variable modification. In this experiment, 27 Kglu sites were identified on core histones from HeLa cells (Figures 2A and 2B;Supplemental Information). To ensure that the derived mass shift of +114.0317 Da is caused by Kglu rather than other structural isomers, we sought to compare the retention time, MS, and MS/MS spectra of the putative histone Kglu peptides identified from HeLa cells with their synthetic counterparts (Figure 2C). Toward this end, we synthesized two Kglu peptide standards according to the glutarylated histone H4K31 (24DNIQGITKgluPAIR35) and H3K79 (73EIAQDFKgluTKLR83) peptide candidates identified in the original MS analysis. The synthetic peptides were then propionylated by deuteriumlabeled propionic anhydride (C6D10O3), while a cell-derived tryptic histone peptide mixture was labeled by normal propionic anhydride (C6H10O3). The propionylated synthetic and cellderived peptides were then mixed and subjected to an LC-MS/ MS analysis. The deuterium-labeled propionylated synthetic H4K31 glu peptide (D5-pr-24DNIQGITKgluPAIR35) was found to coelute with a cell-derived tryptic peptide, with the mass 5 Da less than the synthetic peptide (Figure 2D). A high-resolution MS/MS analysis revealed that all of the C-terminal fragments (i.e., y ions) of this tryptic peptide were the same as that of the synthetic H4K31 glu peptide, whereas all of its b ions had a
5-Da mass shift when compared with that of the synthetic

(G) Immunofluorescence image showing the cellular distribution of GluAM-yne-labeled proteins in HeLa cells by fluorescence microscopy. Blue channel: DAPI. Green channel: fluorescein isothiocyanate (FITC). Red channel: rhodamine. Scale bar, 20 mm. (H) Metabolic labeling of cytoplasmic (Cyt) or nuclear (Nuc) extracted proteins by GluAM-yne. Immunoblotting analyses of histone H3 and a-tubulin showing the purity of nuclear and cytoplasmic fractions, respectively. The arrows indicate the protein bands, with molecular weight at 15 kDa. (I) Metabolic labeling of core histone by GluAM-yne. Coomassie blue (CB) staining showing equal protein loading. FI, fluorescence imaging. See also Figure S1.

Molecular Cell 76, 1–16, November 21, 2019 3

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

(legend on next page)

4 Molecular Cell 76, 1–16, November 21, 2019

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

peptide (Figure 2E). These data confirmed that the originally detected mass shift of +114 Da in the tryptic histone peptides from HeLa cells is caused by Kglu. Similarly, we also verified Kglu in a tryptic histone H3K79 peptide (73EIAQDFKgluTKLR83) (Figures S2A–S2D). Histone H4K91glu Destabilizes Nucleosome In Vitro Among the 27 identified histone glutarylation sites, we focused on a Kglu mark on the globular domain of histone H4 at Lys 91 (H4K91glu), which has the highest modification stoichiometry among the six sites (H4K91, H4K77, H4K59, H3K115, H2BK46, and H2BK108), with only the glutaryl group detected from tryptic histone peptides (Figures S2E–S2G). This lysine residue locates at the interface between the histone H3/H4 tetramer and the H2A/H2B dimer and forms a salt bridge with a glutamic acid residue from histone H2B within a nucleosome (Figure S3A) (Cosgrove et al., 2004). We therefore reasoned that the installation of a negatively charged, bulky glutaryl group at this site would affect nucleosome stability. To test this hypothesis, we used an expressed protein ligation (EPL) (Muir et al., 1998) strategy to semi-synthesize homogeneous histone H4 with K91 glutarylation at the stoichiometric level (Figures 3A–3C). This semi-synthetic H4K91glu, together with the recombinant histone H2A, H2B, and H3, was then used to assemble histone octamer in vitro. In a size-exclusion chromatography analysis, the assembled protein complex showed an apparent molecular weight that was lower than an expected octamer but higher than an H3/H4 tetramer (Figure 3D). While all of the core histones were detected in the assembled complex, H2A and H2B appeared to be substoichiometric (Figure 3E), suggesting that H4K91glu may prevent an efficient assembly of H2A/H2B dimers to the H3/H4 tetramer for the octamer formation. We next reconstituted mononucleosomes from a DNA fragment containing a nucleosome positioning (Widom 601) sequence and pre-assembled octamer, pre-assembled H3/H4 tetramer and H2A/H2B dimer, or individual core histones, respectively (Figure S2B). The reconstituted mononucleosomes were then examined by a gel electrophoresis mobility shift assay (EMSA), in which differences in the mass of particles were revealed by their inversely proportional mobility. No matter which method of reconstitution was used, the incorporation of K91 glutarylated H4 led to the formation of a large portion of the H3/H4 tetramer-DNA complex (i.e., tetrasome), while the unmodified core histones were predominantly assembled into mononucleosomes (Figures S2C–S2E). This result aligns with the observation in the histone octamer assembly experiment above and suggests that H4K91glu could perturb interactions between the histone H3/H4 tetramer and the H2A/H2B dimer within a nucleosome.

Histone H4K91glu Promotes Dissociation of H2A/H2B Dimers from Nucleosomes To further investigate the effect of H4K91glu on nucleosome dynamics, we used a Fo¨rster resonance energy transfer (FRET) approach to analyze the structural transitions during nucleosome disassembly. In response to increasing ionic strength, nucleosomes are known to undergo a stepwise disassembly, which involves the opening of the interface between the H3/H4 tetramers and the H2A/H2B dimers and the dissociation of the H2A-H2B dimers from the DNA as the first steps (Bo¨hm et al., 2011). Given the location of H4K91glu at the interface between the H2A/H2B dimer and the H3/H4 tetramer, we reasoned that it may facilitate the release of H2A-H2B from the nucleosome. To test this hypothesis, Alexa 488 and Alexa 594 were used as donor and acceptor fluorophores, respectively, to label the ends of a nucleosomal DNA (Figure 3F) (Gansen et al., 2015). Changes in nucleosome architecture can thus be investigated by monitoring changes in the distance between the donor and acceptor. In a tightly compacted nucleosome, the fluorophores at the DNA ends are within the critical distance for efficient FRET. When the H2A-H2B dimers dissociate from the nucleosome, the ends of DNA are loosed from the nucleosome, causing the loss of FRET. We assembled unmodified and H4K91glu mononucleosomes with end-labeled DNA (Figure S3F) and performed the FRET assay. We observed a sigmoidal decay in FRET between the donor and acceptor fluorophores at the DNA ends, as the salt concentration of the nucleosome solution was increased gradually (Figures 3F, S3G, and S3H). The salt concentration at which the FRET had decreased by 50% is denoted as c1/2, which reflects the stability of the nucleosomes. When compared with the nucleosomes reconstituted from unmodified histone H4, the nucleosomes containing the H4K91glu showed a significantly lower c1/2 value (Figures 3H and S3H), indicating that this glutarylation facilitated the dissociation of the H2A/ H2B dimer from the H3/H4 tetramer. This conclusion is also supported by another FRET experiment in which the dissociation of the H2A/H2B dimer from the nucleosome was monitored by the donor and acceptor fluorophores that labeled the middle of DNA and H2B, respectively (Figures 3G and 3H). Histone H4K91E Induces Defects in Cell-Cycle Progression We next sought to investigate the potential roles of H4K91glu (Figure S4A) in regulating nucleosome and chromatin dynamics in vivo using Saccharomyces cerevisiae. To this end, we generated budding yeast strains in which histone H4 K91 was mutated to glutamic acid (K91E; Figure S4B), glutamine (K91Q), and arginine (K91R) to mimic glutaryalated, acetylated, and unmodified

Figure 2. Identification of Lysine Glutarylation on Histones (A) A diagram showing histone Kglu sites identified in this study. (B) Map of histone Kglu residues present in the globular domains of the nucleosome and C terminus. (C) Validation of histone lysine glutarylation. Histone tryptic peptides and synthetic standard peptides were treated with light (CH3CH2CO)2O) and heavy (CD3CD2CO)2O) forms of propionic anhydride, respectively, and then pooled together for subsequent analysis. (D) Standard peptide D5-prDNIQGITKgluPAIR and in vivo-derived peptide 24prDNIQGITKgluPAIR35 from histone H4 showing the same retention time. (E) Standard peptide and in vivo-derived peptide showing consistent MS/MS spectral pattern, except for a 5-Da mass shift in their precursor ion peaks and b ions caused by D5 incorporation in the propionyl group. See also Figure S2.

Molecular Cell 76, 1–16, November 21, 2019 5

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

(legend on next page)

6 Molecular Cell 76, 1–16, November 21, 2019

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

lysine, respectively (Table S1). We compared the growth rates of the wild type and these K91 mutant strains. While all of the mutant strains showed a slower growth rate than the wild-type strain, the H4K91E mutation resulted in the greatest delay in cell proliferation (Figures 4A and S4C). It was noted that the growth defects observed in the presence of the H4K91 alleles were not due to alterations in histone H4 protein expression levels (Figure S4D). Further analysis of the cell-cycle distribution revealed a large decrease in the population of the H4K91E mutant cells in G1 phase and an increase in both the S and G2/M populations (Figure 4B). Consistently, the H4K91E mutant cells demonstrated significant delays in S and G2/M phase progression (Figure S4E). This prolonged cell cycle suggests that the K91E mutation, the mimic of K91glu, may compromise the assembly of nucleosome and chromatin in a series of DNA-associated processes during S phase and mitosis. Histone H4K91E Increases Sensitivity to DNA Damage Given the defects in cell-cycle progression induced by the H4K91E, we next examined whether this mutation would influence the DNA damage repair process that requires efficient disassembly and reassembly of nucleosomes. Yeast strains were assayed upon the challenge of a series of DNA-damaging agents, including methyl methanesulfonate (MMS), hydroxyurea (HU), and UV radiation (Figures 4C and4D). As expected, the H4K91E mutation significantly increased cell sensitivity to these DNA-damaging agents, whereas the K91Q and K91R alleles showed little effect, indicating that H4K91glu may play a distinct role in response to DNA damage. To further elucidate how the DNA repair process may be affected by H4K91glu, we generated the yeast strains with H4K91E mutation combined with mutations in the factors involved in distinct aspects of the DNA repair process (Table S1). H4K91E mutation exacerbated the HU sensitivity of the strains that had defects in either the nonhomologous end-joining (yku70D) or homologous recombinational (rad52D) repair pathways (Figure S4F), whereas the depletion of factors involved in chromatin assembly, including ASF1, CAC1, and HIR1, did not aggravate the sensitivity of H4K91 mutant cells (Figure 4E). This genetic evidence strongly supports our hypothesis that H4K91glu could affect the assembly of chromatin in DNA damage response. Histone H4K91E Influences Chromatin Structure The defects in nucleosome and chromatin assembly would likely lead to local and global defects in chromatin structure. To examine the effect of the H4K91E allele on silent chromatin

structure, we next inserted a reporter gene (URA3) near the telomere regions (Figure S4G). Transcriptional silencing of URA3 was assayed by comparing the growth of cells in the presence of 5-fluoro-orotic acid (5-FOA), which can be converted into a cytotoxic compound, 5-fluorouracil, when URA3 is transcriptionally active. As shown in Figure 4F, the transcriptional silencing of URA3 near the telomeres was severely disrupted by the H4K91E mutation. To seek direct evidence that the H4K91E mutation influences the chromatin compaction structure, we isolated chromatin from the wild-type and H4K91E cells and performed a micrococcal nuclease (MNase) digestion assay. The chromatin extracted from the H4K91E mutant cells was found to be digested more rapidly than that from the wild-type cells (Figure 4G), indicating a less compact chromatin structure in the K91E mutant cells. In addition, we performed an RNA sequencing (RNA-seq) analysis to examine the effect of K91E mutation on global transcription. As shown in Figure 4H, hundreds of genes were upregulated in the H4K91E mutant cells. In line with the effect of H4K91E mutant on telomere structure and global chromatin structure, the plot showed that most of the significant changes occurred in the lowly expressed genes in the compacted chromatin regions. These data agree well with the observed nucleosome instability caused by H4K91glu in vitro. Sirt7 Functions as a Histone Deglutarylase To facilitate the study of H4K91glu in mammalian cells, we raised a rabbit polyclonal antibody against this histone mark. A series of tests validated that the antibody is modification specific and site specific against histone H4K91glu (Figures 5A, 5B, and S5A). Using this anti-H4K91glu antibody, we detected Kglu on histones extracted from budding yeast (S. cerevisiae), mouse (RAW264.7), and various human (HeLa, HEK293T, HL60, U2OS, HepG2, and MOLM-13) cells (Figure 5C), indicating that H4K91glu is evolutionarily conserved. With the specific anti-H4K91glu antibody, we sought to identify enzymes that regulate H4K91glu in human cells. Sirt5 was reported to function as deglutarylase on mitochondrial proteins (Tan et al., 2014). However, the depletion of Sirt5 had no detectable effects on the H4K91glu level (Figure S5B). The treatment of the cells with nicotinamide (NAM), a broad-spectrum inhibitor for all sirtuins (Avalos et al., 2005), caused a significant increase in the histone H4K91glu level (Figure 5D), indicating the possibility of other sirtuins contributing to the histone deglutarylation process. We then turned to another potential candidate, Sirt7, a nucleus-localized sirtuin that was recently discovered to function as a histone desuccinylase (Li et al., 2016). The glutarylation of

Figure 3. Effects of H4K91glu on Nucleosome Stability (A) Expressed protein ligation (EPL) strategy to synthesize histone H4K91glu protein. (B and C) Characterization of purified histone H4K91glu protein by high-performance liquid chromatography (HPLC) (B) and electrospray ionization-mass spectrometry (ESI-MS) (C). (D) Elution profile of histone complexes from a Superdex S-200 gel-filtration column. Black trace: unmodified histone octamer; black dashed trace: unmodified H3/H4 tetramer; red trace: H4K91glu modified histone complex. (E) A triton acid urea (TAU) gel resolution of single histones and histone complexes. (F and G) Plot showing the normalized FRET efficiency as a function of salt concentration for the nucleosomes containing unmodified H4 or H4K91glu histone H4 and end-labeled DNA (F) or H2B-DNA
15 labeled nucleosomal DNA (G). Error bars indicate average ± SE, n = 3. (H) Summary of c1/2 values for (F) and (G). See also Figure S3.

Molecular Cell 76, 1–16, November 21, 2019 7

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

Figure 4. Effects of H4K91E Mutation on Chromatin-Related DNA Processes and Chromatin Structure in Budding Yeast (A) Growth curve analysis of wild-type and H4K91 mutant cells. (B) Cell-cycle analysis of wild-type and H4K91E mutant cells determined by flow cytometry analysis. (legend continued on next page)

8 Molecular Cell 76, 1–16, November 21, 2019

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

H4K91 was increased by Sirt7 depletion (Figure 5E, 5G, and S5C). Consistently, the overexpression of a hemagglutinin (HA)-tagged Sirt7 resulted in a significant reduction in their histone H4K91glu level (Figures 5F, 5G, and S5C). Besides cell-based assays, we also examined the deglutarylase activity of Sirt7 in vitro. LC-MS was used to monitor the hydrolysis of the H4K91glu peptide by Sirt7. As expected, Sirt7 catalyzed the hydrolysis of the glutaryl peptide in the presence of nicotinamide adenine dinucleotide (NAD) and DNA (Figures 5H, 5I, S5D, and S5E), suggesting an NAD- and DNA-dependent deglutarylation mechanism. In addition to the peptide substrate, Sirt7 also removed Kglu from the semi-synthesized H4K91glu histone protein (Figure 5J). Consistently, chromatin immunoprecipitation (ChIP) coupled with qPCR with the anti-H4K91glu antibody revealed that Sirt7 depletion by small interfering RNA (siRNA) resulted in significant increases in H4K91glu at the promoters of the Sirt7-regulated genes (Figure S5F). These results revealed that Sirt7 functions as a histone deglutarylase both in vitro and in cells. KAT2A Acts as a Histone Glutaryltransferase It was recently reported that a known histone acetyltransferase KAT2A (Grant et al., 1997; Wang and Dent, 2014), when coupled with the a-ketoglutarate dehydrogenase (a-KGDH) complex, can catalyze succinylation on H3K79 (Wang et al., 2017). The a-KGDH complex, which contains three components—oxoglutarate dehydrogenease (OGDH, E1), dihydrolipoyl succinyltransferase (DLST, E2), and dihydrolipoyl dehydrogenase (DLD, E3)—is responsible for the generation of succinyl-coenzyme A (CoA) in the nucleus. Through binding to the a-KGDH complex, KAT2A uses the in situ-generated succinyl-CoA for histone succinylation. It was also reported that the a-ketoadipate dehydrogenase (a-KADH) complex that catalyzes the conversion of a-ketoadipate to glutaryl-CoA shares the same E2 and E3 components of the a-KGDH complex (Nemeria et al., 2018). We therefore speculated that KAT2A may interact with the a-KADH complex and use glutaryl-CoA for H4K91glu. Considering that KAT2A directly binds to OGDH (E1) of the a-KGDH complex, we focused on DHTKD1, the E1 component of the a-KADH complex, to test our hypothesis. Besides the reported mitochondria localization, we found DHTKD1 in the nucleus (Figure 6A). Immunoprecipitation of endogenous DHTKD1 co-purified KAT2A (Figure 6B), suggesting that KAT2A interacted with DHTKD1. Furthermore, the knockdown of KAT2A resulted in a significant reduction in both H4K91glu and H3K9ac levels in HEK293 cells (Figures 6C and 6D). In comparison, DHTKD1 depletion only led to a decreased H4K91glu level, but it had little effect on H3K9ac (Figures 6E and 6F). These results indi-

cated that KAT2A, coupling with the a-KADH complex, can function as a histone glutrayltransferase in cells. Sirt7 Catalyzes H4K91glu Deglutarylation upon Chromatin Condensation As described above, H4K91glu destabilized nucleosomes in vitro and H4K91E mutation induced defects in chromatin compaction in budding yeast. We therefore speculate that the condensation of chromatin may be associated with the deglutarylation of H4K91glu. H4K91glu was found to be at a high level during S phase and to be reduced immediately after the onset of mitosis (Figures 7A, S6A, and S6B), indicating that the removal of the glutarylation at H4K91 was coincident with chromatin condensation in mitosis. Another line of evidence came from immunofluorescence staining. H4K91 glu colocalized with DAPI in the nucleus, but it was excluded from nucleoli marked by an anti-fibrillarin antibody (Figure 7B). Consistently, the H4K91glu mark was wiped off the condensed chromosomes during mitosis (Figure S6C). It was also noted that the cell-cycledependent pattern of Sirt7 expression was opposite that of the H4K91glu level (Figures 7A and S6B), agreeing with the role of Sirt7 as an ‘‘eraser’’ of H4K91glu. Chromatin condensation is also actively involved in the DNA damage response and repair process (Burgess et al., 2014; Li et al., 2016). Therefore, we sought to investigate whether H4K91glu was involved in the DNA damage response in mammalian cells. HEK293T cells were treated with different genotoxic reagents, such as hydroxyurea, camptothecin, doxorubicin, and cisplatin. As shown in Figures 7C and S6D, the level of H4K91glu was dramatically attenuated once cells were exposed to toxic agents. To examine whether Sirt7 is involved in the regulation of H4K91glu upon DNA damage, we treated the control or Sirt7 knockdown cells with HU. As shown in Figure 7D, the reduction of H4K91glu was less evident in the Sirt7 knockdown cells than in the control cells. In addition, we found that H4K91glu was reversely correlated with H2A.X phosphorylation, an early event in the DNA damage response (Figure S6E). These data suggest that the genotoxic reagent-induced decrease in H4K91glu may be functionally associated with Sirt7 in response to DNA damage (Figure 7E). Genomic Distribution of H4K91glu To assess the chromatin occupancy of H4K91glu, we performed a ChIP-seq experiment in human cells. We identified 79,771 H4K91glu-enriched peaks, which were widely distributed in the genome. The ChIP-seq peaks for H4K91glu were mainly enriched in the gene promoter regions (Figure 7E). The average

(C) 10-fold serial dilutions of cells containing the indicated allele of histone H4 were plated on yeast extract-peptone-dextrose (YPD) plates ± the indicated DNAdamaging agents. (D) UV sensitivity analysis of wild-type and H4K91 mutant cells. Error bars indicate average ± SD, n = 4. (E) The indicated histone H4K91E allele was introduced into strains depleted of histone chaperone (ASF1) or chromatin assembly factors (CAC1 and HIR1). (F) Wild-type and H4K91E strains were assayed for silencing of a telomeric URA3 gene inserted on chromosome VIIL and VR by monitoring the cell growth on synthetic complete (SC) plate with or without 0.1% 5-FOA. (G) Equal quantities of nuclei from wild-type and H4K91E cells were digested with MNase for a series of time points. (H) MA plot (expression level in average log counts per million versus log fold change) for differential expression analysis for RNA-seq experiment comparing wildtype with H4K91E mutant. The red points represent significantly differentially expressed genes with a log fold change >1 (false discovery rate [FDR]-corrected p < 0.05 and log fold change [FC] >1). Genes upregulated or downregulated in H4K91E mutant have positive or negative values on the y axis (log FC), respectively. See also Figure S4 and Tables S1 and S2.

Molecular Cell 76, 1–16, November 21, 2019 9

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

Figure 5. Sirt7 Functions as an Endogenous Histone Deglutarylase (A) Dot blot analysis on glutarylated H4K31 and H4K91; H3K79 and H3K122; H2BK20, H2BK116, and H2BK43; H2AK95 peptides; or H4K91 glutarylated, succinylated, acetylated, and unmodified H4 proteins using rabbit anti-H4K91glu antibody. (B) Immunoblotting analysis against human histones using anti-H4K91glu antibody in the presence of different peptides—H4K91glu, H4K91succ, H4K91, or H3K79glu—as a competitor. H4 was used as a loading control. (C) Detection of H4K91glu in different species, ranging from S. cerevisiae and mouse (RAW 264.7) to different human cell lines. (D) Immunoblotting analyses showing that the treatment of nicotinamide (NAM), a pan-sirtuin inhibitor, led to increased H4K91glu signal. PBS treatment served as a negative control. Error bars indicate means ± SEs, n = 3. (legend continued on next page)

10 Molecular Cell 76, 1–16, November 21, 2019

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

Figure 6. Characterization of KAT2A as a Histone Glutaryltransferase (A) Nuclear localization of DHTKD1. Immunoblotting analysis of DHTKD1 and KAT2A in cytosolic (Cyt), mitochondrial (Mit), and nuclear (Nuc) fractions. Immunoblotting analyses of HSP60b, H4, and b-actin showing the purity of cytosolic, mitochondrial, and nuclear fractions, respectively. (B) DHTKD1 binds to KAT2A. Immunoprecipitation with anti-KAT2A antibody were performed. (C and E) Immunoblotting analyses showing the effect of KAT2A knockdown (C) and DHTKD1 knockdown (E) on H4K91glu and H3K9ac. b-Actin, H4, and H3 were used as loading controls. (D and F) Quantitative analysis of immunoblotting results in (C) and (E). Error bars indicate means ± SEs, n = 3. The p values are based on the Student’s t test: *p < 0.05, **p < 0.01, ***p < 0.001.

H4K91glu ChIP-seq signal around genes was strongly enriched at transcription starting sites (TSSs) and also within the gene body. The enrichment was found to be strongest in highly expressed genes, while there was only minor enrichment in non-expressed genes (Figure 7F). This is consistent with the RNA-seq analysis result, in which the incorporation of H4K91E, a mimic of glutarylation, largely resulted in the overexpression

of genes (Figure 4H). We also performed ChIP-PCR of H4K91glu at the promoters of the selected genes. As shown in Figure 7G, H4K91glu was highly enriched at active genes instead of repressive genes. In addition, H4K91glu was found to correlate with euchromatin rather than heterochromatin (Figure 7H). To see the correlation of H4K91glu with KAT2A, we compared their chromatin occupancy and found that KAT2A was also

(E and F) Immunoblotting analyses showing the effect of Sirt7 knockdown (E) and overexpression (F) on H4K91glu levels. H4 and actin were used as loading controls. (G) Quantitative analysis of immunoblotting results in (E) and (F). Error bars indicate means ± SEs, n = 3. (H and I) The hydrolysis of the glutarylated H4K91 peptide by Sirt7 was analyzed by HPLC (H)-MS (I). (J) Immunoblotting analyses showing the deglutarylation of semi-synthesized H4K91glu histone catalyzed by Sirt7 on the PVDF membrane. H4 was used as a loading control. Error bars indicate means ± SEs, n = 3. The p values were based on the Student’s t test: *p < 0.05, **p < 0.01, ***p < 0.001. See also Figure S5.

Molecular Cell 76, 1–16, November 21, 2019 11

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

Figure 7. Cellular Roles of H4K91glu in DNA Damage Response and Gene Transcription (A) Cell cycle-dependent level change of H4K91glu and Sirt7. Cells were synchronized at the G1/S transition by a double-thymidine procedure and then collected every 2 h after releasing for analysis. H4 and actin were used as loading controls. (B) Immunofluorescence analysis showing the distribution of H4K91glu in intermitotic cells. Blue channel: DAPI. Red channel: H4K91glu. Green channel: fibrillarin. Scale bar, 20 mm. (C) Immunoblotting analyses showing H4K91glu, histone H4, and phosphorylation of H2A.X (g-H2A.X) in the absence or presence of the indicated DNA damage reagents, hydroxyurea (HU), camptothecin (CPT), cisplatin (Cis), and doxorubicin (Dox). (legend continued on next page)

12 Molecular Cell 76, 1–16, November 21, 2019

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

mainly distributed at TSSs in the promoter regions. Furthermore, 4,742 chromatin regions were occupied by both H4K91glu and KAT2A; these regions represented 5.9% of the H4K91glu peaks and 38.3% of the KAT2A-occupying peaks, suggesting that the binding of KAT2A to chromatin for glutarylation is transient and dynamic. DISCUSSION H4K91glu Affects Nucleosome Stability and Dynamics Kac (Tan et al., 2011), Kcr (Tweedie-Cullen et al., 2012), and Ksucc (Xie et al., 2012) have been previously reported to occur on histone H4K91. However, in these studies, the identification of the H4K91 acyl modifications was facilitated by using panantibodies (pan-Kac, pan-Kcr, and pan-Ksucc, respectively) to enrich the modified histone peptides for MS analysis. As a result, the studies lack the information about the abundance of the modifications at each site in the original digested histone peptides. In our experiment, we analyzed the digested histones extracted from cells without any enrichment. The relative abundance of each modification could then be estimated from the intensities of their corresponding mass signals. While many histone lysine residues were found to be modified by different acyl modifications such as Kac, Kcr, Ksucc, and Kglu, we detected Kglu only at H4K91, H4K77, H4K59, H3K115, H2BK46, and H2BK108, indicating that the abundance of Kglu is much higher than Kac, Kcr, and Ksucc at these sites (Figures S2E–S2F). Among them, H4K91glu showed the highest modification stoichiometry (2.5%) (Figure S2G). The H4K91ac has also been described to regulate nucleosome stability by affecting the interactions between H2A/H2B dimers and H3/H4 tetramers (Ye et al., 2005). In the study by Ye et al. (2005), the H4K91A mutation results in the destabilization of the histone octamer; however, H4K91A mutation fails to serve as a good mimic for Kac. In the present study, we used a semisynthetic approach to generate fully glutarylated H4K91 histone protein (Figures 3A–3C). The addition of glutarylation at H4K91 led to the formation of a large portion of tetrasome (Figures S3B–S3E). Using the FRET-based approach, which measured the salt sensitivity of nucleosomes, the H4K91glu-containing nucleosomes were less stable than both H4K91ac-containing and -unmodified nucleosomes (Figures S3G and S3H). In agreement with in vitro data, the deglutarylation of H4K91glu is associated with the process of chromatin condensation. We provided evidence that the level of H4K91glu peaked during S phase but dropped rapidly upon entry into mitotic phase (Figures 7A and S6B). More evidence came from the observation that H4K91glu was excluded from the highly compacted nucleoli region (Figure 7B). In addition, during both metaphase and

anaphase, the signal of H4K91glu scarcely can be detected on the chromosomes. In contrast, H4K91ac maintained the high level in mitotic cells and could be detected on the chromosomes (Figure S6C), indicating the different regulatory roles played by H4K91ac and H4K91glu in chromatin structure and dynamics. The incorporation of H4K91glu causes dramatic structural disturbance of the nucleosome both in vitro and in vivo, and therefore has significant consequences for chromatin structure and function. Involvement of Sirt7 in DNA Damage Response Sirt7 has been reported to promote genome integrity and modulate DNA repair (Vazquez et al., 2016). The deficiency of Sirt7 is associated with significantly diminished resistance to oxidative and genotoxic stresses (Vakhrusheva et al., 2008). The loss of function of Sirt7 is associated with chromatin decompaction (Li et al., 2016). The enzymatic activity of Sirt7 targets both acetylated H3 lysine 18 (Vazquez et al., 2016) and succinylated H3 lysine 122 (Li et al., 2016). After the occurrence of DNA damage, Sirt7 is recruited to DNA damage sites in a poly(ADP-ribose) polymerase 1 (PARP-1)-dependent manner and catalyzes the deacetylation of H3K18ac and the desuccinylation of H3K122succ. The removal of H3K18ac in turn affects the recruitment of the damage response factor 53BP1 to damage sites, and the diminished H3K122succ level promotes chromatin condensation to activate the DNA damage response in the repair of DNA double-strand breaks. In this study, we demonstrate that endogenous Sirt7, in addition to deacetylation and desuccinylation activities, also functions as an eraser to regulate the dynamics of histone Kglu in various human cell lines (Figures 5E–5G and S5C). In line with the involvement of Sirt7 in DNA damage repair, the depletion of Sirt7 hindered the removal of H4K91glu (Figure 7D). It is likely that, similar to Sirt7-catalyzed hydrolysis of H3K122succ, the removal of the glutaryl group from H4K91 also aims to promote chromatin condensation for DNA repair. However, it is not clear whether H4K91glu, H3K122succ, and H3K18ac function independently or in a synergistic manner when challenged with DNA damage. As our present study focused only on H4K91, we cannot exclude the possibility that Sirt7 regulates the dynamics of Kglu on other histone sites. This newly discovered deglutarylase activity broadens the landscape of PTMs that are targeted by sirtuins, and it also provides new impetus to investigate the cellular mechanisms and functions of Sirt7, which to date have been considered solely deacetylases or desuccinylases. KAT2A Functions as a Context-Dependent Histone Acyltransferase KAT2A, a known histone acetyltransferase (Grant et al., 1997; Wang and Dent, 2014), when coupled with the a-KGDH complex,

(D) Immunoblotting analyses showing the effect of Sirt7 depletion on H4K91glu in the absence or presence of the indicated DNA damage reagent HU. (E) Genomic distributions of ChIP-seq peaks for H4K91glu. The distance indicated is upstream of the transcription start site (TSS). (F) Profile plot shows the density of sequence reads over gene body of highly expressed (dark blue), lowly expressed (light blue), and non-expressed (yellow) genes for H4K91glu (ChIP-seq data were input normalized). (G) ChIP assay with anti-H4K91glu antibody and qPCR, with primers against promoters of highly and lowly expressed genes. (H) ChIP assay with anti-H4K91glu antibody and qPCR, with primers against euchromatin and heterochromatin regions. Error bars indicate means ± SEs, n = 3. See also Figures S6 and S7.

Molecular Cell 76, 1–16, November 21, 2019 13

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

can catalyze succinylation on H3K79 (Wang et al., 2017). In the SPT-ADA-KAT2A acetyltransferase (SAGA), KAT2A acts as a histone acetyltransferase. The depletion of TAF RNA polymerase II, a core component of the SAGA complex, reduced H3K9ac and H3K14ac without affecting H3K79succ. When coupled with the a-KGDH complex, KAT2A can recognize succinyl-CoA and transfer the succinyl group to the histone H3 Lys79 site. The reconstituted expression of the mutant DLST, a component of the a-KGDH complex, reduced H3K79succ, but did not reduce H3K9ac or H3K14ac. In the present study, we found that KAT2A, coupled with the a-KADH complex, which catalyzes the oxidative decarboxylation of a-ketoadipate to glutaryl-CoA, acts as a histone glutaryltransferase (Figures 6C and 6D). The depletion of DHTKD1, a core component of the a-KADH complex, led to the decrease in H4K91glu, but had no effect on H3K9ac (Figures 6E and 6F). Thus, KAT2A functions as either histone acetyltransferase, succinyltransferase, or glutaryltransferase in a context-dependent manner. Increasing evidence has suggested that there is a tight link between metabolism and epigenetic regulation. The subcellular availability and concentration of different acyl-CoAs (e.g., acetylCoA, crotonyl-CoA, succinyl-CoA, glutaryl-CoA) could largely affect the existence and abundance of the corresponding acyl modifications in different type of cells, different stages of cells, or even for cells in response to different environment stimuli. Nevertheless, while we do not fully understand this complex regulation network, our study showed for the first time how a newly identified negatively charged modification could affect the structure and function of chromatin. The discoveries provide a molecular basis for the elucidation of epigenetic regulation by H4K91 glutarylation and a mechanistic insight into the biological significance of Sirt7 and KAT2A.

B

d d

Generation of H4K91 glu by expressed protein ligation (EPL) B Preparation of Histone Octamer, H2A/H2B Dimer, (H3/ H4)2 or (H3/H4K91glu)2 Tetramer B Non-Fluorophore-Labeled Nucleosome Reconstitution and Electrophoretic Mobility Gel Shift Assay (EMSA) B Preparation and Purification of ‘‘Widom 601’’ DNA Fragment B Preparation and Purification of Fluorophore-labeled ‘‘Widom 601’’ DNA fragment B Preparation and Purification of Fluorophore-Labeled Mononucleosomes B Fluorescence Resonance Energy Transfer Analysis of Reconstituted Nucleosome B Growth Curve Analysis B Flow Cytometry B DNA Damage Assays B Selection for 5-FOA Colonies B Chromatin Extraction from Yeast Cell Culture B MNase Digestion B Telomere Silencing B RNAi Experiments B Enzymatic reactions B On membrane digestion assay B Subcellular fractionation B Immunoprecipitation B ChIP and ChIP-seq assay B RNA sequencing analysis B ChIP sequencing analysis QUANTIFICATION AND STATISTICAL ANALYSIS DATA AND CODE AVAILABILITY

SUPPLEMENTAL INFORMATION

STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d

d

KEY RESOURCES TABLE LEAD CONTACT AND MATERIALS AVAILABILITY EXPERIMENTAL MODEL AND SUBJECT DETAILS B Yeast strains B Mammalian cells METHOD DETAILS B Metabolic Labeling and Preparation of Cell Lysates B Cu (I)-Catalyzed Cycloaddition/Click Chemistry B In-gel Fluorescence Visualization B Streptavidin Affinity Enrichment of Biotinylated Proteins B Immunofluorescence B Histone Extraction B Sample Preparation for Mass Spectrometry B Mass Spectrometry B Histone Lysine Glutarylation Validation B Peptide Synthesis B Preparation of Recombinant Xenopus laevis Histones B Labeling of H2BT112C with Alexa488-C5-maleimide

14 Molecular Cell 76, 1–16, November 21, 2019

Supplemental Information can be found online at https://doi.org/10.1016/j. molcel.2019.08.018. ACKNOWLEDGMENTS We acknowledge support from the National Natural Science Foundation of China (21572191 and 91753130 to X.D.L.); the Hong Kong Research Grants Council Collaborative Research Fund (CRF C7029-15G to X.D.L. and C705818GF to K.W.Y.Y.); the Areas of Excellence Scheme (AoE/P-705/16 to X.D.L); the General Research Fund (GRF 17126618, 17125917, and 17303114 to X.D.L.); and the Early Career Scheme (ECS) (HKU 709813P to X.D.L.). AUTHOR CONTRIBUTIONS X.B. and X.D.L. conceived and designed the project. Y.X. synthesized GluAMyne. X.B. performed the experiments to detect histone Kglu using GluAM-yne. X.B. and Y.M.E.F. performed the MS-based identification of histone Kglu. Z.L. conducted the peptide and protein chemistry, nucleosome reconstitution, and FRET experiments. X.B., W.Z., and G.T. performed the budding yeast experiments. X.B. performed the experiments to characterize H4K91glu in mammalian cells. X.B. and Z.L. performed the in vitro enzymatic assays to characterize the deglutarylase activity of Sirt7. X.B. performed the RNA-seq, ChIP-PCR, and ChIP-seq experiments. X.B. and K.G. conducted the data analysis of RNA-seq and ChIP-seq. K.W.Y.Y. supervised the budding yeast experiments. J.W.H.W. supervised the RNA-seq and ChIP-seq data analysis. X.D.L. and X.B. wrote the manuscript. W.Z. and K.W.Y.Y. reviewed and edited the manuscript. X.D.L. supervised the project.

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

DECLARATION OF INTERESTS The authors declare no competing interests. Received: April 9, 2018 Revised: May 29, 2019 Accepted: August 21, 2019 Published: September 18, 2019 REFERENCES Avalos, J.L., Bever, K.M., and Wolberger, C. (2005). Mechanism of sirtuin inhibition by nicotinamide: altering the NAD(+) cosubstrate specificity of a Sir2 enzyme. Mol. Cell 17, 855–868. Bao, X., Zhao, Q., Yang, T., Fung, Y.M., and Li, X.D. (2013). A chemical probe for lysine malonylation. Angew. Chem. Int. Ed. Engl. 52, 4883–4886. Bao, X., Xiong, Y., Li, X., and Li, X.D. (2018). A chemical reporter facilitates the detection and identification of lysine HMGylation on histones. Chem. Sci. (Camb.) 9, 7797–7801. Bo¨hm, V., Hieb, A.R., Andrews, A.J., Gansen, A., Rocker, A., To´th, K., Luger, K., and Langowski, J. (2011). Nucleosome accessibility governed by the dimer/tetramer interface. Nucleic Acids Res. 39, 3093–3102. Bowman, G.D., and Poirier, M.G. (2015). Post-translational modifications of histones that influence nucleosome dynamics. Chem. Rev. 115, 2274–2295. Burgess, R.C., Burman, B., Kruhlak, M.J., and Misteli, T. (2014). Activation of DNA damage response signaling by condensed chromatin. Cell Rep. 9, 1703–1717. Chen, C.C., Carson, J.J., Feser, J., Tamburini, B., Zabaronick, S., Linger, J., and Tyler, J.K. (2008). Acetylated lysine 56 on histone H3 drives chromatin assembly after repair and signals for the completion of repair. Cell 134, 231–243. Coin, I., Beyermann, M., and Bienert, M. (2007). Solid-phase peptide synthesis: from standard procedures to the synthesis of difficult sequences. Nat. Protoc. 2, 3247–3256. Cosgrove, M.S., Boeke, J.D., and Wolberger, C. (2004). Regulated nucleosome mobility and the histone code. Nat. Struct. Mol. Biol. 11, 1037–1043. Di Cerbo, V., Mohn, F., Ryan, D.P., Montellier, E., Kacem, S., Tropberger, P., Kallis, E., Holzner, M., Hoerner, L., Feldmann, A., et al. (2014). Acetylation of histone H3 at lysine 64 regulates nucleosome dynamics and facilitates transcription. eLife 3, e01632. Du, J., Zhou, Y., Su, X., Yu, J.J., Khan, S., Jiang, H., Kim, J., Woo, J., Kim, J.H., Choi, B.H., et al. (2011). Sirt5 is a NAD-dependent protein lysine demalonylase and desuccinylase. Science 334, 806–809. Du, Y., Cai, T., Li, T., Xue, P., Zhou, B., He, X., Wei, P., Liu, P., Yang, F., and Wei, T. (2015). Lysine malonylation is elevated in type 2 diabetic mouse models and enriched in metabolic associated proteins. Mol. Cell. Proteomics 14, 227–236. Ehrenhofer-Murray, A.E. (2004). Chromatin dynamics at DNA replication, transcription and repair. Eur. J. Biochem. 271, 2335–2349. Gansen, A., To´th, K., Schwarz, N., and Langowski, J. (2015). Opposing roles of H3- and H4-acetylation in the regulation of nucleosome structure––a FRET study. Nucleic Acids Res. 43, 1433–1443. Grant, P.A., Duggan, L., Coˆte´, J., Roberts, S.M., Brownell, J.E., Candau, R., Ohba, R., Owen-Hughes, T., Allis, C.D., Winston, F., et al. (1997). Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA (Spt/Ada) complex. Genes Dev. 11, 1640–1650. Groth, A., Rocha, W., Verreault, A., and Almouzni, G. (2007). Chromatin challenges during DNA replication and repair. Cell 128, 721–733. Hirschey, M.D., and Zhao, Y. (2015). Metabolic Regulation by Lysine Malonylation, Succinylation, and Glutarylation. Mol. Cell. Proteomics 14, 2308–2315.

Li, Q., Zhou, H., Wurtele, H., Davies, B., Horazdovsky, B., Verreault, A., and Zhang, Z. (2008). Acetylation of histone H3 lysine 56 regulates replicationcoupled nucleosome assembly. Cell 134, 244–255. Li, L., Shi, L., Yang, S., Yan, R., Zhang, D., Yang, J., He, L., Li, W., Yi, X., Sun, L., et al. (2016). SIRT7 is a histone desuccinylase that functionally links to chromatin compaction and genome stability. Nat. Commun. 7, 12235. Longtine, M.S., McKenzie, A., 3rd, Demarini, D.J., Shah, N.G., Wach, A., Brachat, A., Philippsen, P., and Pringle, J.R. (1998). Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, 953–961. Lowary, P.T., and Widom, J. (1998). New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning. J. Mol. Biol. 276, 19–42. €der, A.W., Richmond, R.K., Sargent, D.F., and Richmond, T.J. Luger, K., Ma (1997). Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389, 251–260. Luger, K., Rechsteiner, T.J., and Richmond, T.J. (1999). Expression and purification of recombinant histones and nucleosome reconstitution. Methods Mol. Biol. 119, 1–16. Manohar, M., Mooney, A.M., North, J.A., Nakkula, R.J., Picking, J.W., Edon, A., Fishel, R., Poirier, M.G., and Ottesen, J.J. (2009). Acetylation of histone H3 at the nucleosome dyad alters DNA-histone binding. J. Biol. Chem. 284, 23312–23321. Masumoto, H., Hawke, D., Kobayashi, R., and Verreault, A. (2005). A role for cell-cycle-regulated histone H3 lysine 56 acetylation in the DNA damage response. Nature 436, 294–298. Muir, T.W., Sondhi, D., and Cole, P.A. (1998). Expressed protein ligation: a general method for protein engineering. Proc. Natl. Acad. Sci. USA 95, 6705–6710. Nemeria, N.S., Gerfen, G., Nareddy, P.R., Yang, L., Zhang, X., Szostak, M., and Jordan, F. (2018). The mitochondrial 2-oxoadipate and 2-oxoglutarate dehydrogenase complexes share their E2 and E3 components for their function and both generate reactive oxygen species. Free Radic. Biol. Med. 115, 136–145. Nishida, Y., Rardin, M.J., Carrico, C., He, W., Sahu, A.K., Gut, P., Najjar, R., Fitch, M., Hellerstein, M., Gibson, B.W., and Verdin, E. (2015). SIRT5 Regulates both Cytosolic and Mitochondrial Protein Malonylation with Glycolysis as a Major Target. Mol. Cell 59, 321–332. Park, J., Chen, Y., Tishkoff, D.X., Peng, C., Tan, M., Dai, L., Xie, Z., Zhang, Y., Zwaans, B.M., Skinner, M.E., et al. (2013). SIRT5-mediated lysine desuccinylation impacts diverse metabolic pathways. Mol. Cell 50, 919–930. Peng, C., Lu, Z., Xie, Z., Cheng, Z., Chen, Y., Tan, M., Luo, H., Zhang, Y., He, W., Yang, K., et al. (2011). The first identification of lysine malonylation substrates and its regulatory enzyme. Mol. Cell. Proteomics 10, M111.012658. Ridgway, P., and Almouzni, G. (2001). Chromatin assembly and organization. J. Cell Sci. 114, 2711–2712. Sabari, B.R., Zhang, D., Allis, C.D., and Zhao, Y. (2017). Metabolic regulation of gene expression through histone acylations. Nat. Rev. Mol. Cell Biol. 18, 90–101. Sewitz, S.A., Fahmi, Z., and Lipkow, K. (2017). Higher order assembly: folding the chromosome. Curr. Opin. Struct. Biol. 42, 162–168. Tan, M., Luo, H., Lee, S., Jin, F., Yang, J.S., Montellier, E., Buchou, T., Cheng, Z., Rousseaux, S., Rajagopal, N., et al. (2011). Identification of 67 histone marks and histone lysine crotonylation as a new type of histone modification. Cell 146, 1016–1028. Tan, M., Peng, C., Anderson, K.A., Chhoy, P., Xie, Z., Dai, L., Park, J., Chen, Y., Huang, H., Zhang, Y., et al. (2014). Lysine glutarylation is a protein posttranslational modification regulated by SIRT5. Cell Metab. 19, 605–617. Tessarz, P., and Kouzarides, T. (2014). Histone core modifications regulating nucleosome structure and dynamics. Nat. Rev. Mol. Cell Biol. 15, 703–708. Thinon, E., and Hang, H.C. (2015). Chemical reporters for exploring protein acylation. Biochem. Soc. Trans. 43, 253–261.

Molecular Cell 76, 1–16, November 21, 2019 15

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

Toulmay, A., and Schneiter, R. (2006). A two-step method for the introduction of single or multiple defined point mutations into the genome of Saccharomyces cerevisiae. Yeast 23, 825–831.

Wang, Y., Guo, Y.R., Liu, K., Yin, Z., Liu, R., Xia, Y., Tan, L., Yang, P., Lee, J.H., Li, X.J., et al. (2017). KAT2A coupled with the a-KGDH complex acts as a histone H3 succinyltransferase. Nature 552, 273–277.

Tropberger, P., and Schneider, R. (2013). Scratching the (lateral) surface of chromatin regulation by histone modifications. Nat. Struct. Mol. Biol. 20, 657–661.

Wilson, J.P., Raghavan, A.S., Yang, Y.Y., Charron, G., and Hang, H.C. (2011). Proteomic analysis of fatty-acylated proteins in mammalian cells with chemical reporters reveals S-acylation of histone H3 variants. Mol. Cell. Proteomics 10, M110.001198.

Tropberger, P., Pott, S., Keller, C., Kamieniarz-Gdula, K., Caron, M., Richter, €hler, M., et al. (2013). Regulation of transcripF., Li, G., Mittler, G., Liu, E.T., Bu tion through acetylation of H3K122 on the lateral surface of the histone octamer. Cell 152, 859–872. Tweedie-Cullen, R.Y., Brunner, A.M., Grossmann, J., Mohanna, S., Sichau, D., Nanni, P., Panse, C., and Mansuy, I.M. (2012). Identification of combinatorial patterns of post-translational modifications on individual histones in the mouse brain. PLoS One 7, e36980. Vakhrusheva, O., Smolka, C., Gajawada, P., Kostin, S., Boettger, T., Kubin, T., Braun, T., and Bober, E. (2008). Sirt7 increases stress resistance of cardiomyocytes and prevents apoptosis and inflammatory cardiomyopathy in mice. Circ. Res. 102, 703–710. Vazquez, B.N., Thackray, J.K., Simonet, N.G., Kane-Goldsmith, N., MartinezRedondo, P., Nguyen, T., Bunting, S., Vaquero, A., Tischfield, J.A., and Serrano, L. (2016). SIRT7 promotes genome integrity and modulates nonhomologous end joining DNA repair. EMBO J. 35, 1488–1503. Venkatesh, S., and Workman, J.L. (2015). Histone exchange, chromatin structure and the regulation of transcription. Nat. Rev. Mol. Cell Biol. 16, 178–189. Voss, T.C., and Hager, G.L. (2014). Dynamic regulation of transcriptional states by chromatin and transcription factors. Nat. Rev. Genet. 15, 69–81. Wang, L., and Dent, S.Y. (2014). Functions of SAGA in development and disease. Epigenomics 6, 329–339.

16 Molecular Cell 76, 1–16, November 21, 2019

Xie, Z., Dai, J., Dai, L., Tan, M., Cheng, Z., Wu, Y., Boeke, J.D., and Zhao, Y. (2012). Lysine succinylation and lysine malonylation in histones. Mol. Cell. Proteomics 11, 100–107. Yang, Y.Y., Ascano, J.M., and Hang, H.C. (2010). Bioorthogonal chemical reporters for monitoring protein acetylation. J. Am. Chem. Soc. 132, 3640–3641. Yang, M., Wang, Y., Chen, Y., Cheng, Z., Gu, J., Deng, J., Bi, L., Chen, C., Mo, R., Wang, X., and Ge, F. (2015). Succinylome analysis reveals the involvement of lysine succinylation in metabolism in pathogenic Mycobacterium tuberculosis. Mol. Cell. Proteomics 14, 796–811. Ye, J., Ai, X., Eugeni, E.E., Zhang, L., Carpenter, L.R., Jelinek, M.A., Freitas, M.A., and Parthun, M.R. (2005). Histone H4 lysine 91 acetylation a core domain modification associated with chromatin assembly. Mol. Cell 18, 123–130. Zentner, G.E., and Henikoff, S. (2013). Regulation of nucleosome dynamics by histone modifications. Nat. Struct. Mol. Biol. 20, 259–266. Zhang, Z., and Reese, J.C. (2006). Isolation of yeast nuclei and micrococcal nuclease mapping of nucleosome positioning. Methods Mol. Biol. 313, 245–255. Zhang, Z., Tan, M., Xie, Z., Dai, L., Chen, Y., and Zhao, Y. (2011). Identification of lysine succinylation as a new post-translational modification. Nat. Chem. Biol. 7, 58–63.

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

CPS1

Santa Cruz

#SC-376190; RRID: AB_10985993

GAPDH

Santa Cruz

#SC-47724; RRID: AB_62767

H3

Cell Signaling Technology

#9715; RRID: AB_331563

a-tubulin

Santa Cruz

#SC-5286; RRID: AB_628411

Antibodies

H4K91glu

This study

RRID: AB_2811259

H4

Abcam

#ab31830; RRID: AB_1209246

Sirt7

Santa Cruz

#SC-365344; RRID: AB_10850175

b-actin

Cell Signaling Technology

#3700; RRID: AB_2242334

H3K10ph

Cell Signaling Technology

#9701; RRID: AB_331535

g-H2A.X

Cell Signaling Technology

#2577; RRID: AB_2118010

PGK

Abcam

#ab113687; RRID: AB_10861977

Sirt5

Cell Signaling Technology

#8779; RRID: AB_2797663

DHTKD1

Abcam

#ab230392; RRID: AB_2811257

KAT2A

Abcam

#ab231075;RRID: AB_2811258

H3K9ac

Abcam

#ab10812; RRID: AB_297491

Fibrillarin

Abcam

#ab4566; RRID: AB_304523

H4K91ac

Abcam

#ab4627; RRID: AB_304538

All Saccharomyces cerevisiae strains used in this study are listed in Table S1

This paper

N/A

MAX Efficiency DH5a Competent Cells

Theromo Fisher Scientific

#18258012

Escherichia coli Rosetta competent cells

Theromo Fisher Scientific

#70954

HeLa

ATCC

#CCL-2

HeLa S3

ATCC

#CCL-2.2

U2OS

ATCC

#HTB-96

HEK293T

ATCC

#CRL-11268

HepG2

ATCC

#HB-8065

Raw264.7

ATCC

#TIB-71

HL60

ATCC

# CCL-240

MOLM-13

Donated by Mingkui Luo

N/A

Benzonase nuclease purity > 99% 25U/ml

Merck Millipore

Cat#70664-3

cOmplete EDTA-Free Protease Inhibitor Cocktail

Roche

#04693132001

Dynabead Protein A for Immunoprecipitation

Theromo Fisher Scientific

#10001D

Experimental Models: Organisms/Strains/Cell lines

Chemicals, Peptides, and Recombinant Proteins

Methyl methanesulfonate (MMS)

Sigma-Aldrich

#129925

Hydroxyurea

Formedium

#HDU0025

Camptothecin

Sigma-Aldrich

#C9911

Cisplatin

Sigma-Aldrich

#PHR1624

Doxorubicin

Sigma-Aldrich

#PHR1789

a-factor

Zymo Research

#Y1001

G418

Formedium

#SKU:G4181

Thymidine

Sigma-Aldrich

#T9250

Phenylmethylsulfonyl fluoride (PMSF)

Sigma-Aldrich

#78830 (Continued on next page)

Molecular Cell 76, 1–16.e1–e9, November 21, 2019 e1

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Sequencing grade modified trypsin

Promege

#V5111

High capacity streptavidin agarose

Thermo Fisher Scientific

#20361

Zymolase 100T

Zymo Research

#E1005

Micrococcal Nuclease

Thermo Fisher Scientific

#EN0181

Proteinase K

Thermo Fisher Scientific

#25530049

RNase A

Thermo Fisher Scientific

#12091021

Propidium iodide solution

Thermo Fisher Scientific

#P1304MP

Tris(2-carboxyethyl)phosphine (TCEP)

Sigma-Aldrich

#75259

Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl] amine (TBTA)

Click Chemistry Tools

#1061-500

Propionic anhydride (C6D10O3)

Sigma-Aldrich

#615692

Alexa488-C5-maleimide

Thermo Fisher Scientific

#A10254

Alexa Fluor 594 C5 maleimide

Thermo Fisher Scientific

#A10256

5-Fluoroorotic acid (5-FOA)

Thermo Fisher Scientific

#R0811

Salmon sperm DNA

Thermo Fisher Scientific

#15632011

Nicotinamide

Sigma-Aldrich

#N3376

EIAQDFKgluTDLR

This paper

N/A

DNIQGITKgluPAIR

This paper

N/A

VTIMPKgluDIQLAR

This paper

N/A

ESYSIYVYKgluVLK

This paper

N/A

NDEELNKgluLLGK

This paper

N/A

HAVSEGTKgluAVTK

This paper

N/A

KAVTKgluAQKKD

This paper

N/A

DVVYALKacRQGRTLWW

This paper

N/A

DVVYALKsuccRQGRTLWW

This paper

N/A

DVVYALKgluRQGRTLWW

This paper

N/A

Recombinant H2A

This paper

N/A

Recombinant H2B

This paper

N/A

Recombinant H2BT112C

This paper

N/A

Recombinant H3

This paper

N/A

Recombinant H4

This paper

N/A

Recombinant H4(1-88)

This paper

N/A

Semi-synthesized H4K91glu

This paper

N/A

Semi-synthesized H4K91ac

This paper

N/A

BCA protein assay kit

Thermo Fisher Scientific

#23227

Quick start bradford protein assay

Bio-Rad

#5000201

Critical Commercial Assays

Deposited Data Raw and analyzed data

This paper

GSE131807

Raw and analyzed data

Wang et al. 2017

GSE97994

Human reference genome GRCh37/hg19

Genome Reference Consortium

https://support.illumina.com/sequencing/ sequencing_software/igenome.html

Saccharomyces cerevisiae reference genome (sacCer3).

The Saccharomyces Genome Database (SGD)

https://www.yeastgenome.org/

This paper

N/A

Oligonucleotides All oligonucleotides used in this study are listed in Table S2

(Continued on next page)

e2 Molecular Cell 76, 1–16.e1–e9, November 21, 2019

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Recombinant DNA pcDNA3.1-Sirt7

This paper

N/A

His-Sirt7

Gift from Haitao Li

N/A

‘‘Widom 601’’ DNA

Tech Dragon

N/A

pV-R URA3-TEL

Gift from Virginia A. Zakian

N/A

pVII-L URA3-TEL

Gift from Virginia A. Zakian

N/A

Plasmids for histones expression

Gift from by Bing Zhu

N/A

Software and Algorithms GraphPad prism 6

GraphPad Software

N/A

Maxquant

Cox Group

N/A

ImageJ

NIH

N/A

Xcalibur

Thermo Fisher Scientific

N/A

OriginPro 8.0

OriginLab

N/A

STAR v 2.5.2b

N/A

https://github.com/alexdobin/STAR

FeatureCounts v 1.6.2

N/A

http://subread.sourceforge.net/

R v 3.5.1

N/A

https://www.r-project.org/

Burrows-Wheeler Aligner (BWA, v 0.7.17-r1188)

N/A

https://github.com/lh3/bwa

SAMtools v 1.9

N/A

http://samtools.sourceforge.net

DeepTools v 3.2.0

N/A

https://deeptools.readthedocs.io/en/develop/ index.html

BedTools v2.27.1

N/A

https://github.com/arq5x/bedtools2/releases

LEAD CONTACT AND MATERIALS AVAILABILITY Further information and request for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Xiang David Li ([email protected]). EXPERIMENTAL MODEL AND SUBJECT DETAILS Yeast strains All Saccharomyces cerevisiae strains were YPH499 derivatives, as detailed in Table S1. The gene deletions strains were generated by the method reported (Longtine et al., 1998). The point mutation of histone H4 lysine (K) alleles to glutamic acid (E), glutamine (Q) and arginine (R) were constructed based on a two-step method described previously (Toulmay and Schneiter, 2006), in addition to delete the non-essential HHF2 copy. Plasmids, padh4::URA3, pVII-L URA3-TEL and pV-R URA3-TEL are generous gifts from Dr. Virginia Zakian. Strains XDL2, XDL4 and XDL6 with URA3 incorporation were constructed by transforming YPH499 with different DNA fragments: XDL2 with plasmid padh4::URA3 cleaved by BamHI and SalI, XDL4 with plasmid pVII-L URA3-TEL cleaved by SalI and EcoRI and XDL6 with plasmid pV-R URA3-TEL cleaved by EcoRI. Strains XDL1, XDL3 and XDL5 with URA3 incorporation were constructed by transforming WYYY390 with those DNA fragments. Transformants were selected as being Ura+. Mammalian cells MOLM-13 cell line was a generous gift from Dr. Mingkui Luo and was cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and standard antibiotics. HeLa, HeLa S3, U2OS, HEK293T, HepG2, Raw 264.7 and HL60 cells were purchased from ATCC, as detailed in Key Resources Table, and cultured in DMEM or RPMI 1640 medium supplemented with 10% FBS and standard antibiotics. METHOD DETAILS Metabolic Labeling and Preparation of Cell Lysates For metabolic labeling efficiency comparison, HeLa S3 cells were incubated with 200 mM GluAM-yne for 1 h. For competition assay, HeLa S3 cells were pre-incubated with 20 mM glutarate, succinate, malonate or crotonate for 6 h followed by metabolic labeling by 200 mM of GluAM-yne for 1 h. For competition assay using GluAM as a competitor, HeLa S3 cells were pre-incubated with a series of concentration of GluAM for 1 h prior to metabolic labeling by 200 mM of GluAM-yne for another 1 h.

Molecular Cell 76, 1–16.e1–e9, November 21, 2019 e3

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

Cu (I)-Catalyzed Cycloaddition/Click Chemistry Briefly, to the prepared samples, 100 mM rhodamine azide for in-gel fluorescence scanning or cleavable biotin azide for streptavidin enrichment was added, followed by 1 mM tris(2-carboxyethyl)phosphine (TCEP), 100 mM tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl] amine (TBTA) and finally the reactions were initiated by the addition of 1 mM CuSO4. The reactions were incubated for 1.5 h at room temperature. In-gel Fluorescence Visualization The click chemistry reactions were quenched by adding 1 volume of 2 3 sample buffer. The proteins were heated at 85  C for 8 min and resolved by SDS-PAGE. The labeled proteins were visualized by scanning the gel on a Typhoon 9410 variable mode imager (excitation 532 nm, emission 580 nm). Streptavidin Affinity Enrichment of Biotinylated Proteins After the click chemistry with cleavable biotin-azide, the reaction was quenched by adding 4 volumes of ice-cold acetone to precipitate the proteins. After washing with ice cold methanol twice, the air-dried protein pellet was dissolved in PBS with 4% SDS, 20 mM EDTA, and 10% glycerol by vortexting and heating. The solution was then diluted with PBS to give a final concentration of SDS of 0.5%. High capacity streptavidin agarose beads (Thermo Fisher Scientific) were added to bind the biotinylated proteins with rotating for 1.5 hr at room temperature. To remove non-specific binding, the beads were washed with PBS with 0.2% SDS, 6 M urea in PBS with 0.1% SDS, and 250 mM NH4HCO3 with 0.05% SDS. The enriched proteins were then eluted by incubating with 25 mM Na2S2O4, 250 mM NH4HCO3, and 0.05% SDS for 1 hr. The eluted proteins were dried down with SpeedVac. Immunofluorescence HeLa cells grown on coverslips were metabolically labeled with DMSO or 200 mM GluAM-yne for 1 h, fixed with 3.7% PFA, permeabilized with 0.1% Triton X-100 and then reacted with 20 mM azide-rhodamine, 1 mM TCEP, 100 mM TBTA and 1 mM CuSO4 for 1 h. Cells were incubated with anti-a-tubulin antibody or anti-H4K91 glu overnight at 4 C, washed trice with PBST (0.1% tween 20 in PBS) prior FITC-conjugated secondary antibody (containing DAPI for nucleus staining) incubation at room temperature for 1 h. Washed cell were then subjected to a Zeiss LSM 510 laser scanning confocal microscope. Histone Extraction Briefly, the harvested HeLa S3 cell pellet was resuspended with lysis buffer (10 mM Tris–HCl pH 8.0, 1 mM KCl, 1.5 mM MgCl2, 1 mM DTT, 2 mM PMSF, and Roche Complete EDTA free protease inhibitors) and incubated at 4 C by rotating for 1 h. The intact nuclei were pelleted by centrifuging at 10,000 3 g for 10 min at 4 C. To extract histones, 0.4 N H2SO4 was added to resuspend the nuclei, followed by rotating at 4  C overnight. After centrifuging to remove the nuclei debris, histones were precipitated by adding 100% trichloroacetic acid drop by drop (trichloroacetic acid final concentration 33%). The precipitated histones were pelleted at 16,000 3 g for 10 min at 4  C and washed with ice cold acetone twice. The air-dried protein pellet was dissolved with ddH2O and stored at
80  C for later use. Sample Preparation for Mass Spectrometry In-solution tryptic digestion of histone samples was carried out based on previous described protocols (Tan et al., 2011). In vitro lysine propionylation of histone extract and tryptic histone peptides were treated with propionic anhydride twice to make sure fully labeling. Histone extracts were in-solution digested without chemical propionylation, chemically propionylated before or after insolution digestion. The resulting peptides were enriched with the StageTips. The eluted peptides from the StageTips were dried down by SpeedVac and then resuspended in 0.5% acetic acid for analysis by LC-MS/MS. Mass Spectrometry Mass spectrometry was performed on an LTQ-Orbitrap Velos mass spectrometer (Thermo Scientific). First, peptide samples in 0.1% formic acid were pressure loaded onto a self-packed PicoTip column (New Objective) (360-mm o.d., 75-mm i.d., 15-mm tip), packed with 7–10 cm of reverse-phase C18 material (ODS-A C18 5-mm beads from YMC), rinsed for 5 min with 0.1% formic acid and subsequently eluted with a linear gradient from 2 to 35% B in 150 min (A = 0.1% formic acid, B = 0.1% formic acid in ACN, flow rate 200 nL/min) into the mass spectrometer. The instrument was operated in a data dependent mode cycling through a full scan (300–2,000 m/z, single mscan) followed by 10 CID MS/MS scans on the 10 most abundant ions from preceding full scan. The cations were isolated with a 2-Da mass window and set on a dynamic exclusion list for 60 s after they were first selected for MS/MS. The raw data were processed and analyzed using MaxQuant (version 1.6.1.0) setting lysine glutarylation as a variable modification to identify glutarylated lysine sites in histones. A human histone fasta file was used as protein sequence searching database. Default parameters were adapted for the protein identification and quantification. In particular, parent peak MS tolerance is 6 ppm, MS/MS tolerance is 0.5 Da, and minimum peptide length is 6 amino acids, maximum number of missed cleavages is 2. The proteins quantified were supported by at least 2 quantification events.

e4 Molecular Cell 76, 1–16.e1–e9, November 21, 2019

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

Histone Lysine Glutarylation Validation Tryptic histone peptides and synthesized peptides were treated with light form of propionic anhydride (C6H10O3) and heavy form of propionic anhydride (C6D10O3), respectively, and then pooled for peptide enrichment and desalting with the StageTips. The eluted peptides from the StageTips were dried down by SpeedVac and then resuspended in 0.5% acetic acid for analysis by LC-MS/MS. Peptide Synthesis All peptides used in this research were synthesized on 2-chlorotrityl chloride resin followed standard Fmoc-based solid-phase peptide synthesis protocol (Coin et al., 2007). Peptides were purified by preparative HPLC with a Vydac C18 column (22 mm X 250 mm, 10 mm, Garce). The purity (> 95%) and identity of peptides were confirmed by LC-MS. Preparation of Recombinant Xenopus laevis Histones All the recombinant Xenopus laevis histones H2A, H2B, H2BT112C, H3 and H4 were expressed in Rosetta cell and purified as previously described (Luger et al., 1999). Labeling of H2BT112C with Alexa488-C5-maleimide The purified H2BT112C was dissolved in labeling buffer (6 M guanidinium hydrochloride, 25 mM HEPES, 1 M NaCl, pH 7.5) to reach a concentration of 77 mM. A 10-fold molar excess of TCEP was added and followed by adjust the pH to 7.5 by NaOH. Then, alexa488C5-maleimide (10 mM, stock in DMSO) was added to solution to a final concentration of 540 mM. The mixture was shaken for 4 h and quenched by addition of sufficient amount of 2-mercaptoethanol. Alexa488 labeled H2B was further purified by using semi-preparative C18 RP-HPLC (10 mm X 250 mm, 10 mm, Garce) and characterized by analytical HPLC and ESI-MS. Generation of H4K91 glu by expressed protein ligation (EPL) Preparation of recombinant H4 N-terminal fragment with a-thioester Truncated histone H4 (residues 1-88) was cloned as a fusion protein with intein and a chitin binding domain (CBD) into the pTXB1 vector (New England Biolabs). The H4 (1-88)-intein-CBD was expressed in Rosetta cells and purified from inclusion bodies. The H4 (1-88) with a-thiolester can be generated as previous described. In general, thiolysis can be initiated by addition of 100 mM sodium 2-sulfanylethanesulfonate (MESNA). After incubation for 48h at 4 C, the sample was concentrated to the total protein above 1 mg/mL and adjust the buffer component to ligation buffer (50 mM HEPES (pH 7.5), 6 M urea, 1 M NaCl, 1 mM EDTA, 50 mM MESNA). The H4K91 glu histone ligation method adapted from Manohar et al. (2009) Ten molar equivalents of synthesized H4K91glu (89-102, A89C) peptide were added to the concentrated H4 (1-88) thioester solution in ligation buffer and ligation proceeded 24 h at 4 C. The radical-induced desulfurization of the mutant cysteine residue was carried out using the crude ligation product. Tris(2-carboxyethyl)phosphine (TCEP) and VA-044 (a radical initiator) was added to a final concentration of 300 mM and 10 mM, respectively. The reaction was kept at 42  C for 4 h. After the desulfurization, the ligated H4K91glu (full length) was purified by reversed-phase C4 column (22 mm X 250 mm, 10 mm, GRACE) with a gradient of 40% - 60% B (A: 0.1% TFA in water, B: 90% Acetonitrile; 0.1% TFA) over 15 column volumes. Fractions containing pure H4K91glu (full length) were pooled and characterized by LC-MS. Preparation of Histone Octamer, H2A/H2B Dimer, (H3/H4)2 or (H3/H4K91glu)2 Tetramer Histone octamers were refolded from four histones following a protocol described previously. Briefly, equimolar amounts of H4 or H4K91glu, H2A, H2B and H3 were mixed and dissolved in unfolding buffer (6 M guanidinium hydrochlorid, 20 mM Tris
HCl, pH 7.5, 1.0 mM EDTA, 10 mM DTT) at a concentration of 1 mg/mL and incubated at room temperature for 30 min. The mixture was dialyzed against two changes of refolding buffer (2 M NaCl, 10 mM Tris-HCl, pH 7.5, 1.0 mM EDTA, 5 mM b-mercaptoethanol) at 4  C. The refolded octamers were then purified over a Superdex 200 pg column (HiLoad 16/60, GE) to remove any histone monomer and impurities. Fractions containing octamers or dimers were pooled, concentrated, and checked by 15% tris-acid-urea (TAU) PAGE. Recombinant H2A-H2B dimer and (H3-H4)2 or (H3-H4K91glu)2 tetramer was got by same method. Non-Fluorophore-Labeled Nucleosome Reconstitution and Electrophoretic Mobility Gel Shift Assay (EMSA) Histone dimer and tetramer assembled into nucleosomes with DNA by salt deposition as described in previous literature. Briefly, purified dimers and tetramers or octamer were incubated with 153bp of SELEX-generated ‘‘Widom 601’’ DNA at concentration of 2 mM in 50 mL reconstitution buffer (2 M KCl, 10 mM Tris pH 7.8, 0.1 mM EDTA). The mixture was transferred into a Slide-A-Lyzer MINI dialysis unit and dialyzed at 4  C against reconstitution buffer containing 1.6 M KCl, 1.4 M KCl, 1.2 M KCl, 1.0 M KCl, 0.8 M KCl, 0.5 M KCl, 0.2 M KCl for 50 min each, and followed by 10 mM KCl for overnight. To assess the impact of glutarylation modification on nucleosome assembly, parallel dialysis steps were performed with H4K91glu modified octamer or tetramer. The reconstituted nucleosome samples were then resolved on a native-PAGE gel (5% TBE gel, running in 0.5x TBE buffer). The gel was stained with ethidium bromide for a period of 15 min and nucleosomes were visualized by UV.

Molecular Cell 76, 1–16.e1–e9, November 21, 2019 e5

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

Preparation and Purification of ‘‘Widom 601’’ DNA Fragment The template of 153 bp DNA ‘‘Widom 601’’(Lowary and Widom, 1998) was synthesized (Tech Dragon Limited, HK) and incorporated into pcDNA 3.1 vector by EcoRV. The detailed sequence information of 153 bp DNA ‘‘Widom 601’’ is (GAT)ATCGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCC CCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCGAT(TAC) The ‘‘Widom 601’’ positioning sequence was used for all the nucleosome reconstitution experiments, to ensure a uniform nucleosome positioning. The DNA fragment were obtained by PCR from a template of ‘‘Widom 601’’ containing plasmid, further precipitated by isopropyl alcohol, washed by ethanol and dissolved in the refolding buffer (2 M NaCl, 10 mM Tris
HCl, 1 mM EDTA, 5 mM b
mercaptoethanol, pH 7.5). The concentration of DNA was measured by UV-Vis spectrophotometer (260 nm, NanoDrop 2000, Thermo). The primers used in PCR are: Primer_601_Forward: ATCGAGAATCCCGGTGCCG Primer_601_Reverse: ATCGGATGTATATATCTGACACGTGCC Preparation and Purification of Fluorophore-labeled ‘‘Widom 601’’ DNA fragment Fluorophores on the DNA (Alexa 488 and Alexa 594) were incorporated by PCR using fluorophore-labeled primers purchased from IBA (IBA GmbH, German). The sequence of primers are: Primer_end_Forward: 50
T(Alexa 488)ATCGAGAATCCCGGTGCCGAGGCCGCTCAATTG
30 Primer_end_Reverse: 50
T(Alexa 594)ATCGGATGTATATATCTGAC
30 Primer_-15_Forward: 50 -ATCGGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTT GGCGGTTAAAACGC(Alexa594)GGGGG-30 Primer_-15_Reverse: 50 -ATCGGATGTATATATCTGACACGTGCC-30 Both fluorophores were attached via aminolink-C6 linkers. The PCR products were precipitated by isopropyl alcohol, washed by ethanol and dissolved in the refolding buffer. The concentration of DNA was measured by UV-Vis spectrophotometer. Preparation and Purification of Fluorophore-Labeled Mononucleosomes The method for the preparation of fluorophore-labeled mononucleosomes is the same as that for non-labeled nucleosomes described above. Briefly, purified dimers and tetramers or octamer were incubated with fluorophore-labeled ‘‘Widom 601’’ DNA at concentration of 2 mM (the molar ratio is dimer: tetramer: DNA = 4: 1: 1.2 or octamer: DNA = 1: 1.2) in 50 mL nucleosome reconstitution buffer. The mixture was dialyzed at 4  C against reconstitution buffer containing 1.6 M KCl, 1.4 M KCl, 1.2 M KCl, 1.0 M KCl, 0.8 M KCl, 0.5 M KCl, 0.2 M KCl for 50 min each, and followed by 10 mM KCl for overnight. The reconstituted nucleosomes were then purified by a native-PAGE gel (5% TBE gel, acryamide: Bis = 60: 1) using mini prep cell (Bio-rad, Model 491). The purity of nucleosomes was checked by native-PAGE gel. Fluorescence Resonance Energy Transfer Analysis of Reconstituted Nucleosome Salt-dependent dissociation of mononucleosomes can be quantified by single-pair Fo¨rster resonance energy transfer (FRET) as described in previous literatures (Bo¨hm et al., 2011; Gansen et al., 2015). The donor and acceptor used here were Alexa Fluor 488 (ex/em 490/525 nm) and Alexa Fluor 594 (ex/em 590/617 nm) fluorophores, respectively. Freshly prepared fluorophore-labeled mononucleosomes were incubated in experimental buffer (10 mM Tris, 0.1 mM EDTA, pH 7.5, 1 mM ascorbic acid and 0.1 g/L BSA) containing different salt concentrations from 0.01 M to 1.6 M. Samples were incubated in the 384-well microplates, and for each sample, fluorescence intensities were taken three times by plate reader (Beckman Coulter, DTX 880). Energy transfer changes caused by salt-induced mononucleosome dissociation were measured by emission of the acceptor (Alexa594, excitation at 590 nm and emission at 617 nm) upon selective donor excitation (Alexa 488, excitation at 490 nm and emission at 525 nm). Fluorescence was detected in two spectral windows, yielding signal intensity of donor (I0D ) and transfer (I0T ) channels. The corrected intensity of donor (ID ) and transfer (IT ) were yielded from the following equations:

 IT = I0T
BT
aDT I0D
BD
fdir
 ID = I0D
BD

e6 Molecular Cell 76, 1–16.e1–e9, November 21, 2019

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

Where,BT and BD are background intensity from experimental buffer, aDT is spectral crosstalk from the donor into the transfer channel, and fdir is direct excitation of the acceptor dye. The formula for calculating aDT and fdir is given from Gansen et al. (2015) Briefly, the only
donor labeled samples were added into Aem plate wells and emission intensity of the donor ðIDem Dex Þ and acceptor ðIDex Þ were detected upon excited by 488 nm. The spectral crosstalk factor was obtained by the formula below: aDT =

IAem Dex
BD IDem Dex
BD

The direct excitation of acceptor dye fdir can be calculated as following: !
 IAem Dex
BT fdir = Aem 3 IAem Aex
BA FRET IAex
BA A
only

Where, ðIAem Dex ÞA
only

and ðIAem Aex ÞA
only

are acceptor emission intensity detected by donor and acceptor excitation wavelengths (488 and 532 nm, respectively) of only
acceptor labeled samples. ðIAem Aex
BA ÞFRET is acceptor emission intensity excited by acceptor excitation wavelengths (532 nm) of both donor and acceptor labeled sample. BT and BA are background intensities from buffer. The proximity ratio P was calculated as a measure of energy transfer efficiency: P=

IT IT + ID

To measure salt
dependent dissociation of mononucleosomes, a sigmoidal function below (Gansen et al., 2015) was fitted to the experimental curves. Stabilities of mononucleosomes were quantified by the c1=2 parameter, namely the salt concentration where the P has dropped to half its initial value. PðXÞ = Pð0Þ +

PðNÞ
Pð0Þ
 1 + exp c1=2
X b

Here, X is the salt concentration in M and b describes the slope of the curve at X = c1=2 . P(0) and PðNÞ are amplitude and offset of the salt
titration curve. Growth Curve Analysis The yeast strains were grown exponentially in YPD at 30  C with continuous rotation. Cells were collected by centrifugation, resuspended in sterile water to 0.2 3 107 cells/mL. Each well of 96-well non-coated polystyrene microplates containing 95 mL of fresh YPD media with or without corresponding concentration of MMS or HU was inoculated with 5 mL of yeast cultures (5 3 104 cells). The samples were prepared in triplicate and cell growth was monitored with microplate scanning spectrophotometer at 600 nm every 20 min during 24 h period. The whole set of experiments were repeated at least three times. Flow Cytometry Yeast cells were synchronized into G1 phase via incubation with a-factor for 3 h and then collected every 15 min after releasing for analysis. DNA content at indicated times will be determined via flow cytometric analysis. Cells at different time points were collected by centrifugation and fixed in 70% ethanol for overnight. After centrifugation, the cell pellet was washed and then treated with RNase A (1 mg/mL) and proteinase K (1 mg/mL) for 1 h at 37  C and 55  C respectively. Samples were stained with 5 mg/mL propidium iodide at 4  C overnight in the dark. A flow cytometer was used to analyze the samples. For each histogram, 10,000 cells were assayed. DNA Damage Assays To test the effects of modifications at H4K91 on DNA damage sensitivity, both the WT and H4K91E/Q/R cells were treated with MMS, HU and UV irradiation. Briefly, serial dilutions of the cells were made and spotted onto yeast extract–peptone–dextrose (YPD) media plates containing either MMS or HU. For UV sensitivity, cells were plated in triplicate on YPD plates and irradiated with a series of UV intensities. The viability of each strain was determined as the ratio of colonies formed on the UV-irradiated plates to those without UV exposure. Selection for 5-FOA Colonies Cells were grown into colonies for 3 days at 30  C on SC-Ura plates. Colonies were picked and resuspended in sterilized water. Serial dilution of cells were made and spotted onto SC and SC-5-FOA plates for 34 days at 30  C. Chromatin Extraction from Yeast Cell Culture Chromatin extraction from budding yeast was performed as previously described (Zhang and Reese, 2006).

Molecular Cell 76, 1–16.e1–e9, November 21, 2019 e7

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

MNase Digestion Extracted nuclei were preincubated at 37  C and then digested with a series of concentration of MNase at 37  C for 10 min. Reactions were stopped by adding 0.5 M EDTA. Following RNase A and proteinase K treatment to remove RNA and proteins contained in nuclei, DNA was isolated via phenol-chloroform-isoamyl alcohol extraction. Ethanol precipitated DNA was washed with 70% ethanol, dissolved in ddH2O, electrophoresed in 1.6% agarose gel and visualized by ethidium bromide staining. Telomere Silencing Tenfold serial dilutions of the cell suspensions were prepared, and 3 mL of each diluted suspension was spotted onto synthetic complete plate (SC), synthetic complete plate without uracil (SC-ura) and synthetic complete plate containing 0.1% 5-fluoroorotic acid (SC+5-FOA). The plates were incubated at 30  C for 3 days and then photographed. RNAi Experiments 30 nM of Sirt5 siRNA (Thermo Scientific), Sirt7 siRNA (Thermo Scientific), KAT2A (Thermo Scientific) or DHTKD1 (Thermo Scientific) was transfected into human cell lines with Lipofectamine 2000 Transfection Reagent (Thermo Scientific), according to the manufacturer’s instructions. Corresponding concentrations of control siRNA were used as negative controls. Following transfection, cells were then maintained in a humidified 37 C incubator with 5% CO2 for another 48 h (for Sirt5, KAT2A and DHTKD1) or 72 h (for Sirt7). Enzymatic reactions The enzymatic activities of human Sirt7 were measured by detecting the removal of the modified groups from peptides. 5 mM of Sirt7 was incubated with 500 mM of corresponding peptides in a reaction buffer containing 50 mM Tris, pH 8.0, 150 mM NaCl, 2 mM NAD, 1 mM DTT in the presence of salmon sperm DNA at 37  C for 2 h. The reactions were stopped by adding one-third reaction volume of 20% TFA and immediately frozen in liquid N2. Samples were then analyzed by LC-MS with a Vydac 218TP C18 column (4.6 mm 3 250 mm, 5 mm; Grace Davison, Columbia, MD). On membrane digestion assay Semi-synthesized histone H4K91glu protein (1 mg) was resolved by SDS-PAGE gel and transferred to PVDF membranes. The membranes were incubated with or without 10 mg of Sirt7 in reaction buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 2 mM NAD, 1 mM DTT) in the presence of salmon sperm DNA at 37  C for 2 h. The reactions were quenched by adding 4 3 loading buffers. The glutarylation level of histones was determined by immunoblotting using anti-H4K91glu antibody. Subcellular fractionation In brief, HeLa cells were harvested by centrifugation and washed with PBS twice; all subsequent steps were performed at 4  C. Cells were then suspended in 5 cell pellet volumes of buffer A (10 mM HEPES, pH 7.9 at 4  C, 1.5 mM MgCl2, 10 mM KCl, and 0.5 mM DTT) followed by incubation for 10 min. After centrifugation, cells were resuspended in 2 cell pellet volumes of buffer A and lysed by Dounce homogenizer (B type pestle) with homogenate checked by microscopy. The cell lysis was layered over 30% sucrose in buffer A and then centrifuged for 15 min at 800 3 g. The resulting pellet was recovered from the sucrose phase, washed by buffer A twice, and then extracted by buffer C (20 mM HEPES, pH 7.9, 25% (vol/vol) glycerol, 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM PMSF, and 0.5 mM DTT) for 30 min at 4  C. After centrifugation at 12,000 3 g for 30 min, the supernatant was termed the nuclear fraction. The resulting supernatant was centrifuged twice at 800 3 g to complete the pellet nuclei and intact cell. The supernatant was then centrifuged at 7,000 3 g to pellet the mitochondria followed by washing twice with buffer A. The supernatant was termed the cytosolic fraction. The mitochondria were then lysed by TXIP-1 buffer (1% Triton X-100 (vol/vol), 150 mM NaCl, 0.5 mM EDTA, and 50 mM Tris–HCl, pH 7.4). Protein concentration was determined by BCA assay. Immunoprecipitation Proteins were extracted from cultured cells using a modified buffer. Immunoprecipitation analyses were with anti-DHTKD1 antibody were performed as described previously (Wang et al., 2017). A lysis buffer with 0.2% Triton X-100 was used for immunoprecipitation of DHTKD1 in HEK293T cells. ChIP and ChIP-seq assay Cells were cross linked by 1% formaldehyde for 10 min and quenched by 0.125 M glycine for 5 min at room temperature. Cells were then lysed by ChIP lysis buffer (5 mM PIPES pH 8.0, 85 mM KCl, and 1% IGEPAL CA-630) and homogenized using a glass Dounce homogenizer (type B pestle). The nuclear fraction was precipitated and lysed in nuclei lysis buffer (50 mM Tris–HCl, pH 8.0, 10 mM EDTA, and 1% SDS) for 30 min at 4  C. The nuclear lysis was sonicated to a chromatin around 500 bp. Immunoprecipitation was done in immunoprecipitation dilution buffer (50 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1% IGEPAL CA-630, 0.25% deoxycholic acid, and 1 mM EDTA) using Dynabeads coupled with Protein G (Life Technologies). Chromatin and anti-H4K91glu antibody were used for each ChIP reaction. Chromatin complex was eluted from beads by ChIP elution buffer (50 mM NaHCO3 and 1% SDS) and added to 5 M NaCl to a final concentration of 0.54 M. To reverse cross links of protein/DNA complex to free DNA, samples were incubated

e8 Molecular Cell 76, 1–16.e1–e9, November 21, 2019

Please cite this article in press as: Bao et al., Glutarylation of Histone H4 Lysine 91 Regulates Chromatin Dynamics, Molecular Cell (2019), https:// doi.org/10.1016/j.molcel.2019.08.018

at 65  C for 2 hr followed by 95  C for 15 min. After incubation with RNase (Thermo Fisher Scientific) for 20 min at 37  C, DNA was recovered. Libraries were prepared for sequencing on the BGISEQ 500 platform. RNA sequencing analysis The mRNA was extracted from wild-type and H4K91E mutant by RNA extraction kit form Thermo Scientific. Libraries were prepared for sequencing on the BGISEQ 500 platform. Raw reads in FASTQ sequencing files were aligned by STAR (version 2.5.2b) aligner to the Saccharomyces cerevisiae reference genome (sacCer3). Read counts were generated by featureCounts (version 1.6.2) and then applied for differential expression analysis, which was performed by using package edgeR (version 3.24.3) in R (version 3.5.1). To remove low/non-expressed genes, genes with less than 1 read per million bp in at least 3 samples were removed from this analysis. To detect significantly differentially expressed genes with edgeR between the wild-type and the mutant the quasi-likelihood approach was applied. False Discovery Rate (FDR) values were extracted by using Benjamini-Hochberg (BH) algorithm (FDR-corrected p value < 0.05 and logFC > 1). ChIP sequencing analysis H4K91glu and input control ChIP-seq data (50bp sequence reads) were aligned to the human reference genome (hg19) using Burrows-Wheeler Aligner (BWA, version 0.7.17-r1188). The created BAM files were sorted and indexed with SAMtools (version 1.9). Raw ChIP-seq data files for KAT2A were available online in the Gene Expression Omnibus (GEO) with the accession number GSE97994. These data were converted to fastq format and aligned using the same pipeline as mentioned before (BWA, SAMtools). To obtain an input-normalized BigWig files needed for the profile analysis, DeepTools (version 3.2.0) was applied. Finding the enriched regions (peak calling) was done with MACS (version 2.1.2). This was followed by cross comparison of the detected peaks using bedTools (version v2.27.1) intersect. QUANTIFICATION AND STATISTICAL ANALYSIS Statistical parameters, including number of events quantified, standard deviation, and statistical significance are reported in the figures and figure legends. Statistical analysis has been performed using Microsoft Excel, Origin or GraphPad software. DATA AND CODE AVAILABILITY The accession number for the raw sequencing data of ChIP-seq and RNA-seq analyses in this paper is GEO: GSE131807. The original imaging and immunoblotting data have been deposited to Mendeley (https://doi.org/10.17632/nx8xxvg4b3.2).

Molecular Cell 76, 1–16.e1–e9, November 21, 2019 e9