Gly126Arg substitution causes anomalous behaviour of α-skeletal and β-smooth tropomyosins during the ATPase cycle

YABBI 6589

No. of Pages 10, Model 5G

2 January 2014 Archives of Biochemistry and Biophysics xxx (2014) xxx–xxx 1

Contents lists available at ScienceDirect

Archives of Biochemistry and Biophysics journal homepage: www.elsevier.com/locate/yabbi 5 6

Gly126Arg substitution causes anomalous behaviour of a-skeletal and b-smooth tropomyosins during the ATPase cycle

3 4 7 8 9 10 11 12 13 14 1 9 6 2 17 18 19 20 21 22 23 24 25 26 27 28

Q1

Nikita A. Rysev a, Ilya A. Nevzorov d, Stanislava V. Avrova a, Olga E. Karpicheva a, Charles S. Redwood c, Dmitrii I. Levitsky b, Yurii S. Borovikov a,⇑ a

Laboratory of Mechanisms of Cell Motility, Institute of Cytology, Russian Academy of Sciences, 4 Tikhoretsky Avenue, St. Petersburg 194064, Russia A.N. Bach Institute of Biochemistry, Russian Academy of Sciences, Moscow 119071, Russia Department of Cardiovascular Medicine, University of Oxford, John Radcliffe Hospital, Oxford OX3 9DU, UK d Institute of Biotechnology, University of Helsinki, Viikinkaari 9, 00014 Helsinki, Finland b c

a r t i c l e

i n f o

Article history: Received 16 July 2013 and in revised form 13 December 2013 Available online xxxx Keywords: Tropomyosin Troponin F-actin Myosin Ghost muscle fibers Fluorescence polarization

a b s t r a c t To investigate how TM stabilization induced by the Gly126Arg mutation in skeletal a-TM or in smooth muscle b-TM affects the flexibility of TMs and their position on troponin-free thin filaments, we labelled the recombinant wild type and mutant TMs with 5-IAF and F-actin with FITC-phalloidin, incorporated them into ghost muscle fibres and studied polarized fluorescence at different stages of the ATPase cycle. It has been shown that in the myosin-and troponin-free filaments the Gly126Arg mutation causes a shift of TM strands towards the outer domain of actin, reduces the number of switched on actin monomers and decreases and increases the rigidity of the C- and N-termini of a- and b-TMs, respectively. The binding of myosin subfragment-1 to the filaments shifted the wild type TMs towards the inner domain of actin, decreased the flexibility of both terminal parts of TMs, and increased the number of switched on actin monomers. Multistep alterations in the position of a- and b-TMs and actin monomers in the filaments and in the flexibility of TMs and F-actin during the ATPase cycle were observed. The Gly126Arg mutation uncouples a correlation between the position of TM and the number of the switched on actin monomers in the filaments. Ó 2013 Published by Elsevier Inc.

30 31 32 33 34 35 36 37 38 39 40 41 42 43 44

45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62

Introduction Muscle contraction results from the ATP-powered cyclic interaction between myosin heads protruding from the thick filaments and actin subunits in the thin filaments, causing the thick and thin filaments to slide past each other (for a review, see [1,2]). Previous studies have shown that tropomyosin (TM1) wraps around the thin filaments and is located in a position to influence the actin–myosin interaction. It has been suggested that TM can regulate this interaction by moving from a position where it blocks the actin–myosin interaction to the one where it allows myosin head binding to F-actin. According to this hypothesis, actin exists in two states: that of blocking myosin binding and open to it. The reduction in binding of S1 to actin by tropomyosin directly results in decreased ATPase activity (for a review, see [3]). However, subsequent biochemical and structural studies have shown that the mechanism of regulation of the actin–myosin interaction is more complicated (for a review, see [2,4]). ⇑ Corresponding author. Fax: +7 812 2970341. E-mail address: [email protected] (Y.S. Borovikov). 1 Abbreviations used: TM, tropomyosin; WT-TM, wild type tropomyosin; TN, troponin; S1, myosin subfragment 1; FITC-phalloidin, fluorescein phalloidin; 5-IAF, 5-iodoacetamidofluorescein; DTT, dithiothreitol.

According to current views, regulation of striated muscle contraction involves changes that occur in the co-operative system consisting of myosin, actin, troponin and tropomyosin. A threestate allosteric model was proposed to describe this process, where S1 and Ca2+ are allosteric effectors of tropomyosin [5–9]. In the absence of Ca2+, troponin constrains TM, which occupies a position on the outer domain of actin that sterically inhibits the binding of myosin cross-bridges to actin (‘‘blocked position’’) and, consequently, the ATPase and filament sliding. Ca2+ binding to troponin shifts TM strands towards the inner domain of actin, exposing most of the myosin-binding sites [6–9]. However, TM still covers a part of the myosin-binding site (‘‘closed position’’). Only when myosin head attaches to the actin filament, TM moves to the inner domain of actin and fully exposes the myosin binding site on actin (‘‘open position’’) [9,10]. These three structural states are in rapid equilibrium with each other [11], so that in each condition there is a distribution of states [12]. Also, a significant role of the conformational changes of actin in this regulation was revealed ([13–15] for see, for example). It was suggested that for each TM position there was a particular ratio of monomers in two states – the so-called ‘‘switched on’’ and ‘‘switched off’’ states, which differ in monomer orientation relative to the filament axis [14,15]. The switched on monomers are able,

0003-9861/$ - see front matter Ó 2013 Published by Elsevier Inc. http://dx.doi.org/10.1016/j.abb.2013.12.016

Please cite this article in press as: N.A. Rysev et al., Arch. Biochem. Biophys. (2014), http://dx.doi.org/10.1016/j.abb.2013.12.016

63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85

YABBI 6589

No. of Pages 10, Model 5G

2 January 2014 2

N.A. Rysev et al. / Archives of Biochemistry and Biophysics xxx (2014) xxx–xxx

144

whereas the switched off monomers are unable, to activate the ATPase, i.e. actin monomers may be in the so-called ‘‘active/inactive’’ functional states (for a review, see [2,4,16]). Electron microscopy and molecular dynamics simulations show that TM is a semirigid structure which is stiff enough to move across the surface of actin as a unit when perturbed mechanically by other actin-binding proteins such as myosin [17–22]. TM is a two-chain a-helical coiled coil whose periodic interactions with the F-actin helix are critical for thin filament stabilization and the regulation of muscle contraction. Like all coiled-coils, each a-helical chain of TM displays a seven amino acid long ‘‘heptad’’ periodicity required to build the characteristic ‘‘knobs into holes’’ structure at the interface between the two adjoining a-helices [24]. In this pattern, the residues in the heptad repeat are labeled a–g. The a and d residues are hydrophobic and pack at the interface, while the e and g residues are oppositely charged and stabilize the coiled coil through interchain electrostatic interactions. Residues in the b, c and f positions are available for binding to other proteins [25]. Several non-canonical residues (e.g. Asp-137, Tyr-214, Glu-218, Tyr-221, Gln-263, Tyr-267 and Gly126) as well as Ala, Ser, and other polar and charged residues in the interface of TM can destabilize the molecule at these points [26,27]. For example, Gly126 in the g position may perturb coiled-coil structure by disrupting the a-helical structure and inter-chain salt bridge. Recently it has been shown that, like in the case with the Leu substitution at Asp 137, the mutation of Gly 126 to Ala or Arg also dramatically reduces proteolytic susceptibility at Arg-133 in both smooth and skeletal muscle TMs, increase the stabilization of the middle part of the TM molecule and ATPase activity [28]. This article presents the first study that aims to examine the effect of substitution of Gly126 with an Arg residue in skeletal a-TM or in smooth muscle b-TM on the position and flexibility of C- and N-termini of TMs on the troponin-free thin filament at different stages of the ATPase cycle using polarized fluorimetry, a technique we have previously used to study mutant TMs [29–31]. In the myosin- and troponin-free filaments both mutant TMs are found to be shifted further towards the periphery of the filaments, with the flexibility of the C-terminus of a-TM increasing and the flexibility of the N-terminus of b-TM decreasing. The binding of S1 to F-actin moves the wild-type TMs towards the center of the filaments (towards the ‘‘open position’’), which results in decreased flexibility of the C-terminus of a-TM and N-terminus of b-TM and a pronounced rotation of actin monomers to the periphery of the filaments. The latter indicates an increase in the number of switched on actin monomers. The Gly126Arg mutation alters the effect of S1binding by shifting a- and b-TM strands further to the inner domain of actin, increases the flexibility of both TMs and increases the number of switched on monomers in experiments with a-skeletal TMs while leaving the number of switched on monomers in experiments with b-TMs unchanged. Multistep alterations in the position of a- and b-TMs and flexibility of TMs and F-actin during the ATPase cycle were observed. The position and flexibility of TM and orientation of actin monomers depend on the intermediate S1 state, the Gly126Arg mutation and TM isoforms. We suggest that the observed increased ATPase activity induced by substitution of Gly126 with an Arg in TM [28] may result from the uncoupling of correlation between the position of TM and the number of switched on monomers during the ATPase cycle.

145

Materials and methods

146

Preparation of proteins

147

All of the TMs used in this work were recombinant human proteins that have Ala-Ser N-terminal extension [32] to imitate

86 87 88 89 90 91 92 93 94 95

96 97 98 99 100 101 102 103 104 105 106 107 108 109

110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143

148

naturally occurring N-terminal acetylation of native TM. The wile-type (WT) and mutant TMs were prepared in the bacterial expression plasmid pMW172 [33] by PCR-mediated site-directed mutagenesis using AccuPrimeTM Pfx DNA Polymerase (Invitrogen). The oligonucleotides used for mutagenesis for Gly126Arg were: GAGTGAGAGACGCATGAAAG (mutant codon is underlined). The PCR products were cloned and sequenced to verify the substitutions. The pMW172 constructs were used to transform the Escherichia coli strain BL21(DE3)pLysS, and large scale cultures were grown, and overexpression was induced according to standard methods [34]. Bacterial cell lysates containing recombinant AlaSer TMs were heated to 85 °C before clarification by centrifugation at 33,200g for 10 min. The resulting supernatant was fractionated by reducing the pH to 4.8, and the recombinant protein was purified by anion exchange chromatography. The mutant TM was purified by the same method as was used for the wild-type protein. TM concentration was determined using BCA Protein Assay (Thermo Scientific). Labelling of TM with 5-iodoacetamide fluorescein (5-IAF) at Cys190 or Cys36 was performed as previously described giving probe to protein ratio 0.8:1 [35]. Myosin subfragment-1 (S1) was prepared by treatment of skeletal muscle myosin with a-chymotrypsin for 10 min at 25 °C [36]. Purity of the protein preparations, as well as the composition of the fibres after washing out of the unbound proteins, was monitored by SDS–PAGE. Protein concentrations were determined by measuring UV absorbance.

149

Preparation and labeling of ghost fibers

175

Glycerinated muscle fibers were obtained from rabbit psoas muscles by the method of Szent-Gyorgyi [37]. Ghost fibers were prepared by incubation of single glycerinated fibers for 1.5 h in the solution containing 800 mM KCl, 1 mM MgCl2, 10 mM ATP, 67 mM phosphate buffer, pH 7.0, as described earlier [14,29]. The resultant ghost fibers were composed of actin by more than 80%. S1 and TM were incorporated into pure F-actin filaments by incubation of the fibers in the solution containing 50 mM KCl, 3 mM MgCl2, 1 mM DTT, 10 mM Tris–HCl, pH 6.8, and 1.0– 2.5 mg/ml protein. The order of the incorporation of proteins into the ghost fibers was as follows: TM, S1. The unbound proteins were washed out by incubation of the fibers in the same buffer without proteins. FITC-phalloidin was tightly bound to F-actin of the fibres by their incubation in a solution containing 6.7 mM phosphate buffer (pH 7.0), 50 mM KCl, 3 mM MgCl2 and 40 lM FITC-phalloidin for 2.5 h at room temperature [39]. The effectiveness of the reconstitution of filaments in ghost muscle fibres used for fluorescent measurements was verified by examining the protein content by SDS–PAGE with subsequent densitometry of the gels (UltroScan XL, Pharmacia LKB). The fibres in the final preparations contained actin, myosin subfragment-1, recombinant TM and Z-line proteins. The molar ratio of TM to actin was 1:6.5 (±2) irrespective of whether these proteins were modified by 5-IAF or not. In the absence of the nucleotides and in the presence of ADP, AMP-PNP, ATPcS, and ATP the molar ratio of S1 to actin was 1:5 (±2), 1:5 (±2), 1:8 (±2), 1:12 (±2), and 1:14 (±2), respectively.

176

Fluorescence polarization measurement

203

Steady-state fluorescence polarization measurements on single ghost muscle fibres were made using a flow-through chamber and photometer [39]. The polarized fluorescence from IAF-labelled TM and FITC-labelled actin was recorded at 500–600 nm after excitation at 489 ± 5 nm. Probes in ghost fibres were excited by a 250 W mercury lamp DRSH-250. The exciting light was passed through a quartz lens and a double monochromator, and split into

204

Please cite this article in press as: N.A. Rysev et al., Arch. Biochem. Biophys. (2014), http://dx.doi.org/10.1016/j.abb.2013.12.016

150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174

177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202

205 206 207 208 209 210

YABBI 6589

No. of Pages 10, Model 5G

2 January 2014 N.A. Rysev et al. / Archives of Biochemistry and Biophysics xxx (2014) xxx–xxx 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276

two polarized beams by a polarizing prism. The ordinary polarized beam was reflected at the dichroic mirror and was condensed by a quartz objective (UV 58/0.80) on a fiber in the cell on the microscope stage. The emitted light from the fibre was collected by the objective and led to a concave mirror with a small hole. After passing through lens and a barrier filter, the beam was separated by a Wollaston prism into polarized beams perpendicular and parallel to the fibres axis. The intensities of four components of polarized fluorescence ||I||, ||I\, \I\ and \I|| were detected by two photomultiplier tubes. The subscripts || and \ designate the direction of polarization parallel and perpendicular to the fiber axis, the former denoting the direction of polarization of the incident and the latter that of the emitted light. Fluorescence polarization ratios were defined as: P|| = (||I|| ||I\)/(||I|| + ||I\) and P\ = (\I\ \I||)/(\I\ + \I||). The most significant systematic errors in measuring polarization of fluorescence are caused by the depolarization of exciting and emitted light arising from the dichroic mirror, the high numerical aperture of the objective [40], and photobleaching [41]. Since the objective aperture was 0.80, the depolarization of the exciting light is neglected [42]. Photobleaching was minimal because the light intensity was low (typically 0.1 mW) and all solutions contained 0.1% b-mercaptoethanol. We corrected for the dichroic mirror using a solution of free fluorescent dyes where ||I|| = ||I\ = \I\ = \I||. An instrumental correction was used to satisfy this condition. Nonspecific covalent probes can also cause marked fluorescence depolarization. Here, TM was modified specifically by 5-IAF before incorporation into ghost fibre and FITC-phalloidin binds only to F-actin, which excludes the modification of other proteins [15,39]. Measurements were carried out in solutions containing 1 mM DTT, 6.7 mM phosphate buffer, pH 7.0, in the absence or presence of 2.5 mM ADP, 16 mM AMP-PNP or 5 mM ATP. The concentration of MgCl2 was 3 mM both in the absence and presence of ADP. In the presence of ATP and AMP-PNP, MgCl2 concentration was 8 and 18 mM [15,43], respectively. Solutions containing ATP also contained 1 mg/ml creatine phosphokinase (100–200 units/mg activity). All solutions were made up at room temperature (20 °C) and brought to the ionic strength 75 mM. The fluorescence polarization ratios can be used to assess qualitatively the distribution of the fluorescent probe orientations with respect to the muscle fiber axis as follows: If P|| = P\, then the probes are either oriented at 54.7° with respect to the muscle fiber axis or isotropically disordered; if P\ < P||, then the average angle between the probe dipole and muscle fiber axis is less than the magic angle (54.7°); if P\ > P||, then the average angle between the probe dipole and muscle fiber axis is greater than 54.7°. To quantitatively assess changes in the probe orientation, we used the ‘‘helix plus isotropic model’’ [44]. In this model, it is assumed that there are two populations of probes in the fiber: N probes with a disordered orientation and (1 N) probes with an ordered orientation. The axes of dipoles of the ordered probes are arranged in a spiral along the surface of the cone, the axis of which coincides with the long axis of actin filament. The dipoles of fluorescence absorption and emission form the angles UA and UE, respectively, at the top of the cone. The angle between the axes of the dipoles of absorption and emission is constant for the probe; it was close to 14° (for FITC-phalloidin-actin) and 17° (for IAF-TM). The thin filament is flexible and can deviate from the fibre axis by the maximal angle h1/2. According to the theory of a semiflexible filament, the average value of sin2h in terminal bending motion is related to elastic modulus for bending e. For a filament length L with one end fixed and the other end free, sin2h = 0.87(kT/e)L. Thus, the elastic modulus (or flexural rigidity, e) can be estimated from sin2h [45]. Since a probe upon its attachment to a protein molecule can become available for a solvent as well as affected by adjacent amino

3

acid residues, the orientation and mobility of absorption and emission dipoles of the probe may be also sensitive to a change in its local environment. The information about such changes can be obtained by analyzing the fluorescent spectrum of the probes. In our work, we measured the position of the fluorescence spectrum maximum in all the experiments with an accuracy of 0.3 nm, and did not find any reliable shifts of the spectrum of the proteins modified by 5-IAF and FITC-phalloidin. Based on these data was the suggestion that the changes in polarized fluorescence registered in our experiments reflected mainly the changes in orientation and mobility of the absorption and emission dipoles of the probes. In all experiments the pattern of UE changes was similar to that of UA changes, therefore only UE and e values were presented in the figures. The statistical reliability of the changes was evaluated using Student’s t-test.

277

Results and discussion

292

It is known that tropomyosin is a coiled-coil protein that assembles head-to-tail to form continuous strands that run along the entire length of F-actin and have the ability to shift azimuthally around actin filaments in a Ca2+- and nucleotide-dependent manner in response to S1 and/or troponin binding to actin [15,46]. While TM changes its structure and position in the thin filaments, F-actin also undergoes spatial rearrangement depending on S1, nucleotides and Ca2+ [15]. Therefore, to understand how the substitution of Gly126 with Arg in a-skeletal or b-smooth TMs alters the mechanism of regulation of the actin–myosin interaction by TM, it is necessary to know how this mutation changes the spatial arrangement of both the TM strands and F-actin in the same filaments. In order to study the myosin-induced movement of the wildtype (WT) and mutant TMs across the filaments we used a specially developed model – a system of the troponin-free filaments reconstituted in the ghost fibres from F-actin, TM, and S1, and mimicked several steps of ATP hydrolysis either by the presence of MgADP, MgAMP-PNP or MgATP or by the absence of nucleotides in the solution in which the fibre was immersed [47,48]. The absence of nucleotides simulated the AM state of the actomyosin complex; MgADP, MgAMP-PNP, and MgATP were used for mimicking intermediate states of actomyosin, AM^
ADP, AM⁄
ADP and AM⁄⁄
ADP
Pi, respectively, where A is actin and M, M⁄, M⁄⁄ and M^ are various conformational states of the myosin head. TM and F-actin were labelled with fluorescent dyes: 5-IAF was covalently linked to Cys190 of a-skeletal and to Cys36 of b-smooth TMs [15,49], and FITC-phalloidin was bound to F-actin in the region of actin groove [50], which allowed to determine the changes in flexibility and spatial arrangement of TM strands [15,29–31] and actin subunits in the filaments [38,39,51–53]. 5-IAF-labelled TM showed no pronounced difference in functional properties from unmodified TM [35]. It is known that phalloidin increases the stiffness of the actin filament [54]. The effect of phalloidin on the ATPase activity of the actin-activated skeletal muscle myosin was studied by Dancker and co-workers [55] on isolated actomyosin and by Bukatina and Fuchs [56] on myofibrils. The first group of researchers found no effect of phalloidin, while the second one reported a Ca2+-dependent increase in the ATPase activity. With 50 lM phalloidin added, the maximal increase of 25% was observed at pCa 8, while at pCa 4 there was no increase in the ATPase activity [56]. Taking into account that the increase in ATPase activity remains constant for skeletal muscle in the range of pCa from 4.0 to 5.5, one can conclude that no effect of phalloidin was found by these authors under their experimental conditions that were not dissimilar from those used in our work on troponin-free ghost muscle fibres (see Section 2). Besides, treatment of

293

Please cite this article in press as: N.A. Rysev et al., Arch. Biochem. Biophys. (2014), http://dx.doi.org/10.1016/j.abb.2013.12.016

278 279 280 281 282 283 284 285 286 287 288 289 290 291

294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339

YABBI 6589

No. of Pages 10, Model 5G

2 January 2014 4 340 341 342 343 344 345 346 347 348 349 350 351

N.A. Rysev et al. / Archives of Biochemistry and Biophysics xxx (2014) xxx–xxx

skeletal muscle fibres by FITC-phalloidin did not alter Ca2+ sensitivity and tension development in skinned rabbit psoas fibers [51]. In our control experiments, we did not find any effect of FITC-phalloidin on the ATPase activity of S1 either. Earlier we discovered a change in the rigidity of the ghost muscle fiber under the influence of 40 lM phalloidin or rhodamin-phalloidin. Such fibers kept their ability to respond to the binding of S1 and TM by conformational changes [38] similar to those observed in parallel experiments with the ghost fibers that were not treated by phalloidin or rhodamin-phalloidin (for a review see [16]). Thus, it is possible that FITC-phalloidin may have little effect on the contractile apparatus of striated muscle [51].

Table 2 The effect of the nucleotides, wild-type (WT-TM), or Gly126Arg mutant b-smooth tropomyosins and S1 on polarization ratios of FITC-phalloidin bound to F-actin in ghost fibers. Nucleotide

353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378

379 380 381

The effect of the substitution of Gly126 with Arg into a-skeletal and b-smooth tropomyosins on the polarized fluorescence of FITCphalloidin-labelled F-actin and 5-IAF-labelled TMs in ghost fibres In line with our previously published data [15,29–31], the incorporation of 5-IAF-labelled recombinant TM or FITC-phalloidin-labelled actin into ghost fibres initiated polarized fluorescence. The P|| values were uniformly lower and higher than P\ values for IAF-TM and FITC-actin, respectively, thus showing that the emission dipoles of 5-IAF and FITC were oriented predominantly perpendicular and parallel to the fibre axis, respectively (Tables 1–4) with an average angle being distinct from the ‘‘magic angle’’ of 54.7° [57]. When the helix plus isotropic model (see Section 2) was fitted to the fluorescence polarization data for FITC-actin and IAFwild-type TM, the values of the angle UE were 47.7° and 54.7°, respectively (Figs. 1a and 2a). The relative amount of disordered probes (N) was zero for 5-IAF-labelled TMs and did not exceed 0.35 for FITC-phalloidin-labelled actin, showing the rigid binding of the probes to their target proteins and a highly-ordered arrangement of F-actin and TM in the fibres (for a review, see [16]). Similar values of UE for FITC-actin and 5-IAF-TM were obtained earlier [29–31,39,58]. Since FITC-phalloidin is bound strongly and specifically to F-actin, the values of UE (the angle between the filament axis and the emission dipole) and e (the flexural rigidity) contain information about spatial arrangement and flexibility of the filament. Similarly, as 5-IAF is bound in the C-terminal and N-terminal part of tropomyosin a- and b-isoforms, respectively, the values of UE and e predominantly provide information on the spatial arrangement of TM and flexibility of its C- or N-termini [15,29–31,43].

Table 1 The effect of the nucleotides, wild-type (WT-TM), or Gly126Arg mutant a-skeletal tropomyosins and S1 on polarization ratios of FITC-phalloidin bound to F-actin in ghost fibers. Nucleotide

S1

WT-TM

Gly126Arg

+ +

ADP AMP-PNP ATP

+ + + + + + + +

+ + + + + + + +

n

P|| ± SEM

P\ ± SEM

15 7 8 7 8 7 8 7 5 5 5

0.359 ± 0.002 0.387 ± 0.001 0.371 ± 0.002 0.352 ± 0.001 0.337 ± 0.002 0.346 ± 0.001 0.338 ± 0.001 0.347 ± 0.002 0.340 ± 0.001 0.362 ± 0.002 0.359 ± 0.001

0.151 ± 0.002 0.160 ± 0.002 0.156⁄ ± 0.001 0.158 ± 0.002 0.165 ± 0.001 0.181 ± 0.002 0.191 ± 0.001 0.110 ± 0.001 0.104 ± 0.001 0.039 ± 0.001 0.104 ± 0.002

P|| and P\ were calculated as described in Section 2. n is the number of fibres used in the experiments. TMs and the nucleotides have a pronounced effect on the values of P|| and P\, indicating the changes in the conformational state of F-actin in ghost fibres (P < 0.05). (⁄) Asterisks indicate unreliable differences in the values of P between wild-type and the mutant TMs in the same condition.

WT-TM

Gly126Arg

+ +

ADP AMP-PNP ATP

352

S1

+ + + + + + + +

+ + + + + + + +

n

P|| ± SEM

P\ ± SEM

15 5 8 5 8 5 8 5 5 5 5

0.359 ± 0.002 0.364 ± 0.003 0.364⁄ ± 0.003 0.311 ± 0.001 0.305 ± 0.002 0.296 ± 0.001 0.298⁄ ± 0.001 0.347 ± 0.002 0.340 ± 0.001 0.313 ± 0.002 0.324 ± 0.001

0.151 ± 0.002 0.178 ± 0.002 0.179⁄ ± 0.002 0.196 ± 0.002 0.183 ± 0.001 0.221 ± 0.002 0.199 ± 0.001 0.110 ± 0.001 0.104 ± 0.001 0.159 ± 0.001 0.128 ± 0.002

The conditions of the measurements and designations are as in Table 1. (⁄) Asterisks indicate unreliable differences in the values of P between wild type and the mutant TMs in the same condition.

Table 3 The effect of the nucleotides and S1 on polarization ratios of 5-IAF bound to wild-type (WT-TM), or Gly126Arg mutant a-skeletal tropomyosins in ghost fibers. Nucleotide

S1

WT-TM

Gly126Arg

+ +

ADP AMP-PNP ATP

+ + + + + + + +

+ + + + + + + +

n

P|| ± SEM

P\ ± SEM

7 7 7 7 7 7 6 7 6 5

0.106 ± 0.002 0.148 ± 0.001 0.122 ± 0.001 0.151 ± 0.001 0.126 ± 0.001 0.157 ± 0.001 0.110 ± 0.002 0.134 ± 0.002 0.176 ± 0.002 0.191 ± 0.001

0.201 ± 0.003 0.263 ± 0.001 0.174 ± 0.001 0.249 ± 0.001 0.174 ± 0.001 0.247 ± 0.001 0.151 ± 0.002 0.220 ± 0.002 0.195 ± 0.002 0.230 ± 0.002

The conditions of the measurements and designations are as in Table 1. (⁄) Asterisks indicate unreliable differences in the values of P between wild type and the mutant TMs in the same condition.

Q2

Table 4 The effect of the nucleotides and S1 on polarization ratios of 5-IAF bound to wild-type (WT-TM), or Gly126Arg mutant b-smooth tropomyosins in ghost fibers. Nucleotide

S1

WT-TM

Gly126Arg

+ +

ADP AMP-PNP ATP

+ + + + + + + +

+ + + + + + + +

n

P|| ± SEM

P\ ± SEM

8 7 8 7 8 7 7 6 6 6

0.082 ± 0.002 0.075 ± 0.001 0.076 ± 0.003 0.060 ± 0.001 0.076 ± 0.002 0.064 ± 0.001 0.067 ± 0.002 0.060 ± 0.002 0.082 ± 0.002 0.104 ± 0.001

0.236 ± 0.002 0.229 ± 0.002 0.221 ± 0.001 0.214 ± 0.001 0.224 ± 0.001 0.217 ± 0.001 0.189 ± 0.002 0.194⁄ ± 0.002 0.190 ± 0.002 0.195⁄ ± 0.002

The conditions of the measurements and designations are as in Table 1. (⁄) Asterisks indicate unreliable differences in the values of P between wild type and the mutant TMs in the same condition.

The anisotropic actin filament is now thought to exhibit two distinct modes of large-scale flexibility: long axis bending motions reflecting filament flexural rigidity and long axis twisting motions reflecting filament torsional rigidity. It is known that FITC-phalloidin and 5-IAF are rigidly bound to F-actin and TM, respectively, while F-actin and TM are associated only due to electrostatic interactions. This permits determination of the flexural rigidity of the protein parts, containing a fluorescent probe for each of the two proteins separately. For TM, these probe-containing parts are either C- or N-terminus of the molecule. It is obvious that if TM and F-actin were cross-linked, either probe would provide

Please cite this article in press as: N.A. Rysev et al., Arch. Biochem. Biophys. (2014), http://dx.doi.org/10.1016/j.abb.2013.12.016

382 383 384 385 386 387 388 389 390 391 392

YABBI 6589

No. of Pages 10, Model 5G

2 January 2014 N.A. Rysev et al. / Archives of Biochemistry and Biophysics xxx (2014) xxx–xxx

5

Fig. 1. The effect of the Gly126Arg mutation in a-skeletal and in b-smooth tropomyosins on the values of UE (a) and e (b) of the polarized fluorescence of FITC-phallodin-actin, revealed in ghost fibres during the simulation of the sequential steps of the ATPase cycle. Calculations of UE and e values, preparation of the fibres, their composition, and the conditions of the experiments are described in Section 2. The data represent the mean values for 5–15 fibres for each experimental condition (see Tables 1 and 2). The UE and e values in the absence and in the presence of nucleotides are significantly altered by the Gly126Arg mutation in TMs (P < 0.05). (⁄) Asterisks indicate unreliable differences between wild type and the mutant TMs in the values of UE and e. Error bars indicate ±SEM. The values of N were close to 0.3.

Fig. 2. The effect of the Gly126Arg mutation in a-skeletal and in b-smooth tropomyosins on the values of UE (a) and e (b) of the polarized fluorescence of 5-IAF linked with TMs, revealed in ghost fibres during the simulation of the sequential steps of the ATPase cycle. The conditions of the measurements and designations are as in Fig. 1. The data represent the mean values for 6–8 fibres for each experimental condition (see Tables 3 and 4). The UE and e values in the absence and in the presence of nucleotides are significantly altered by the Gly126Arg mutation in TMs (P < 0.05). (⁄) Asterisks indicate unreliable differences between wild type and the mutant TMs in the values of UE and e. Error bars indicate ±SEM. The values of N were close to zero.

393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415

information on the rigidity of the F-actin-TM complex as a whole. Our data show that the flexural rigidity (see Section 2) of F-actin was close to 5.5  10 26 Nm2 (Fig. 1b). As the binding of FITC-phalloidin to F-actin can increase its flexural rigidity [54], it appears that the real value of e was somewhat overrated. The same order of magnitude values of flexural rigidity were observed earlier for F-actin in solution and in muscle fibres [45,59]. The flexural rigidity of C- and N-termini of TMs was about 12  10 26 Nm2 i.e. twice higher than that of F-actin (Figs. 1b and 2b). This quantitative estimate of tropomyosin flexibility is in a good agreement with that recently made for TM molecules bound to F-actin [23]. The binding of each of the TMs to F-actin increases the flexural rigidity of the latter. This observation is in agreement with the available data on an increase in actin’s persistence length induced by TM [54,60]. The substitution of Gly126 with Arg into a-skeletal and b-smooth TMs resulted in statistically significant (P < 0.05) changes in the values of UE and e for FITC-actin and IAF-TMs (Figs. 1 and 2), which demonstrates changes in the conformational states of F-actin and TMs induced by this mutation. Thus, according to Fig. 1a, TM binding to F-actin increases the values of UE for FITC-actin from 46.6° to 47.7° and to 47.4° (P < 0.05) in the presence of the WT and the Gly126Arg mutant a-skeletal TMs, respectively. For the WT and Gly126Arg mutant b-smooth TMs the values

of UE increase to 47.7° and to 47.5° (P < 0.05), respectively. Thus, the mutation decreases the values of UE for FITC-actin both in aand b-TM. F-actin consists of two chains that form a right-handed long pitch helix. As FITC-phalloidin is located in the groove of the filament and is specifically bound to three adjacent actin subunits [50], the changes in UE values presumably reflect the changes in F-actin helical structure (for example, variations in the pitch of the genetic and long pitch helices [61,62]). The increase in the UE values can be easily explained by rotation of the actin subunits to the periphery of the thin filament [39,58]. According to this suggestion the decrease in UE values induced by the Gly126Arg mutation into a-skeletal and b-smooth TMs (Fig. 1a) can be interpreted as a result of inhibition of actin monomer rotation. According to the assumption put forward earlier, in pure F-actin filaments there are two different states of actin monomers; the socalled ‘‘ON’’ state is able to activate myosin ATPase activity, whereas the ‘‘OFF’’ state cannot. These two states are in a rapid equilibrium, so that in the filaments the relative amount of monomers in each state can be changed by binding of TM, myosin or TN to F-actin ([14,15], for a review, see [16]). For the regulated filament, it was observed earlier that in the presence and absence of Ca2+ (i.e. at the simulation of the so-called closed and blocked

Please cite this article in press as: N.A. Rysev et al., Arch. Biochem. Biophys. (2014), http://dx.doi.org/10.1016/j.abb.2013.12.016

416 417 418 419 420 421 422 423 424

425 426 427 428 429 430 431 432 433 434 435 436 437 438

YABBI 6589

No. of Pages 10, Model 5G

2 January 2014 6

N.A. Rysev et al. / Archives of Biochemistry and Biophysics xxx (2014) xxx–xxx

states of the filament [22,63]), TN increases and decreases, respectively, the number of switched on actin monomers. In troponinfree filaments the number of switched on actin monomers is higher than in the regulated thin filaments in the absence of Ca2+and lower in the presence of Ca2+ [14,15], suggesting that the state of F-actin in troponin-free filaments can be an intermediate one between the closed and blocked states. Here we have also shown that the TM binding to F-actin increases the UE values as compared to the pure F-actin (Fig. 1a), which can be interpreted as an increase in the number of actin monomers in the ON state. The increase in the UE values is inhibited in the case of the Gly126Arg mutation in a-skeletal and b-smooth TMs as compared to the WT-TM (Fig. 1a). It is possible that in the troponin-free filaments the Gly126Arg mutant TMs may transform F-actin towards the blocked functional state rather than to the closed one, as shown by an increase in the number of switched off actin monomers. This means that the mutation in TM may cause some impediment for binding of myosin to F-actin. Fig. 2a presents the UE values for the Gly126Arg mutant and wild-type 5-IAF-TM. It is necessary to take into account the fact that upon TM binding to the pure F-actin filament, actin monomers rotate and the amplitude of this rotation is different for the WT and mutant TMs (Fig. 1a); the actin subunit rotation probably induces a corresponding shift of TM strands that twist around F-actin and have multiple electrostatic bonds with it (there are approximately 30 electrostatic salt bridges between each TM molecule and F-actin [22,63]). Accordingly, the observed UE values for 5-IAF-TMs (Fig. 2a) are seen as overstated by the difference between the UE value for each of the complexes actin-TM and the UE value for F-actin (i.e. by 1.1° and 0.8° for the WT and mutant a-skeletal TMs and by 1.1° and 0.9° for the WT and mutant b-smooth TMs, respectively). After correction on the rotation of actin monomers the values of UE are 53.6° and 54.5°for the WT and mutant a-skeletal TMs, and 54.4° and 54.9° for the WT and mutant b-smooth TMs, respectively (Fig. 3). This means that the substitution of Gly126 with Arg can cause a rotation of the emission dipole to the periphery of the filament in all TMs. Since the fluorescent probe 5-IAF is covalently bound to TM strands, it is possible to suggest that the mutant TM was located closer to the outer domain of actin than the WT-TM. Consequently, the substitution of Gly126 with Arg into a-skeletal and b-smooth TMs shifts the TM strands further towards the blocked position (Fig. 3), switches actin monomers off (Fig. 1) and thus can inhibit the binding of S1 to actin. There is substantial evidence (our data presented here (Figs. 1–3) and published earlier

439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483

Q3

Fig. 3. The values of UE angles of 5-IAF bound to the wild-type (WT) or the Gly126Arg (126R) mutant a- and b-TMs during the ATPase cycle after correction on the rotation of actin monomers. There was a significant difference between the wild type and Gly126Arg mutant TMs in UE values in all simulated states of the ATPase cycle (P < 0.05).

[14,15]) in support of the suggestion that inhibition of myosin binding to actin by TM is performed not only via a simple movement of TM strands to the blocked position but also via an allosteric mechanism, that is by inducing conformational changes in F-actin, accompanied by the rotation of actin monomers. It is noteworthy that the UE values for WT a-skeletal and b-smooth TMs were 53.6° and 54.5° (Fig. 3), which indicates that b-smooth TM was located closer to the periphery of the filament than a-skeletal TM. A similar difference in position for a- and b-TMs on the troponin-free filaments was observed earlier [64]. It has been recently shown that the substitution of Gly126 with Arg into a-skeletal and b-smooth TMs induce a decrease in the flexibility of the central part of TM molecule. The size of the flexible middle part of TM is estimated to be 60–70 amino acid residues [28]. The effect of the Gly126Arg mutation on the flexibility of other parts of TM has not been studied. Our data indicate that besides affecting the middle part of TM, this mutation changes the flexibility of the C-terminus of a-skeletal TM and of the N-terminus of b-smooth TM as well. Thus, the Gly126Arg mutation induces a decrease in the flexural rigidity of the C-terminus (the region of Cys190) by 31% in a-skeletal TM, while it slightly increases the flexural rigidity of the N-terminus (the region of Cys36) by 6% in b-smooth TM (Fig. 2b). In the presence of a-skeletal TM or b-smooth TM the mutation decreases or has no effect on the flexural rigidity of F-actin, respectively (Fig. 1b). It could be suggested that the changes in the flexibility of TM strands and F-actin result from conformational changes in these proteins induced by an alteration in electrostatic bonds between TM strands and F-actin. Indeed, the Gly126Arg mutation induces a change in the reciprocal position of TM strands (Fig. 3) and F-actin helix (Fig. 1a). The mutant TM strands move to the periphery of the filaments while actin monomers rotate in the opposite direction, to the center of the filament. This implies that the mutation causes conformational changes in TM and F-actin that may extend to the regions involved in the contact between these proteins and result in alterations in flexural rigidity of F-actin and TMs. As a- and bisoforms have somewhat different amino acid sequences and the Gly126Arg mutation induces a distinct shift of skeletal and smooth TMs to the periphery of the filament (Fig. 3a), the flexural rigidity of F-actin and TMs may change in a different way: it decreases or does not change for F-actin in the presence of mutant a-TM and b-TM, respectively (Fig. 1b), decreases for the C-terminus of a-TM and increases for the N-terminus of b-TM (Fig. 2b). It was suggested earlier by Lehman and co-workers [22] that troponin-free thin filaments were in the Apo-state, which is structurally most similar to the B- (blocked-) state rather than to the C- (closed-) state. A comparison of the data obtained by us earlier [14,15] with the results of the present work (Fig. 3) allows to suggest that in troponin-free thin filaments TM is located somewhere between C- and B-positions, which is in agreement with the suggestion discussed in Lehman’s paper [22]. It is interesting that there are more switched on actin monomers in F-actin-TM (Fig. 1) than in the regulated thin filaments in the absence of Ca2+ [14,15]. If it were the B-state, the amount of switched on monomers would be smaller, as is the case with F-actin-TM-TN in the absence of Ca2+.

484

The effect of the substitution of Gly126 with Arg into a-skeletal and bsmooth tropomyosins on the polarized fluorescence of FITC-phalloidinlabelled F-actin and 5-IAF-labelled TMs during the ATPase cycle

540

The binding of S1 to F-actin in the presence of the WT or Gly126Arg mutant TMs and nucleotides had a pronounced effect on the parameters (P||, P\, UE, and e) of polarized fluorescence of 5-IAF-TM and FITC-actin (Tables 1–4, Figs. 1 and 2). In contrast, in the absence of S1 no significant changes in the parameters of

543

Please cite this article in press as: N.A. Rysev et al., Arch. Biochem. Biophys. (2014), http://dx.doi.org/10.1016/j.abb.2013.12.016

485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539

541 542

544 545 546 547

YABBI 6589

No. of Pages 10, Model 5G

2 January 2014 N.A. Rysev et al. / Archives of Biochemistry and Biophysics xxx (2014) xxx–xxx 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571

572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594

595

596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613

FITC-actin or F-actin-5-IAF-TM induced by addition of nucleotides or their analogues were revealed. This implies that the changes in the polarized parameters reflect primarily conformational changes in F-actin and TMs during the ATPase cycle [29–31,39,43]). According to Figs. 1a and 2a, the binding of S1 to F-actin (AM state formation) increases and decreases the UE values for the fluorescent probes FITC-phalloidin and 5-IAF located in actin and TM, respectively. For the WT and Gly126Arg mutant a-skeletal TMs, the UE values fall by 1.0° and 0.4° (P < 0.05) for 5-IAF, but increase by 0.9° and 2.3° (P < 0.05) for FITC-actin, respectively (Figs. 1a and 2a). Consequently, S1binding makes the emission dipole of the probes located on F-actin and TM move in opposite directions, with FITC-phalloidin dipole on actin proceeding towards the periphery of the filament and 5-IAF dipole on TMs shifting towards the center of the filament. Similar changes in the UE values are observed for b-smooth TM. For example, for the WT and mutant b-smooth TMs the values of UE increase by 2.4° and 2.5° for FITC-actin, respectively and practically do not change for 5-IAF-TM (Figs. 1a and 2a). The increased UE values for FITC-actin can be easily explained by a rotation of actin monomers to the periphery of the filament. As supposed earlier [58], the changes in the orientation of actin monomers leading to an increase in the UE value can be interpreted as an increase in the number of actin monomers in the ‘‘ON’’ state. According to Fig. 1a, the binding of S1 to F-actin increases the UE values more appreciably for Gly126Arg mutant a-skeletal TM than for the WT-TM; it means that this mutation amplifies the switching of actin monomers on in the filaments and stimulates the formation of a strong binding between myosin and actin, which is essential for force generation [1,65]. This can lead to the enhanced myosin ATPase activity observed earlier [28]. In contrast, the Gly126Arg mutation in b-smooth TM entails practically no change in the UE values (Fig. 1a) showing that in the F-actin-TMS1 complex, containing WT or mutant b-smooth TMs the number of actin monomers in the ‘‘ON’’ state was the same. According to Fig. 2a, the UE values of 5-IAF bound to the Gly126Arg mutant and wild-type a-skeletal TMs change at S1 binding to F-actin-TM complex. It is necessary to take into account the fact that at S1 binding to the filament, actin monomers rotate, and the amplitude of this rotation is different for the WT and mutant TMs (Fig. 2a). The actin subunit rotation most probably induces a corresponding shift of TM strands that have multiple electrostatic bonds with F-actin. Accordingly, the observed UE values for 5-IAF-TMs (Fig. 2a) are seen as overstated by the difference between the UE value for each of the complexes actin-TM-S1 and the UE value for F-actin-TM (i.e. 0.9° and 2.3° for the WT and mutant a-skeletal IAF-TMs and 2.4° and 2.5° for the WT and mutant b-smooth TMs, respectively, Fig. 2a). After correction, the UE values for IAF-TMs are 52.8° and 52.6° for the WT and mutant a-skeletal TMs, and 52.9°and 52.7° for the WT and mutant b-smooth TMs, respectively (Fig. 3). It is probable that, upon S1 binding to F-actin, the UE values decrease, reflecting movement of the emission dipole of the fluorescent probe located on TMs towards the center of the filament. Since the fluorescent probe 5-IAF is covalently bound to TM, the observed changes in UE values show that S1 shifts TM strands to the actin inner domain, exposing the myosin binding site on actin. This suggestion is in line with the data on the shift of native [9,10] and recombinant [29–31] TMs towards the open position initiated by S1. Since the UE values were smaller for the mutant TMs than for the WT-TMs (Fig. 3) in the AM state, the mutant TMs were located closer to the actin inner domain than the WT-TMs. Consequently, in the AM state S1 shifts a-skeletal and b-smooth WT TM strands towards the open position and increases the number of the switched on actin monomers in the filaments. The substitution of Gly126 with Arg into a-skeletal shifts TM strands further to the open position and switches on more actin subunits in the fila-

7

ments. In the case with b-smooth TM the Gly126Arg mutation also shifts TM strands further to the open position causing no change in the number of switched on actin monomers. These differences might point to the absence of full similarity between conformational states of a-skeletal and b-smooth TM induced by the Gly126Arg mutation. The binding of S1 to F-actin decreases and increases the flexural rigidity of F-actin and the TMs, respectively. Thus, the flexural rigidity of TM increases by 19% and 4% for the WT and mutant a-skeletal TMs, and by 27% and 8% (P < 0.05) for the WT and mutant b-smooth TMs, respectively, showing that S1 immobilizes TM strands on the surface of the filament. This immobilization might result from the trapping of TM strands by S1, which follows S1 binding to TM [66]. The substitution of Gly126 with Arg into a-skeletal and b-smooth TMs modifies this effect. According to Fig. 2b, this substitution reduces the immobilization of both a-skeletal and b-smooth TM strands by S1, which may indicate a change in electrostatic interaction between TM, actin, and S1. It is difficult to exclude a certain role of S1 binding to TM in the molecular mechanism of muscle contraction [66]. Incorporation of S1 in the ghost fibres decreases the flexural rigidity of F-actin by 20% and 15% in the presence of the WT and mutant a-skeletal TM, respectively, and these values fall by 12% and 11% (P < 0.05) in the presence of WT and mutant b-smooth TMs, respectively. This is in line with the fact that S1 is strongly bound to F-actin at the AM state of the ATPase cycle, resulting in an increase in its mobility [15]. The substitution of Gly126 with Arg into TMs does not affect the values of e (Fig. 1b), showing that conformational changes in TM induced by the Gly126Arg mutation cause only a small alteration in S1 affinity to F-actin in agreement with earlier observations [28]. At the transition from AM to AM⁄⁄
ADP
Pi state, a multistep change in the values of UE and e for FITC-actin were found (Fig. 1). It is believed that at strong binding of F-actin to myosin (AM and AM^
ADP states), actin subunits are in the ON conformational state, which can activate myosin ATPase, and at the weak binding (AM⁄
ADP and AM⁄⁄
ADP
Pi states) – in the OFF state, in which they are unable to activate the ATPase [15]. It should be noted that during the ATPase cycle each intermediate state of the myosin head induces a definite conformational state and a specific position of actin subunits in the filament [15]. Thus, in the filaments containing WT-TMs in the presence of MgADP the UE values were higher than in the absence of nucleotides (Fig. 1a). This means that the amount of actin subunits in the ON state in the actin-S1-TM-MgADP complex is higher than that in the actin-S1-TM complex. In the presence of MgAMP-PNP (in the AM⁄
ADP state), the values of UE decrease (Fig. 1a), showing that actin subunits rotate to the filament center, which is indicative of the weak binding of myosin to actin [58]. Since at the mimicked AM⁄⁄
ADP
Pi state the values of UE were small, at this stage of the ATPase cycle the overwhelming majority of actin monomers were most probably in the OFF state [15]. The substitution of Gly126 with Arg into a-skeletal and b-smooth TMs increases the UE values at the AM⁄⁄
ADP
Pi and AM⁄
ADP states (weak-binding states) (Fig. 1a), showing an increment in the number of switched on actin monomers. In contrast, the mutation in b-smooth and a-skeletal TMs entails almost no change in the UE values at the mimicked AM and AM^
ADP states and AM^
ADP state, respectively, showing that the Gly126Arg mutation does not change the amount of switched on monomers at these stages of the ATPase cycle. Our data indicate that S1 also changes the position of TM strands in a nucleotide-dependent manner (Fig. 2a). Thus, at the transformation from AM to AM⁄⁄
ADP
Pi state a multistep decrease in the UE values were observed. As at the transition from AM to AM⁄⁄
ADP
Pi state actin monomers rotate to the filament center,

Please cite this article in press as: N.A. Rysev et al., Arch. Biochem. Biophys. (2014), http://dx.doi.org/10.1016/j.abb.2013.12.016

614 615 616 617 618 619 620 621 622

623 624 625 626 627

628 629

630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679

YABBI 6589

No. of Pages 10, Model 5G

2 January 2014 8 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694

695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720

721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745

N.A. Rysev et al. / Archives of Biochemistry and Biophysics xxx (2014) xxx–xxx

the values of UE for 5-IAF-TM may be understated by 1.5° and 0.7° for the a-skeletal WT and mutant IAF-TMs and are diminished by 0.3° and 0.2° for the WT and mutant b-smooth TMs, respectively (Fig. 2a). After correction on actin rotation (Fig. 1a) the UE values for 5-IAF-TMs in the presence of MgATP are 54.6° and 54.3°for the WT and Gly126Arg mutant a-skeletal TMs, and 54.8° and 54.4° for the WT and mutant b-smooth TMs, respectively (Fig. 3), showing that at the mimicked AM⁄⁄
ADP
Pi state (weak-binding state) the mutant a-skeletal and b-smooth TMs were located farther from the periphery of the filament than the WT-TMs. The UE values were very small in the presence of MgADP (Fig. 3). Thus, for the WT and mutant a-skeletal TMs these values were 52.7° and 53.2°, and for the WT and mutant b-smooth TMs 52.4° and 52.2° (P < 0.05), respectively (Fig. 3), showing that at the mimicked AM^
ADP state the Gly126Arg mutation shifts the a-skeletal and b-smooth TM strands, respectively, further to the periphery and to the center of the filament, in comparison with the WT-TMs. In the mimicked AM⁄
ADP state (in the presence of MgAMP-PNP) the Gly126Arg mutation in a-skeletal TM shifts TM strands further towards the periphery of the filaments without changing the position of b-smooth TM (Fig. 3). In the presence of MgATP the mutation in both TMs shifts TM strands to the center of the filament. Thus, a different mode of movement during the ATPase cycle was observed for the mutant a-skeletal and b-smooth TMs. This dissimilarity results, primarily, from the different electrostatic bonds that F-actin forms with a-skeletal and b-smooth TMs. Our data indicate that TM position and flexibility correlate throughout the intermediate states of the ATPase cycle (Figs. 2b and 3). Thus, in the absence of nucleotides and in the presence of S1, the positions of TM closer to the centre of the filament coincides with lower TM rigidity. Nucleotides invert this effect: in the presence of each nucleotide (excluding a-skeletal TM in the presence of ATP) the TM positions closer to the centre correlate with higher rigidity. As the nucleotides themselves have no considerable effect on TM position in the absence of S1, it is possible that the changes in TM rigidity may result primarily from the changes in conformation of TM, which occur upon myosin binding to F-actin and appearance of electrostatic interaction between F-actin, myosin and TM, suggested recently [22,66]. The different values of rigidity obtained at different intermediate states for the mutant a-skeletal and b-smooth TMs as compared with the WT-TMs may be explained by an essential change in the nature of electrostatic interaction between the mutant TM and the acto-S1-nucleotide complex. For example, the higher values of rigidity obtained in the presence of ATP for the mutant b-smooth TM may be explained by a rise in the number (or a change in the nature) of electrostatic bonds between F-actin, S1 and TM). The evidence presented in this work suggests that the Gly126Arg mutation uncouples correlation between the position of TM and the number of switched on monomers (Figs. 1 and 3). The data obtained earlier [15] as well as the results reported here show that the mode of WT-TM movement over the surface of F-actin correlates with the average statistical number of switched on actin monomers. A multi-step shifting of WT-TMs from the periphery to the centre of the filament is observed at the transition from the weak to the strong binding in the ATP hydrolysis cycle. Each TM position corresponds to the number of switched on monomers [15] (Figs. 1 and 3). The Gly126Arg mutation disturbs this regularity at some intermediate states in the case of a-skeletal-TM or all simulated stages of the ATPase cycle in the case of b-smooth-TM. Thus, for the mutant a-skeletal-TM in the presence of MgADP or MgAMP-PNP the shift of the TM strand to the periphery of the filament is accompanied by an increase, and not a decrease in the number of switched on monomers. For the mutant b-smooth-TM, the above-mentioned interdependence appears to be violated at

all stages of the cycle. In particular, when TM shifts to the centre of the filament at the AM and AM^
ADP stages, the relative amount of switched on monomers decreases or remains unchanged instead of growing. Presumably the Gly126Arg mutation may disrupt the consistency of the steric and allosteric regulatory mechanisms. This disturbance can destroy the concert conformational changes in the F-actin-TM-S1 complex during the ATPase cycle, as was the case with the Glu54Lys mutant TM described earlier [67]. It is believed that a tropomyosin molecule wraps superhelically around actin filaments and forms 14 pseudo-repeats of 19–20 residues, divided into 7 pairs of a- and b-bands. These bands may act as alternate 7-fold sets of sites for specific binding to actin in different conformational states of the regulated thin filament. As the 20-residues spacing between a- and b-bands correspond to a 90° rotation in the coiled-coil superhelix, a corresponding shift of TM triggered by the binding of Ca2+ and myosin heads to the regulated thin filament has been proposed [2]. Recently, electron microscopy and molecular computational simulations have shown that there are about 30 potential salt bridges between tropomyosin and actin in troponin-free filaments that are thought to result in a relatively strong interaction [22] between these proteins. In contrast, in the presence of myosin only 11 bridges were found. Additionally TM interacts with myosin, resulting in another 16 possible salt bridges [66]. The importance of salt bridge interactions has been highlighted by the finding that point mutations of some amino acids in TM participating in electrostatic interactions with actin are associated with a number of human diseases [68,69]. It was found that these point mutations could change the position of TM on the filament, as well as the conformational and functional states of actin and myosin [43,67,70]. Based on these facts we assume that the position of TM strands on the surface of the filament determines a functional state of F-actin in muscle fibres (Figs. 1 and 3) via electrostatic interactions of TM with actin and myosin. Thus, in myosin- and troponin-free filaments TM strands are located between the blocked and closed positions (Fig. 3), therefore in response to the electrostatic TM interaction with actin [22] only a part of actin monomers switch on. In contrast, the S1 binding to F-actin shifts TM strands to the center of the filaments (to the open position) and this remarkably changes the nature of electrostatic interaction between TM and actin and induces novel electrostatic interaction with myosin [66], resulting in a pronounced increase in the amount of switched on actin monomers. It is likely that point mutations in the TM molecule alter the sites responsible for a specific binding of TM to actin and provide a structural basis for the altered actin–myosin interaction during the ATPase cycle. The pattern of the electrostatic interaction between TM and F-actin and myosin may depend on not only the position of the TM strands on the surface of the filament and direction of their movement but also on the sequence of conformational changes in actomyosin during the ATPase cycle [67]. If this assumption is true, a modification of TM structure may alter the pattern of the electrostatic interaction between TM and F-actin and myosin in the process of shifting, which could affect the position of TM and the amplitude of its movement and alter effectiveness of the work of myosin cross-bridges [29–31,70]. Indeed, our data indicated that the Gly126Arg mutation changes the pattern of the movement of TM strands during the ATPase cycle (Fig. 3). As in all coiled-coils, each a-helical chain of TM displays seven amino acid long ‘‘heptad’’ periodicity (the amino acids are designated a–g) required to build the characteristic ‘‘knobs into holes’’ structure at the interface of the two adjoining a-helices [24,71]. The ‘‘e’’ and ‘‘g’’ residues are often oppositely charged and stabilize the coiled coil through interchain electrostatic interactions. Noncanonical Gly126 residue is located in ‘‘g’’-position; however, it is uncharged and therefore may cause local destabilization of the

Please cite this article in press as: N.A. Rysev et al., Arch. Biochem. Biophys. (2014), http://dx.doi.org/10.1016/j.abb.2013.12.016

746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811

YABBI 6589

No. of Pages 10, Model 5G

2 January 2014 N.A. Rysev et al. / Archives of Biochemistry and Biophysics xxx (2014) xxx–xxx

861

coiled coil [28]. The substitution of the Gly126 with Arg may cause the formation of a new salt bridge through amino acid charge reversal caused by the mutation (the uncharged residue is substituted by the positively charged one). This substitution is likely to cause a local change in the TM conformation (for example, it may induce a local deformation of TM molecule), which can be a structural basis for the altered TM regulation. In summary, the application of reconstituted muscle fibres enabled us to study the effect of the Gly126Arg mutation on the position of a-skeletal and b-smooth tropomyosins and actin monomers in the troponin-free filaments, and flexibility of TMs and F-actin during the ATPase cycle. We studied the structural states of the protein ensemble after an equilibrium among several structural states had been reached and the competition between the components for certain sites of protein–protein interactions had been resolved [15]. It has been shown that the nucleotides acting via the myosin motor, modify the structural state of actin and TM, and can disturb the equilibrium state of the ensemble thereby inducing a transition of all the components of the ensemble (actin, myosin and TM) and thus the state of the ensemble on the whole to another equilibrium state. Both the data presented here (Figs. 1 and 3) and the data obtained by us earlier [29,31,67,70] demonstrate that the effect of the Gly126Arg substitution on the mutually dependent TM position and conformational state of actin during the ATPase cycle was opposite to the effect of the Glu54Lys, Glu40Lys, and Glu117Lys mutations. Thus, at the mimicked AM state the mutations that disrupt a salt bridge (the Glu54Lys, Glu40Lys, and Glu117Lys mutations) shift the TM strands towards the closed position and decrease the number of switched on monomers during the ATPase cycle. In contrast, the formation of a novel salt bridge (the Gly126Arg mutation) shifts TM strands further to the center of the filaments (to the open position) and increases the number of switched on actin monomers (Figs. 1 and 3). It is likely that a deformation of TM molecule caused by these mutations may act via an altered electrostatic interaction between TM and actin and myosin during the ATPase cycle. The data obtained earlier [15] as well as the results reported here (Figs. 1 and 3) have shown that during the ATPase cycle the direction of TM movement over the surface of F-actin correlates with the type of changes in the average statistical number of switched on actin monomers and in the amount of myosin heads capable of strong binding to actin. The closer that tropomyosin is to the centre of the filament, the larger the amount of both switched on actin monomers and myosin heads capable of strong binding to actin. The farther away the TM strands are from the centre of the filament, the smaller the amount of both switched on actin monomers and myosin heads capable of strong binding to actin (Figs. 1 and 3) [15]. This correlation between TM position and actin conformation appears to be broken by the Gly126Arg mutation in TM (Figs. 1 and 3).

862

Acknowledgments

863 865

This work was supported by the Russian Fund for Fundamental Research (No. 11-04-00244a), the Programme of Presidium of RAS (theme No. 7) and the Muscular Dystrophy Campaign.

866

References

812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860

864

867 868 869 870 871 872 873 874

[1] [2] [3] [4] [5] [6] [7] [8]

M.A. Geeves, K.C. Holmes, Adv. Protein Chem. 71 (2005) 161–193. A.M. Gordon, E. Homsher, M. Regnier, Physiol. Rev. 80 (2000) 854–922. L.A. Amos, Annu. Rev. Biophys. Biophys. Chem. 14 (1985) 291–313. J.M. Chalovich, J. Muscle Res. Cell Motil. 33 (2012) 493–499. D.F. McKillop, M.A. Geeves, Biophys. J. 65 (1993) 693–701. W. Lehman, R. Craig, P. Vibert, Nature 368 (1994) 65–67. W. Lehman, P. Vibert, P. Uman, R. Craig, J. Mol. Biol. 251 (1995) 191–196. P. Vibert, R. Craig, W. Lehman, J. Mol. Biol. 266 (1997) 8–14.

9

[9] C. Xu, R. Craig, L.S. Tobacman, R. Horowitz, W. Lehman, Biophys. J. 77 (1999) 985–992. [10] R. Craig, W. Lehman, J. Mol. Biol. 311 (2001) 1027–1036. [11] B. Brenner, J.M. Chalovich, Biophys. J. 77 (1999) 2692–2708. [12] A. Pirani, C. Xu, V. Hatch, R. Craig, L.S. Tobacman, W. Lehman, J. Mol. Biol. 346 (2005) 761–772. [13] T. Yanagida, M. Taniguchi, F. Oosawa, J. Mol. Biol. 90 (1974) 509–522. [14] Y.S. Borovikov, N.B. Gusev, Eur. J. Biochem. 136 (1983) 363–369. [15] Y.S. Borovikov, O.E. Karpicheva, S.V. Avrova, C.S. Redwood, Biochim. Biophys. Acta 1794 (2009) 985–994. [16] Y.S. Borovikov, Int. Rev. Cytol. 189 (1999) 267–301. [17] A. Singh, S.E. Hitchcock-DeGregori, Structure 14 (2006) 43–50. [18] K.C. Holmes, W. Lehman, J. Muscle Res. Cell Motil. 29 (2008) 213–219. [19] K.J. Poole, M. Lorenz, G. Evans, G. Rosenbaum, A. Pirani, R. Craig, L.S. Tobacman, W. Lehman, K.C. Holmes, J. Struct. Biol. 155 (2006) 273–284. [20] W. Zheng, B. Barua, S.E. Hitchcock-Degregori, Biophys. J. 105 (2013) 1882– 1892. [21] S.S. Lehrer, J. Muscle Res. Cell Motil. 32 (2011) 203–208. [22] W. Lehman, M. Orzechowski, X.E. Li, S. Fischer, S. Raunser, J. Muscle Res. Cell Motil. 34 (2013) 155–163. [23] X.E. Li, W. Suphamungmee, M. Janco, M.A. Geeves, S.B. Marston, S. Fischer, W. Lehman, Biochem. Biophys. Res. Commun. 424 (2012) 493–496. [24] F.H.C. Crick, Acta Crystallogr. 6 (1953) 689–697. [25] A. Singh, S.E. Hitchcock-DeGregori, PLoS One 4 (2009) e6336. [26] J.H. Brown, C. Cohen, D.A. Parry, Proteins 26 (1996) 134–145. [27] J.M. Mason, K.M. Arndt, ChemBioChem 5 (2004) 170–176. [28] I.A. Nevzorov, O.P. Nikolaeva, Y.A. Kainov, C.S. Redwood, D.I. Levitsky, J. Biol. Chem. 286 (2011) 15766–15772. [29] O.E. Karpicheva, P. Robinson, A. Piers, Y.S. Borovikov, C.S. Redwood, Arch. Biochem. Biophys. 536 (2013) 25–30. [30] Y.S. Borovikov, N.A. Rysev, O.E. Karpicheva, C.S. Redwood, Biochem. Biophys. Res. Commun. 411 (2011) 496–500. [31] Y.S. Borovikov, O.E. Karpicheva, G.A. Chudakova, P. Robinson, C.S. Redwood, Biochem. Biophys. Res. Commun. 38 (2009) 403–406. [32] P. Robinson, S. Lipscomb, L.C. Preston, E. Altin, H. Watkins, C.C. Ashley, C. Redwood, FASEB J. 21 (2007) 896–905. [33] M. Way, B. Pope, J. Gooch, M. Hawkins, A.G. Weeds, EMBO J. 9 (1990) 4103–4109. [34] F.W. Studier, A.H. Rosenberg, J.J. Dunn, J.M. Dubendorff, Methods Enzymol. 185 (1990) 60–89. [35] M. Lamkin, T. Tao, S.S. Lehrer, Biochemistry 22 (1983) 3053–3058. [36] Y. Okamoto, T. Sekine, J. Biol. Chem. 98 (1985) 1143–1145. [37] A.G. Szent-Gyorgyi, Arch. Biochem. Biophys. 42 (1953) 305. [38] Y.S. Borovikov, J. Moraczewska, M.I. Khoroshev, H. Strzelecka-Gołaszewska, Biochim. Biophys. Acta 1478 (2000) 138–149. [39] Y.S. Borovikov, I.V. Dedova, C.G. dos Remedios, N.N. Vikhoreva, P.G. Vikhorev, S.V. Avrova, T.L. Hazlett, B.W. Van Der Meer, Biophys. J. 86 (2004) 3020–3029. [40] J. Borejdo, O. Assulin, T. Ando, S. Putnam, J. Mol. Biol. 158 (1982) 391–414. [41] A. Kishino, T. Yanagida, Nature 334 (1988) 74–76. [42] Yu.S. Borovikov, G.N. Vinogradova, I.M. Rozanov, I.I. Barskii, Tsitologiya 16 (1974) 1045–1050. [43] N.A. Rysev, O.E. Karpicheva, C.S. Redwood, Y.S. Borovikov, Biochim. Biophys. Acta 1824 (2012) 366–373. [44] G.W. Tregear, R.A. Mendelson, Biophys. J. 15 (1975) 455–467. [45] T. Yanagida, F. Oosawa, J. Mol. Biol. 126 (1978) 507–524. [46] A. Galinska-Rakoczy, P. Engel, C. Xu, H. Jung, R. Craig, L.S. Tobacman, W. Lehman, J. Mol. Biol. 379 (2008) 929–935. [47] R.S. Goody, W. Hofmann, J. Muscle Res. Cell Motil. 1 (1980) 101–115. [48] O. Roopnarine, D.D. Thomas, Biophys. J. 70 (1996) 2795–2806. [49] N. Kulikova, O.E. Pronina, R. Dabrowska, Y.S. Borovikov, Biochem. Biophys. Res. Commun. 345 (2006) 280–286. [50] M. Lorenz, D. Popp, K.C. Holmes, J. Mol. Biol. 234 (1993) 826–836. [51] E. Prochniewicz-Nakayama, T. Yanagida, F. Oosawa, J. Cell Biol. 97 (1983) 1663–1667. [52] J. Borejdo, P. Muthu, J. Talent, I. Akopova, T.P. Burghardt, J. Biomed. Opt. 12 (2007) 014013. [53] J. Borejdo, A. Shepard, D. Dumka, I. Akopova, J. Talent, A. Malka, T.P. Burghardt, Biophys. J. 86 (2004) 2308–2317. [54] H. Isambert, P. Venier, A.C. Maggs, A. Fattoum, R. Kassab, D. Pantaloni, M.F. Carlier, J. Biol. Chem. 270 (1995) 11437–11444. [55] P. Dancker, I. Löw, W. Hasselbach, T. Wieland, Biochim. Biophys. Acta 400 (1975) 407–414. [56] A.E. Bukatina, F. Fuchs, J. Muscle Res. Cell Motil. 15 (1994) 29–36. [57] C.L. Berger, J.S. Craik, D.R. Trentham, J.E. Corrie, Y.E. Goldman, Biophys. J. 71 (1996) 3330–3343. [58] S.V. Avrova, N.A. Rysev, O.S. Matusovsky, N.S. Shelud’ko, Y.S. Borovikov, Arch. Biochem. Biophys. 521 (2012) 1–9. [59] M.A. Deriu, T.C. Bidone, F. Mastrangelo, G. Di Benedetto, M. Soncini, F.M. Montevecchi, U. Morbiducci, J. Biomech. 44 (2011) 630–636. [60] M. Greenberg, C. Wang, W. Lehman, J. Moore, Cell Motil. Cytoskeleton 65 (2008) 156–164. [61] E.H. Egelman, N. Francis, D.J. DeRosier, Nature 298 (1982) 131–135. [62] K. Wakabayashi, Y. Sugimoto, H. Tanaka, Y. Ueno, Y. Takezawa, Y. Amemiya, Biophys. J. 67 (1994) 2422–2435. [63] X.E. Li, L.S. Tobacman, J.Y. Mun, R. Craig, S. Fischer, W. Lehman, Biophys. J. 100 (2011) 1005–1013.

Please cite this article in press as: N.A. Rysev et al., Arch. Biochem. Biophys. (2014), http://dx.doi.org/10.1016/j.abb.2013.12.016

875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960

YABBI 6589

No. of Pages 10, Model 5G

2 January 2014 10 961 962 963 964 965 966 967 968

N.A. Rysev et al. / Archives of Biochemistry and Biophysics xxx (2014) xxx–xxx

[64] W. Lehman, V. Hatch, V. Korman, M. Rosol, L. Thomas, R. Maytum, M.A. Geeves, J.E. Van Eyk, L.C. Tobacman, R. Craig, J. Mol. Biol. 302 (2000) 593–606. [65] I. Rayment, H.M. Holden, M. Whittaker, C.B. Yohn, M. Lorenz, K.C. Holmes, R.A. Milligan, Science 351 (1993) 58–65. [66] E. Behrmann, M. Müller, P.A. Penczek, H.G. Mannherz, D.J. Manstein, S. Raunser, Cell 150 (2012) 327–338. [67] Y.S. Borovikov, S.V. Avrova, O.E. Karpicheva, P. Robinson, C.S. Redwood, Biochem. Biophys. Res. Commun. 411 (2011) 496–500.

[68] S. Marston, M. Memo, A. Messer, M. Papadaki, K. Nowak, E. McNamara, R. Ong, M. El-Mezgueldi, X. Li, W. Lehman, Hum. Mol. Genet. (2013) [Epub ahead of print] PMID: 23886664. [69] D.F. Wieczorek, G. Jagatheesan, S. Rajan, Adv. Exp. Med. Biol. 644 (2008) 132– 142. [70] Y.S. Borovikov, O.E. Karpicheva, S.V. Avrova, P. Robinson, C.S. Redwood, Arch. Biochem. Biophys. 489 (2009) 20–24. [71] A.D. McLachlan, M. Stewart, J. Mol. Biol. 98 (1975) 293–304.

969 970 971 972 973 974 975 976 977

Please cite this article in press as: N.A. Rysev et al., Arch. Biochem. Biophys. (2014), http://dx.doi.org/10.1016/j.abb.2013.12.016