Glutathione transferase (GST) as a candidate molecular-based biomarker for soil toxin exposure in the earthworm Lumbricus rubellus

Environmental Pollution 157 (2009) 2459–2469

Contents lists available at ScienceDirect

Environmental Pollution journal homepage: www.elsevier.com/locate/envpol

Glutathione transferase (GST) as a candidate molecular-based biomarker for soil toxin exposure in the earthworm Lumbricus rubellus E. James LaCourse a, *, Mariluz Hernandez-Viadel a, James R. Jefferies a, Claus Svendsen b, David J. Spurgeon b, John Barrett a, A. John Morgan c, Peter Kille c, Peter M. Brophy a a b c

Institute of Biological, Environmental, and Rural Sciences, Aberystwyth University, Aberystwyth SY23 3DA, UK Centre for Ecology and Hydrology, Huntingdon PE28 2LS, UK Biosciences, University of Cardiff, Cardiff CF10 3TL, UK

This study currently provides the most comprehensive view of the Phase II detoxification enzyme superfamily of glutathione transferases within the important environmental pollution sentinel earthworm Lumbricus rubellus.

a r t i c l e i n f o

a b s t r a c t

Article history: Received 13 October 2008 Received in revised form 3 March 2009 Accepted 7 March 2009

The earthworm Lumbricus rubellus (Hoffmeister, 1843) is a terrestrial pollution sentinel. Enzyme activity and transcription of phase II detoxification superfamily glutathione transferases (GST) is known to respond in earthworms after soil toxin exposure, suggesting GST as a candidate molecular-based pollution biomarker. This study combined sub-proteomics, bioinformatics and biochemical assay to characterise the L. rubellus GST complement as pre-requisite to initialise assessment of the applicability of GST as a biomarker. L. rubellus possesses a range of GSTs related to known classes, with evidence of tissue-specific synthesis. Two affinity-purified GSTs dominating GST protein synthesis (Sigma and Pi class) were cloned, expressed and characterised for enzyme activity with various substrates. Electrospray ionisation mass spectrometry (ESI-MS) and tandem mass spectrometry (MS/MS) following SDS-PAGE were superior in retaining subunit stability relative to two-dimensional gel electrophoresis (2-DE). This study provides greater understanding of Phase II detoxification GST superfamily status of an important environmental pollution sentinel organism. Ó 2009 Elsevier Ltd. All rights reserved.

Keywords: Glutathione transferase Lumbricus rubellus Earthworm 2-DE

1. Introduction Earthworms are important test organisms in laboratory and field investigations, serving as bioindicators of soil toxicity (Edwards and Bater, 1992; Beeby, 2001). Several earthworm species are suggested as sentinels to monitor contamination of terrestrial ecosystems (Beeby, 2001; Simonsen and Scott-Fordsmand, 2004; Spurgeon et al., 2003, 2004; USEPA, 2000; Morgan and Morgan, 1999; Scott-Fordsmand et al., 2004), with tests based on enzyme activity (Nadeau et al., 2001), structural observations (Sauve et al., 2002; Svendsen et al., 2004), molecular genetics (Sturzenbaum et al., 1998; Galay-Burgos et al., 2003; Ricketts et al., 2004; De Coen and Janssen, 2003) and behavioural responses (Hund-Rinke and Wiechering, 2001). Earthworms’ exposure to the range of xenobiotics encountered in soil necessitates dependence upon detoxification strategies; the biochemical and molecular nature of which * Corresponding author. Veterinary Parasitology, Faculty of Veterinary Science, The University of Liverpool, Liverpool L69 7ZJ, UK. Tel.: þ44 (0) 151 7941178; fax: þ44 (0) 151 7941519. E-mail address: [email protected] (E.J. LaCourse). 0269-7491/$ – see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.envpol.2009.03.015

has been much researched as a potential biomarker of pollution status and its effects (Scott-Fordsmand and Weeks, 2000; SanchezHernandez, 2006). Of the potential biomarkers, earthworm glutathione transferase (GST) enzymes are shown to respond to toxin exposures. Most earthworm GST studies have been biochemical activity-based in crude or semi-purified preparations, with activity alterations after exposure to industrial metals and pesticide contaminated soils reported (Aly and Schro¨der, 2008; Maity et al., 2008; qaszczyca et al., 2004; Lukkari et al., 2004; Saint-Denis et al., 2001; Booth et al., 2000). Recently, transcriptome approaches in the earthworm L. rubellus (Hoffmeister, 1843) highlight GSTs as responders to xenobiotics from across chemical classes including inorganic (cadmium, copper), organic (fluoranthene) and agrochemicals (atrazine) (Bundy et al., 2008; Owen et al., 2008). Soluble GSTs form a ubiquitous superfamily of multi-functional dimeric enzymes (w50 kDa) with roles in Phase-II detoxification. GSTs neutralise a broad range of xenobiotics and endogenous metabolic by-products via enzymic glutathione conjugation, glutathione-dependent peroxidase activity or isomerisation reactions (Hayes et al., 2005). Although GSH-toxin conjugation

2460

E.J. LaCourse et al. / Environmental Pollution 157 (2009) 2459–2469

typically renders many toxins less reactive and more water-soluble allowing for excretion via Phase III detoxification (Salinas and Wong, 1999), GSTs can in some instances increase the toxicity of some compounds such as ethylene dibromide (Kim and Guengerich, 1990). Some GSTs may neutralise cytotoxins by sacrificial binding (Sheehan et al., 2001), and others have molecular housekeeping functions such as the transport of hydrophobic ligands (Brophy and Pritchard, 1992), leukotriene and prostaglandin D2, E2, F2a synthesis (Nicholson et al., 1993; Ujihara et al., 1988) and amino acid catabolism (Board et al., 1997). Mammalian GSTs have cellular roles as modulators of Jun N-terminal kinase signalling pathways, protecting against hydrogen peroxideinduced apoptosis (Tew and Ronai, 1999), whilst preliminary evidence indicates GST is also part of invertebrate heme transport and oxidative stress response pathways (Perally et al., 2008; Leiers et al., 2003). Human cytosolic GSTs also have clinical applications as biomarkers in human cancer epidemiology and for multi-drug resistance in human tumours (Waxman, 1990; Linsenmeyer et al., 1992; Tew, 1994). The wide range of xenobiotics encountered in variable environments may have directed the selection, via gene duplication, of the multiple GST isoforms, with broad substrate specificity, but low catalytic efficiency. Membrane associated GSTs are described, but the cytosolic enzymes contribute approximately 1–5% of total cytosolic protein (Wilce and Parker, 1994), and around 90% of total GST activity (Jakobsson et al., 1999). Soluble GSTs are sub-divided into at least seven taxonomically widespread classes (Alpha, Mu, Pi, Theta, Zeta, Omega, and Sigma). Other species and phylum-specific GSTs have been suggested, as in the invertebrate GST Nu class proposed by Campbell et al. (2001), plant Phi and Tau classes (Edwards et al., 2000) and insect classes of Epsilon (Ranson et al., 2001) and Delta (Chelvanayagam et al., 2001). Given the ubiquity and ‘cross-taxa’ conservation of GST classes, studies with non-mammalian invertebrate organisms such as earthworms, with their wide habitat distribution and availability offer a relative ease of laboratory culture, manipulations and hypothesis testing. Despite widespread use and importance of earthworms as environmental pollution sentinels, and much researched detoxification role of GSTs, little sequence information for earthworm GSTs was available prior to the Earthworm Genomics project (http:// xyala.cap.ed.ac.uk/Lumbribase/lumbribase_php/lumbribase.php). Only three partial amino acid and nucleotide sequences exist publicly outside of the genomics’ L. rubellus project; these short, incomplete sequences shown in Borgeraas et al. (1996) and Lee et al. (2005). This study has presented for the first time, a proteomics approach coupled with bioinformatics and mechanistic biochemical characterisation of recombinant proteins to investigate GSTs from the earthworm L. rubellus. This approach serves as pre-requisite in initial assessment of potential application of earthworm GSTs as biomarkers of soil toxin exposure. 2. Materials and methods

commercial topsoil – [Broughton Loam, Kettering, UK]; 1 part composted bark [with freeze-sterilised horse manure and fresh vegetables added as food]). Commercial topsoil characterised as clay loam (24% sand, 35% silt, 41% clay; all w/w) was baked to sterilise, before adding urine-free, finely-ground horse manure (from pasture grazed by non-medicated animals) to 3% (dry w/w) with final rehydration to 60% water-holding-capacity (WHC – 1020 mL kg1). Each 1.4 kg of soil medium (2 L containers) was equilibrated over two-weeks before worm introduction and maintained at 15  C þ/ 1.5  C in a 16:8 h, light:dark regime. Five grams air-dried horse manure plus 20 ml distilled water was added weekly as food. Remaining food was removed and weighed weekly to estimate consumption before fresh food addition. Moisture was monitored throughout culture, and corrected as required. Cocoon numbers at the end of the culture indicated reproduction rates within established range for healthily maintained L. rubellus. Each worm was visually inspected for presence of skin lesions, clitellum scarring, body constrictions, turgour loss, and reduced vigour according to ‘‘condition index’’ scores ranging from 1 (pristine) to 5 (very poor for many characters). This precautionary screen allowed removal of poor condition worms. 2.2. Tissue preparation and homogenization To preserve compositional fidelities of tissue fractions, earthworms were dissected into major tissue fractions as rapidly and accurately as possible. Therefore, attempting to remove non-discrete chloragogen tissue would have imposed significant delay in procedures with potential appreciable post-mortem degradation of proteins. Adult worms were dissected into seven tissue fractions: (i) anterior gut (pharynx, oesophagus, calciferous glands plus attached tissues); (ii) posterior gut (intestinal epithelium, chloragogenous tissue); (iii) anterior body wall (the deeply pigmented tissue, comprised of circular and longitudinal muscle layers, plus epidermis) from the anterior edge of the clitellum to the mouth; (iv) clitellum region of the body wall with its swollen, highly secretory, epidermis; (v) posterior body wall, relatively poorly pigmented, and running from posterior edge of clitellum to anus, each body wall fraction containing attached nephridia and ventral nerve; (vi) crop and gizzard; (vii) seminal vesicles. Frozen whole L. rubellus or isolated tissues were homogenized on ice in glass homogenizers, in five buffer volumes-to-worm-weight ratio. Homogenization buffer consisted of 20 mM potassium phosphate pH 7.4, 50 mM sodium chloride with protease-inhibitor cocktail (Mini-Complete, Roche). Tissue-specific homogenates combined three or four whole tissues removed from individual worms. After homogenization, cell debris was removed by centrifugation at 17 000  g 15 min 4  C; supernatant was ultracentrifuged at 100 000  g 30 min 4  C. This resulting ‘second’ supernatant was retained as soluble ‘cytosolic’ fraction. Equal quantities of cytosolic protein from whole non-dissected worms were pooled to minimize individual variations. Three earthworms were pooled for each of three replicate biological samples. Protein concentrations were estimated using Sigma Bradford Reagent B6916 protocol according to manufacturer’s instructions based upon the method of Bradford (1976). 2.3. GST purification and enzyme assay GSTs were purified from L. rubellus cytosol via glutathione (GSH)-affinity chromatography according to the methods of Simons and Vander Jagt (1977) using glutathione–agarose (Sigma G4510) as per manufacturer’s instructions. Initial establishment of GST presence within samples was assayed via enzyme activity using 1 mM 1-chloro-2, 4-dinitrobenzene (CDNB) as standard second substrate at 25  C over 3 min at 340 nm according to the method of Habig et al. (1974). Various substrates were used in assays to further characterise GSTs; 1,2-dichloro-4-nitrobenzene (DCNB) activity according to Habig et al. (1974); ethacrynic acid, 1,2-epoxy-3-(p-nitrophenoxy)propane (EPNP), Trans-4-phenyl3-buten-2-one, Trans-2-nonenal and trans, trans-2, 4-decadienal according to Habig and Jakoby (1981); 4-hydroxynonenal according to Alin et al. (1985) and cumene hydroperoxide according to Jaffe and Lambert (1986). See Table 2 for assay conditions. Assays were completed in triplicate. Specific activities expressed as mmol GSH/substrate conjugated min1 mg1 protein.

2.1. Earthworm culture

2.4. Tryptic digest of proteins for mass spectrometry

Worms used in this study were from the same population of worms used in the Earthworm Genomics Consortium project from which ESTs were created (for further details see Owen et al. (2008) with project information available at LumbriBase http://xyala.cap.ed.ac.uk/Lumbribase/lumbribase_php/lumbribase.php). Clitellate adult worms originated from a commercially maintained field (Neptune Ecology, Ipswich, UK) and classified as L. rubellus using the Lumbricidae Key of Sims and Gerrard (1985). Worms showing clitellum scarring (aging and senescence symptom) were excluded from the experiment. Worms were maintained under laboratory observation, prior to investigation, for forty days on 2 mm mesh-sieved medium (1 part Sphagnum peat; 1 part

Protein spots excised from gels were digested with trypsin according to the following protocol. Excised gel plugs were washed and destained with 100 mL 50% acetonitrile/50 mM ammonium bicarbonate for 15 min, before removal of ‘wash solution’ and incubation with 100 mL acetonitrile for 15 min. This process was repeated three times. Washed gel plugs were vacuum dried and proteins digested for 18–24 h 37  C in 10 mL 10 mg/mL trypsin (T6567, Sigma) in 25 mM ammonium bicarbonate. Post-digest peptides were extracted in solution following two 1 h incubations with 50 mL of 50% acetonitrile/5% trifluoroacetic acid, with removal and collection of solution after each incubation. Extracted peptides were dried and resuspended in 10 mL 1% formic acid.

E.J. LaCourse et al. / Environmental Pollution 157 (2009) 2459–2469 2.5. Quadrupole Time of Flight tandem mass spectrometry (QToF MS/MS) identification of proteins Extracted peptides were run on a ‘Waters’ QToF2 hybrid quadrupole mass spectrometer (Waters, UK. http://www.waters.com) incorporating integrated capillary LC system. Five mL of digest was introduced via an autosampler loaded onto a C18 packed pre-column for desalting, before elution onto an analytical capillary C18 column (100 mm  0.75 mm id – flow at 200 nL/min – solvent gradient over 1 h). Eluted peptides were directly submitted via nanospray into the mass spectrometer at 3 kV. Reference solution was human angiotensin I (1296.6853 Da; Sigma A9650). Acquired data were combined, smoothed twice (Savitzky–Golay method) and subjected to maximum entropy (Maxent) 3 deconvolution software (MassLynx v. 3.5) at minimum mass 50 Da; maximum 2000 Da. Fragmentation spectra analysis via Peptide Sequencing Tool (PepSeq) in the MassLynx version 3.5 software package (Micromass, UK) provided peptide sequences (intensity threshold at 1; fragment ion tolerance 0.1 Da). Peptide modifications considered were methionine oxidation and carbamidomethylation of cysteines. Additionally, selected fragmentation spectra were analysed manually and de novo sequencing carried out to confirm software prediction. Peptide sequence Basic Local Alignment Search Tool (BLAST – Altschul et al., 1990) analysis was conducted within public databases and L. rubellus expressed sequence tag (EST) project database (LumbriBase http://xyala.cap.ed.ac.uk/ Lumbribase/lumbribase_php/lumbribase.php Accessed 09/04/2005). Additional BLAST analysis was undertaken within a local L. rubellus GST protein database to identify proteins. This local database was constructed from sequences obtained from LumbriBase including translated nucleotide sequences gained through further forward and reverse reads of plasmids produced from the LumbriBase EST project (‘Worm Consortium’ – Earthworm–Nematode Environmental Genomics consortium NERC Environmental Genomics Programme, http://www.earthworms.org/).

2461

body sections and culture conditions from which the GST EST sequences were isolated is shown in Supplementary Table 1). A combination of text searches and BLAST analysis (Altschul et al., 1990) within LumbriBase provided the translated sequences. Several EST reads within LumbriBase were only partial sequence of GST genes. To obtain further sequence for these GSTs, several EST plasmids containing the GST sequences from this project were kindly donated by Dr. Jennifer Owen (Cardiff School of Biosciences) allowing additional sequencing and generation of more complete sequences. Forward and reverse DNA sequencing was performed at the DNA sequencing service at the Institute of Grassland and Environmental Biology (Plas Gogerddan, Aberystwyth, Ceredigion, Wales, UK) on an Applied Biosystems ABI 3100 DNA analyser. The final set of L. rubellus sequences containing recognised GST domains (Pfam N-terminal domain PF02798 and C-terminal domain PF00043) was searched against public non-redundant databases via the National Centre for Biotechnology Information (NCBI) using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi – Altschul et al., 1990) identifying similar sequences from other organisms. GST proteins representative of recognised GST superfamily classes were downloaded from Interpro database at the European Bioinformatics Institute (EBI – http://www.ebi.ac.uk/ interpro/), and from non-redundant databases at NCBI (http://www.ncbi.nlm.nih. gov/). L. rubellus sequences, highest scoring BLAST hits of putative homologues and GST class representatives were aligned via ClustalW program (Thompson et al., 1994) in BioEdit Sequence Alignment Editor Version 7.0.5.2. (Hall, 1999) and sequence identity matrices produced from multiple alignments. Phylogenetic bootstrap neighbour-joining trees were produced as PHYLIP output files in ClustalX Version 1.83 (Thompson et al., 1997) according to the neighbour-joining method of Saitou and Nei (1987). ClustalX default settings for alignments were accepted using the GONNET protein weight matrices with PHYLIP tree format files viewed within TREEVIEW (Page, 1996). 2.9. Production of recombinant L. rubellus GSTs

2.6. Electrospray ionisation mass spectrometry (ESI) GSH-affinity fractions were assayed for GST subunit content and mass via electrospray ionisation mass spectrometry (ESI). An LCT orthogonal accelerationTime of Flight (oa-TOF) mass spectrometer (Micromass, Manchester, UK) with Z-spray atmospheric pressure ionisation (API) source (MassLynx 3.5 software) acquired electrospray mass spectral data in positive ion mode. Protein samples were prepared by adding 60 mL 1:1 CH3CN:H2O. 0.5% formic acid (v/v) to 15 mL protein sample (100 mg/mL) and infused into source using a Harvard Apparatus Model 11 syringe pump (flow-rate 5 mL/min). Nitrogen, (via gas generator – PTL, Products of Technology Ltd., Killearn) assisted electrospray nebulisation (80 L/h) and desolvation (460 L/h). Source conditions were; spraying capillary 3 kV; cone voltage 45 V, source temp. 80  C; desolvation gas (nitrogen) 120  C. Instrument calibration was over mass range m/z 200–2000, using myoglobin (Sigma, M1882). Continuum data were acquired, smoothed and transformed to give molecular weight information of sample proteins. 2.7. Protein electrophoresis Protein samples were resolved via either standard sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) according to the discontinuous buffer system (Laemmli, 1970) or two-dimensional polyacrylamide gel electrophoresis (2-DE) according to the methods of Go¨rg et al. (1988). For 2-DE, a ‘Protean IEF’ unit (Bio-Rad, UK) was used for protein separation according to isoelectric point (pI) and either a ‘Protean II xi Cell’ or ‘Mini-Protean (Bio-Rad), for protein separation based upon molecular weight in SDS-PAGE. Protein samples were resuspended into immobilised pH gradient (IPG) rehydration buffer (6 M urea, 1.5 M Thiourea, 3% w/v CHAPS, 66 mM DTT, 0.5% v/v ampholytes pH 3–10 (Pharmalytes, Amersham BioSciences, UK)). In-gel passive rehydration and isoelectric focusing of IPG gel strips with protein samples was at 20  C with mineral oil overlay according to IPG strip manufacturer’s instructions (Bio-Rad, UK). Isoelectric focused strips were equilibrated, in two stages: ‘reducing stage’ for 15 min in ‘equilibration buffer’ (50 mM Tris–HCl pH 8.8, 6 M urea, 30% glycerol, 2% SDS) containing 1% (w/v) DTT, followed by 15 min ‘alkylating stage’ in ‘equilibration buffer’ containing 2.5% (w/v) iodoacetamide replacing 1% DTT. SDS-PAGE was carried out on polyacrylamide gels (12.5% acrylamide, 0.1% bis-acrylamide, 395 mM Tris pH 8.7, 0.13% SDS, 0.03% TEMED, 0.07% ammonium persulphate) with Tris/Glycine/SDS buffer (25 mM Tris, 192 mM glycine, 0.1% (w/v) SDS). Gels were silver-stained by the method of Shevchenko et al. (1996), or Coomassie stained (PhastGel Blue R, Pharmacia Biotech) and scanned upon a GS-800 densitometer (Bio-Rad). 2.8. Sequence analysis Protein sequences with sufficient similarity to infer functional and evolutionary relationship to the GST gene family were obtained from the Earthworm Genomics project EST database (for further details of EST construction see Owen et al., 2008 with project information available at LumbriBase http://xyala.cap.ed. ac.uk/Lumbribase/lumbribase_php/lumbribase.php – A summary of the lifestages,

Full-length cDNAs encoding LRP04659 and LRP06119 were cloned and expressed from the Escherichia coli BL21(DE3)pLysS þ pET 23a plasmid system (Novagen), with protein purified by GSH-affinity chromatography, and purity assessed by ESI and SDS-PAGE. Primers for polymerase chain reaction were designed to incorporate restriction enzyme sites for NdeI (CATATG) and NotI (GCGGCCGC) to facilitate insertion into pET 23a plasmid vector as follows; LRP04659 FORWARD, 50 CATATGGTGCACTACAAGCTGACC30 ; LRP04659 REVERSE, 50 GCGGCCGCTTAGAATTTGCTAT30 ; LRP06119 FORWARD, 50 CATATGCCCTACAAACTTCAG3 0 ; LRP06119 REVERSE, 50 GCGGCCGCTTACTGTTTGCC30 .

3. Results and conclusions Gene sequence of significant quantity has only recently become available for the earthworm (http://xyala.cap.ed.ac.uk/Lumbribase/ lumbribase_php/lumbribase.php). Consequently, despite the importance of earthworms in monitoring toxins and pollutants, the Phase II detoxification GST superfamily has only been studied in the main by partially purified extract enzyme activity assessments. This study aimed to exploit the recently available sequence alongside study of native and recombinant protein biochemistry to provide a platform to understand the role and potential of the earthworm GST superfamily at the protein level in future toxin response investigations. 3.1. Sequence analysis of the GST complement, or ‘GSTome’, of L. rubellus Fifteen predicted GST sequences were obtained from LumbriBase EST database (http://xyala.cap.ed.ac.uk/Lumbribase/ lumbribase_php/lumbribase.php) (Table 1), representing four classes of soluble GSTs (Omega, Alpha, Sigma and Pi) and three classes of membrane GSTs and elongation factors. There is no significant evidence of novel GST classes in L. rubellus, and, in common with nematodes, no Theta or Mu class-related GSTs predicted by phylogenetic analysis (Fig. 1). Little sequence information exists for GSTs of other earthworms. Only one other partial DNA sequence similar to GST was found in public databases. This

2462

E.J. LaCourse et al. / Environmental Pollution 157 (2009) 2459–2469

Table 1 L. rubellus GSTs predicted via BLAST analysis of the L. rubellus EST project database (LumbriBase http://xyala.cap.ed.ac.uk/Lumbribase/lumbribase_php/lumbribase.php Accessed 09/04/2005). L. rubellus GST sequences were searched against publicly available non-redundant databases using the BLAST to find the most similar sequences from other organisms. The PSort program (Horton & Nakai, 1997 – http://psort.ims.u-tokyo.ac.jp/form2.html) provided subcellular localization prediction. GST class assignment was based upon highest similarity to previously predicted class-specific GSTs. Note that several GSTs are not presented within the EST database as full-length proteins (LRP00636, LRP00945, LRP02027, LRP02598, LRP05089, LRP05391 and LRP07525). LumbriBase No.

Amino acid No.

Molecular weight (Da)

Isoelctric point

Predicted GST class

Psort predicted cellular localisation

BLAST homologue

BLAST E-value

% amino acid identity/positive

LRP02027 LRP01376

182 440

20 721 49 920

4.82 6.95

ALPHA EF1G

52.2%: cytoplasmic 87.0%: cytoplasmic

6.00E-25 3.00E-150

(38%)/(58%) (59%)/(73%)

LRP05089

166

18 961

9.85

EF1G

47.8%: mitochondrial

7.00E-59

(64%)/(81%)

LRP00945

108

12 566

9.19

MAPEG

7.00E-22

(53%)/(66%)

LRP03958

154

17 253

9.18

MAPEG

Q9CPU4; microsomal GST 3 [Mus musculus]

4.00E-24

(40%)/(59%)

LRP07525 LRP00636 LRP02410 LRP06119 LRP01838 LRP02154

109 134 210 207 206 208

12 367 15 631 24 043 23 374 23 240 23 769

6.24 5.74 6.96 8.87 5.31 7.79

MAPEG OMEGA PI PI SIGMA SIGMA

66.7%: Endoplasmic reticulum’’ 55.6%: Endoplasmic reticulum’’ 26.1%: cytoplasmic 43.5%: cytoplasmic 43.5%: cytoplasmic 47.8%: cytoplasmic 65.2%: cytoplasmic 73.9%: cytoplasmic

P24472; GST alpha 4 [Mus musculus] Q90YC0; Elongation factor-1 gamma [Carassius auratus] XP_535882; Euk. translation elong. F-1 epsilon 1 [Canis familiaris] Q91VS7; microsomal GST 1 [Mus musculus]

8.00E-24 3.00E-30 8.00E-76 5.00E-22 2.00E-33 4.00E-40

(56%)/(68%) (57%)/(72%) (69%)/(74%) (56%)/(71%) (42%)/(60%) (45%)/(62%)

LRP02186 LRP02598 LRP04659 LRP05391

208 209 205 164

23 23 22 17

8.62 9.01 5.11 5.74

SIGMA SIGMA SIGMA SIGMA

78.3%: cytoplasmic 43.5%: mitochondrial 39.1%: cytoplasmic 56.5%: cytoplasmic

Q6NTT5; MGC82293 protein [Xenopus laevis] Q70PH4; GST omega 1; [Crassostrea gigas] Q9DDU5; GST pi [Danio rerio] Q9DDU5; GST pi. [Danio rerio] Q8JHA7; GST [Xenopus laevis] O73888; GSH-dependent PGD synthetase [Gallus gallus] P46436; GST 1 sigma [Ascaris suum] Q622B1; GST [Caenorhabditis briggsae] Q9NAW7; GST [Haemonchus contortus] Q8MUR9; GST S1-2 [Anopheles gambiae]

6.00E-35 3.00E-36 2.00E-30 2.00E-23

(44%)/(54%) (39%)/(54%) (42%)/(55%) (35%)/(55%)

824 935 969 830

sequence most closely aligned with Sigma class GSTs from L. rubellus (Supplementary Fig. 1), and was isolated from the midgut of the earthworm Eisenia andrei (Accession No. BP524385 GenBank – Lee et al., 2005). Two other short, twelve-amino-acid N-terminal sequences were published by Borgeraas et al. (1996). These fragments were from earthworms E. andrei and Eisenia veneta, and aligned most closely to Pi and Sigma class GSTs respectively (Supplementary Fig. 1). Several L. rubellus GSTs bear significant identity to nematode GSTs (Table 1). Borgeraas et al. (1996) show N-terminal sequences of earthworms E. andrei and E. veneta displaying up to 90% identity with several nematode species’ GSTs; described here as most similar to Sigma GSTs. The same study also displays N-terminal sequence from E. andrei GST as closest in identity to Pi GSTs. In contrast to nematodes and invertebrates in general, L. rubellus was found to possess a single Alpha class GST (LRP02027). Interestingly, Alpha GSTs are not represented in the range of invertebrate DNA sequences entered into current public databases, though Alpha GSTs are widely represented in vertebrate genomes. Additionally, this L. rubellus Alpha GST has been shown to respond significantly under cadmium exposure (Owen et al., 2008). The apparent GST gene duplication within the Sigma class shown in the nematode Caenorhabditis elegans (Campbell et al., 2001) may also be present in the genome of earthworms, suggested by the presence of at least seven Sigma GSTs in L. rubellus, and at least two Pi GSTs (see Supplementary Fig. 2 for sequence identity matrix of L. rubellus GSTs). In contrast, there is only one Sigma GST in Drosophila, with many Epsilon and Delta class GSTs present; classes not identified in either nematodes or earthworms to date (Tu and Akgu¨l, 2005). The taxonomic separation of earthworms and nematodes does not necessarily suggest duplication events arose in a common ancestor before their divergence, and so may reveal a shared environmental/habitat element has selected for the development of their ‘GSTomes’ from an ancestral, though classspecific, set of GSTs. The commonality of GST classes Pi, Sigma, Omega and Alpha between L. rubellus, nematodes and humans, suggests earthworms may have significant conserved similarities in a variety of GST functions.

3.2. SDS-PAGE and mass spectrometry identification of L. rubellus GSTs SDS-PAGE and ESI (Fig. 2) displayed two bands of GSH-affinity proteins, indicating earthworm cytosol is dominated by two GST protein isoforms. Additional peaks on the ESI spectrum may be post-translationally modified isoforms of major subunits, or other GST isoforms at lower quantities. A ‘shotgun’ approach, where GSH-affinity protein bands resolved via SDS-PAGE, digested with trypsin and peptides identified by tandem mass spectrometry (MS/ MS), was used to identify L. rubellus GSTs. In total, thirty peptide sequences were analysed from digests of SDS-PAGE bands of GSH-affinity proteins (Supplementary Table 2). Sixteen sequences were from the lower molecular weight (Lmw) SDS-PAGE band and fourteen sequences from the higher weight (Hmw) band. Individual peptide sequences were searched via the LumbriBase L. rubellus EST BLAST facility for similarity and also within a local database of GST sequences from both LumbriBase and further sequencing of ‘EST plasmids’ from the same L. rubellus EST database. Sixteen peptides (Supplementary Table 2) matched to four L. rubellus GST proteins; three Sigma and one Pi class (LRP01838, LRP02154, LRP04659 and LRP06119) (Fig. 3). The Hmw SDS-PAGE band provided six fragments matched to four L. rubellus GST proteins; LRP06119 (Pi), LRP04659 (Sigma), LRP01838 (Sigma) and LRP02154 (Sigma). GSTs predicted from ten peptide fragments in the Lmw SDS-PAGE band (Supplementary Table 2) matched to three GSTs; LRP06119 (Pi), LRP04659 (Sigma), and LRP01838 (Sigma). Fourteen other fragments were sequenced, but did not bring significant matches to predicted proteins in LumbriBase or the local L. rubellus GST database (Supplementary Table 2). Both databases are based upon ESTs, and due to incomplete coverage, may not represent all GSTs synthesised as protein or present as genes. Two of these unmatched peptides were similar to GSTs in other organisms within GenBank (NCBI http://www.ncbi.nlm.nih.gov/). Interestingly, one peptide (Hmw band peptide No. 5) was similar to a fragment of Beta class bacterial GST suggesting possible co-purification of soil bacteria or commensal. The other fragment was similar to a GST clustering most closely with Theta class GSTs similar to the Amphioxus

E.J. LaCourse et al. / Environmental Pollution 157 (2009) 2459–2469

2463

SmanGSTO 813

CeleGSTO 996

OMEGA.

LRP00636 1000

homoGSTO1 1000

musGSTO1 CeleGSTZ42 1000

DmelGSTZ1 1000

ZETA.

homoGSTZ1 1000

870

musGSTZ1 DmelGSTT1

748

SpurGSTT1 1000

THETA.

homoGSTT1 1000

musGSTT1 LRP02410 998

LRP06119 994

homoGSTP1 1000 994

PI.

musGSTP1 OvolGSTP 1000

970

CeleGSTP1 DerGSTM1 1000

FhepGSTM27

492

520

MU.

homoGSTM1 1000

musGSTM1 LRP02027 988

homoGSTA1

990

ALPHA.

1000

musGSTA1 BmorGSTS homoGST PGD 1000

musGST PGD2

961

LRP05391 LRP04659

616 682

1000

SIGMA.

LRP02598

566

LRP01838

903 350

LRP02186 1000

LRP02154 HconGSTS 0.1 Fig. 1. Phylogenetic neighbour-joining tree showing the relationship of L. rubellus GST proteins to seven taxonomically widespread cytosolic GST classes. L. rubellus proteins containing typical GST domains (pfam 02798 and/or pfam 00043) were translated from the LumbriBase EST database (http://xyala.cap.ed.ac.uk/Lumbribase/lumbribase_php/ lumbribase.php Accessed 09/04/2005). Mammalian and invertebrate GSTs allow classification to that originally based on mammalian sequences and with more recently sequenced invertebrate GSTs. L. rubellus proteins are preceded by the letters ‘LRP’. Other numbers are accession codes (accessed 01/07/2005) shown below. Sequences were aligned within ClustalX V1.83 and a neighbour-joining (NJ) phylogenetic tree constructed according to the method of Saitou and Nei (1987). NJ tree was viewed within TREEVIEW software (Page, 1996). Numbers shown alongside branches are bootstrap values. Key to sequences used in neighbour-joining tree. Nomenclature displayed in the tree is shown alongside Swiss-Prot/TrEMBL protein codes and organism for the GSTs chosen. Vertebrates (mammals); homoGSTM1 – P09488 [Homo sapiens]; musGSTM1 – Q58ET5 [Mus musculus]; homoGSTA1 – P08263 [Homo sapiens]; musGSTA1 – Q6P8Q0 [Mus musculus]; homoGSTP1 – Q5TZY3 [Homo sapiens]; musGSTP1 – P19157 [Mus musculus]; homoGST_PGD – Q6FHT9 [Homo sapiens]; musGST_PGD2 – Q8CA80 [Mus musculus]; homoGSTZ1 – Q6IB17 [Homo sapiens]; musGSTZ1 – Q9WVL0 [Mus musculus]; homoGSTO1 – P78417 [Homo sapiens]; musGSTO1 – O09131 [Mus musculus]; homoGSTT1 – Q5TZY2 [Homo sapiens]; musGSTT1 – Q91X50 [Mus musculus]; Invertebrates; FhepGSTM27 – P31670 [Fasciola hepatica]; DerGSTM1 – P46419 [Dermatophagoides pteronyssinus] (dust mite); DmelGSTZ1 – Q9VHD2 [Drosophila melanogaster]; CeleGSTZ42 – Q18938 [Caenorhabditis elegans]; OvolGSTP – P46427 [Onchocerca volvulus]; CeleGSTP1 – P10299 [Caenorhabditis elegans]; BmorGSTS – Q5CCJ4 [Bombyx mori]; HconGSTS – Q9NAW7 [Haemonchus contortus]; CeleGSTO – P34345 [Caenorhabditis elegans]; SmanGSTO – Q86LC0 [Schistosoma mansoni]; SpurGSTT1 – href ¼ ‘‘genbank:XP_790223’’>XP_790223.1 [Strongylocentrotus purpuratus]; DmelGSTT1 – P20432 [Drosophila melanogaster].

2464

E.J. LaCourse et al. / Environmental Pollution 157 (2009) 2459–2469

Fig. 2. L. rubellus GSH-affinity purified proteins directly analysed by electrospray ionisation (ESI) mass spectrometry. Direct ESI mass spectrometry of L. rubellus GSH-affinity purified proteins shows evidence of many potential subunits. Two subunits predominate in the ESI spectrum and are confirmed by the presence of two distinct bands of comparable masses (‘Higher molecular weight’ [Hmw] and ‘Lower molecular weight’ [Lmw]) when visualised via standard SDS-PAGE (inset), a ‘zoom-section’ of which is shown horizontally below the spectra.

(Branchiostoma) of recent molecular and genetic interest due to its cephalochordate group’s debated position as closest relatives of the craniate chordates (Hmw band peptide No. 14). As further sequences become available, these peptide fragments may yet be found to match currently unidentified and novel GSTs. Pi class LRP06119, and Sigma class LRP04659 GSTs dominated peptide retrieval, yielding seven and eight peptide hits respectively (Supplementary Table 2). Peptides unique to LRP04659 were evident, with overall coverage at 27% of the protein, positively supporting this Sigma GST’s presence. Pi GST LRP06119 was also positively identified via seven unique peptides covering 30% of the protein. Pi GST LRP06119 and Sigma GSTs LRP04659 and LRP01838 were found in both Hmw and Lmw SDS-PAGE bands. Interestingly, the dominating Pi GST LRP06119 is shown to be transcriptionally increased in adult L. rubellus following copper exposure (Bundy et al., 2008) whilst a similar Pi GST from L. rubellus (LRP02410) is also transcriptionally increased following fluoranthene exposure (Owen et al., 2008). Sigma GST LRP04659 also shows transcriptional increase detected via microarray following cadmium exposure (LumbriBase microarray data http://www. earthworms.org/). Transcriptional studies of Bundy et al. (2008) and Owen et al. (2008), upon L. rubellus also show GSTs of the soluble Omega and Alpha GST classes and microsomal GST class responding to copper, cadmium, fluoranthene and atrazine. GSTs of these classes were not however detected as protein within this study. However, this is probably due in part to; (1.) the poor ability of Omega GSTs to bind GSH-affinity matrices, (2.) the absence of microsomal GST-containing fractions within the sample used for

Fig. 3. Protein sequence coverage of L. rubellus GSTs from QToF MS/MS derived peptide sequencing to identify LRPs (01838, 02154, 04659, 06119) from the two molecular weight SDS-PAGE bands (Fig. 2.). Regions of matching sequence from MS/MS peptides are underlined in bold font with numbers and percentages of amino acid coverage identity shown. BLAST values are given from peptide searches against a local protein database of L. rubellus GSTs constructed from GSTs within the L. rubellus EST project database (LumbriBase http://xyala.cap.ed.ac.uk/Lumbribase/lumbribase_php/lumbribase.php Accessed 09/04/2005).

E.J. LaCourse et al. / Environmental Pollution 157 (2009) 2459–2469

2465

Fig. 4. 2-DE Sub-proteome of L. rubellus GSTs in selected earthworm tissues. Native GSTs purified by GSH-affinity chromatography from L. rubellus appear to suffer degradation under the conditions of 2-DE, as shown by the lower molecular weight protein spots that are absent from standard SDS-PAGE gels or ESI spectra (Fig. 2). Recombinant proteins of L. rubellus GSTs do not suffer instability under 2-DE conditions however (Fig. 6.). Reasons for apparent instability of L. rubellus native GSTs remains unclear to us at present. 50 mg of GSTs from whole worms and individual pooled tissues were profiled on 17 cm pH 3–10 IPG strips and 12.5% acrylamide SDS-PAGE 2-DE silver-stained gels. Numbers of spots typically present upon each gel for a specific tissue sample varied significantly within replicates due to apparent protein degradation during the 2-DE process; the reasons for which remain unknown. Numbers of spots present for the set of gels shown are; Crop & gizzard 14; Anterior gut 34; Posterior gut 28; Clitellum 10; Posterior body wall 22; Seminal vesicles 32; Anterior body wall 16; Whole worm 40. Individual spots did not reveal mass spectral peptide sequence due to low protein abundance. However, each sample was identified as glutathione transferase protein without the presence of detectable contamination from other proteins (via SDS-PAGE and ESI – Fig. 2) based upon concordance with observations of binding to a glutathione matrix, enzymatic activity with CDNB (model substrate for GSTs) and size upon SDS-PAGE and ESI. Whole worm GSTs were confirmed as such by QToF MS/MS from excised SDS-PAGE bands (Supplementary Table 2).

GSH-affinity here, and (3.) a possible low abundance of Alpha GST relative to other GSTs with regard to detection via the ‘shotgun’ digest methods for mass spectrometry used here. 3.3. 2-DE profiling of L. rubellus GSTs Despite the previously reported and unresolved activity and storage stability complications observed for GST enzymes (Stenersen and Oien, 1981; Stokke and Stenersen, 1993), native1 enzyme preparations in this study were stable for activity assays, SDS-PAGE, ESI and storage of enzymes at 80  C for at least six months (not checked after this time scale). However, native GSTs isolated from L. rubellus appeared to suffer varying degrees of instability under the 2-DE conditions used in this investigation for reasons unknown at present. Low molecular weight proteins on 2-DE gels (Fig. 4) are not present on SDS-PAGE or ESI of the same samples (Fig. 2), and so these 2-DE spots are presumed to be GSTs degraded by the 2-DE process. Prior to degradation, all sample bound GSH-agarose, displayed high GST activity and was of typical GST size on SDS-PAGE and ESI. QToF MS/MS of sample confirmed abundant GST peptides from SDS-PAGE bands (Supplementary Table 2). Identifications of 2-DE protein spots from tissues and whole worms via mass spectrometry was problematic, due largely to practical difficulties concerning low protein content and potential degradation. 2-DE displays of GSTs from a variety of invertebrate organisms including the nematode C. elegans and the trematode Fasciola hepatica are routinely profiled with apparent stability using 2-DE methods in our laboratory (Chemale et al., 2006; LaCourse et al., 2008). However, optimal conditions for stable 2-DE with GSHaffinity purified preparations of earthworm native GSTs were not realised here despite repeated efforts to modify procedures.

Distinguishing, but complex, 2-DE profiles were nevertheless produced between tissue types (Fig. 4.). Tissues of lower GST activity (clitellum, crop and gizzard) also displayed a relatively reduced spot number profile of GSH-affinity proteins with the exception of seminal vesicles that presented a 2-DE profile bearing some similarity to that of anterior gut and posterior body wall (Fig. 4). These latter two gut and body wall samples displayed an apparent wide range of GST forms that may again reflect a ‘first-line xenobiotic defence’ to diverse toxic assault, thus requiring a wider range of GST isoforms, compared to the clitellum, with perhaps a more focused role in reproduction mechanics. 3.4. Enzyme activity profiling of GST in L. rubellus tissues GST specific activity with GST model substrate CDNB was shown to have a tissue-specific enzymic activity pattern in L. rubellus (Fig. 5; Supplementary Table 3). Crop and gizzard, seminal vesicles and clitellum showed lowest GST activity levels, with recovery of GST in any tissues highest in seminal vesicles whilst poorest in clitellum. Highest GST activity was shown in posterior body wall and intestinal tissues. This high GST activity possibly reflects ‘general first-line detoxification’ responsibilities of the nephridia and the primitive ‘liver-like’ chloragogenous that surround the body wall and intestine respectively. These tissues are known to accumulate heavy metals, and also contain high levels of metallothioneines also linked to detoxification (Sturzenbaum et al., 2004; Morgan et al., 2004). Tissue-specificity of GST activity is also reported in other organisms, such as insects (Enayati et al., 2005) where the xenobiotic exposed fatbody and midgut have relatively high levels of GST activity. 3.5. Recombinant L. rubellus GST characterisation

1 ‘native’ in this study will refer to those proteins isolated from earthworms; so as to distinguish them from recombinant proteins expressed in E. coli.

In contrast to native L. rubellus GSTs, recombinant GSTs (Pi class LRP06119 & Sigma class LRP04659) were entirely stable under all

a

Total Activities of GST with CDNB within Specific Tissues of L. rubellus during GSH-affinity Purification. 18

Total activity (Units) {µmol product per min.}

16 14

Whole Sample Non-affinity Sample Purified GST Sample

12 10 8 6 4 2 0 Crop and Gizzard.

Anterior Gut.

Posterior Clitellum. Posterior Seminal Anterior Gut. body wall. Vesicles. body wall.

Whole worm.

Tissue Type. Percentage Yields of GST Gained from Specific Tissues of L. rubellus during GSH-affinity Purification.

b 100

Percentage yield of GST.

90

Non-affinity sample. GSH-affinity sample.

80 70 60 50 40 30 20 10 0 Crop and Gizzard.

Anterior Posterior Gut. Gut.

Clitellum.

Posterior Body Wall.

Seminal Vesicles.

Anterior Body Wall.

Whole Worm.

Tissue Type.

c

Glutathione Transferase Specific Activity Profiling of Tissue Specific Soluble Extracts of Lumbricus rubellus . 1.6

GST Activity with CDNB (µmol-1 min-1 mg-1 protein)

1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 Crop and gizzard

Anterior gut

Posterior gut

Clitellum

posterior body wall

Seminal vesicles

Anterior body wall

Whole worm

Tissue type. Fig. 5. GST specific enzymic activity profiling in L. rubellus earthworm tissues with the model xenobiotic CDNB. Error bars show þ/ standard deviation. For activity values, see Supplementary Table 3.

E.J. LaCourse et al. / Environmental Pollution 157 (2009) 2459–2469

procedures used in this study, including 2-DE (Fig. 6). It is therefore interesting to note that 2-DE-stable recombinant GSTs displayed modifications typical of proteins expressed in prokaryotic systems that are unlikely to reflect the true status of native GSTs (Fig. 6). Protein products with N-terminal methionines retained and removed were present, as were glutathionylated cysteine residues when viewed via ESI. 2-DE gels of recombinant forms were comparable to ESI results, bearing in mind cysteine residues would be carbamidomethylated in 2-DE as opposed to selectively glutathionylated, whilst oxidation of methionines would not be detected on 2-DE. Stability of the prokaryotic-modified recombinant GSTs may point to eukaryotic post-translational modifications of native GSTs within L. rubellus (and possibly other species of earthworms) allowing, upon unfolding within urea and/or zwitterionic detergents such as CHAPS, a form of auto-degradation and proteolysis. The nature of possible modifications however is yet to be resolved. Enzyme assay of the recombinant L. rubellus GSTs (Table 2) reveal Pi and Sigma GSTs (LRP06119 & LRP04659) to possess conjugation activity towards the reactive carbonyl, trans-2-nonenal; the Pi GST having six-fold higher activity than the Sigma GST. The Pi GST, but not the Sigma GST, is also active with another reactive carbonyl, 4-hydroxynonenal (4HNE), but does not show activity with the peroxide substrate cumene hydroperoxide, unlike

2467

the Sigma GST. C. elegans Pi and Sigma GSTs also show activity with 4HNE (Ayyadevara et al., 2007; Perally et al., 2008) whilst the Sigma GST in Drosophila (GTSS1-1) accounts for around two-thirds of 4HNE activity (Singh et al., 2001). In mammals, Alpha GSTs typically show high activity with 4HNE (Hubatsch et al., 1998), although mammalian Mu GSTs also show activity (Mannervik and Danielson, 1988). It would appear that the ability of GSTs to conjugate 4HNE is taxonomically widespread, not class specific and so may have arisen either early on in evolution of the GST family, or independently more than once following class divergence. Lipid peroxides and reactive carbonyls are produced following oxidative stress-induced peroxidation of cell membrane lipids, resulting in cellular damage. Earthworms encounter a wide range of such stress-inducing xenobiotics, plant and microorganism secondary metabolites in soil, as well as endogenous oxidative processes of normal metabolism. Therefore, earthworms will require mechanisms such as the GST Phase II detoxification system shown here, capable of targeting and adapting to a diverse range of toxic substrates, to protect against and limit cellular toxicity. Indeed, earthworm response to xenobiotics from across differing chemical classes including inorganic (cadmium, copper), organic (fluoranthene) and agrochemicals (atrazine) highlights several specifically responding GSTs including the Pi GST LRP06119 and

Fig. 6. Analysis of purity of recombinant L. rubellus GSTs LRP06119 and LRP04659, following purification by GSH-affinity chromatography and resolution by ESI and 2-DE.

2468

E.J. LaCourse et al. / Environmental Pollution 157 (2009) 2459–2469

Table 2 GST assays with various substrates and recombinant forms of the two major GSTs in L. rubellus; Sigma class LRP04659 and Pi class LRP06119. Specific activity (mmol min1 mg1)

Assay conditions Substrate 1-Chloro-2,4- dinitrobenzene (CDNB) 1,2-dichloro-4-nitrobenzene (DCNB) Ethacrynic acid 1,2-Epoxy-3- (p-nitrophenoxy) propane (EPNP) Cumene hydroperoxide Trans-4-phenyl-3-buten-2-one Trans-2-nonenal Trans, trans-2, 4-decadienal 4-hydroxynonenal

[Substrate] (mM)

[GSH] (mM)

100 mM KHPO4 (pH)

Temp ( C).

l Max

3

(nm)

(mM1 cm1)

1 1 0.08 0.08 1

1 5 0.25 1 5

6.5 7.5 6.5 6.5 7

25 25 25 25

340 345 270 270 360

0.064 0.05 0.023 0.023 0.1

1 0.25 1 1 0.5

6.5 6.5 6.5 6.5 6.5

25 25 25 25 30

340 290 225 280 224

Sigma GST LRP04659 characterised here (Bundy et al., 2008; Owen et al., 2008). In addition to the detoxification potential of GSTs towards a range of pollutants, including the peroxides and carbonyls, the L. rubellus Pi GST substrate 4HNE in particular has received much attention as a cellular signalling molecule (Awasthi et al., 2005). This suggests Pi GST regulation of intracellular concentrations of 4HNE may additionally serve to mediate a variety of downstream cellular functions. The different substrate affinity and activity profile indicates specific roles for these GSTs, whilst overlap in substrates and classes of substrate may suggest common involvement in similar pathways of response to stress. In line with other Pi class GSTs from vertebrate and invertebrate taxa (Mannervik and Danielson, 1988; Liebau et al., 1996) activity with ethacrynic acid, although moderate, was significantly higher with Pi GST LRP06119 than that displayed by Sigma GST LRP04659. In summary, the earthworm sentinel L. rubellus produces a range of GST proteins related to previously known GSTs from across taxa including plants, nematodes and humans, with evidence of tissue-specific isoforms, activity, location, the ability to detoxify products of cellular toxicity and potential response to pollution. Further investigation of L. rubellus GST complement may offer more exacting assays for individual earthworm exposures to terrestrial pollutants. Acknowledgments The authors acknowledge the support of NERC UK (Environmental Genomics Programme NER/T/S/2002/00021) for project grants to complete this work and the University of Wales for a PhD scholarship for EJLaC. The authors would also like to thank Dr. Jennifer Owen (Cardiff School of Biosciences) for kindly donating plasmids from the Lumbribase EST collection. Appendix. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.envpol.2009.03.015. References Alin, P., Danielson, U.H., Mannervik, B., 1985. 4-Hydroxyalk-2-enals are substrates for glutathione transferase. FEBS Lett. 179 (2), 267–270. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Aly, M.A., Schro¨der, P., 2008. Effect of herbicides on glutathione S-transferases in the earthworm, Eisenia fetida. Environ. Sci. Pollut. Res. Int. 15 (2), 143–149. Awasthi, Y.C., Ansari, G.A., Awasthi, S., 2005. Regulation of 4-hydroxynonenal mediated signaling by glutathione S-transferases. Methods Enzymol. 401, 379–407.

9.6 9.6 5 4.5 6.22 24.8 19.2 29.7 13.75

Pi LRP06119

Sigma LRP04659

3.534 (0.616) ND (<0.0005) 0.0890 (0.0018) 0.2510 (0.0096) ND (<0.0005)

1.882 (0.173) ND (<0.0005) 0.0060 (0.0006) 0.0102 (0.0013) ND (<0.0005)

ND (<0.0005) ND (<0.0005) 0.1687 (0.0536) ND (<0.0005) 0.134 (0.018)

0.1451 (0.0066) ND (<0.0005) 0.0274 (0.0084) ND (<0.0005) ND (<0.0005)

Ayyadevara, S., Dandapat, A., Singh, S.P., Siegel, E.R., Shmookler Reis, R.J., Zimniak, L., Zimniak, P., 2007. Life span and stress resistance of Caenorhabditis elegans are differentially affected by glutathione transferases metabolizing 4-hydroxynon2-enal. Mech. Ageing Dev. 128, 196–205. Beeby, A., 2001. What do sentinels stand for? Environ. Pollut. 112, 285–298. Board, P.G., Baker, R.T., Chelvanayagam, G., Jermiin, L.S., 1997. Zeta, a novel class of glutathione transferases in a range of species from plants to humans. Biochem. J. 328 (3), 929–935. Booth, L.H., Heppelthwaite, V., Mcglinchy, A., 2000. The effect of environmental parameters on growth, cholinesterase activity and glutathione S-transferase activity in the earthworm Apporectodea caliginosa. Biomarkers 5, 46–55. Borgeraas, J., Nilsen, K., Stenersen, J., 1996. Methods for purification of glutathione transferases in the earthworm genus Eisenia, and their characterization. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol. 114, 129–140. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilising the principle of protein dye-binding. Anal. Biochem. 72, 248–254. Brophy, P.M., Pritchard, D.I., 1992. Metabolism of lipid peroxidation products by the gastro-intestinal nematodes Necator americanus, Ancylostoma ceylanicum and Heligmosomoides polygyrus. Int. J. Parasitol. 7, 1009–1012. Bundy, J.G., Sidhu, J.K., Rana, F., Spurgeon, D.J., Svendsen, C., Wren, J.F., Stu¨rzenbaum, S.R., Morgan, A.J., Kille, P., 2008. ‘Systems toxicology’ approach identifies coordinated metabolic responses to copper in a terrestrial non-model invertebrate, the earthworm Lumbricus rubellus. BMC Biol. 6, 25. Campbell, A.M., Teesdale-Spittle, P.H., Barrett, J., Liebau, E., Jefferies, J.R., Brophy, P.M., 2001. A common class of nematode glutathione S-transferase GST revealed by the theoretical proteome of the model organism Caenorhabditis elegans. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 128 (4), 701–708. Chelvanayagam, G., Parker, M.W., Board, P.G., 2001. Fly fishing for GSTs: a unified nomenclature for mammalian and insect glutathione transferases. Chem. Biol. Interact. 133, 256–260. Chemale, G., Morphew, R., Moxon, J.V., Morassuti, A.L., LaCourse, E.J., Barrett, J., Johnston, D.A., Brophy, P.M., 2006. Proteomic analysis of glutathione transferases from the liver fluke parasite, Fasciola hepatica. Proteomics 6 (23), 6263–6273. De Coen, W.M., Janssen, C.R., 2003. A multivariate biomarker-based model predicting population-level responses of Daphnia magna. Environ. Toxicol. Chem. 22, 2195–2201. Edwards, Bater, J.E., 1992. The use of earthworms in environmental management. Soil Biol. Biochem. 24, 1683–1689. Edwards, R., Dixon, D.P., Walbotm, V., 2000. Plant glutathione S-transferases, enzymes with multiple functions in sickness and in health. Trends Plant Sci. 5, 193–198. Enayati, A.A., Ranson, H., Hemingway, J., 2005. Insect glutathione transferases and insecticide resistance. Insect Mol. Biol. 14, 3–8. Galay-Burgos, M., Spurgeon, D.J., Weeks, J.M., Sturzenbaum, S.R., Morgan, A.J., Kille, P., 2003. Developing a new method for soil pollution monitoring using molecular genetic biomarkers. Biomarkers 8, 229–239. Go¨rg, A., Postel, W., Gunther, S., 1988. The current state of two-dimensional electrophoresis with immobilized pH gradients. Electrophoresis 9, 531–546. Habig, W.H., Jakoby, W.B., 1981. Assays for differentiation of glutathione S-transferases. Methods Enzymol. 77, 398–405. Habig, W.H., Pabst, M.J., Jakoby, W.B., 1974. Glutathione S-transferases – the first enzymatic step in mercapturic acid formation. J. Biol. Chem. 249, 7130–7139. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Hayes, J.D., Flanagan, J.U., Jowsey, I.R., 2005. Glutathione transferases. Annu. Rev. Pharmacol. Toxicol. 45, 51–88. Horton, P., Nakai, K., 1997. Better prediction of protein cellular localization sites with the k nearest neighbors classifier. Proc. Int. Conf. Intell. Syst. Mol. Biol. 5, 147–152. Hubatsch, I., Ridderstrom, M., Mannervik, B., 1998. Human glutathione transferase A4-4: an alpha class enzyme with high catalytic efficiency in the conjugation of

E.J. LaCourse et al. / Environmental Pollution 157 (2009) 2459–2469 4-hydroxynonenal and other genotoxic products of lipid peroxidation. Biochem. J. 330, 175–179. Hund-Rinke, K., Wiechering, H., 2001. Earthworm avoidance test for soil assessment. J. Soils Sediments 1, 15–20. Jaffe, J.J., Lambert, R.A., 1986. Glutathione S-transferase in adult Dirofilaria immitis and Brugia pahangi. Mol. Biochem. Parasitol. 20, 199–206. Jakobsson, P.J., Morgenstern, R., Mancini, J., Ford-Hutchinson, A., Persson, B., 1999. Common structural features of MAPEG – a widespread superfamily of membrane associated proteins with highly divergent functions in eicosanoid and glutathione metabolism. Protein Sci. 3, 689–692. Kim, D.H., Guengerich, F.P., 1990. Formation of the DNA adduct S-[2-(N7-guanyl) ethyl]glutathione from ethylene dibromide: effects of modulation of glutathione and glutathione S-transferase levels and lack of a role for sulfation. Carcinogenesis 11 (3), 419–424. LaCourse, E.J., Perally, S., Hernandez-Viadel, M., Wright, H.A., Brophy, P.M., 2008. A proteomics approach to quantify protein levels following RNA interference: case study with glutathione transferase superfamily from the model metazoan Caenorhabditis elegans. J. Proteome Res. 7 (8), 3314–3318. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 (5259), 680–685. qaszczyca, P., Augustyniak, M., Babczyn´ska, A., Bednarska, K., Kafel, A., Migula, P., Wilczek, G., Witas, I., 2004. Profiles of enzymatic activity in earthworms from zinc, lead and cadmium polluted areas near Olkusz (Poland). Environ. Int. 30 (7), 901–910. Lee, M.S., Cho, S.J., Tak, E.S., Lee, J.A., Cho, H.J., Park, B.J., Shin, C., Kim, D.K., Park, S.C., 2005. Transcriptome analysis in the midgut of the earthworm Eisenia andrei using expressed sequence tags. Biochem. Biophys. Res. Commun. 328 (4), 1196– 1204. Leiers, B., Kampko¨tter, A., Grevelding, C.G., Link, C.D., Johnson, T.E., Henkle-Du¨hrsen, K., 2003. A stress-responsive glutathione S-transferase confers resistance to oxidative stress in Caenorhabditis elegans. Free Radic. Biol. Med. 34 (11), 1405–1415. Liebau, E., Wildenburg, G., Brophy, P.M., Walter, R.D., Henkle-Du¨hrsen, K., 1996. Biochemical analysis, gene structure and localization of the 24 kDa glutathione S-transferase from Onchocerca volvulus. Mol. Biochem. Parasitol. 80 (1), 27–39. Linsenmeyer, M.E., Jefferson, S., Wolf, M., Matthews, J.P., Board, P.G., Woodcock, D.M., 1992. Levels of expression of the mdr1 gene and glutathione S-transferase genes 2 and 3 and response to chemotherapy in multiple myeloma. Br. J. Cancer 65, 471–475. Lukkari, T., Taavitsainen, M., Soimasuo, M., Oikari, A., Haimi, J., 2004. Biomarker responses of the earthworm Aporrectodea tuberculata to copper and zinc exposure, differences between populations with and without earlier metal exposure. Environ. Pollut. 129, 377–386. Maity, S., Roy, S., Chaudhury, S., Bhattacharya, S., 2008. Antioxidant responses of the earthworm Lampito mauritii exposed to Pb and Zn contaminated soil. Environ. Pollut. 151 (1), 1–7. Mannervik, B., Danielson, U.H., 1988. Glutathione transferases: structure and catalytic activity. CRC Crit. Rev. Biochem. 23, 283–337. Morgan, J.E., Morgan, A.J., 1999. The accumulation of metals (Cd, Cu, Pb, Zn and Ca) by two ecologically contrasting earthworm species (Lumbricus rubellus and Aporrectodea caliginosa): implications for ecotoxicological testing. Appl. Soil Ecol. 13, 9–20. Morgan, A.J., Stu¨rzenbaum, S.R., Winters, C., Grime, G.W., Aziz, N.A., Kille, P., 2004. Differential metallothionein expression in earthworm (Lumbricus rubellus) tissues. Ecotoxicol. Environ. Saf. 57 (1), 11–19. Nadeau, D., Corneau, S., Plante, I., Morrow, G., Tanguay, R.M., 2001. Evaluation for Hsp70 as a biomarker of effect of pollutants on the earthworm Lumbricus terrestris. Cell Stress Chaperones 6, 153–163. Nicholson, D.W., Ali, A., Vaillancourt, J.P., Calaycay, J.R., Mumford, R.A., Zamboni, R.J., Ford-Hutchinson, A.W., 1993. Purification to homogeneity and the N-terminal sequence of human leukotriene C4 synthase: a homodimeric glutathione S-transferase composed of 18-kDa subunits. Proc. Natl. Acad. Sci. U.S.A. 90 (5), 2015–2019. Owen, J., Hedley, B.A., Svendsen, C., Wren, J., Jonker, M.J., Hankard, P.K., Lister, L.J., Stu¨rzenbaum, S.R., Morgan, A.J., Spurgeon, D.J., Blaxter, M.L., Kille, P., 2008. Transcriptome profiling of developmental and xenobiotic responses in a keystone soil animal, the oligochaete annelid Lumbricus rubellus. BMC Genomics 9, 266. Page, R.D.M., 1996. TREEVIEW: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12, 357–358. Perally, S., LaCourse, E.J., Campbell, A.M., Brophy, P.M., Aug 23 2008. Heme transport and detoxification in nematodes: subproteomics evidence of differential role of glutathione transferases. J. Proteome Res. [Epub ahead of print]. Ranson, H., Rossiter, L., Ortelli, F., Jensen, B., Wang, X., Roth, C.W., Collins, F.H., Hemingway, J., 2001. Identification of a novel class of insect glutathione S-transferases involved in resistance to DDT in the malaria vector Anopheles gambiae. Biochem. J. 359 (2), 295–304. Ricketts, H.J., Morgan, A.J., Spurgeon, D.J., Kille, P., 2004. Measurement of annetocin gene expression: a new reproductive biomarker in earthworm ecotoxicology. Ecotoxicol. Environ. Saf. 57, 4–10.

2469

Saint-Denis, M., Narbonne, J.F., Arnaud, C., Ribera, D., 2001. Biochemical responses of the earthworm Eisenia fetida andrei exposed to contaminated artificial soil, effects of lead acetate. Soil Biol. Biochem. 33 (3), 395–404. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4 (4), 406–425. Salinas, A.E., Wong, M.G., 1999. Glutathione S-transferases – a review. Curr. Med. Chem. 4, 279–309. Sanchez-Hernandez, J.C., 2006. Earthworm biomarkers in ecological risk assessment. Rev. Environ. Contam. Toxicol. 188, 85–126. Sauve, S., Hendawi, M., Brousseau, P., Fournier, M., 2002. Phagocytic response of terrestrial and aquatic invertebrates following in vitro exposure to trace elements. Ecotoxicol. Environ. Saf. 52, 21–29. Scott-Fordsmand, J.J., Weeks, J.M., 2000. Biomarkers in earthworms. Rev. Environ. Contam. Toxicol. 165, 117–159. Scott-Fordsmand, J.J., Van Gestel, C.A., Weeks, J.M., 2004. Third international workshop on earthworm ecotoxicology: ecological, physiological, and physicochemical factors in earthworm ecotoxicology. Ecotoxicol. Environ. Saf. 57, 1–3. Sheehan, D., Meade, G., Foley, V.M., Dowd, C.A., 2001. Structure function and evolution of glutathione transferases: implications for classification of non-mammalian members of an ancient enzyme superfamily. Biochem. J. 360 (1), 1–16. Shevchenko, A., Wilm, M., Vorm, O., Mann, M., 1996. Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem. 68 (5), 850–858. Simons, P.C., Vander Jagt, D.L., 1977. Purification of glutathione S-transferase from human liver by glutathione affinity chromatography. Anal. Biochem. 82, 334–341. Simonsen, V., Scott-Fordsmand, J.J., 2004. Genetic variation in the enzyme esterase, bioaccumulation and life history traits in the earthworm Lumbricus rubellus from a metal contaminated area, Avonmouth, England. Ecotoxicology 13, 773–786. Sims, R.W., Gerrard, B.M. (Eds.), 1985. Earthworms. Linnean Society, London, UK. Singh, S.P., Coronella, J.A., Benesˇ, H., Cochrane, B.J., Zimniak, P., 2001. Catalytic function of Drosophila melanogaster glutathione S-transferase DmGSTS1-1 (GST-2) in conjugation of lipid peroxidation end products. Eur. J. Biochem. 268, 2912–2923. Spurgeon, D.J., Svendsen, C., Weeks, J.M., Hankard, P.K., Stubberud, H.E., Kammenga, J.E., 2003. Quantifying copper and cadmium impacts on intrinsic rate of population increase in the terrestrial oligochaete Lumbricus rubellus. Environ. Toxicol. Chem. 22 (7), 1465–1472. Spurgeon, D.J., Sturzenbaum, S.R., Svendsen, C., Hankard, P.K., Morgan, A.J., Weeks, J.M., Kille, P., 2004. Toxicological, cellular and gene expression responses in earthworms exposed to copper and cadmium. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 138 (1), 11–21. Stenersen, J., Oien, N., 1981. Glutathione S-transferases in earthworms Lumbricidae. Substrate specificity, tissue and species distribution and molecular weight. Comp. Biochem. Physiol. C 69 (2), 243–252. Stokke, K., Stenersen, J., 1993. Non-inducibility of the glutathione transferases of the earthworm Eisenia andrei. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol. 106, 753–756. Sturzenbaum, S.R., Kille, P., Morgan, A.J., 1998. Identification of heavy metal induced changes in the expression patterns of the translationally controlled tumour protein (TCTP) in the earthworm Lumbricus rubellus. Biochim. Biophys. Acta 1398, 294–304. Sturzenbaum, S.R., Georgiev, O., Morgan, A.J., Kille, P., 2004. Cadmium detoxification in earthworms: from genes to cells. Environ. Sci. Technol. 38, 6283–6289. Svendsen, C., Spurgeon, D.J., Hankard, P.K., Weeks, J.M., 2004. A review of lysosomal membrane stability measured by neutral red retention: is it a workable earthworm biomarker? Ecotoxicol. Environ. Saf. 57, 20–29. Tew, K.D., 1994. Glutathione-associated enzymes in anticancer drug resistance. Cancer Res. 54, 4313–4320. Tew, K.D., Ronai, Z., 1999. GST function in drug and stress response. Drug Resist. Updat. 3, 143–147. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W, improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22 (22), 4673–4680. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Tu, C.P., Akgu¨l, B., 2005. Drosophila glutathione S-transferases. Methods Enzymol. 401, 204–226. USEPA, 2000. Ecological Soil Screening Level Guidance. Office of Emergency and Remedial Response. U.S. Environmental Protection Agency, Washington, DC. Ujihara, M., Tsuchida, S., Satoh, K., Sato, K., Urade, Y., 1988. Biochemical and immunological demonstration of prostaglandin D2, E2, and F2 alpha formation from prostaglandin H2 by various rat glutathione S-transferase isozymes. Arch. Biochem. Biophys. 264 (2), 428–437. Waxman, D.J., 1990. Glutathione S-transferases, role in alkylating agent resistance and possible target for modulation chemotherapy-a review. Cancer Res. 50, 6449–6454. Wilce, M.C., Parker, M.W., 1994. Structure and function of glutathione S-transferases. Biochim. Biophys. Acta 1205 (1), 1–18.