- Email: [email protected]
Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface
International Journal of Food Microbiology 273 (2018) 20–27
Contents lists available at ScienceDirect
International Journal of Food Microbiology journal homepage: www.elsevier.com/locate/ijfoodmicro
Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface
T
⁎
Natalia Crespo Tapia, Heidy M.W. den Besten, Tjakko Abee
Wageningen University & Research, Laboratory of Food Microbiology, P.O. Box 17, 6700 AA Wageningen, The Netherlands
A R T I C LE I N FO
A B S T R A C T
Keywords: Listeria monocytogenes Glycerol Biofilm Aerotaxis Metabolism
Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in foodprocessing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source.
1. Introduction Listeria monocytogenes is a food-borne pathogen that causes listeriosis, which is a life-threatening disease that presents 20–30% of mortality rate in people at risk (David and Cossart, 2017; Møretrø and Langsrud, 2004; Rolhion and Cossart, 2017). This microorganism is a Gram-positive, motile bacterium that can be present in food-processing environments, where it can grow as a biofilm on the surface of the equipment, as well as in pipes and drains (Colagiorgi et al., 2017; Møretrø and Langsrud, 2004). When L. monocytogenes cells detach from the biofilm matrix they might colonize food products as they pass through the food-processing line (Colagiorgi et al., 2017). Due to their increased resistance to disinfectants and cleaning strategies (Ferreira et al., 2014; Martinez-Suarez et al., 2016), L. monocytogenes biofilms are a major concern for food safety. Besides its ability to grow as a biofilm, another important reason for the presence and persistence of L. monocytogenes in the food-processing industry is its ability to survive and adapt to growth in different niches and conditions (Møretrø and Langsrud, 2004). Indeed, as a saprophytic environmental bacterium, commensal microorganism for certain animals, and human pathogen, L. monocytogenes has the ability to survive
⁎
in a broad range of environments (Ferreira et al., 2014; Gray et al., 2006; Pine et al., 1989; Vivant et al., 2013). Its growth in soil makes it able to utilize many different carbon and energy sources that are derived from plants and animal waste (Deutscher et al., 2014). From the soil, the bacteria can get transmitted to animals and plants, and eventually make their way into food-processing environments. Here it can contaminate vegetables, dairy products, meat and many other food products, and finally cause infection in the human host upon ingestion of contaminated food. Therefore, L. monocytogenes needs to be able to utilize the carbon sources that are available inside the human body. The presence or absence of specific carbon sources can regulate the expression of the majority of virulence genes (Eisenreich et al., 2010; Freitag et al., 2009; Joseph et al., 2008; Milenbachs et al., 1997). It has been reported that the presence of sugars that are metabolized via the phosphoenolpyruvate (PEP):carbohydrate phosphotransferase system (PTS), such as glucose and cellobiose, leads to a strong inhibition of PrfA activity, the main controller of virulence in L. monocytogenes (Deutscher et al., 2014). On the other hand, non-PTS carbon sources such as glycerol are believed to induce a high level of activation of PrfAdependent genes (Joseph et al., 2008). Previous studies have identified a role in glycerol metabolism for the alternative sigma factor B (σB)
Corresponding author. E-mail address: [email protected] (T. Abee).
https://doi.org/10.1016/j.ijfoodmicro.2018.03.009 Received 4 December 2017; Received in revised form 12 March 2018; Accepted 13 March 2018 Available online 15 March 2018 0168-1605/ © 2018 Elsevier B.V. All rights reserved.
International Journal of Food Microbiology 273 (2018) 20–27
N. Crespo Tapia et al.
250 μL and 1 mL of total volume, respectively. The plates were statically incubated in NB with and without carbon source supplementation for 48 h at 30 °C, and subsequently stained with 0.1% (w/v) crystal violet (CV) solution as previously described (Fernandez Ramirez et al., 2015). Briefly, the wells were washed twice with PBS, left to dry for 5 min, and stained with 250 μL or 1 mL of 0.1% CV for 30 min. After staining, images of the biofilm's position in the 24-well plate were taken with a 12 MP camera (Apple). For biofilm quantification experiments, the bound crystal violet was dissolved from the biofilm grown in the 96well plate with 70% ethanol for 15 min, after which the absorbance was measured at 595 nm with the Spectramax M2 plate reader (Molecular Devices). Experiments were performed in three independent reproductions, with three technical replicates each.
(Abram et al., 2008), which is a transcriptional regulator involved in virulence and the general stress response in L. monocytogenes (Guldimann et al., 2016). Mutants lacking σB show increased sensitivity to a broad range of environmental stresses, such as heat and low pH, and have also been shown to utilize glycerol inefficiently compared to the wild type strain (Abram et al., 2008). Some studies suggest that σB is also involved in the process of biofilm formation (van der Veen and Abee, 2010). However, the role of glycerol metabolism in biofilm formation in L. monocytogenes has not been investigated yet. Being a common fermentation product (Guadalupe Medina et al., 2010; Semkiv et al., 2017), and widely used in food production as a food additive (Pagliaro and Rossi, 2008), glycerol can be encountered by bacteria in the food-processing environment. Most bacterial species are able to utilize glycerol as a carbon source (da Silva et al., 2009). Once glycerol has been taken up by the cell via facilitated diffusion, it can follow two different metabolic pathways. One pathway begins with the phosphorylation of glycerol to glycerol-3-phosphate (Glycerol-3P) by a glycerol kinase, and subsequent conversion into dihydroxyacetone phosphate (DHA-P) via a glycerol-3P dehydrogenase. Alternatively, glycerol may be first oxidized to dihydroxyacetone (DHA) by a glycerol dehydrogenase, and then phosphorylated into DHA-P by a dihydroxyacetone kinase (Bizzini et al., 2010; Monniot et al., 2012). L. monocytogenes is also able to utilize glycerol as a carbon source and its main glycerol metabolic pathway, usually referred to as the glpFK operon, includes the GlpF facilitator, the GlpK kinase, and the GlpD glycerol-3P dehydrogenase. The second metabolic route mentioned before has not been fully characterized in this microorganism yet, but some of its components have already been described (Deutscher et al., 2014). This system has been mainly studied in L. innocua, where it is encoded by the gol operon (Monniot et al., 2012). In silico analysis of L. monocytogenes genome sequence has confirmed the presence of an operon homologous to L. innocua's gol operon (Monniot et al., 2012). In this study the impact of glycerol on L. monocytogenes biofilm production was analysed. When grown in liquid media, L. monocytogenes biofilms are usually located at the bottom of the wells or all over the wells. In our experiments, however, the presence of glycerol in the media consistently induced the formation of a biofilm at the airliquid interface of the well. After further investigation of this specific phenotype, a link was found between the capacity of L. monocytogenes to metabolize glycerol under aerobic conditions, and aerotaxis of cells grown in the presence of glycerol.
2.3. Planktonic growth curves NB medium (25 mL) with and without supplements was inoculated with 1% (v/v) of bacterial overnight culture. Cultures were incubated at 30 °C under aerobic (160 rpm shaking) or anaerobic (Anoxomat modified atmosphere, MART) conditions for up to 48 h (Anaerobic mixture 0% O2, 10% CO2, 5% H2, 85% N2). OD600 measurements were taken every 2 h during the first 10 h of incubation, with two final samplings at 24 and 48 h. Anaerobic conditions were disturbed briefly for each time point during sampling, but no appreciable effect on bacterial growth was observed. The experiment was performed in three independent reproductions. 2.4. Metabolic activity The Phenol Red pH indicator tubes assay was performed as follows. Briefly, glass tubes were inoculated with 5 mL of Phenol Red broth (10 g/L casein peptone, 5 g/L NaCl, 0.018 g/L Phenol Red) with or without glucose or glycerol supplementation, and 1% (v/v) inoculum of the bacterial overnight culture. The tubes were then incubated at 30 °C under aerobic (160 rpm shaking) or anaerobic (Anoxomat modified atmosphere) conditions. A color switch of the medium from red to yellow shows acidification of the media caused by bacterial metabolic activity. Experiments were performed in two independent reproductions, with two technical replicates each. Pictures of the tubes were taken after 48 h of incubation (12 MP camera, Apple). 2.5. High pressure liquid chromatography (HPLC)
2. Material and methods NB medium (25 mL) with and without supplements was inoculated with 1% (v/v) of bacterial overnight culture. Cultures were incubated at 30 °C under aerobic (160 rpm shaking) or anaerobic (Anoxomat modified atmosphere) conditions. 1 mL samples were taken at time zero and after 10, 24 and 48 h of growth. After centrifugation, the cell pellet was removed and the supernatant was treated for protein decontamination with Carrez A (K4FE(CN)6.3H20, Merck) and B (ZnSO·73H20, Merck) (2fold dilution) and 2-fold diluted with MilliQ. The experiment was performed twice, with two technical replicates per experiment. Additionally, a standard curve of known concentrations of glycerol was prepared (2-fold dilutions, from 37.5 mM to 1.2 mM; detection limit 1.2 mM), in order to quantify the concentration of glycerol present in the supernatant of our samples. The HPLC was performed on an Ultimate 3000 HPLC (Dionex) equipped with an RI-101 refractive index detector (Shodex, Kawasaki, Japan), an autosampler and an ion-exclusion Aminex HPX – 87H column (7.8 × 300 mm) with a guard column (Bio-Rad, Hercules, CA). As mobile phase, 5 mM H2SO4 was used at a flow rate of 0.6 mL/min, and the column was kept at 40 °C. Total run time was 30 min. The injection volume was 10 μL.
2.1. Bacterial strains and growth conditions All experiments performed in this study were carried out with L. monocytogenes strain EGDe (ATCC BAA-679). Bacterial stocks were stored at −80 °C in Brain Heart Infusion (BHI) broth (Becton Dickinson Difco) supplemented with 15% glycerol (Fluka). Working cultures were prepared by inoculating 10 mL of BHI broth with a single colony from a BHI agar (1.5%, Oxoid) plate and grown shaking (160 rpm) overnight at 30 °C (final concentration 109 CFU/mL). The culturing medium used in all experiments was nutrient broth (NB, Oxoid) and NB supplemented with 1% (w/v) glucose (Sigma-Aldrich) or glycerol (Fluka) unless specified otherwise. Stocks of 25% glucose and glycerol diluted with demineralized water were autoclaved separately and added to the media. Phosphate buffered saline (PBS) was prepared by dissolving 8.98 g di‑sodium hydrogen phosphate (Merck), 2.72 g sodium dihydrogen phosphate (Merck) and 8.5 g sodium chloride (Sigma-Aldrich) in 1 L demineralized water. 2.2. Crystal violet staining
2.6. Motility assays Polystyrene 96- and 24-well plates (Sigma-Aldrich) were inoculated with 1% (v/v) of bacterial overnight culture. Each well was filled with
For swimming assays, 5 μL of an overnight culture were spot 21
International Journal of Food Microbiology 273 (2018) 20–27
N. Crespo Tapia et al.
RT-PCR as described before (Metselaar et al., 2015). Briefly, the conditions were set up as follows: initial denaturation (4 min at 95 °C), amplification (40 cycles of 95 °C for 15 s, 59 °C for 1 min) and a melting step (65–95 °C with 0.5 °C steps) to confirm the formation of a single product. Primer efficiency was checked by the standard curve method. The efficiencies of all primers ranged from 1.99 to 1.89 (R2 above 0.99). Relative expression of the target genes in the presence of glycerol was analysed with the ΔΔCt method using samples grown in non-supplemented NB as control, and normalization of the expression of the target genes with the 16S rRNA gene (Abram et al., 2008; Metselaar et al., 2015). Final values were plotted as the fold change in gene expression levels of NB-Glycerol cultures over the NB control. The same procedure was followed for aerobic and anaerobic samples.
inoculated onto 0.3% nutrient agar (NA) plates with and without 1% glucose or glycerol. For the aerotaxis experiments, approximately 109 cells from an overnight culture of L. monocytogenes were centrifuged (5 min, 3000 ×g), washed twice with PBS and resuspended in 50 μL of PBS. The highly concentrated cell suspension was then inoculated in 5 mL of PBS agar (0.3%) tubes, supplemented with 1% glucose or glycerol when necessary. The inoculation of the bacteria into the agar tubes was carried out once the agar had cooled down enough to be handled easily by hand to mix the agar and the cells. The plates and tubes were incubated at 30 °C, in aerobic and anaerobic (Anoxomat modified atmosphere) conditions. Pictures of the swimming halos (geldoc system, UVItec Alliance) and aerotactic rings (12 MP camera, Apple) were taken after 24–48 h. Both experiments were performed with 3 independent cultures.
2.9. Statistical analysis 2.7. Flagella staining A two-tailed Student's t-test was used to determine statistically significant differences in biofilm production between aerobic and anaerobic cultures grown in the presence of glucose or glycerol, compared to those grown in non-supplemented NB. Significant differences in gene expression levels and glycerol consumption between cells grown aerobically and anaerobically was determined by the same method. P values of 0.05 or lower were considered statistically significant.
L. monocytogenes cultures were grown at 30 °C in NB and NB supplemented with 1% glucose or glycerol, in aerobic and anaerobic conditions. Samples were taken after 24 h of incubation following inoculation of the growth media, and checked for motility directly under the microscope. Subsequently, the slides were treated with Ryu flagella stain, prepared as described (Kodaka et al., 1982) and cells were checked under the microscope for the presence or absence of flagella. The experiment was performed in 2 independent reproductions. Two to three representative images of each sample were taken with CellB software.
3. Results 3.1. The presence of glycerol in the medium induces air-liquid interface biofilm formation
2.8. Quantification of gene expression levels 2.8.1. RNA extraction and reverse transcription L. monocytogenes cultures were grown at 30 °C in NB and NB supplemented with 1% glycerol, in aerobic and anaerobic conditions. Samples for RNA extraction were taken after 5 h of incubation (early or late exponential phase, see Fig.2B) and immediately stabilized with Bacterial RNAProtect (Qiagen), following the manufacturer's instructions. Cell lysis was performed by bead beating (Fast Prep, settings 6 m/ s 30 s twice, rest 5 min on ice, twice). From here on, the RNeasy mini kit (Qiagen) was followed according to the manufacturer's instructions, including the in-column DNase treatment. RNA concentration was determined via UV absorbance at 260 nm (BioPhotometer Eppendorf), and its integrity was assessed by gel electrophoresis. cDNA synthesis was performed with the Superscript III inverse transcriptase (Invitrogen), following the manufacturer's instructions. Samples were stored at -80 °C until RT-PCR analysis.
L. monocytogenes biofilms were incubated without shaking for 48 h at 30 °C. After CV staining, cultures grown in the presence of glycerol showed a distinct air-liquid interface biofilm formation, in contrast to the biofilms formed in NB or NB supplemented with glucose, where most of the biomass was found at the bottom of the well (Fig. 1A). Interestingly, when biofilms were grown under anaerobic conditions, the air-liquid interface phenotype was lost, and the stained appearance of glycerol-grown biofilms closely resembled those grown in non-supplemented NB (Fig. 1A). Additionally, OD595 measurements of bound CV showed significantly higher biofilm production in the presence of glycerol under aerobic conditions when compared to non-supplemented NB, whereas biofilms grown anaerobically in the presence of glycerol showed CV staining levels similar to those from biofilms grown in plain NB (Fig. 1B). Biofilm production in NB supplemented with glucose is also reduced in anaerobic conditions compared to biofilms grown in the presence of oxygen, but they are still significantly different from the ones grown in NB under the same conditions (Fig. 1B).
2.8.2. Primer design and qRT-PCR Table 1 shows a list of all primers used in this study. After analysis of the stability of a set of potential reference genes by Bestkeeper (Pfaffl et al., 2004) the 16S rRNA gene was selected for normalization of the samples. The primers for the target genes were designed with the primer3 online software, and their specificity was checked by gel electrophoresis of the PCR products. The qRT-PCR was performed using SYBRgreen PCR MasterMix (Applied Biosystems) in a Bio-Rad CFX96
3.2. The presence of glycerol enhances planktonic growth under aerobic conditions The previous results suggested that the influence of glycerol in L. monocytogenes' biofilm production is restricted to growth under aerobic
Table 1 Primers used for RT-PCR experiments. Target
Product size (bp)
Forward primer
Reverse primer
Melting T (°C) f/r
Source
16S glpF glpK glpD golD dhaL golR
116 96 62 117 78 68 80
GATGCATAGCCGACCTGAGA CCATCTTAACCCCGCAGTAA AGTTCCGGTTGCAGGTATTG GGAAAGACGCTGTTGTGGAT AAATTATCGGTCGCGAAATG GAAAGGTCGCGCACTAAGAC AGAAGCGGCGACTTTAGTGA
TGCTCCGTCAGACTTTCGTC GCCCCAATAAACTGAGCAAG CGAAACAACCTTGACCGAAT AATCAGCCGGTTCTCTAGCA GTGCGATGACAGAAGCTTGA AAGACGATTCAGAGCCAGGA ATTCTTTTGCAAGCGCAAGT
65.3/65.6 63.6/64.2 63.8/63.8 64.0/63.8 63.5/64.3 63.8/63.9 63.9/63.7
(Metselaar et al., 2015) This study This study This study This study This study This study
22
International Journal of Food Microbiology 273 (2018) 20–27
N. Crespo Tapia et al.
Fig. 1. Biofilm production of L. monocytogenes biofilms after growth for 48 h at 30 °C in NB and NB supplemented with glucose (GLU) and glycerol (GLY), under aerobic (O2) and anaerobic (AnO2) conditions. A) Representative images of localization of CV-stained biofilms. Black arrow shows clear air-liquid interface biofilm formation on aerobic NB-Glycerol sample. B) OD595 measurements of CV-stained biofilms. Error bars show standard deviation of three independent reproductions. Results significantly different from NB are highlighted with *.
On the other hand, the planktonic performance of cells grown in NB supplemented with glycerol only showed an increase in OD600 when they were incubated in the presence of oxygen. Under anaerobic conditions, the growth curves of cells grown in plain NB and in NB supplemented with glycerol were similar (Fig. 2B).
conditions. Therefore, it was decided to assess planktonic performance and metabolic activity of cells grown in the presence of glycerol, under aerobic and anaerobic conditions. The Phenol Red pH indicator test shows that L. monocytogenes can metabolize glucose both aerobically and anaerobically, whereas in the presence of glycerol metabolic activity was only detected in tubes with aerobically grown cells (Fig. 2A). These results correlated with the planktonic performance of L. monocytogenes in the same experimental conditions. Based on cell density absorbance measurements (OD600), the presence of glucose in the medium enhanced the growth of L. monocytogenes compared to non-supplemented NB, at both aerobic and anaerobic conditions (Fig. 2B).
3.3. Oxygen conditions influence the expression of genes involved in glycerol metabolism Some studies support the existence of two different glycerol pathways in L. monocytogenes (Monniot et al., 2012; Deutscher et al., 2014), which are shown in Fig. 3A.
Fig. 2. L. monocytogenes behaviour grown in Phenol Red media (A) or in NB (B), with and without glucose (GLU) or glycerol (GLY), in aerobic (O2) and anaerobic (AnO2) conditions. A) Phenol Red pH indicator tubes assay. The presence and absence of metabolic activity with different carbon sources is indicated by the yellow and red coloration of the media, respectively. Phenol Red media without inoculum (MEDIA) and with inoculum (MEDIA + inoculum) were used as controls. B) Planktonic growth curves of cells grown at 30 °C NB without and with added GLU or GLY, expressed in OD600 absorbance measurements over time. Each time point represents the mean of three biological replicates; error bars correspond to the standard deviation. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
23
International Journal of Food Microbiology 273 (2018) 20–27
N. Crespo Tapia et al.
Fig. 3. L. monocytogenes' glycerol metabolism. A) Schematic representation of predicted metabolic pathways. After glycerol is taken into the cells, it can be metabolized into dihydroxyacetone phosphate (DHA-P) in two different ways (pathway A in green and B in orange). The glycerol facilitator glpF (in gray) is common to both pathways. B) Relative gene expression levels of both pathways in NB supplemented with glycerol over NB. After 5 h of incubation, aerobic (O2) and anaerobic (AnO2) samples correspond to full and pattern bars, respectively. Error bars represent the standard deviation of two independent reproductions. * represents significant differences in relative expression between aerobic and anaerobic samples (Student's t-test, P < 0.05). C) Glycerol consumption of cultures grown under aerobic (O2) and anaerobic (AnO2) conditions. Samples were taken after 48 h of incubation and measured with HPLC. Error bars represent the standard deviation of two independent reproductions. * shows a significant difference between both conditions (Student's t-test, P < 0.05). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
In pathway A (Fig. 3A, green), glycerol is first phosphorylated into glycerol-3P by the kinase GlpK. Afterwards, the glycerol-3P is oxidized into DHA-P by the glycerol-3P dehydrogenase GlpD. Pathway B (Fig. 3A, orange) is proposed to start with the oxidation of glycerol into DHA by the recently described glycerol dehydrogenase GolD (Monniot et al., 2012). The resultant DHA is then phosphorylated into DHA-P by the DhaL/DhaK system. The DHA-P produced by both pathways can then be utilized by the cell in several metabolic reactions. In this study the relative expression of selected genes of these two pathways was analysed in aerobic and anaerobic conditions. Fig. 3B shows that there is a clear difference in the expression of the glycerol metabolism genes. With the exception of glpD (P = 0.07), all tested genes showed a significant difference in gene expression between aerobic and anaerobic conditions (P < 0.05). In the presence of oxygen, the glpF gene encoding the glycerol facilitator and the genes involved in pathway A were upregulated in NB supplemented with glycerol compared to the non-supplemented NB. On the other hand, pathway B genes golD and dhaL were downregulated (Fig. 3B). Indeed, the putative repressor of this pathway, golR, was upregulated only in aerobically grown cultures. When cells were grown anaerobically all of the target genes were downregulated in the presence of glycerol compared to plain NB (Fig. 3B).
presence of oxygen consumed up to 20 mmol/L of glycerol, whereas glycerol consumption of cells grown anaerobically was < 1 mmol/L (Fig. 3C), and significantly different from the aerobic cultures (P < 0.05).
3.5. The presence of glycerol in the media induces aerotaxis in L. monocytogenes It was then decided to investigate the role of motility and aerotaxis in the formation of the air-liquid interface biofilms in L. monocytogenes. As shown in Fig. 4A, motility assays showed slightly reduced swimming of aerobically-grown L. monocytogenes cells in 0.3% nutrient agar (NA) supplemented with glucose, compared to plain NA and NA supplemented with glycerol. However, the diameters of the halos were very similar for NA and NA supplemented with glycerol (Fig. 4A). Cells incubated anaerobically showed the same trend as cells grown in the presence of oxygen, but were overall less motile (Fig. S2A). Cells were also stained for flagella to confirm motility results. Flagellated cells were found in all tested conditions, although in different amounts. In general, cultures grown in plain NB and NB supplemented with glycerol showed higher numbers of flagellated cells, compared to NB supplemented with glucose (Fig. 4B), which matched the results obtained in the swimming assays. A similar trend was observed in the anaerobic samples (Fig. S2B). The number of flagella per cell could not be quantified. Additionally, aerotaxis experiments were performed in conditions that do not stimulate growth. For this, PBS tubes supplemented with 0.3% agar were inoculated with a high concentration of bacterial cells (approximately 109 cfu/mL), incubated at 30 °C for 48 h in the presence and absence of oxygen, and used to assess motility of the cells towards the surface of the tube, where the concentration of oxygen is higher. The results showed no change in appearance between the non-supplemented PBS control tubes and the tubes supplemented with glucose after 48 h of incubation (Fig. 4C). On the other hand, when the PBS agar
3.4. L. monocytogenes requires oxygen to be able to import and utilize glycerol To further investigate L. monocytogenes' ability to metabolize glycerol under aerobic and anaerobic conditions, we measured glycerol consumption over time. Samples taken after 10, 24 and 48 h of incubation were compared with samples taken at time zero (T0), and the amount of glycerol left in the supernatant was quantified with HPLC. The amount of glycerol at T0 minus the amount of glycerol left after incubation was defined as glycerol consumption (Fig. S1). The results showed that after 48 h of incubation at 30 °C, cells grown in the 24
International Journal of Food Microbiology 273 (2018) 20–27
N. Crespo Tapia et al.
Fig. 4. Motility and aerotaxis of cells grown at 30 °C, under aerobic conditions. A) Swimming halos of cells spot inoculated in non-supplemented NA (Control) and NA supplemented with glucose and glycerol. Plates were imaged after 24 h of incubation. B) Flagella stained cells grown in NB (Control) and NB supplemented with glucose and glycerol. Samples were taken after 24 h of incubation, treated with the Ryu stain technique, and visualized under the microscope (100×). White arrows point to flagellated cells. Scale bar represents 10 μm. C) Aerotaxis experiment of cells incubated in soft PBS agar tubes (Control), supplemented with glucose or glycerol. White arrow shows concentration of the cells at the surface of the tube. Images were taken after 48 h of incubation.
Glucose might be L. monocytogenes's preferred carbon source in most conditions (Gilbreth et al., 2004), but this micro-organism is also capable of using many alternative compounds, including glycerol (Deutscher et al., 2014), a compound present in food-processing environments and fermented foods. Previous studies have shown that L. monocytogenes can utilize glucose as a carbon source under aerobic and anaerobic conditions (Pine et al., 1989). It is known that several bacterial species can use glycerol under anaerobic conditions as well (da Silva et al., 2009). For instance, E. coli possess two isoforms of the glycerol 3-P dehydrogenase, which are active in either aerobic or anaerobic conditions (Murarka et al., 2008). Additionally, it has been demonstrated that in Enterococci spp. the two main glycerol pathways are induced in the presence of oxygen, whereas under anaerobic conditions only pathway B is active (Bizzini et al., 2010). In contrast, other bacterial species like Lactobacillus rhamnosus, are unable to utilize glycerol anaerobically (Alvarez Mde et al., 2004). A study by Müller-Herbst et al. (2014) reported that the expression of glpF, glpK and glpD is downregulated under anaerobic conditions in L. monocytogenes. In line with this study, we found that all genes involved in glycerol metabolism analysed in our experiments were downregulated during anaerobic growth with glycerol as the carbon source,
was supplemented with glycerol a distinct ring of concentrated cells located very close to the surface of the tubes was observed, in a position that generally represents microaerophilic behaviour (Fig. 4C). This phenotype was not found when the tubes were incubated under anaerobic conditions (Fig. S2C).
4. Discussion We report here the formation of an air-liquid interface biofilm by L. monocytogenes, induced by the presence of glycerol in the media. The work described in this study corresponds to laboratory strain EGDe; however, we performed a screening with 19 additional L. monocytogenes strains (from different origins, including food isolates) and most of them showed the same behaviour (data not shown). Our results showed that both glucose and glycerol enhanced growth and biofilm production under aerobic conditions in comparison with non-supplemented NB. On the other hand, in anaerobic conditions only the addition of glucose to the media showed an enhanced effect. This strongly suggests that L. monocytogenes might not be able to use glycerol efficiently without oxygen. Although the incubation temperature used in this study was 30 °C, additional experiments showed that similar phenotypes are also present at room temperature (data not shown). 25
International Journal of Food Microbiology 273 (2018) 20–27
N. Crespo Tapia et al.
Unlike the floating cell aggregates known as pellicles formed by other bacteria (Lemon et al., 2008), the biofilm formed by L. monocytogenes was found to be surfaced-attached. This study extends the knowledge on biofilm formation capacity and characteristics of this highly versatile human pathogen that has been shown to be persistent in food-processing environments (Møretrø and Langsrud, 2004). Furthermore, we show that L. monocytogenes cannot use glycerol anaerobically, which provides additional information about the behaviour of this microorganism in glycerol-containing food products. Future studies aim to characterize this type of L. monocytogenes biofilm in more detail, including matrix composition and the mechanism behind the transcriptional regulation of the glycerol metabolism genes by environmental conditions including temperature and oxygen.
compared to plain NB. During aerobic growth, the genes involved in the glpFK operon (the GlpF transporter and the genes from pathway A) were upregulated in the presence of glycerol. On the other hand, the genes belonging to the gol operon (Pathway B) were downregulated, with the exception of the golR repressor, which was upregulated. This suggests that in the conditions we tested, pathway A is in charge of the utilization of glycerol as a carbon source, whereas pathway B is being actively repressed. Notably, previous studies have suggested that these two pathways might be active in different conditions in L. monocytogenes (Deutscher et al., 2014). The expression of Pathway A was found to be induced during growth inside human cells, whereas Pathway B was induced during growth in soil (Deutscher et al., 2014). The effect of environmental and host factors next to that of possible transcriptional and translational regulation of glycerol uptake and metabolism in L. monocytogenes in the absence and presence of oxygen remain to be elucidated. The presence of oxygen is important for biofilm formation in several bacterial species (Colon-Gonzalez et al., 2004; Hölscher et al., 2015; Schauer et al., 2010). In the case of Bacillus subtilis, it has been determined that both motility and aerotaxis play a significant role in pellicle formation (Hölscher et al., 2015). Furthermore, previous research suggests that flagellar motility is required for biofilm formation in L. monocytogenes (Lemon et al., 2007; Vatanyoopaisarn et al., 2000), although other studies show conflicting results (Todhanakasem and Young, 2008). The two component-system CheA/CheY has been previously linked to motility and chemotaxis in B. subtilis and E. coli (Parkinson et al., 2015; Rao et al., 2008). In L. monocytogenes, the genes encoding two proteins with high homology to B. subtilis CheA and CheY are located immediately downstream the flagellin gene (Dons et al., 2004). A study by Flanary et al (Flanary et al., 1999) showed that the mutation of these genes induces reduced flagellin production and swarming in L. monocytogenes, and had a negative effect in the cells response to oxygen gradients. The role of these genes in L. monocytogenes EGDe aerotaxis, however, remains to be elucidated. In order to link the air-liquid interface phenotype and L. monocytogenes aerobic metabolism of glycerol, we performed motility assays. The results showed similar motility levels for cells grown in NA and NA supplemented with glycerol. This suggests that the formation of a biofilm at the air-liquid interface of the culture is not likely caused by an increased motility in the presence of glycerol but merely linked to the aerobic metabolism of this carbon and energy source. Positive aerotaxis has been described as the directed motility of microorganisms towards oxygen in response to a gradient of oxygen concentrations (Hölscher et al., 2015; Shioi et al., 1987). L. monocytogenes is a facultative anaerobic bacterium and, in line with this, our aerotaxis experiments in PBS showed no directed motility at all in the presence of glucose and in the non-supplemented control. Lack of aerotaxis in the presence of glucose is conceivably due to the capacity of L. monocytogenes to metabolize this compound in anaerobic conditions, even if energy generation is not as efficient as in the presence of oxygen. However, in the presence of glycerol, the cells formed a concentrated ring close to the surface of the agar, in a location usually linked to microaerophilic behaviour. As expected, no aerotactic ring was found when the tubes were incubated under anaerobic conditions. Since PBS agar without and with added substrate does not stimulate bacterial growth, it can be assumed that it is glycerol itself what triggers swimming towards the surface. We hypothesize that upon sensing the presence of glycerol in the environment, L. monocytogenes cells move towards higher concentrations of oxygen and transcription of the genes involved in glycerol metabolism starts supporting the utilization of this compound as a carbon source. Ultimately, this behaviour leads to the formation of a biofilm at the air-liquid interface of the culture. This type of biofilm is of particular interest, as it represents a complex environment in which bacterial cells have easy access to both a high concentration of oxygen in the air, and all the nutrients present in the media (Koza et al., 2009).
Acknowledgements This work was supported by the European Union's Horizon 2020 Research and Innovation Framework Programme under the Marie Sklodowska-Curie (List_MAPS) [grant agreement no 641984]. Conflict of interest The authors declare that they have no conflict of interest. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ijfoodmicro.2018.03.009. References Abram, F., Su, W.L., Wiedmann, M., Boor, K.J., Coote, P., Botting, C., Karatzas, K.A.G., O'Byrne, C.P., 2008. Proteomic analyses of a Listeria monocytogenes mutant lacking σB identify new components of the σB regulon and highlight a role for σB in the utilization of glycerol. Appl. Environ. Microbiol. 74, 594–604. Alvarez Mde, F., Medina, R., Pasteris, S.E., Strasser de Saad, A.M., Sesma, F., 2004. Glycerol metabolism of Lactobacillus rhamnosus ATCC 7469: cloning and expression of two glycerol kinase genes. J. Mol. Microbiol. Biotechnol. 7, 170–181. Bizzini, A., Zhao, C., Budin-Verneuil, A., Sauvageot, N., Giard, J.C., Auffray, Y., Hartke, A., 2010. Glycerol is metabolized in a complex and strain-dependent manner in Enterococcus faecalis. J. Bacteriol. 192, 779–785. Colagiorgi, A., Bruini, I., Di Ciccio, P.A., Zanardi, E., Ghidini, S., Ianieri, A., 2017. Listeria monocytogenes biofilms in the wonderland of food industry. Pathogens 6, 41. Colon-Gonzalez, M., Mendez-Ortiz, M.M., Membrillo-Hernandez, J., 2004. Anaerobic growth does not support biofilm formation in Escherichia coli K-12. Res. Microbiol. 155, 514–521. David, D.J.V., Cossart, P., 2017. Recent advances in understanding Listeria monocytogenes infection: the importance of subcellular and physiological context. F1000Res 6, 1126. Deutscher, J., Aké, F.M.D., Zébré, A.C., Cao, T.N., Kentache, T., Monniot, C., Pham, Q.M.M., Mokhtari, A., Joyet, P., Milohanic, E., 2014. Listeria monocytogenes: Food Sources, Prevalence and Management Strategies. Chapter: Carbohydrate Utilization by Listeria monocytogenes and Its Influence on Virulence Gene Expression. Nova Science Publishers. Dons, L., Eriksson, E., Jin, Y., Rottenberg, M.E., Kristensson, K., Larsen, C.N., Bresciani, J., Olsen, J.E., 2004. Role of flagellin and the two-component CheA/CheY system of Listeria monocytogenes in host cell invasion and virulence. Infect. Immun. 72, 3237–3244. Eisenreich, W., Dandekar, T., Heesemann, J., Goebel, W., 2010. Carbon metabolism of intracellular bacterial pathogens and possible links to virulence. Nat. Rev. Microbiol. 8, 401–412. Fernandez Ramirez, M.D., Smid, E.J., Abee, T., Nierop Groot, M.N., 2015. Characterisation of biofilms formed by Lactobacillus plantarum WCFS1 and food spoilage isolates. Int. J. Food Microbiol. 207, 23–29. Ferreira, V., Wiedmann, M., Teixeira, P., Stasiewicz, M.J., 2014. Listeria monocytogenes persistence in food-associated environments: epidemiology, strain characteristics, and implications for public health. J. Food Prot. 77, 150–170. Flanary, P.L., Allen, R.D., Dons, L., Kathariou, S., 1999. Insertional inactivation of the Listeria monocytogenes cheYA operon abolishes response to oxygen gradients and reduces the number of flagella. Can. J. Microbiol. 45, 646–652. Freitag, N.E., Port, G.C., Miner, M.D., 2009. Listeria monocytogenes - from saprophyte to intracellular pathogen. Nat. Rev. Microbiol. 7, 623–628. Gilbreth, S.E., Benson, A.K., Hutkins, R.W., 2004. Catabolite repression and virulence gene expression in Listeria monocytogenes. Curr. Microbiol. 49, 95–98. Gray, M.J., Freitag, N.E., Boor, K.J., 2006. How the bacterial pathogen Listeria monocytogenes mediates the switch from environmental Dr. Jekyll to pathogenic Mr. Hyde.
26
International Journal of Food Microbiology 273 (2018) 20–27
N. Crespo Tapia et al.
Scherer, S., 2014. Identification of genes essential for anaerobic growth of Listeria monocytogenes. Microbiology 160, 752–765. Murarka, A., Dharmadi, Y., Yazdani, S.S., Gonzalez, R., 2008. Fermentative utilization of glycerol by Escherichia coli and its implications for the production of fuels and chemicals. Appl. Environ. Microbiol. 74, 1124–1135. Pagliaro, M., Rossi, M., 2008. The Future of Glycerol: New Usages for a Versatile Raw Material. Chapter: Glycerol: Properties and Production. The Royal Society of Chemistry, Green Chemistry Book Series. Parkinson, J.S., Hazelbauer, G.L., Falke, J.J., 2015. Signaling and sensory adaptation in Escherichia coli chemoreceptors: 2015 update. Trends Microbiol. 23, 257–266. Pfaffl, M.W., Tichopad, A., Prgomet, C., Neuvians, T.P., 2004. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper – Excel-based tool using pair-wise correlations. Biotechnol. Lett. 26, 509–515. Pine, L., Malcolm, G.B., Brooks, J.B., Daneshvar, M.I., 1989. Physiological studies on the growth and utilization of sugars by Listeria species. Can. J. Microbiol. 35, 245–254. Rao, C.V., Glekas, G.D., Ordal, G.W., 2008. The three adaptation systems of Bacillus subtilis chemotaxis. Trends Microbiol. 16, 480–487. Rolhion, N., Cossart, P., 2017. How the study of Listeria monocytogenes has led to new concepts in biology. Future Microbiol 12, 621–638. Schauer, K., Geginat, G., Liang, C., Goebel, W., Dandekar, T., Fuchs, T.M., 2010. Deciphering the intracellular metabolism of Listeria monocytogenes by mutant screening and modelling. BMC Genomics 11, 573. Semkiv, M.V., Dmytruk, K.V., Abbas, C.A., Sibirny, A.A., 2017. Metabolic engineering for high glycerol production by the anaerobic cultures of Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 101, 4403–4416. Shioi, J., Dang, C.V., Taylor, B.L., 1987. Oxygen as attractant and repellent in bacterial chemotaxis. J. Bacteriol. 169, 3118–3123. da Silva, G.P., Mack, M., Contiero, J., 2009. Glycerol: a promising and abundant carbon source for industrial microbiology. Biotechnol. Adv. 27, 30–39. Todhanakasem, T., Young, G.M., 2008. Loss of flagellum-based motility by Listeria monocytogenes results in formation of hyperbiofilms. J. Bacteriol. 190, 6030–6034. Vatanyoopaisarn, S., Nazli, A., Dodd, C.E.R., Rees, C.E.D., Waites, W.M., 2000. Effect of flagella on initial attachment of Listeria monocytogenes to stainless steel. Appl. Environ. Microbiol. 66, 860–863. van der Veen, S., Abee, T., 2010. Importance of SigB for Listeria monocytogenes static and continuous-flow biofilm formation and disinfectant resistance. Appl. Environ. Microbiol. 76, 7854–7860. Vivant, A.L., Garmyn, D., Piveteau, P., 2013. Listeria monocytogenes, a down-to-earth pathogen. Front. Cell. Infect. Microbiol. 3, 87.
Infect. Immun. 74, 2505–2512. Guadalupe Medina, V., Almering, M.J., van Maris, A.J., Pronk, J.T., 2010. Elimination of glycerol production in anaerobic cultures of a Saccharomyces cerevisiae strain engineered to use acetic acid as an electron acceptor. Appl. Environ. Microbiol. 76, 190–195. Guldimann, C., Boor, K.J., Wiedmann, M., Guariglia-Oropeza, V., 2016. Resilience in the face of uncertainty: sigma factor B fine-tunes gene expression to support homeostasis in Gram-positive bacteria. Appl. Environ. Microbiol. 82, 4456–4469. Hölscher, T., Bartels, B., Lin, Y.-C., Gallegos-Monterrosa, R., Price-Whelan, A., Kolter, R., Dietrich, L.E.P., Kovács, Á.T., 2015. Motility, chemotaxis and aerotaxis contribute to competitiveness during bacterial pellicle biofilm development. J. Mol. Biol. 427, 3695–3708. Joseph, B., Mertins, S., Stoll, R., Schar, J., Umesha, K.R., Luo, Q., Muller-Altrock, S., Goebel, W., 2008. Glycerol metabolism and PrfA activity in Listeria monocytogenes. J. Bacteriol. 190, 5412–5430. Kodaka, H., Armfield, A.Y., Lombard, G.L., Dowell, V.R., 1982. Practical procedure for demonstrating bacterial flagella. J. Clin. Microbiol. 16, 948–952. Koza, A., Hallett, P.D., Moon, C.D., Spiers, A.J., 2009. Characterization of a novel airliquid interface biofilm of Pseudomonas fluorescens SBW25. Microbiology 155, 1397–1406. Lemon, K.P., Higgins, D.E., Kolter, R., 2007. Flagellar motility is critical for Listeria monocytogenes biofilm formation. J. Bacteriol. 189, 4418–4424. Lemon, K.P., Earl, A.M., Vlamakis, H.C., Aguilar, C., Kolter, R., 2008. Biofilm development with an emphasis on Bacillus subtilis. Curr. Top. Microbiol. Immunol. 322, 1–16. Martinez-Suarez, J.V., Ortiz, S., Lopez-Alonso, V., 2016. Potential impact of the resistance to quaternary ammonium disinfectants on the persistence of Listeria monocytogenes in food processing environments. Front. Microbiol. 7, 638. Metselaar, K.I., den Besten, H.M.W., Boekhorst, J., van Hijum, S.A.F.T., Zwietering, M.H., Abee, T., 2015. Diversity of acid stress resistant variants of Listeria monocytogenes and the potential role of ribosomal protein S21 encoded by rpsU. Front. Microbiol. 6, 422. Milenbachs, A.A., Brown, D.P., Moors, M., Youngman, P., 1997. Carbon-source regulation of virulence gene expression in Listeria monocytogenes. Mol. Microbiol. 23, 1075–1085. Monniot, C., Zebre, A.C., Ake, F.M., Deutscher, J., Milohanic, E., 2012. Novel listerial glycerol dehydrogenase- and phosphoenolpyruvate-dependent dihydroxyacetone kinase system connected to the pentose phosphate pathway. J. Bacteriol. 194, 4972–4982. Møretrø, T., Langsrud, S., 2004. Listeria monocytogenes: biofilm formation and persistence in food-processing environments. Biofilms 1, 107–121. Müller-Herbst, S., Wustner, S., Muhlig, A., Eder, D., Fuchs, T.M., Held, C., Ehrenreich, A.,
27
Contents lists available at ScienceDirect
International Journal of Food Microbiology journal homepage: www.elsevier.com/locate/ijfoodmicro
Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface
T
⁎
Natalia Crespo Tapia, Heidy M.W. den Besten, Tjakko Abee
Wageningen University & Research, Laboratory of Food Microbiology, P.O. Box 17, 6700 AA Wageningen, The Netherlands
A R T I C LE I N FO
A B S T R A C T
Keywords: Listeria monocytogenes Glycerol Biofilm Aerotaxis Metabolism
Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in foodprocessing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source.
1. Introduction Listeria monocytogenes is a food-borne pathogen that causes listeriosis, which is a life-threatening disease that presents 20–30% of mortality rate in people at risk (David and Cossart, 2017; Møretrø and Langsrud, 2004; Rolhion and Cossart, 2017). This microorganism is a Gram-positive, motile bacterium that can be present in food-processing environments, where it can grow as a biofilm on the surface of the equipment, as well as in pipes and drains (Colagiorgi et al., 2017; Møretrø and Langsrud, 2004). When L. monocytogenes cells detach from the biofilm matrix they might colonize food products as they pass through the food-processing line (Colagiorgi et al., 2017). Due to their increased resistance to disinfectants and cleaning strategies (Ferreira et al., 2014; Martinez-Suarez et al., 2016), L. monocytogenes biofilms are a major concern for food safety. Besides its ability to grow as a biofilm, another important reason for the presence and persistence of L. monocytogenes in the food-processing industry is its ability to survive and adapt to growth in different niches and conditions (Møretrø and Langsrud, 2004). Indeed, as a saprophytic environmental bacterium, commensal microorganism for certain animals, and human pathogen, L. monocytogenes has the ability to survive
⁎
in a broad range of environments (Ferreira et al., 2014; Gray et al., 2006; Pine et al., 1989; Vivant et al., 2013). Its growth in soil makes it able to utilize many different carbon and energy sources that are derived from plants and animal waste (Deutscher et al., 2014). From the soil, the bacteria can get transmitted to animals and plants, and eventually make their way into food-processing environments. Here it can contaminate vegetables, dairy products, meat and many other food products, and finally cause infection in the human host upon ingestion of contaminated food. Therefore, L. monocytogenes needs to be able to utilize the carbon sources that are available inside the human body. The presence or absence of specific carbon sources can regulate the expression of the majority of virulence genes (Eisenreich et al., 2010; Freitag et al., 2009; Joseph et al., 2008; Milenbachs et al., 1997). It has been reported that the presence of sugars that are metabolized via the phosphoenolpyruvate (PEP):carbohydrate phosphotransferase system (PTS), such as glucose and cellobiose, leads to a strong inhibition of PrfA activity, the main controller of virulence in L. monocytogenes (Deutscher et al., 2014). On the other hand, non-PTS carbon sources such as glycerol are believed to induce a high level of activation of PrfAdependent genes (Joseph et al., 2008). Previous studies have identified a role in glycerol metabolism for the alternative sigma factor B (σB)
Corresponding author. E-mail address: [email protected] (T. Abee).
https://doi.org/10.1016/j.ijfoodmicro.2018.03.009 Received 4 December 2017; Received in revised form 12 March 2018; Accepted 13 March 2018 Available online 15 March 2018 0168-1605/ © 2018 Elsevier B.V. All rights reserved.
International Journal of Food Microbiology 273 (2018) 20–27
N. Crespo Tapia et al.
250 μL and 1 mL of total volume, respectively. The plates were statically incubated in NB with and without carbon source supplementation for 48 h at 30 °C, and subsequently stained with 0.1% (w/v) crystal violet (CV) solution as previously described (Fernandez Ramirez et al., 2015). Briefly, the wells were washed twice with PBS, left to dry for 5 min, and stained with 250 μL or 1 mL of 0.1% CV for 30 min. After staining, images of the biofilm's position in the 24-well plate were taken with a 12 MP camera (Apple). For biofilm quantification experiments, the bound crystal violet was dissolved from the biofilm grown in the 96well plate with 70% ethanol for 15 min, after which the absorbance was measured at 595 nm with the Spectramax M2 plate reader (Molecular Devices). Experiments were performed in three independent reproductions, with three technical replicates each.
(Abram et al., 2008), which is a transcriptional regulator involved in virulence and the general stress response in L. monocytogenes (Guldimann et al., 2016). Mutants lacking σB show increased sensitivity to a broad range of environmental stresses, such as heat and low pH, and have also been shown to utilize glycerol inefficiently compared to the wild type strain (Abram et al., 2008). Some studies suggest that σB is also involved in the process of biofilm formation (van der Veen and Abee, 2010). However, the role of glycerol metabolism in biofilm formation in L. monocytogenes has not been investigated yet. Being a common fermentation product (Guadalupe Medina et al., 2010; Semkiv et al., 2017), and widely used in food production as a food additive (Pagliaro and Rossi, 2008), glycerol can be encountered by bacteria in the food-processing environment. Most bacterial species are able to utilize glycerol as a carbon source (da Silva et al., 2009). Once glycerol has been taken up by the cell via facilitated diffusion, it can follow two different metabolic pathways. One pathway begins with the phosphorylation of glycerol to glycerol-3-phosphate (Glycerol-3P) by a glycerol kinase, and subsequent conversion into dihydroxyacetone phosphate (DHA-P) via a glycerol-3P dehydrogenase. Alternatively, glycerol may be first oxidized to dihydroxyacetone (DHA) by a glycerol dehydrogenase, and then phosphorylated into DHA-P by a dihydroxyacetone kinase (Bizzini et al., 2010; Monniot et al., 2012). L. monocytogenes is also able to utilize glycerol as a carbon source and its main glycerol metabolic pathway, usually referred to as the glpFK operon, includes the GlpF facilitator, the GlpK kinase, and the GlpD glycerol-3P dehydrogenase. The second metabolic route mentioned before has not been fully characterized in this microorganism yet, but some of its components have already been described (Deutscher et al., 2014). This system has been mainly studied in L. innocua, where it is encoded by the gol operon (Monniot et al., 2012). In silico analysis of L. monocytogenes genome sequence has confirmed the presence of an operon homologous to L. innocua's gol operon (Monniot et al., 2012). In this study the impact of glycerol on L. monocytogenes biofilm production was analysed. When grown in liquid media, L. monocytogenes biofilms are usually located at the bottom of the wells or all over the wells. In our experiments, however, the presence of glycerol in the media consistently induced the formation of a biofilm at the airliquid interface of the well. After further investigation of this specific phenotype, a link was found between the capacity of L. monocytogenes to metabolize glycerol under aerobic conditions, and aerotaxis of cells grown in the presence of glycerol.
2.3. Planktonic growth curves NB medium (25 mL) with and without supplements was inoculated with 1% (v/v) of bacterial overnight culture. Cultures were incubated at 30 °C under aerobic (160 rpm shaking) or anaerobic (Anoxomat modified atmosphere, MART) conditions for up to 48 h (Anaerobic mixture 0% O2, 10% CO2, 5% H2, 85% N2). OD600 measurements were taken every 2 h during the first 10 h of incubation, with two final samplings at 24 and 48 h. Anaerobic conditions were disturbed briefly for each time point during sampling, but no appreciable effect on bacterial growth was observed. The experiment was performed in three independent reproductions. 2.4. Metabolic activity The Phenol Red pH indicator tubes assay was performed as follows. Briefly, glass tubes were inoculated with 5 mL of Phenol Red broth (10 g/L casein peptone, 5 g/L NaCl, 0.018 g/L Phenol Red) with or without glucose or glycerol supplementation, and 1% (v/v) inoculum of the bacterial overnight culture. The tubes were then incubated at 30 °C under aerobic (160 rpm shaking) or anaerobic (Anoxomat modified atmosphere) conditions. A color switch of the medium from red to yellow shows acidification of the media caused by bacterial metabolic activity. Experiments were performed in two independent reproductions, with two technical replicates each. Pictures of the tubes were taken after 48 h of incubation (12 MP camera, Apple). 2.5. High pressure liquid chromatography (HPLC)
2. Material and methods NB medium (25 mL) with and without supplements was inoculated with 1% (v/v) of bacterial overnight culture. Cultures were incubated at 30 °C under aerobic (160 rpm shaking) or anaerobic (Anoxomat modified atmosphere) conditions. 1 mL samples were taken at time zero and after 10, 24 and 48 h of growth. After centrifugation, the cell pellet was removed and the supernatant was treated for protein decontamination with Carrez A (K4FE(CN)6.3H20, Merck) and B (ZnSO·73H20, Merck) (2fold dilution) and 2-fold diluted with MilliQ. The experiment was performed twice, with two technical replicates per experiment. Additionally, a standard curve of known concentrations of glycerol was prepared (2-fold dilutions, from 37.5 mM to 1.2 mM; detection limit 1.2 mM), in order to quantify the concentration of glycerol present in the supernatant of our samples. The HPLC was performed on an Ultimate 3000 HPLC (Dionex) equipped with an RI-101 refractive index detector (Shodex, Kawasaki, Japan), an autosampler and an ion-exclusion Aminex HPX – 87H column (7.8 × 300 mm) with a guard column (Bio-Rad, Hercules, CA). As mobile phase, 5 mM H2SO4 was used at a flow rate of 0.6 mL/min, and the column was kept at 40 °C. Total run time was 30 min. The injection volume was 10 μL.
2.1. Bacterial strains and growth conditions All experiments performed in this study were carried out with L. monocytogenes strain EGDe (ATCC BAA-679). Bacterial stocks were stored at −80 °C in Brain Heart Infusion (BHI) broth (Becton Dickinson Difco) supplemented with 15% glycerol (Fluka). Working cultures were prepared by inoculating 10 mL of BHI broth with a single colony from a BHI agar (1.5%, Oxoid) plate and grown shaking (160 rpm) overnight at 30 °C (final concentration 109 CFU/mL). The culturing medium used in all experiments was nutrient broth (NB, Oxoid) and NB supplemented with 1% (w/v) glucose (Sigma-Aldrich) or glycerol (Fluka) unless specified otherwise. Stocks of 25% glucose and glycerol diluted with demineralized water were autoclaved separately and added to the media. Phosphate buffered saline (PBS) was prepared by dissolving 8.98 g di‑sodium hydrogen phosphate (Merck), 2.72 g sodium dihydrogen phosphate (Merck) and 8.5 g sodium chloride (Sigma-Aldrich) in 1 L demineralized water. 2.2. Crystal violet staining
2.6. Motility assays Polystyrene 96- and 24-well plates (Sigma-Aldrich) were inoculated with 1% (v/v) of bacterial overnight culture. Each well was filled with
For swimming assays, 5 μL of an overnight culture were spot 21
International Journal of Food Microbiology 273 (2018) 20–27
N. Crespo Tapia et al.
RT-PCR as described before (Metselaar et al., 2015). Briefly, the conditions were set up as follows: initial denaturation (4 min at 95 °C), amplification (40 cycles of 95 °C for 15 s, 59 °C for 1 min) and a melting step (65–95 °C with 0.5 °C steps) to confirm the formation of a single product. Primer efficiency was checked by the standard curve method. The efficiencies of all primers ranged from 1.99 to 1.89 (R2 above 0.99). Relative expression of the target genes in the presence of glycerol was analysed with the ΔΔCt method using samples grown in non-supplemented NB as control, and normalization of the expression of the target genes with the 16S rRNA gene (Abram et al., 2008; Metselaar et al., 2015). Final values were plotted as the fold change in gene expression levels of NB-Glycerol cultures over the NB control. The same procedure was followed for aerobic and anaerobic samples.
inoculated onto 0.3% nutrient agar (NA) plates with and without 1% glucose or glycerol. For the aerotaxis experiments, approximately 109 cells from an overnight culture of L. monocytogenes were centrifuged (5 min, 3000 ×g), washed twice with PBS and resuspended in 50 μL of PBS. The highly concentrated cell suspension was then inoculated in 5 mL of PBS agar (0.3%) tubes, supplemented with 1% glucose or glycerol when necessary. The inoculation of the bacteria into the agar tubes was carried out once the agar had cooled down enough to be handled easily by hand to mix the agar and the cells. The plates and tubes were incubated at 30 °C, in aerobic and anaerobic (Anoxomat modified atmosphere) conditions. Pictures of the swimming halos (geldoc system, UVItec Alliance) and aerotactic rings (12 MP camera, Apple) were taken after 24–48 h. Both experiments were performed with 3 independent cultures.
2.9. Statistical analysis 2.7. Flagella staining A two-tailed Student's t-test was used to determine statistically significant differences in biofilm production between aerobic and anaerobic cultures grown in the presence of glucose or glycerol, compared to those grown in non-supplemented NB. Significant differences in gene expression levels and glycerol consumption between cells grown aerobically and anaerobically was determined by the same method. P values of 0.05 or lower were considered statistically significant.
L. monocytogenes cultures were grown at 30 °C in NB and NB supplemented with 1% glucose or glycerol, in aerobic and anaerobic conditions. Samples were taken after 24 h of incubation following inoculation of the growth media, and checked for motility directly under the microscope. Subsequently, the slides were treated with Ryu flagella stain, prepared as described (Kodaka et al., 1982) and cells were checked under the microscope for the presence or absence of flagella. The experiment was performed in 2 independent reproductions. Two to three representative images of each sample were taken with CellB software.
3. Results 3.1. The presence of glycerol in the medium induces air-liquid interface biofilm formation
2.8. Quantification of gene expression levels 2.8.1. RNA extraction and reverse transcription L. monocytogenes cultures were grown at 30 °C in NB and NB supplemented with 1% glycerol, in aerobic and anaerobic conditions. Samples for RNA extraction were taken after 5 h of incubation (early or late exponential phase, see Fig.2B) and immediately stabilized with Bacterial RNAProtect (Qiagen), following the manufacturer's instructions. Cell lysis was performed by bead beating (Fast Prep, settings 6 m/ s 30 s twice, rest 5 min on ice, twice). From here on, the RNeasy mini kit (Qiagen) was followed according to the manufacturer's instructions, including the in-column DNase treatment. RNA concentration was determined via UV absorbance at 260 nm (BioPhotometer Eppendorf), and its integrity was assessed by gel electrophoresis. cDNA synthesis was performed with the Superscript III inverse transcriptase (Invitrogen), following the manufacturer's instructions. Samples were stored at -80 °C until RT-PCR analysis.
L. monocytogenes biofilms were incubated without shaking for 48 h at 30 °C. After CV staining, cultures grown in the presence of glycerol showed a distinct air-liquid interface biofilm formation, in contrast to the biofilms formed in NB or NB supplemented with glucose, where most of the biomass was found at the bottom of the well (Fig. 1A). Interestingly, when biofilms were grown under anaerobic conditions, the air-liquid interface phenotype was lost, and the stained appearance of glycerol-grown biofilms closely resembled those grown in non-supplemented NB (Fig. 1A). Additionally, OD595 measurements of bound CV showed significantly higher biofilm production in the presence of glycerol under aerobic conditions when compared to non-supplemented NB, whereas biofilms grown anaerobically in the presence of glycerol showed CV staining levels similar to those from biofilms grown in plain NB (Fig. 1B). Biofilm production in NB supplemented with glucose is also reduced in anaerobic conditions compared to biofilms grown in the presence of oxygen, but they are still significantly different from the ones grown in NB under the same conditions (Fig. 1B).
2.8.2. Primer design and qRT-PCR Table 1 shows a list of all primers used in this study. After analysis of the stability of a set of potential reference genes by Bestkeeper (Pfaffl et al., 2004) the 16S rRNA gene was selected for normalization of the samples. The primers for the target genes were designed with the primer3 online software, and their specificity was checked by gel electrophoresis of the PCR products. The qRT-PCR was performed using SYBRgreen PCR MasterMix (Applied Biosystems) in a Bio-Rad CFX96
3.2. The presence of glycerol enhances planktonic growth under aerobic conditions The previous results suggested that the influence of glycerol in L. monocytogenes' biofilm production is restricted to growth under aerobic
Table 1 Primers used for RT-PCR experiments. Target
Product size (bp)
Forward primer
Reverse primer
Melting T (°C) f/r
Source
16S glpF glpK glpD golD dhaL golR
116 96 62 117 78 68 80
GATGCATAGCCGACCTGAGA CCATCTTAACCCCGCAGTAA AGTTCCGGTTGCAGGTATTG GGAAAGACGCTGTTGTGGAT AAATTATCGGTCGCGAAATG GAAAGGTCGCGCACTAAGAC AGAAGCGGCGACTTTAGTGA
TGCTCCGTCAGACTTTCGTC GCCCCAATAAACTGAGCAAG CGAAACAACCTTGACCGAAT AATCAGCCGGTTCTCTAGCA GTGCGATGACAGAAGCTTGA AAGACGATTCAGAGCCAGGA ATTCTTTTGCAAGCGCAAGT
65.3/65.6 63.6/64.2 63.8/63.8 64.0/63.8 63.5/64.3 63.8/63.9 63.9/63.7
(Metselaar et al., 2015) This study This study This study This study This study This study
22
International Journal of Food Microbiology 273 (2018) 20–27
N. Crespo Tapia et al.
Fig. 1. Biofilm production of L. monocytogenes biofilms after growth for 48 h at 30 °C in NB and NB supplemented with glucose (GLU) and glycerol (GLY), under aerobic (O2) and anaerobic (AnO2) conditions. A) Representative images of localization of CV-stained biofilms. Black arrow shows clear air-liquid interface biofilm formation on aerobic NB-Glycerol sample. B) OD595 measurements of CV-stained biofilms. Error bars show standard deviation of three independent reproductions. Results significantly different from NB are highlighted with *.
On the other hand, the planktonic performance of cells grown in NB supplemented with glycerol only showed an increase in OD600 when they were incubated in the presence of oxygen. Under anaerobic conditions, the growth curves of cells grown in plain NB and in NB supplemented with glycerol were similar (Fig. 2B).
conditions. Therefore, it was decided to assess planktonic performance and metabolic activity of cells grown in the presence of glycerol, under aerobic and anaerobic conditions. The Phenol Red pH indicator test shows that L. monocytogenes can metabolize glucose both aerobically and anaerobically, whereas in the presence of glycerol metabolic activity was only detected in tubes with aerobically grown cells (Fig. 2A). These results correlated with the planktonic performance of L. monocytogenes in the same experimental conditions. Based on cell density absorbance measurements (OD600), the presence of glucose in the medium enhanced the growth of L. monocytogenes compared to non-supplemented NB, at both aerobic and anaerobic conditions (Fig. 2B).
3.3. Oxygen conditions influence the expression of genes involved in glycerol metabolism Some studies support the existence of two different glycerol pathways in L. monocytogenes (Monniot et al., 2012; Deutscher et al., 2014), which are shown in Fig. 3A.
Fig. 2. L. monocytogenes behaviour grown in Phenol Red media (A) or in NB (B), with and without glucose (GLU) or glycerol (GLY), in aerobic (O2) and anaerobic (AnO2) conditions. A) Phenol Red pH indicator tubes assay. The presence and absence of metabolic activity with different carbon sources is indicated by the yellow and red coloration of the media, respectively. Phenol Red media without inoculum (MEDIA) and with inoculum (MEDIA + inoculum) were used as controls. B) Planktonic growth curves of cells grown at 30 °C NB without and with added GLU or GLY, expressed in OD600 absorbance measurements over time. Each time point represents the mean of three biological replicates; error bars correspond to the standard deviation. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
23
International Journal of Food Microbiology 273 (2018) 20–27
N. Crespo Tapia et al.
Fig. 3. L. monocytogenes' glycerol metabolism. A) Schematic representation of predicted metabolic pathways. After glycerol is taken into the cells, it can be metabolized into dihydroxyacetone phosphate (DHA-P) in two different ways (pathway A in green and B in orange). The glycerol facilitator glpF (in gray) is common to both pathways. B) Relative gene expression levels of both pathways in NB supplemented with glycerol over NB. After 5 h of incubation, aerobic (O2) and anaerobic (AnO2) samples correspond to full and pattern bars, respectively. Error bars represent the standard deviation of two independent reproductions. * represents significant differences in relative expression between aerobic and anaerobic samples (Student's t-test, P < 0.05). C) Glycerol consumption of cultures grown under aerobic (O2) and anaerobic (AnO2) conditions. Samples were taken after 48 h of incubation and measured with HPLC. Error bars represent the standard deviation of two independent reproductions. * shows a significant difference between both conditions (Student's t-test, P < 0.05). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
In pathway A (Fig. 3A, green), glycerol is first phosphorylated into glycerol-3P by the kinase GlpK. Afterwards, the glycerol-3P is oxidized into DHA-P by the glycerol-3P dehydrogenase GlpD. Pathway B (Fig. 3A, orange) is proposed to start with the oxidation of glycerol into DHA by the recently described glycerol dehydrogenase GolD (Monniot et al., 2012). The resultant DHA is then phosphorylated into DHA-P by the DhaL/DhaK system. The DHA-P produced by both pathways can then be utilized by the cell in several metabolic reactions. In this study the relative expression of selected genes of these two pathways was analysed in aerobic and anaerobic conditions. Fig. 3B shows that there is a clear difference in the expression of the glycerol metabolism genes. With the exception of glpD (P = 0.07), all tested genes showed a significant difference in gene expression between aerobic and anaerobic conditions (P < 0.05). In the presence of oxygen, the glpF gene encoding the glycerol facilitator and the genes involved in pathway A were upregulated in NB supplemented with glycerol compared to the non-supplemented NB. On the other hand, pathway B genes golD and dhaL were downregulated (Fig. 3B). Indeed, the putative repressor of this pathway, golR, was upregulated only in aerobically grown cultures. When cells were grown anaerobically all of the target genes were downregulated in the presence of glycerol compared to plain NB (Fig. 3B).
presence of oxygen consumed up to 20 mmol/L of glycerol, whereas glycerol consumption of cells grown anaerobically was < 1 mmol/L (Fig. 3C), and significantly different from the aerobic cultures (P < 0.05).
3.5. The presence of glycerol in the media induces aerotaxis in L. monocytogenes It was then decided to investigate the role of motility and aerotaxis in the formation of the air-liquid interface biofilms in L. monocytogenes. As shown in Fig. 4A, motility assays showed slightly reduced swimming of aerobically-grown L. monocytogenes cells in 0.3% nutrient agar (NA) supplemented with glucose, compared to plain NA and NA supplemented with glycerol. However, the diameters of the halos were very similar for NA and NA supplemented with glycerol (Fig. 4A). Cells incubated anaerobically showed the same trend as cells grown in the presence of oxygen, but were overall less motile (Fig. S2A). Cells were also stained for flagella to confirm motility results. Flagellated cells were found in all tested conditions, although in different amounts. In general, cultures grown in plain NB and NB supplemented with glycerol showed higher numbers of flagellated cells, compared to NB supplemented with glucose (Fig. 4B), which matched the results obtained in the swimming assays. A similar trend was observed in the anaerobic samples (Fig. S2B). The number of flagella per cell could not be quantified. Additionally, aerotaxis experiments were performed in conditions that do not stimulate growth. For this, PBS tubes supplemented with 0.3% agar were inoculated with a high concentration of bacterial cells (approximately 109 cfu/mL), incubated at 30 °C for 48 h in the presence and absence of oxygen, and used to assess motility of the cells towards the surface of the tube, where the concentration of oxygen is higher. The results showed no change in appearance between the non-supplemented PBS control tubes and the tubes supplemented with glucose after 48 h of incubation (Fig. 4C). On the other hand, when the PBS agar
3.4. L. monocytogenes requires oxygen to be able to import and utilize glycerol To further investigate L. monocytogenes' ability to metabolize glycerol under aerobic and anaerobic conditions, we measured glycerol consumption over time. Samples taken after 10, 24 and 48 h of incubation were compared with samples taken at time zero (T0), and the amount of glycerol left in the supernatant was quantified with HPLC. The amount of glycerol at T0 minus the amount of glycerol left after incubation was defined as glycerol consumption (Fig. S1). The results showed that after 48 h of incubation at 30 °C, cells grown in the 24
International Journal of Food Microbiology 273 (2018) 20–27
N. Crespo Tapia et al.
Fig. 4. Motility and aerotaxis of cells grown at 30 °C, under aerobic conditions. A) Swimming halos of cells spot inoculated in non-supplemented NA (Control) and NA supplemented with glucose and glycerol. Plates were imaged after 24 h of incubation. B) Flagella stained cells grown in NB (Control) and NB supplemented with glucose and glycerol. Samples were taken after 24 h of incubation, treated with the Ryu stain technique, and visualized under the microscope (100×). White arrows point to flagellated cells. Scale bar represents 10 μm. C) Aerotaxis experiment of cells incubated in soft PBS agar tubes (Control), supplemented with glucose or glycerol. White arrow shows concentration of the cells at the surface of the tube. Images were taken after 48 h of incubation.
Glucose might be L. monocytogenes's preferred carbon source in most conditions (Gilbreth et al., 2004), but this micro-organism is also capable of using many alternative compounds, including glycerol (Deutscher et al., 2014), a compound present in food-processing environments and fermented foods. Previous studies have shown that L. monocytogenes can utilize glucose as a carbon source under aerobic and anaerobic conditions (Pine et al., 1989). It is known that several bacterial species can use glycerol under anaerobic conditions as well (da Silva et al., 2009). For instance, E. coli possess two isoforms of the glycerol 3-P dehydrogenase, which are active in either aerobic or anaerobic conditions (Murarka et al., 2008). Additionally, it has been demonstrated that in Enterococci spp. the two main glycerol pathways are induced in the presence of oxygen, whereas under anaerobic conditions only pathway B is active (Bizzini et al., 2010). In contrast, other bacterial species like Lactobacillus rhamnosus, are unable to utilize glycerol anaerobically (Alvarez Mde et al., 2004). A study by Müller-Herbst et al. (2014) reported that the expression of glpF, glpK and glpD is downregulated under anaerobic conditions in L. monocytogenes. In line with this study, we found that all genes involved in glycerol metabolism analysed in our experiments were downregulated during anaerobic growth with glycerol as the carbon source,
was supplemented with glycerol a distinct ring of concentrated cells located very close to the surface of the tubes was observed, in a position that generally represents microaerophilic behaviour (Fig. 4C). This phenotype was not found when the tubes were incubated under anaerobic conditions (Fig. S2C).
4. Discussion We report here the formation of an air-liquid interface biofilm by L. monocytogenes, induced by the presence of glycerol in the media. The work described in this study corresponds to laboratory strain EGDe; however, we performed a screening with 19 additional L. monocytogenes strains (from different origins, including food isolates) and most of them showed the same behaviour (data not shown). Our results showed that both glucose and glycerol enhanced growth and biofilm production under aerobic conditions in comparison with non-supplemented NB. On the other hand, in anaerobic conditions only the addition of glucose to the media showed an enhanced effect. This strongly suggests that L. monocytogenes might not be able to use glycerol efficiently without oxygen. Although the incubation temperature used in this study was 30 °C, additional experiments showed that similar phenotypes are also present at room temperature (data not shown). 25
International Journal of Food Microbiology 273 (2018) 20–27
N. Crespo Tapia et al.
Unlike the floating cell aggregates known as pellicles formed by other bacteria (Lemon et al., 2008), the biofilm formed by L. monocytogenes was found to be surfaced-attached. This study extends the knowledge on biofilm formation capacity and characteristics of this highly versatile human pathogen that has been shown to be persistent in food-processing environments (Møretrø and Langsrud, 2004). Furthermore, we show that L. monocytogenes cannot use glycerol anaerobically, which provides additional information about the behaviour of this microorganism in glycerol-containing food products. Future studies aim to characterize this type of L. monocytogenes biofilm in more detail, including matrix composition and the mechanism behind the transcriptional regulation of the glycerol metabolism genes by environmental conditions including temperature and oxygen.
compared to plain NB. During aerobic growth, the genes involved in the glpFK operon (the GlpF transporter and the genes from pathway A) were upregulated in the presence of glycerol. On the other hand, the genes belonging to the gol operon (Pathway B) were downregulated, with the exception of the golR repressor, which was upregulated. This suggests that in the conditions we tested, pathway A is in charge of the utilization of glycerol as a carbon source, whereas pathway B is being actively repressed. Notably, previous studies have suggested that these two pathways might be active in different conditions in L. monocytogenes (Deutscher et al., 2014). The expression of Pathway A was found to be induced during growth inside human cells, whereas Pathway B was induced during growth in soil (Deutscher et al., 2014). The effect of environmental and host factors next to that of possible transcriptional and translational regulation of glycerol uptake and metabolism in L. monocytogenes in the absence and presence of oxygen remain to be elucidated. The presence of oxygen is important for biofilm formation in several bacterial species (Colon-Gonzalez et al., 2004; Hölscher et al., 2015; Schauer et al., 2010). In the case of Bacillus subtilis, it has been determined that both motility and aerotaxis play a significant role in pellicle formation (Hölscher et al., 2015). Furthermore, previous research suggests that flagellar motility is required for biofilm formation in L. monocytogenes (Lemon et al., 2007; Vatanyoopaisarn et al., 2000), although other studies show conflicting results (Todhanakasem and Young, 2008). The two component-system CheA/CheY has been previously linked to motility and chemotaxis in B. subtilis and E. coli (Parkinson et al., 2015; Rao et al., 2008). In L. monocytogenes, the genes encoding two proteins with high homology to B. subtilis CheA and CheY are located immediately downstream the flagellin gene (Dons et al., 2004). A study by Flanary et al (Flanary et al., 1999) showed that the mutation of these genes induces reduced flagellin production and swarming in L. monocytogenes, and had a negative effect in the cells response to oxygen gradients. The role of these genes in L. monocytogenes EGDe aerotaxis, however, remains to be elucidated. In order to link the air-liquid interface phenotype and L. monocytogenes aerobic metabolism of glycerol, we performed motility assays. The results showed similar motility levels for cells grown in NA and NA supplemented with glycerol. This suggests that the formation of a biofilm at the air-liquid interface of the culture is not likely caused by an increased motility in the presence of glycerol but merely linked to the aerobic metabolism of this carbon and energy source. Positive aerotaxis has been described as the directed motility of microorganisms towards oxygen in response to a gradient of oxygen concentrations (Hölscher et al., 2015; Shioi et al., 1987). L. monocytogenes is a facultative anaerobic bacterium and, in line with this, our aerotaxis experiments in PBS showed no directed motility at all in the presence of glucose and in the non-supplemented control. Lack of aerotaxis in the presence of glucose is conceivably due to the capacity of L. monocytogenes to metabolize this compound in anaerobic conditions, even if energy generation is not as efficient as in the presence of oxygen. However, in the presence of glycerol, the cells formed a concentrated ring close to the surface of the agar, in a location usually linked to microaerophilic behaviour. As expected, no aerotactic ring was found when the tubes were incubated under anaerobic conditions. Since PBS agar without and with added substrate does not stimulate bacterial growth, it can be assumed that it is glycerol itself what triggers swimming towards the surface. We hypothesize that upon sensing the presence of glycerol in the environment, L. monocytogenes cells move towards higher concentrations of oxygen and transcription of the genes involved in glycerol metabolism starts supporting the utilization of this compound as a carbon source. Ultimately, this behaviour leads to the formation of a biofilm at the air-liquid interface of the culture. This type of biofilm is of particular interest, as it represents a complex environment in which bacterial cells have easy access to both a high concentration of oxygen in the air, and all the nutrients present in the media (Koza et al., 2009).
Acknowledgements This work was supported by the European Union's Horizon 2020 Research and Innovation Framework Programme under the Marie Sklodowska-Curie (List_MAPS) [grant agreement no 641984]. Conflict of interest The authors declare that they have no conflict of interest. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ijfoodmicro.2018.03.009. References Abram, F., Su, W.L., Wiedmann, M., Boor, K.J., Coote, P., Botting, C., Karatzas, K.A.G., O'Byrne, C.P., 2008. Proteomic analyses of a Listeria monocytogenes mutant lacking σB identify new components of the σB regulon and highlight a role for σB in the utilization of glycerol. Appl. Environ. Microbiol. 74, 594–604. Alvarez Mde, F., Medina, R., Pasteris, S.E., Strasser de Saad, A.M., Sesma, F., 2004. Glycerol metabolism of Lactobacillus rhamnosus ATCC 7469: cloning and expression of two glycerol kinase genes. J. Mol. Microbiol. Biotechnol. 7, 170–181. Bizzini, A., Zhao, C., Budin-Verneuil, A., Sauvageot, N., Giard, J.C., Auffray, Y., Hartke, A., 2010. Glycerol is metabolized in a complex and strain-dependent manner in Enterococcus faecalis. J. Bacteriol. 192, 779–785. Colagiorgi, A., Bruini, I., Di Ciccio, P.A., Zanardi, E., Ghidini, S., Ianieri, A., 2017. Listeria monocytogenes biofilms in the wonderland of food industry. Pathogens 6, 41. Colon-Gonzalez, M., Mendez-Ortiz, M.M., Membrillo-Hernandez, J., 2004. Anaerobic growth does not support biofilm formation in Escherichia coli K-12. Res. Microbiol. 155, 514–521. David, D.J.V., Cossart, P., 2017. Recent advances in understanding Listeria monocytogenes infection: the importance of subcellular and physiological context. F1000Res 6, 1126. Deutscher, J., Aké, F.M.D., Zébré, A.C., Cao, T.N., Kentache, T., Monniot, C., Pham, Q.M.M., Mokhtari, A., Joyet, P., Milohanic, E., 2014. Listeria monocytogenes: Food Sources, Prevalence and Management Strategies. Chapter: Carbohydrate Utilization by Listeria monocytogenes and Its Influence on Virulence Gene Expression. Nova Science Publishers. Dons, L., Eriksson, E., Jin, Y., Rottenberg, M.E., Kristensson, K., Larsen, C.N., Bresciani, J., Olsen, J.E., 2004. Role of flagellin and the two-component CheA/CheY system of Listeria monocytogenes in host cell invasion and virulence. Infect. Immun. 72, 3237–3244. Eisenreich, W., Dandekar, T., Heesemann, J., Goebel, W., 2010. Carbon metabolism of intracellular bacterial pathogens and possible links to virulence. Nat. Rev. Microbiol. 8, 401–412. Fernandez Ramirez, M.D., Smid, E.J., Abee, T., Nierop Groot, M.N., 2015. Characterisation of biofilms formed by Lactobacillus plantarum WCFS1 and food spoilage isolates. Int. J. Food Microbiol. 207, 23–29. Ferreira, V., Wiedmann, M., Teixeira, P., Stasiewicz, M.J., 2014. Listeria monocytogenes persistence in food-associated environments: epidemiology, strain characteristics, and implications for public health. J. Food Prot. 77, 150–170. Flanary, P.L., Allen, R.D., Dons, L., Kathariou, S., 1999. Insertional inactivation of the Listeria monocytogenes cheYA operon abolishes response to oxygen gradients and reduces the number of flagella. Can. J. Microbiol. 45, 646–652. Freitag, N.E., Port, G.C., Miner, M.D., 2009. Listeria monocytogenes - from saprophyte to intracellular pathogen. Nat. Rev. Microbiol. 7, 623–628. Gilbreth, S.E., Benson, A.K., Hutkins, R.W., 2004. Catabolite repression and virulence gene expression in Listeria monocytogenes. Curr. Microbiol. 49, 95–98. Gray, M.J., Freitag, N.E., Boor, K.J., 2006. How the bacterial pathogen Listeria monocytogenes mediates the switch from environmental Dr. Jekyll to pathogenic Mr. Hyde.
26
International Journal of Food Microbiology 273 (2018) 20–27
N. Crespo Tapia et al.
Scherer, S., 2014. Identification of genes essential for anaerobic growth of Listeria monocytogenes. Microbiology 160, 752–765. Murarka, A., Dharmadi, Y., Yazdani, S.S., Gonzalez, R., 2008. Fermentative utilization of glycerol by Escherichia coli and its implications for the production of fuels and chemicals. Appl. Environ. Microbiol. 74, 1124–1135. Pagliaro, M., Rossi, M., 2008. The Future of Glycerol: New Usages for a Versatile Raw Material. Chapter: Glycerol: Properties and Production. The Royal Society of Chemistry, Green Chemistry Book Series. Parkinson, J.S., Hazelbauer, G.L., Falke, J.J., 2015. Signaling and sensory adaptation in Escherichia coli chemoreceptors: 2015 update. Trends Microbiol. 23, 257–266. Pfaffl, M.W., Tichopad, A., Prgomet, C., Neuvians, T.P., 2004. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper – Excel-based tool using pair-wise correlations. Biotechnol. Lett. 26, 509–515. Pine, L., Malcolm, G.B., Brooks, J.B., Daneshvar, M.I., 1989. Physiological studies on the growth and utilization of sugars by Listeria species. Can. J. Microbiol. 35, 245–254. Rao, C.V., Glekas, G.D., Ordal, G.W., 2008. The three adaptation systems of Bacillus subtilis chemotaxis. Trends Microbiol. 16, 480–487. Rolhion, N., Cossart, P., 2017. How the study of Listeria monocytogenes has led to new concepts in biology. Future Microbiol 12, 621–638. Schauer, K., Geginat, G., Liang, C., Goebel, W., Dandekar, T., Fuchs, T.M., 2010. Deciphering the intracellular metabolism of Listeria monocytogenes by mutant screening and modelling. BMC Genomics 11, 573. Semkiv, M.V., Dmytruk, K.V., Abbas, C.A., Sibirny, A.A., 2017. Metabolic engineering for high glycerol production by the anaerobic cultures of Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 101, 4403–4416. Shioi, J., Dang, C.V., Taylor, B.L., 1987. Oxygen as attractant and repellent in bacterial chemotaxis. J. Bacteriol. 169, 3118–3123. da Silva, G.P., Mack, M., Contiero, J., 2009. Glycerol: a promising and abundant carbon source for industrial microbiology. Biotechnol. Adv. 27, 30–39. Todhanakasem, T., Young, G.M., 2008. Loss of flagellum-based motility by Listeria monocytogenes results in formation of hyperbiofilms. J. Bacteriol. 190, 6030–6034. Vatanyoopaisarn, S., Nazli, A., Dodd, C.E.R., Rees, C.E.D., Waites, W.M., 2000. Effect of flagella on initial attachment of Listeria monocytogenes to stainless steel. Appl. Environ. Microbiol. 66, 860–863. van der Veen, S., Abee, T., 2010. Importance of SigB for Listeria monocytogenes static and continuous-flow biofilm formation and disinfectant resistance. Appl. Environ. Microbiol. 76, 7854–7860. Vivant, A.L., Garmyn, D., Piveteau, P., 2013. Listeria monocytogenes, a down-to-earth pathogen. Front. Cell. Infect. Microbiol. 3, 87.
Infect. Immun. 74, 2505–2512. Guadalupe Medina, V., Almering, M.J., van Maris, A.J., Pronk, J.T., 2010. Elimination of glycerol production in anaerobic cultures of a Saccharomyces cerevisiae strain engineered to use acetic acid as an electron acceptor. Appl. Environ. Microbiol. 76, 190–195. Guldimann, C., Boor, K.J., Wiedmann, M., Guariglia-Oropeza, V., 2016. Resilience in the face of uncertainty: sigma factor B fine-tunes gene expression to support homeostasis in Gram-positive bacteria. Appl. Environ. Microbiol. 82, 4456–4469. Hölscher, T., Bartels, B., Lin, Y.-C., Gallegos-Monterrosa, R., Price-Whelan, A., Kolter, R., Dietrich, L.E.P., Kovács, Á.T., 2015. Motility, chemotaxis and aerotaxis contribute to competitiveness during bacterial pellicle biofilm development. J. Mol. Biol. 427, 3695–3708. Joseph, B., Mertins, S., Stoll, R., Schar, J., Umesha, K.R., Luo, Q., Muller-Altrock, S., Goebel, W., 2008. Glycerol metabolism and PrfA activity in Listeria monocytogenes. J. Bacteriol. 190, 5412–5430. Kodaka, H., Armfield, A.Y., Lombard, G.L., Dowell, V.R., 1982. Practical procedure for demonstrating bacterial flagella. J. Clin. Microbiol. 16, 948–952. Koza, A., Hallett, P.D., Moon, C.D., Spiers, A.J., 2009. Characterization of a novel airliquid interface biofilm of Pseudomonas fluorescens SBW25. Microbiology 155, 1397–1406. Lemon, K.P., Higgins, D.E., Kolter, R., 2007. Flagellar motility is critical for Listeria monocytogenes biofilm formation. J. Bacteriol. 189, 4418–4424. Lemon, K.P., Earl, A.M., Vlamakis, H.C., Aguilar, C., Kolter, R., 2008. Biofilm development with an emphasis on Bacillus subtilis. Curr. Top. Microbiol. Immunol. 322, 1–16. Martinez-Suarez, J.V., Ortiz, S., Lopez-Alonso, V., 2016. Potential impact of the resistance to quaternary ammonium disinfectants on the persistence of Listeria monocytogenes in food processing environments. Front. Microbiol. 7, 638. Metselaar, K.I., den Besten, H.M.W., Boekhorst, J., van Hijum, S.A.F.T., Zwietering, M.H., Abee, T., 2015. Diversity of acid stress resistant variants of Listeria monocytogenes and the potential role of ribosomal protein S21 encoded by rpsU. Front. Microbiol. 6, 422. Milenbachs, A.A., Brown, D.P., Moors, M., Youngman, P., 1997. Carbon-source regulation of virulence gene expression in Listeria monocytogenes. Mol. Microbiol. 23, 1075–1085. Monniot, C., Zebre, A.C., Ake, F.M., Deutscher, J., Milohanic, E., 2012. Novel listerial glycerol dehydrogenase- and phosphoenolpyruvate-dependent dihydroxyacetone kinase system connected to the pentose phosphate pathway. J. Bacteriol. 194, 4972–4982. Møretrø, T., Langsrud, S., 2004. Listeria monocytogenes: biofilm formation and persistence in food-processing environments. Biofilms 1, 107–121. Müller-Herbst, S., Wustner, S., Muhlig, A., Eder, D., Fuchs, T.M., Held, C., Ehrenreich, A.,
27