- Email: [email protected]
Glycine betaine treatment alleviates chilling injury in zucchini fruit (Cucurbita pepo L.) by modulating antioxidant enzymes and membrane fatty acid metabolism
Postharvest Biology and Technology 144 (2018) 20–28
Contents lists available at ScienceDirect
Postharvest Biology and Technology journal homepage: www.elsevier.com/locate/postharvbio
Glycine betaine treatment alleviates chilling injury in zucchini fruit (Cucurbita pepo L.) by modulating antioxidant enzymes and membrane fatty acid metabolism ⁎
Wensi Yao, Tingting Xu, Syed Umar Farooq, Peng Jin , Yonghua Zheng
T
⁎
College of Food Science and Technology, Nanjing Agricultural University, Nanjing, 210095, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Zucchini fruit Glycine betaine Chilling injury Fatty acid Antioxidant response
The effect of glycine betaine (GB) treatment on chilling injury (CI) and its relation with the physiological response of zucchini fruit to chilling tolerance have been investigated. GB treatment significantly reduced postharvest CI of zucchini fruit at the concentration of 10 mmol L–1 during a fifteen-days period of storage at 1 ℃ followed by an additional three days at 20 ℃. CI index, the activities of lipoxygenase (LOX) and plant phospholipase D (PLD), proline content and fatty acid composition were assessed. The activities of various antioxidant enzymes, including superoxide dismutase (SOD), catalase (CAT) and ascorbate peroxidase (APX) were essayed along with their regulatory gene transcript levels. Results suggested that amelioration of CI in zucchini fruit by GB treatment was associated with the accumulation of proline and the reduction in lipid peroxidation. Meanwhile, GB-treated fruit also showed lower levels of palmitic acid and stearic acid, and lower LOX and PLD activities, but higher activity levels of enzymes related to proline metabolism such as △1-pyrroline-5-carboxylate synthetase (P5CS) and ornithine d-aminotransferase (OAT). Both gene expressions and antioxidant enzyme activities of SOD, CAT and APX in GB-treated fruit were significantly higher than that of control fruit. Thus, exogenous GB treatment could alleviate CI in cold-stored zucchini fruit through improved antioxidant enzymatic mechanisms. Principal component analysis (PCA) indicated that GB treatment possessed a better performance to delay chilling injury of zucchini fruit based on antioxidant levels and fatty acid metabolism than control fruits during 9 d of storage.
1. Introduction
quality of cold-stored zucchini fruit, including super atmospheric oxygen (Zhang et al., 2008), temperature preconditioning (Wang et al., 1992; Carvajal et al., 2015), and chemical treatments such as methyl jasmonate (MeJA) (Wang and Buta, 1999), 1-methycyclopropene (1MCP) (Megías et al., 2016a,b), and putrescine (Palma et al., 2016). Oxidative damage is considered to be an early response of sensitive tissues to chilling (Hariyadi and Parkin, 1991; Wang et al., 2015a,b). Excess reactive oxygen species (ROS) triggered by low temperature cause an increase in the accumulation of saturated fatty acids in membrane lipids and induces oxidative stress, which led to less resistance in stress condition (Valenzuela et al., 2017; Shen et al., 2017). Glycine betaine (GB), a vital kind of osmotic adjustment substance, is produced by various organisms, such as bacteria, fungi, plants and animals (Rhodes and Hanson, 1993; de Zwart et al., 2003). In higher plants, GB has a positive impact on maintaining cell osmotic pressure, protecting protein, and regulating stress response (Mansour, 1998). Moreover, GB has also been reported to increase the activities of ROS scavenging enzymes (SOD, CAT, APX) under stress conditions like
Refrigeration, a useful storage method commonly practiced to extend the postharvest life and to reduce postharvest decay of fruits and vegetables during transportation to distant markets insuring the availability of good quality produce to consumers for an extended period. However, zucchini fruit (Cucurbita pepo L.), one of the most important cucurbit crop specie with subtropical origin, is chilling sensitive and highly vulnerable to chilling injury (CI) at the temperature below 4 ℃ (Palma et al., 2014; Megías et al., 2016a,b). CI symptoms described so far in zucchini fruit include pitting on the fruit surface, sunken lesions, dehydration and softening (Carvajal et al., 2011). These CI symptoms seem to be the result of cellular loss of integrity caused by damages to cell walls or to cell membranes (Fernández-Trujillo and Martínez, 2006; Tatsumi et al., 1987). Generally, the degree of CI symptoms development in zucchini fruit is more rapid during shelf life at ambient temperature, which is not easy to perceive and counter during the period of cold storage. Numerous techniques have been practiced to improve
⁎
Corresponding authors. E-mail addresses: [email protected] (P. Jin), [email protected] (Y. Zheng).
https://doi.org/10.1016/j.postharvbio.2018.05.007 Received 24 February 2018; Received in revised form 4 May 2018; Accepted 11 May 2018 0925-5214/ © 2018 Elsevier B.V. All rights reserved.
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
2.2. Chilling injury index
drought, salinity and cold (Ashraf and Foolad, 2007). To date, it has been revealed that exogenous application of GB alleviate chilling injury effectively in strawberry (Rajashekar et al., 1999), tobacco (Holmstrom et al., 2000), chickpea (Nayyar et al., 2005), and tomatoes (Park et al., 2006). Recently, exogenous GB application has elatedly reduced the CI by inducing cold tolerance in sweet pepper Wang et al., 2016a,b), button mushrooms (Wang et al., 2015a,b), and banana (RodríguezZapata et al., 2015). Shan et al. (2016) reported that exogenous GB improved chilling tolerance in peach fruit and enhanced the accumulation of proline content. Similarly Zhang et al. (2016) reported that GB reduced CI through increased antioxidant enzymes activities in loquat fruit treated with GB. However, little attention is received concerning the effect of exogenous GB on inducing chilling tolerance in zucchini fruit. LOX and PLD are regarded as important enzymes involved in membrane lipid degradation under different stress conditions in plant like injury, drought and chilling. LOX catalyzes the oxygenation reaction of polyunsaturated fatty acids such as linoleic acid and linolenic acid and destroys the bilayer of phospholipids (Fan, 1997). PLD participates in the peroxidation of membrane phospholipids which involved in glycerophospholipid metabolism pathway (Hong et al., 2016). These enzymes are related to fatty acid metabolism and the maintenance of membrane integrity in fruit cells, which involved in chilling tolerance enhancement. Proline also plays important roles in protein protection and osmotic regulation in plant under stress conditions (Luo et al., 2015; Zeng et al., 2015). It is known that there are two pathways to synthesize proline. One is from glutamate by P5CS catalysis, the other is from ornithine by OAT catalysis, whereas PDH catalyzes the degradation of proline (Cao et al., 2012; Liu et al., 2016). Recently, increasing evidences claimed that the accumulation of proline content had benefit in chilling tolerance enhancement in postharvest fruits and vegetables (Luo et al., 2015; Zeng et al., 2015). Our previous studies also found that GB treatment could increase proline content in peach and loquat fruit, which associated with the improved chilling tolerance (Shan et al., 2016; Zhang et al., 2016). However, little information is available regarding the effect of GB on fatty acids and proline metabolism in zucchini fruit. Therefore, the objectives of this study were commenced to evaluate the effects of exogenous GB treatment on CI and cold tolerance, contents of fatty acids and enzymes (LOX and PLD) activities related to fatty acid metabolism. Moreover, the effects of exogenous GB treatment on proline metabolism, the ROS scavenging enzymes activities and their relative gene expressions in zucchini fruit were also investigated to elucidate the possible mechanism in cold-stored zucchini fruit.
Chilling injury (CI) index was assessed after 0, 3, 6, 9, 12 and 15 d of storage respectively at 1 ± 1 ℃ plus 3 d of shelf-life at 20 ℃ using 20 zucchini fruit, as described by Zhang et al., (2008). The degree of CI was arbitrated by scoring the extent of surface pitting as following: 0 = no damage, 1 = superficial damage (damage < 5%), 2 = moderate damage (damage 6% ∼ 25%), 3 = severe damage (damage 26% ∼ 50%), 4 = very severe damage (damage > 50%). The CI index was determined by using the following formula: CI index =Σ [(CI scale) × number of fruits at that CI)] / (5 × total number of fruit in each sample) × 100%. 2.3. LOX and PLD activities For lipoxygenase (LOX) activity, flesh tissue (2 g) was homogenized in 5 mL of 0.1 M phosphate buffer (pH 6.8) containing 1% (w/v) polyvinylpyrrolidone (Liu et al., 2011). The obtained extracts were then homogenized and centrifuged at 12,000 × g for 20 min at 4 ℃. The supernatant was used for the enzyme assay. The substrate used for the enzyme assay was made by mixing 2.7 mL phosphate buffer and 0.1 mL 0.5% (v/v) linoleic acid sodium solution. The mixture was kept at 30 ℃ for 10 min, and then 0.1 mL of the enzyme extract was added. Later on the change in absorbance at 234 nm was measured using a spectrophotometer (MAPADA UV-1200, Shanghai, China). One unit of LOX was defined as the amount of enzyme that caused an increase in the absorbance at 234 nm of 0.01 unit per 60 s. The result was expressed on a fresh weight basis as U kg−1. Plant phospholipase D (PLD) activity was determined by the method described by Liu et al. (2011). Two grams of fruit pericarp tissues were finely ground in liquid nitrogen followed by extraction with 10 mL of 0.1 M ice-cold acetic acid buffer (pH 5.6) containing 1% (w/v) polyvinylpyrrolidone and then centrifuged at 15,000 × g for 20 min at 4 ℃ and the supernatant was used for assaying PLD activity. To prepare the substrate, 40 mg of 1,3-phosphatidyl choline was dissolved in 50 mL of ether and the mixture was dried under a stream of N2 followed by the addition of 100 mL 0.1 M sodium acetate buffer (pH 5.6) containing 5 mM DTT and 1 M CaCl2. The reaction mixture consisted of 3 mL of enzyme solution and 3 mL of 0.4 g L−1 prepared substrate. The reaction was performed for 60 min at 28 ℃ using a water baths shaker and then washed for three times by addition of petroleum ether. The water phase was collected and 3 mL of 1% reineckete salt (ammonium tetrathiocyanate diammonium chloride) was added to the water phase. After centrifugation at 15,000 × g for 15 min, propanone was added to dissolve the sediment and the mixture absorbance was assayed at 520 nm spectrophotometrically. One unit of PLD activity was defined as a change of 0.001 in absorbance at 520 nm per h and expressed as U kg−1.
2. Materials and methods 2.1. Fruit materials and postharvest treatments
2.4. Proline content and P5CS, PDH and OAT activities Zucchini fruit (Cucurbita pepo L. cv. Alexander) were freshly handharvested at commercial maturity from a commercial farm in Nanjing, China. The fruit were transferred to the laboratory within 2 h and selected for uniform size ranging about 20 cm in length. All fruit were divided into two lots of 200 fruit each in triplicates and subjected to the postharvest treatments: (i) immersed in 10 mmol L−1 GB solution for 15 min (GB); (ii) immersed in distilled water for 15 min (Control). The above GB concentration was selected as being optimal from our previous report (Yao et al., 2018). Subsequently, all zucchini fruit were airdried for approximately 30 min and stored at 1 ± 1 ℃ and about 90% relative humidity for 15 d. At 3-days interval during storage, a twenty fruit from replication of each treatment were moved to 20 ℃ for 3 d to simulate shelf conditions so as to evaluate CI index. Meanwhile another 20 fruit were frozen in liquid nitrogen and stored at −80 ℃ for further biochemical analysis. Each treatment was replicated three times and the experiments were conducted twice.
The proline content, △1-pyrroline-5-carboxylate synthetase (P5CS), ornithine d-aminotransferase (OAT) and proline dehydrogenase (PDH) activities were assayed according to the procedure described previously (Shang et al., 2011). The resulting value of proline content was compared with a standard curve and expressed as g kg−1. One unit of all of the three enzymes activities were defined as the decrease of 0.001 in absorbance per 60 s in OD340 and expressed as U kg−1. 2.5. Extraction and GC analysis of fatty acid Total lipids were extracted according to the procedure reported by Cao et al., 2014 with some modifications. Briefly, ten grams of zucchini flesh tissue were homogenized in 15 mL chloroform: methanol (1:2) and centrifuged at 12,000 × g for 15 min at 4 ℃. Afterward, supernatant was collected and mixed with 5 mL 0.76% (m/v) NaCl. The 21
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
Table 1 PCR primers used in gene expression analyses. Gene symbol
Name
Forward primer
Reverse primer
Accession
EF-1α CpCu/Zn SOD CpCAT2 CpAPX1
Elongation factor-1 superoxide dismutase Catalase Ascorbate peroxidase
GCTTGGGTGCTCGACAAACT GTCTACTGGACCACATTACAACC CGCAAGAAGATCGTGTTCAA GCCTTGACATTGCTGTTA
TCCACAGAGCAATGTCAATGG CACAACAGCCCTTCCGATAA CTTAGGAAGCAACAAAGGCG GAACCCTTGGTAGCATCA
HO702383 AF009734 D55646 KF954415
kg−1. 2.6. Antioxidant enzyme extraction and assay All enzyme extract procedures were conducted at 0–4 ℃. For the analysis of superoxide dismutase (SOD), 2 g (flesh weight) of flesh tissue was ground in 5 mL of 100 mM phosphate (pH 7.8). To measure Catalase (CAT) and Ascorbate peroxidase (APX) activities, flesh tissue (2 g) was homogenized in 5 mL of 50 mM phosphate buffer (pH 7.0). Then the obtained homogenate was centrifuged at 12,000 × g for 20 min at 4 ℃ and the subsequent supernatant was used in the enzyme activity assays. Superoxide dismutase (SOD) activity was determined by the method of Zhang et al. (2017a,b). The assay mixture (3 mL) contained 1.7 mL 50 mM phosphate buffer (pH 7.8), 0.3 mL 4 μM riboflavin, 0.3 mL 195 mM methionine (MET), 0.1 mL 3 mM EDTA, 0.3 mL enzyme extract and 0.3 mL 75 μM nitroblue tetrazolium (NBT). 3 ml of the assay mixture in uniform, transparent tubes was shaken and placed under fluorescent light (4000 lx intensity). The configuration of the reaction solution should be carried out in a dark environment. The reaction was then started by turning on the light, after 15 min the light was turned off, and the absorbance by the assay mixture at 560 nm was recorded spectrophotometrically. A similar assay mixture covered with black plastic served as a control. One unit of SOD activity was defined as the amount of enzyme inhibiting the NBT reduction by 50% and expressed as U kg−1. CAT activity was assayed using the method described by Wang et al. (2016a,b). The CAT reaction solution contained 2.6 mL of 50 mM phosphate buffer (pH 7.0), 0.2 mL of 0.75% (v/v) H2O2, and 0.2 mL enzyme extract in a total volume of 3 mL. One unit of CAT activity was defined as the change of 0.01 per 60 s in OD240 and expressed as U kg−1. APX activity was measured according to the method described by Jin et al. (2014) with some modifications. The APX reaction mixture contained 2.7 mL of 50 mM phosphate buffer (pH7.0), 0.1 mL enzyme extract, 0.1 mL of 9 mM ascorbic acid and 0.1 mL of 3% (v/v) H2O2 in a total volume of 3 mL. The reaction was started by adding H2O2, and the
Fig. 1. Effect of glycine betaine (GB) treatment on CI index of zucchini fruit during storage (15 d, 1 ℃) plus shelf life (3 d, 20 ℃). Bars represent the standard deviations of triplicate assays. Different letters above the bars indicate the statistically significant difference at P < 0.05.
resulting organic phase was collected and evaporated to dryness under nitrogen. Methylated fatty acids were carried out by adding 1 mL boron trifluoride/methanol at boiling for 10 min, extracted with 500 μL hexane and evaporated to dryness under nitrogen and redissolved in 200 μl chloroform before injection. Fatty acids were assessed and quantified according to method described by Mirdehghan et al. (2007) using gas chromatography (GC, Superclo sp-2560). Identification and quantification of fatty acids was performed by comparing retention times and peak areas with standard substance (Sigma, USA). The oven temperature was programed as follow: the initial temperature was 140 ℃ (held for 5 min), and then the temperature ramped from 4 ℃ to 220 ℃ and was held for 15 min. The injection volume was 1 μL in split mode at a ratio of 10:1. Nitrogen was used as the carrier gas at a flow rate of 0.025 mL s−1, and the temperatures of the injector and detector were kept at 220 ℃. The result was expressed on a fresh weight basis as g
Fig. 2. Lipoxygenase (LOX) activity (A) and plant phospholipase D (PLD) activity (B) of zucchini fruit during storage (15 d, 1 ℃). Bars represent the standard deviations of triplicate assays. Different letters above the bars indicate the statistically significant difference at P < 0.05. 22
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
Fig. 3. Linoleic acid content (A), palmitic acid content (B), stearic acid content (C) and γ-linolenic acid content (D) of zucchini fruit during storage (15 d, 1 ℃). Bars represent the standard deviations of triplicate assays. Different letters above the bars indicate the statistically significant difference at P < 0.05.
absorbance decrease in OD290 was recorded at 10 s to 120 s after addition of H2O2. One unit of APX activity was defined as the change of 0.01 per 60 s in OD290 and expressed as U kg−1.
variation in cDNA content.
2.7. Relative gene expression by quantitative real-time PCR (q-PCR)
Experiments were performed using a completely randomized design. All statistical analyses of variance were calculated over two factors, treatments and storage time, using the SPSS statistical package (SPSS Inc., Chicago, IL, USA). The main effects were analyzed and the means were compared by Duncan’s multiple range tests, at a significance level of 0.05. In addition, we also used the R software for principal component analysis (PCA) to comprehensively evaluate the impact of GB treatment on the cold damage of zucchini fruit.
2.8. Statistical analysis
In order to investigate the molecular mechanism of GB treatment induced chilling resistance in zucchini fruit, q-PCR was used to analyze the expression patterns of the defense-related genes in zucchini fruit. These genes included: CpCu/Zn SOD (Accession number AF009734), CpCAT2 (Accession number D55646) and CpAPX1 (Accession number KF954415). Total RNA was extracted from zucchini fruit tissues using a Plant Total RNA Extraction Kit (Takara9769, Japan) according to the manufacturer’s instructions. Meanwhile, all samples were in triplicates. First-strand cDNA was synthesized from 2 μg RNA with a Reverse Transcription Kit (TakaraRR036 A, Japan) following the manufacturer’s instructions. Amplifications were performed using 7500 Fast Real-Time PCR System (Thermo Fisher Scientific, USA) and the SYBR Green Q-PCR Kit (TakaraRR420 A, Japan) on the basis of the manufacturer’s instructions. The reaction solution contained 2 μL of the synthesized cDNA, 0.4 μL of 10 μmol L−1 each forward and reverse primers and 17.5 μL of the SYBR Green PCR Master Mix (10 μL SYBR Green, 7 μL RNA-free H2O, 0.5 μL ROX Reference Dye II). The q-PCR program was initiated with a preliminary step of 30 s at 95 °C, followed by 40 cycles of 95 °C for 5 s and 60 °C for 34 s, and ended with a step of 15 s at 95 ℃, 1 min at 60 ℃ and 15 s at 95 ℃. Relative gene expression was calculated using the comparative 2-△△CT method. Primer sequences used for qPCR were designed by Beacon Design 7.0 and listed in Table 1. EF-1α (Accession number HO702383) gene expression was used to minimize
3. Results and discussion 3.1. CI index CI symptoms were first visible in zucchini fruit when stored after 3 d of storage at 1 ℃ plus 3 d at 20 ℃ and followed a sigmoidal pattern (Fig. 1). Overall, the onset of CI was delayed by GB compared with the control at 1 ℃ (Fig. 1). The degree of CI development in control fruit increased dramatically with time and became significantly severer than that of GB-treated fruit during the whole period of cold storage. Moreover, the commodity value in the control group no longer existed beyond 9 d. Similar results also have been reported in other chillingsensitive agriculture products like hot pepper (Ding et al., 2012), cucumber (Zhang et al., 2008) and loquat (Sun et al., 2014). Xu et al. (2015) also reported that treating cucumber with 10 mmol L−1 GB enhanced enzymatic activities at 4 ℃. Since the application of GB was 23
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
Fig. 4. Proline content (A), △1-pyrroline-5-carboxylate synthetase (P5CS) activity (B), proline dehydrogenase (PDH) activity (C) and ornithine d-aminotransferase (OAT) activity (D) of zucchini fruit during storage (15 d, 1 ℃). Bars represent the standard deviations of triplicate assays. Different letters above the bars indicate the statistically significant difference at P < 0.05.
acid and stearic acid than that in the control fruit except on 3 d of storage. By contrast, the contents of linoleic acid and linolenic acid showed a decreasing trend which were different with former ones (Fig. 3C and D). GB-treated fruit kept higher fatty acid levels for both the linoleic acid and linolenic acid as compared with the control fruit integrally throughout the storage period. The changes of membrane structure and composition are considered as the primary event of CI, which caused by the decrease in unsaturation of lipid fatty acids and bulk membrane lipid phase transitions (Fan, 1997). It has been reported that the decrease of lipid unsaturation was involved in the induction of CI in loquat and pear fruit (Rui et al., 2010; Shi et al., 2018). Our results supported that the development of CI in zucchini fruit was associated with the increase of palmitic and stearic acid content. GB treatment decayed the CI and enhanced chilling tolerance in zucchini fruit probably due to maintaining the high level of unsaturated fatty acid.
simple and economical, it would be considered as a beneficial preservative in the cold supply chain of zucchini fruit except for overseas markets. 3.2. LOX and PLD activities LOX activity increased before 6 d and decreased afterwards, while PLD activity increased gradually with the storage time. During low temperature storage LOX and PLD activities increased until a maximum after 6 or 9 d, respectively. GB-treated fruit followed the same pattern but with lower levels than control fruit (Fig. 2). Current study revealed that with the increase of LOX activity (Fig. 2A), content of linoleic acid and linolenic acid in membrane lipid decreased gradually (Fig. 3C and D). This may be due to the fact that LOX degraded polyunsaturated fatty acids in zucchini fruit, resulting in peroxidation of membrane lipids. GB treatment could inhibit the increase of LOX activity, thereby increasing the level of unsaturated fatty acids and improving the cold resistance in zucchini fruit. Recently, Shi et al. (2018) reported similar results in Nanguo pear. GB treatment suppressed PLD activity notably in coldstored zucchini fruit. Therefore, it could elucidate that GB treatment enhanced cold tolerance of zucchini fruit by inhibiting LOX and PLD enzymatic activities.
3.4. Proline content and P5CS, PDH and OAT activities During the storage at 1 °C the proline content of zucchini fruit increased gradually at the early stages of cold storage and decreased afterwards (Fig. 4A). The GB treatment increased proline content markedly on 6 d of storage to maximum and continued at a significantly higher level than that of control fruit during whole storage period. The activities of P5CS and OAT exhibited similar trends as the proline content (Fig. 4B and C). P5CS and OAT activities were 47.7% and 65.8% higher, respectively, in the GB-treated fruit than that in control fruit at the end of period of cold storage. For both GB-treated and control fruit the PDH showed a continuous decrease in its activity
3.3. Fatty acid quantification The palmitic acid and stearic acid exhibited similar increasing tendency both in control and GB-treated zucchini fruit (Fig. 3A and B). Furthermore, the GB-treated fruit maintained a lower level of palmitic 24
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
Fig. 5. Antioxidant enzyme activities and relative gene expressions of ascorbate peroxidase (APX) (A, B), catalase (CAT) (C, D), superoxide dismutase (SOD) (E, F) of zucchini fruit during storage (15 d, 1 ℃). Bars represent the standard deviations of triplicate assays. Different letters above the bars indicate the statistically significant difference at P < 0.05.
had benefit in enzymes and membrane stabilization (Ruggieri et al., 2018). Thus, it could be possible that exogenous GB might play a role in the accumulation of osmotic adjustment substances, such as endogenous GB, proline, GABA, which contributed to membrane protection and cold tolerance. Similar results were also observed in peach and loquat fruit (Shan et al., 2016; Zhang et al., 2016). However, the further mechanism should be explored in the future study.
during the cold storage (Fig. 4D). GB-treated zucchini fruit kept the decline of PDH activity and maintained notably at a lower level than that of control fruit. The experimental results showed that the activities of P5CS and OAT in GB-treated fruit increased, which accumulated more proline contents in zucchini fruit cells. Proline accumulation has a key role in alleviation of chilling injury same like proline accumulation induced by exogenous γ-aminobutyric acid (GABA) treatment could alleviate CI symptoms in banana peel during low temperature storage (Wang et al., 2014, 2016a,b). In fact, the proline behaves like ROS scavenger and GB could induce cold resistance in zucchini fruit by regulating proline metabolism. Moreover, GB might affect the biosynthesis of some amino acids including glycine, lysine or proline by inducing the expression of glycine-rich RNA-binding proteins, which
3.5. Antioxidant enzyme activities and relative gene expressions by quantitative RT-PCR SOD activity in GB-treated fruit was increased over the time with maximum value on 9 d of cold-storage. The control fruits revealed an 25
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
Fig. 6. Principal component analysis (PCA) of GB effects on the chilling injury of zucchini fruits included the correlations among different variables which reflected on antioxidant levels and biosynthesis of fatty acids levels of different treatments (a) and different storage periods (b). The red points were represented by negative controls and blue points were represented by GB treatments during the whole storage period in Fig. 6a; by contrast, deepening of colur in points of Fig. 6b represented the succession of storage periods contained nodes in 0, 3, 6, 9, 12 and 15 d, respectively. The percentages in PC1 and PC2 axises were revealed the degrees of explanation. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).
expression level of CpAPX1 encoding gene was maximum expression after 6 d of cold storage. CpCAT2 expression in GB-treated fruit was 153% higher relative to the expression in control fruit. The gene expression level for all relevant genes studied increased over 9 d of cold storage and dropped afterwards. Antioxidant showed a maximum activity during storage in GB-treated fruit after 6–9 d of cold storage versus the control that showed a more abrupt decrease after 3–9 d, depending on the enzyme tested. In short, GB treatment sustained a higher level of gene expression compared with control fruits throughout the period of cold storage and was a significant difference in transcript levels of all genes in GB-treated and control fruit. The producing and scavenging of intracellular ROS or free radical are in a dynamic equilibrium under normal circumstances. However, this balance is disrupted when plants are subjected to abiotic stresses, leading to the destruction of proteins, nucleic acids, and enzyme structures. To maintain antioxidant system is crucial for plants to protect themselves against temperature stress. SOD generates H2O2 and oxygen through scavenging superoxide radicals in biological cells, and
abrupt decrease in SOD activity after 3 d of storage. Meanwhile, the SOD activity was lower in control fruit than that of GB-treated fruits all over the storage. Parallel to SOD activity, GB-treated zucchini fruit also maintained a higher level of CAT activity than that of control fruits during the period of cold storage. The APX exhibited similar activity trends as CAT. The activity of APX showed trivial decline in both control and GB-treated fruit during the first three days. Later on APX activity increased marginally and went on decline afterwards. The level of APX activity was higher in GB-treated fruits than that of control fruit during the entire period of cold storage. Meanwhile, the maximum APX activity was noticed in GB-treated fruit on 6 d of storage, with 34% higher activity level than that of control fruits. GB treatment revealed a significant influence on expression level of genes concerned with regulation of the enzymatic antioxidant defense mechanism of zucchini fruits. GB-treated fruit showed a significant increase in transcript accumulation of CpCu/Zn SOD, CpCAT2 and CpAPX1 encoding genes relative to the control fruit (Fig. 5). CpCu/Zn SOD and CpCAT2 related genes showed maximum expression after 9 d of cold storage while
26
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
then H2O2 is further catalyzed by CAT to H2O and oxygen. Meanwhile, APX also has the ability to catalyze H2O2. Higher activities of SOD, CAT and APX have been found to be associated with delayed senescence of postharvest fruits. For example, Cao and Zheng (2010) reported abridged decay incidence in postharvest loquat fruit by 1-MCP that is associated with its influence of delaying fruit senescence and alleviating oxidative damage due to increased SOD, CAT and APX activities. Babalar et al. (2018) reported that arginine treatment attenuated CI of cold-stored pomegranate fruit by enhancing antioxidant enzymatic activities. Our research also showed that GB treatment increased the activities of SOD, CAT and APX as well as their gene expressions. Likewise, the reduction of chilling injury in cold-stored zucchini fruit is due to increased activities of SOD, CAT and APX as well as their gene expressions levels by GB treatment which is responsible for lower levels of ROS in zucchini fruit.
abiotic stress resistance. Environ. Exp. Bot. 59, 206–216. Babalar, M., Pirzad, F., Sarcheshmeh, M.A.A., Talaei, A., Lessani, H., 2018. Arginine treatment attenuates chilling injury of pomegranate fruit during cold storage by enhancing antioxidant system activity. Postharvest Biol. Technol. 137, 31–37. Cao, S.F., Yang, Z., Cai, Y., Zheng, Y.H., 2014. Antioxidant enzymes and fatty acid composition as related to disease resistance in postharvest loquat fruit. Food Chem. 163, 92–96. Cao, S.F., Cai, Y., Yang, Z.F., Zheng, Y.H., 2012. MeJA induces chilling tolerance in loquat fruit by regulating proline and gamma-aminobutyric acid contents. Food Chem. 133, 1466–1470. Cao, S.F., Zheng, Y.H., 2010. Effect of 1-methylcyclopropene on anthracnose rot caused by Colletotrichum acutatum and disease resistance in loquat fruit. J. Sci. Food Agric. 90, 2289–2294. Carvajal, F., Martinez, C., Jamilena, M., Garrido, D., 2011. Differential response of zucchini varieties to low storage temperature. Sci. Hortic. 130, 90–96. Carvajal, F., Palma, F., Jamilena, M., Garrido, D., 2015. Preconditioning treatment induces chilling tolerance in zucchini fruit improving different physiological mechanisms against cold injury. Ann. Appl. Biol. 166, 340–354. de Zwart, F.J., Slow, S., Payne, R.J., Lever, M., George, P.M., Gerrard, J.A., Chambers, S.T., 2003. Glycine betaine and glycine betaine analogues in common foods. Food Chem. 83, 197–204. Ding, T., Pang, J., Wang, Q., Yang, N., Gao, L.P., 2012. Effect of exogenous glycine betaine treatment on chilling injury of hot pepper. Guangdong Agric. Sci. 21, 52–55. Fan, X., 1997. Changes in jasmonic acid (JA) concentration during early development of apple fruit. Physiol. Plant 101, 328–332. Fernández-Trujillo, J.P., Martínez, J.A., 2006. Ultrastructure of the onset of chilling injury in cucumber fruit. J. Appl. Bot. Food Qual. 80, 100–110. Hariyadi, P., Parkin, K.L., 1991. Chilling-induced oxidative stress in cucumber fruits. Postharvest Biol. Technol. 1, 33–45. Holmstrom, K.O., Somersalo, S., Mandal, A., Palva, T.E., Welin, B., 2000. Improved tolerance to salinity and low temperature in transgenic tobacco producing glycine betaine. J. Exp. Bot. 51, 177–185. Hong, Y.Y., Zhao, J., Guo, L., Kim, S.C., Deng, X.J., Wang, G.L., Wang, X.M., 2016. Plant phospholipases D and C and their diverse functions in stress responses. Prog. Lipid Res. 62, 55–71. Jin, P., Duan, Y.F., Wang, L., Wang, J., Zheng, Y.H., 2014. Reducing chilling injury of loquat fruit by combined treatment with hot air and methyl jasmonate. Food Bioprocess Technol. 7, 2259–2266. Liu, H., Song, L., You, Y., Li, Y., Duan, X., Jiang, Y., Lu, W., 2011. Cold storage duration affects litchi fruit quality, membrane permeability, enzyme activities and energy charge during shelf time at ambient temperature. Postharvest Biol. Technol. 601, 24–30. Liu, Z., Li, L., Luo, Z., Zeng, F., Tang, K., 2016. Effect of brassinolide on energy status and proline metabolism in postharvest bamboo shoot during chilling stress. Postharvest Biol. Technol. 111, 240–246. Luo, Z., Li, D., Du, R., Mou, W., Mao, L., 2015. Hydrogen sulfide alleviates chilling injury of banana fruit by enhanced antioxidant capacity and proline content. Sci. Hortic. 183, 144–151. Mansour, M.M.F., 1998. Protection of plasma membrane of onion epidermal cells by glycine betaine and proline against NaCl stress. Plant Physiol. Biochem. 36, 767–772. Megías, Z., Manzano, S., Martínez, C., García, A., Aguado, E., Garrido, D., Jamilena, M., 2016a. Postharvest cold tolerance in summer squash and its association with reduced cold-induced ethylene production. Euphytica 213 (1). Megías, Z., Martínez, C., Manzano, S., García, A., del Mar Rebolloso-Fuentes, M., Valenzuela, J.L., Jamilena, M., 2016b. Ethylene biosynthesis and signaling elements involved in chilling injury and other postharvest quality traits in the non-climacteric fruit of zucchini (Cucurbita pepo). Postharvest Biol. Technol. 113, 48–57. Mirdehghan, S.H., Rahemi, M., Martínez-Romero, D., Guillén, F., Valverde, J.M., Zapata, P.J., et al., 2007. Reduction of pomegranate chilling injury during storage after heat treatment: role of polyamines. Postharvest Biol. Technol. 44, 19–25. Nayyar, H., Chander, K., Kumar, S., Bains, T., 2005. Glycine betaine mitigates cold stress damage in Chickpea. Agron. Sustain. Dev. 25, 381–388. Palma, F., Carvajal, F., Jamilena, M., Garrido, D., 2016. Putrescine treatment increases the antioxidant response and carbohydrate content in zucchini fruit stored at low temperature. Postharvest Biol. Technol. 118, 68–70. Palma, F., Carvajal, F., Lluch, C., Jamilena, M., Garrido, D., 2014. Changes in carbohydrate content in zucchini fruit (Cucurbita pepo L.) under low temperature stress. Plant Sci. 217-218, 78–86. Park, E.J., Jeknic, Z., Chen, T.H., 2006. Exogenous application of glycinebetaine increases chilling tolerance in tomato plants. Plant Cell Physiol. 47, 706–714. Rajashekar, C.B., Zhou, H., Marcum, K.B., Prakash, O., 1999. Glycine betaine accumulation and induction of cold tolerance in strawberry plants. Plant Sci. 148, 175–183. Rhodes, D., Hanson, A.D., 1993. Quaternary ammonium and tertiary sulfonium compounds in higher plants. Annu. Rev. Plant. Physiol. Plant Mol. Biol. 44, 357–384. Rodríguez-Zapata, L.C., Gil, E., Cruz-Martínez, S., Talavera-May, C.R., ContrerasMarin, F., Fuentes, G., Sauri-Duch, E., Santamaría, J.M., 2015. Preharvest foliar applications of glycine-betaine protects banana fruits from chilling injury during the postharvest stage. Chem. Biol. Technol. Agric. 2, 6–16. Ruggieri, G.M., Triassi, A., Alvarez, C.E., Gola, A., Wiggenhauser, J., Budde, C.O., Lara, M.V., Drincovich, M.F., Müller, G.L., 2018. Overexpression of glycine-rich RNAbinding protein in tomato renders fruits with higher protein content after cold storage. Biol. Plant. http://dx.doi.org/10.1007/s10535-018-0794-3. (in press). Rui, H.J., Cao, S.F., Shang, H.T., Jin, P., Wang, K.T., Zheng, Y.H., 2010. Effects of heat treatment on internal browning and membrane fatty acid in loquat fruit in response to chilling stress. J. Sci. Food Agric. 90, 1557–1561. Shan, T., Jin, P., Zhang, Y., Huang, Y., Wang, X., Zheng, Y., 2016. Exogenous glycine
3.6. Principle component analysis of GB effects on chilling injury Principle component analysis (PCA) of the correlation of CI index with antioxidant indicators and fatty acids in different treatments and different storage periods were showed in Fig. 6. GB treatments were displayed a significant separation with control (P < 0.05). By contrast, there also existed significant differences among different storage periods (P < 0.05). It was obvious that the enzymes activities of SOD, CAT, APX, P5CS and OAT were exhibited significant positive correlations among each other, however, CI index displayed considerable negative correlations with activities of SOD, CAT, APX, P5CS and OAT in varying degrees. Additionally, proline content was showed positive correlations with activities of SOD, CAT, APX, P5CS and OAT, but except for PDH activity. Meanwhile, CI index displayed distinct positive correlations with LOX and PLD activities together with contents of stearic acid and palmitic acid during all the storage periods. On the contrary, the contents of linoleic acid and linolenic acid were showed significantly negative correlations with CI index and the other two fatty acids. Moreover, the contents of linoleic acid and linolenic acid were also exhibited negative correlations with LOX and PLD activities, respectively. It was also revealed that the contents of fatty acids and their relative enzymes activities were changed in different storage periods significantly (P < 0.05), moreover, there also existed distinct separation between GB treatments and controls (P < 0.05). In summary, our data revealed that exogenous GB treatment could suppress the development of CI and could maintain quality of zucchini fruit during cold storage and subsequent shelf life. The mechanism by which GB accomplished this may be through the stimulation of the enzymatic ROS scavenging systems and relevant antioxidant enzymes gene expression, resulting in increased protection against oxidative stress and lipid peroxidation of cellular membranes. Furthermore, principal component analysis (PCA) of antioxidant levels and fatty acids metabolism of zucchini fruit displayed a clear discrimination between GB treatment and control, thus, indicating that GB could significantly alleviate chilling injury of zucchini. In addition, PCA analysis results also demonstrate that the relative variables were changed during the storage periods continuously, meanwhile, the GB effects were exhibited the most obvious performance from 9 d, because the GB treatments showed a clear discrimination with control. Acknowledgements This study was supported by the National Key Research and Development Program of China (2016YFD0400901), and the National Natural Science Foundation of China (No. 31371862). References Ashraf, M., Foolad, M.R., 2007. Roles of glycine betaine and proline in improving plant
27
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
Biol. Technol. 108, 21–27. Wang, Y., Luo, Z., Mao, L., Ying, T., 2016b. Contribution of polyamines metabolism and GABA shunt to chilling tolerance induced by nitric oxide in cold-stored banana fruit. Food Chem. 197, 333–339. Wang, Z.G., Chen, L.J., Yang, H., Wang, A.J., 2015b. Effect of exogenous glycine betaine on qualities of button mushrooms (Agaricus bisporus) during postharvest storage. Eur. Food Res. Technol. 240, 41–48. Xu, L., Chen, X.N., Zhang, H.Y., Han, T., Wang, F.G., 2015. Effects of exogenous glycine betaine on oxidation metabolism in cucumbers during low-temperature storage. Agr. Sci. Technol. 16, 857–861. Yao, W., Jin, P., Xu, T., Zhu, H., Zhang, T., Zheng, Y.H., 2018. Effects of exogenous glycine betaine treatment on chilling injury and quality of cucurbita pepo L. under low temperature storage. J. Nucl. Agric. Sci (in press, Chinese article with English abstract). Zeng, F., Jiang, T., Wang, Y., Luo, Z., 2015. Effect of UV-C treatment on modulating antioxidative system and proline metabolism of bamboo shoots subjected to chilling stress. Acta Physiologiae Plantarum 37, 244. Zhang, H.Y., Wang, Y.N., Han, T., Li, L.P., Xu, L., 2008. Effect of exogenous glycine betaine on chilling injury and chilling-resistance parameters in cucumber fruits stored at low temperature. Sci. Agric. Sin. 41, 2407–2412. Zhang, T., Che, F., Zhang, H., Pan, Y., Xu, M., Ban, Q., Rao, J., 2017a. Effect of nitric oxide treatment on chilling injury, antioxidant enzymes and expression of the CmCBF1 and CmCBF3 genes in cold-stored Hami melon (Cucumis melo L.) Fruit. Postharvest Biol. Technol. 127, 88–98. Zhang, Y., Jin, P., Huang, Y., Shan, T., Wang, L., Li, Y., Zheng, Y., 2016. Effect of hot water combined with glycine betaine alleviates chilling injury in cold-stored loquat fruit. Postharvest Biol. Technol. 118, 141–147. Zhang, Z., Zhu, Q., Hu, M., Gao, Z., An, F., Li, M., Jiang, Y., 2017b. Low-temperature conditioning induces chilling tolerance in stored mango fruit. Food Chem. 219, 76–84.
betaine treatment enhances chilling tolerance of peach fruit during cold storage. Postharvest Biol. Technol. 114, 104–110. Shang, H.T., Cao, S.F., Yang, Z., Cai, Y., Zheng, Y.H., 2011. Effect of exogenous γ aminobutyric acid treatment on proline accumulation and chilling injury in peach fruit after long-term cold storage. J. Agric. Food Chem. 59, 1264–1268. Shen, Y., Zhao, Z., Zhang, L., Shi, L., Shahriar, S., Chan, R.B., Paolo, G., Min, W., 2017. Metabolic activity induces membrane phase separation in endoplasmic reticulum. Proc. Natl. Acad. Sci. U. S. A. 114, 13394. Shi, F., Zhou, X., Zhou, Q., Tan, Z., Yao, M.M., Wei, B.D., Ji, S.J., 2018. Membrane lipid metabolism changes and aroma ester loss in low-temperature stored Nanguo pears. Food Chem. 245, 446–453. Sun, Y.J., Jin, P., Shan, T.M., Xu, J., Zheng, Y.H., 2014. Effect of glycine betaine treatment on postharvest chilling injury and active oxygen metabolism in loquat fruits. Food Sci. 35, 210–215. Tatsumi, Y., Maeda, K., Murata, T., 1987. Morphological changes in cucumber fruit surfaces associated with chilling injury. J. Jpn. Soc. Hortic. Sci. 56, 187–192. Valenzuela, J.L., Manzano, S., Palma, F., Carvajal, F., Garrido, D., Jamilena, M., 2017. Oxidative stress associated with chilling injury in immature fruit: postharvest technological and biotechnological solutions. Int. J. Mol. Sci. 1467. Wang, C.Y., Buta, J.G., 1999. Methyl jasmonate improves quality of stored zucchini squash. Food Qual. 22, 663–670. Wang, C.Y., Kramer, G.F., Whitaker, B.D., Lusby, W.R., 1992. Temperature preconditioning increases tolerance to chilling injury and alters lipid composition in zucchini squash. Plant Physiol. 140, 229–235. Wang, Q., Ding, T., Zuo, J., Gao, L., Fan, L., 2016a. Amelioration of postharvest chilling injury in sweet pepper by glycine betaine. Postharvest Biol. Technol. 112, 114–120. Wang, Y., Luo, Z., Huang, X., Yang, K., Gao, S., Du, R., 2014. Effect of exogenous γaminobutyric acid (GABA) treatment on chilling injury and antioxidant capacity in banana peel. Sci. Hortic. 168, 132–137. Wang, Y., Luo, Z., Khan, Z., Mao, L., Ying, T., 2015a. Effect of nitric oxide on energy metabolism in postharvest banana fruit in response to chilling stress. Postharvest
28
Contents lists available at ScienceDirect
Postharvest Biology and Technology journal homepage: www.elsevier.com/locate/postharvbio
Glycine betaine treatment alleviates chilling injury in zucchini fruit (Cucurbita pepo L.) by modulating antioxidant enzymes and membrane fatty acid metabolism ⁎
Wensi Yao, Tingting Xu, Syed Umar Farooq, Peng Jin , Yonghua Zheng
T
⁎
College of Food Science and Technology, Nanjing Agricultural University, Nanjing, 210095, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Zucchini fruit Glycine betaine Chilling injury Fatty acid Antioxidant response
The effect of glycine betaine (GB) treatment on chilling injury (CI) and its relation with the physiological response of zucchini fruit to chilling tolerance have been investigated. GB treatment significantly reduced postharvest CI of zucchini fruit at the concentration of 10 mmol L–1 during a fifteen-days period of storage at 1 ℃ followed by an additional three days at 20 ℃. CI index, the activities of lipoxygenase (LOX) and plant phospholipase D (PLD), proline content and fatty acid composition were assessed. The activities of various antioxidant enzymes, including superoxide dismutase (SOD), catalase (CAT) and ascorbate peroxidase (APX) were essayed along with their regulatory gene transcript levels. Results suggested that amelioration of CI in zucchini fruit by GB treatment was associated with the accumulation of proline and the reduction in lipid peroxidation. Meanwhile, GB-treated fruit also showed lower levels of palmitic acid and stearic acid, and lower LOX and PLD activities, but higher activity levels of enzymes related to proline metabolism such as △1-pyrroline-5-carboxylate synthetase (P5CS) and ornithine d-aminotransferase (OAT). Both gene expressions and antioxidant enzyme activities of SOD, CAT and APX in GB-treated fruit were significantly higher than that of control fruit. Thus, exogenous GB treatment could alleviate CI in cold-stored zucchini fruit through improved antioxidant enzymatic mechanisms. Principal component analysis (PCA) indicated that GB treatment possessed a better performance to delay chilling injury of zucchini fruit based on antioxidant levels and fatty acid metabolism than control fruits during 9 d of storage.
1. Introduction
quality of cold-stored zucchini fruit, including super atmospheric oxygen (Zhang et al., 2008), temperature preconditioning (Wang et al., 1992; Carvajal et al., 2015), and chemical treatments such as methyl jasmonate (MeJA) (Wang and Buta, 1999), 1-methycyclopropene (1MCP) (Megías et al., 2016a,b), and putrescine (Palma et al., 2016). Oxidative damage is considered to be an early response of sensitive tissues to chilling (Hariyadi and Parkin, 1991; Wang et al., 2015a,b). Excess reactive oxygen species (ROS) triggered by low temperature cause an increase in the accumulation of saturated fatty acids in membrane lipids and induces oxidative stress, which led to less resistance in stress condition (Valenzuela et al., 2017; Shen et al., 2017). Glycine betaine (GB), a vital kind of osmotic adjustment substance, is produced by various organisms, such as bacteria, fungi, plants and animals (Rhodes and Hanson, 1993; de Zwart et al., 2003). In higher plants, GB has a positive impact on maintaining cell osmotic pressure, protecting protein, and regulating stress response (Mansour, 1998). Moreover, GB has also been reported to increase the activities of ROS scavenging enzymes (SOD, CAT, APX) under stress conditions like
Refrigeration, a useful storage method commonly practiced to extend the postharvest life and to reduce postharvest decay of fruits and vegetables during transportation to distant markets insuring the availability of good quality produce to consumers for an extended period. However, zucchini fruit (Cucurbita pepo L.), one of the most important cucurbit crop specie with subtropical origin, is chilling sensitive and highly vulnerable to chilling injury (CI) at the temperature below 4 ℃ (Palma et al., 2014; Megías et al., 2016a,b). CI symptoms described so far in zucchini fruit include pitting on the fruit surface, sunken lesions, dehydration and softening (Carvajal et al., 2011). These CI symptoms seem to be the result of cellular loss of integrity caused by damages to cell walls or to cell membranes (Fernández-Trujillo and Martínez, 2006; Tatsumi et al., 1987). Generally, the degree of CI symptoms development in zucchini fruit is more rapid during shelf life at ambient temperature, which is not easy to perceive and counter during the period of cold storage. Numerous techniques have been practiced to improve
⁎
Corresponding authors. E-mail addresses: [email protected] (P. Jin), [email protected] (Y. Zheng).
https://doi.org/10.1016/j.postharvbio.2018.05.007 Received 24 February 2018; Received in revised form 4 May 2018; Accepted 11 May 2018 0925-5214/ © 2018 Elsevier B.V. All rights reserved.
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
2.2. Chilling injury index
drought, salinity and cold (Ashraf and Foolad, 2007). To date, it has been revealed that exogenous application of GB alleviate chilling injury effectively in strawberry (Rajashekar et al., 1999), tobacco (Holmstrom et al., 2000), chickpea (Nayyar et al., 2005), and tomatoes (Park et al., 2006). Recently, exogenous GB application has elatedly reduced the CI by inducing cold tolerance in sweet pepper Wang et al., 2016a,b), button mushrooms (Wang et al., 2015a,b), and banana (RodríguezZapata et al., 2015). Shan et al. (2016) reported that exogenous GB improved chilling tolerance in peach fruit and enhanced the accumulation of proline content. Similarly Zhang et al. (2016) reported that GB reduced CI through increased antioxidant enzymes activities in loquat fruit treated with GB. However, little attention is received concerning the effect of exogenous GB on inducing chilling tolerance in zucchini fruit. LOX and PLD are regarded as important enzymes involved in membrane lipid degradation under different stress conditions in plant like injury, drought and chilling. LOX catalyzes the oxygenation reaction of polyunsaturated fatty acids such as linoleic acid and linolenic acid and destroys the bilayer of phospholipids (Fan, 1997). PLD participates in the peroxidation of membrane phospholipids which involved in glycerophospholipid metabolism pathway (Hong et al., 2016). These enzymes are related to fatty acid metabolism and the maintenance of membrane integrity in fruit cells, which involved in chilling tolerance enhancement. Proline also plays important roles in protein protection and osmotic regulation in plant under stress conditions (Luo et al., 2015; Zeng et al., 2015). It is known that there are two pathways to synthesize proline. One is from glutamate by P5CS catalysis, the other is from ornithine by OAT catalysis, whereas PDH catalyzes the degradation of proline (Cao et al., 2012; Liu et al., 2016). Recently, increasing evidences claimed that the accumulation of proline content had benefit in chilling tolerance enhancement in postharvest fruits and vegetables (Luo et al., 2015; Zeng et al., 2015). Our previous studies also found that GB treatment could increase proline content in peach and loquat fruit, which associated with the improved chilling tolerance (Shan et al., 2016; Zhang et al., 2016). However, little information is available regarding the effect of GB on fatty acids and proline metabolism in zucchini fruit. Therefore, the objectives of this study were commenced to evaluate the effects of exogenous GB treatment on CI and cold tolerance, contents of fatty acids and enzymes (LOX and PLD) activities related to fatty acid metabolism. Moreover, the effects of exogenous GB treatment on proline metabolism, the ROS scavenging enzymes activities and their relative gene expressions in zucchini fruit were also investigated to elucidate the possible mechanism in cold-stored zucchini fruit.
Chilling injury (CI) index was assessed after 0, 3, 6, 9, 12 and 15 d of storage respectively at 1 ± 1 ℃ plus 3 d of shelf-life at 20 ℃ using 20 zucchini fruit, as described by Zhang et al., (2008). The degree of CI was arbitrated by scoring the extent of surface pitting as following: 0 = no damage, 1 = superficial damage (damage < 5%), 2 = moderate damage (damage 6% ∼ 25%), 3 = severe damage (damage 26% ∼ 50%), 4 = very severe damage (damage > 50%). The CI index was determined by using the following formula: CI index =Σ [(CI scale) × number of fruits at that CI)] / (5 × total number of fruit in each sample) × 100%. 2.3. LOX and PLD activities For lipoxygenase (LOX) activity, flesh tissue (2 g) was homogenized in 5 mL of 0.1 M phosphate buffer (pH 6.8) containing 1% (w/v) polyvinylpyrrolidone (Liu et al., 2011). The obtained extracts were then homogenized and centrifuged at 12,000 × g for 20 min at 4 ℃. The supernatant was used for the enzyme assay. The substrate used for the enzyme assay was made by mixing 2.7 mL phosphate buffer and 0.1 mL 0.5% (v/v) linoleic acid sodium solution. The mixture was kept at 30 ℃ for 10 min, and then 0.1 mL of the enzyme extract was added. Later on the change in absorbance at 234 nm was measured using a spectrophotometer (MAPADA UV-1200, Shanghai, China). One unit of LOX was defined as the amount of enzyme that caused an increase in the absorbance at 234 nm of 0.01 unit per 60 s. The result was expressed on a fresh weight basis as U kg−1. Plant phospholipase D (PLD) activity was determined by the method described by Liu et al. (2011). Two grams of fruit pericarp tissues were finely ground in liquid nitrogen followed by extraction with 10 mL of 0.1 M ice-cold acetic acid buffer (pH 5.6) containing 1% (w/v) polyvinylpyrrolidone and then centrifuged at 15,000 × g for 20 min at 4 ℃ and the supernatant was used for assaying PLD activity. To prepare the substrate, 40 mg of 1,3-phosphatidyl choline was dissolved in 50 mL of ether and the mixture was dried under a stream of N2 followed by the addition of 100 mL 0.1 M sodium acetate buffer (pH 5.6) containing 5 mM DTT and 1 M CaCl2. The reaction mixture consisted of 3 mL of enzyme solution and 3 mL of 0.4 g L−1 prepared substrate. The reaction was performed for 60 min at 28 ℃ using a water baths shaker and then washed for three times by addition of petroleum ether. The water phase was collected and 3 mL of 1% reineckete salt (ammonium tetrathiocyanate diammonium chloride) was added to the water phase. After centrifugation at 15,000 × g for 15 min, propanone was added to dissolve the sediment and the mixture absorbance was assayed at 520 nm spectrophotometrically. One unit of PLD activity was defined as a change of 0.001 in absorbance at 520 nm per h and expressed as U kg−1.
2. Materials and methods 2.1. Fruit materials and postharvest treatments
2.4. Proline content and P5CS, PDH and OAT activities Zucchini fruit (Cucurbita pepo L. cv. Alexander) were freshly handharvested at commercial maturity from a commercial farm in Nanjing, China. The fruit were transferred to the laboratory within 2 h and selected for uniform size ranging about 20 cm in length. All fruit were divided into two lots of 200 fruit each in triplicates and subjected to the postharvest treatments: (i) immersed in 10 mmol L−1 GB solution for 15 min (GB); (ii) immersed in distilled water for 15 min (Control). The above GB concentration was selected as being optimal from our previous report (Yao et al., 2018). Subsequently, all zucchini fruit were airdried for approximately 30 min and stored at 1 ± 1 ℃ and about 90% relative humidity for 15 d. At 3-days interval during storage, a twenty fruit from replication of each treatment were moved to 20 ℃ for 3 d to simulate shelf conditions so as to evaluate CI index. Meanwhile another 20 fruit were frozen in liquid nitrogen and stored at −80 ℃ for further biochemical analysis. Each treatment was replicated three times and the experiments were conducted twice.
The proline content, △1-pyrroline-5-carboxylate synthetase (P5CS), ornithine d-aminotransferase (OAT) and proline dehydrogenase (PDH) activities were assayed according to the procedure described previously (Shang et al., 2011). The resulting value of proline content was compared with a standard curve and expressed as g kg−1. One unit of all of the three enzymes activities were defined as the decrease of 0.001 in absorbance per 60 s in OD340 and expressed as U kg−1. 2.5. Extraction and GC analysis of fatty acid Total lipids were extracted according to the procedure reported by Cao et al., 2014 with some modifications. Briefly, ten grams of zucchini flesh tissue were homogenized in 15 mL chloroform: methanol (1:2) and centrifuged at 12,000 × g for 15 min at 4 ℃. Afterward, supernatant was collected and mixed with 5 mL 0.76% (m/v) NaCl. The 21
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
Table 1 PCR primers used in gene expression analyses. Gene symbol
Name
Forward primer
Reverse primer
Accession
EF-1α CpCu/Zn SOD CpCAT2 CpAPX1
Elongation factor-1 superoxide dismutase Catalase Ascorbate peroxidase
GCTTGGGTGCTCGACAAACT GTCTACTGGACCACATTACAACC CGCAAGAAGATCGTGTTCAA GCCTTGACATTGCTGTTA
TCCACAGAGCAATGTCAATGG CACAACAGCCCTTCCGATAA CTTAGGAAGCAACAAAGGCG GAACCCTTGGTAGCATCA
HO702383 AF009734 D55646 KF954415
kg−1. 2.6. Antioxidant enzyme extraction and assay All enzyme extract procedures were conducted at 0–4 ℃. For the analysis of superoxide dismutase (SOD), 2 g (flesh weight) of flesh tissue was ground in 5 mL of 100 mM phosphate (pH 7.8). To measure Catalase (CAT) and Ascorbate peroxidase (APX) activities, flesh tissue (2 g) was homogenized in 5 mL of 50 mM phosphate buffer (pH 7.0). Then the obtained homogenate was centrifuged at 12,000 × g for 20 min at 4 ℃ and the subsequent supernatant was used in the enzyme activity assays. Superoxide dismutase (SOD) activity was determined by the method of Zhang et al. (2017a,b). The assay mixture (3 mL) contained 1.7 mL 50 mM phosphate buffer (pH 7.8), 0.3 mL 4 μM riboflavin, 0.3 mL 195 mM methionine (MET), 0.1 mL 3 mM EDTA, 0.3 mL enzyme extract and 0.3 mL 75 μM nitroblue tetrazolium (NBT). 3 ml of the assay mixture in uniform, transparent tubes was shaken and placed under fluorescent light (4000 lx intensity). The configuration of the reaction solution should be carried out in a dark environment. The reaction was then started by turning on the light, after 15 min the light was turned off, and the absorbance by the assay mixture at 560 nm was recorded spectrophotometrically. A similar assay mixture covered with black plastic served as a control. One unit of SOD activity was defined as the amount of enzyme inhibiting the NBT reduction by 50% and expressed as U kg−1. CAT activity was assayed using the method described by Wang et al. (2016a,b). The CAT reaction solution contained 2.6 mL of 50 mM phosphate buffer (pH 7.0), 0.2 mL of 0.75% (v/v) H2O2, and 0.2 mL enzyme extract in a total volume of 3 mL. One unit of CAT activity was defined as the change of 0.01 per 60 s in OD240 and expressed as U kg−1. APX activity was measured according to the method described by Jin et al. (2014) with some modifications. The APX reaction mixture contained 2.7 mL of 50 mM phosphate buffer (pH7.0), 0.1 mL enzyme extract, 0.1 mL of 9 mM ascorbic acid and 0.1 mL of 3% (v/v) H2O2 in a total volume of 3 mL. The reaction was started by adding H2O2, and the
Fig. 1. Effect of glycine betaine (GB) treatment on CI index of zucchini fruit during storage (15 d, 1 ℃) plus shelf life (3 d, 20 ℃). Bars represent the standard deviations of triplicate assays. Different letters above the bars indicate the statistically significant difference at P < 0.05.
resulting organic phase was collected and evaporated to dryness under nitrogen. Methylated fatty acids were carried out by adding 1 mL boron trifluoride/methanol at boiling for 10 min, extracted with 500 μL hexane and evaporated to dryness under nitrogen and redissolved in 200 μl chloroform before injection. Fatty acids were assessed and quantified according to method described by Mirdehghan et al. (2007) using gas chromatography (GC, Superclo sp-2560). Identification and quantification of fatty acids was performed by comparing retention times and peak areas with standard substance (Sigma, USA). The oven temperature was programed as follow: the initial temperature was 140 ℃ (held for 5 min), and then the temperature ramped from 4 ℃ to 220 ℃ and was held for 15 min. The injection volume was 1 μL in split mode at a ratio of 10:1. Nitrogen was used as the carrier gas at a flow rate of 0.025 mL s−1, and the temperatures of the injector and detector were kept at 220 ℃. The result was expressed on a fresh weight basis as g
Fig. 2. Lipoxygenase (LOX) activity (A) and plant phospholipase D (PLD) activity (B) of zucchini fruit during storage (15 d, 1 ℃). Bars represent the standard deviations of triplicate assays. Different letters above the bars indicate the statistically significant difference at P < 0.05. 22
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
Fig. 3. Linoleic acid content (A), palmitic acid content (B), stearic acid content (C) and γ-linolenic acid content (D) of zucchini fruit during storage (15 d, 1 ℃). Bars represent the standard deviations of triplicate assays. Different letters above the bars indicate the statistically significant difference at P < 0.05.
absorbance decrease in OD290 was recorded at 10 s to 120 s after addition of H2O2. One unit of APX activity was defined as the change of 0.01 per 60 s in OD290 and expressed as U kg−1.
variation in cDNA content.
2.7. Relative gene expression by quantitative real-time PCR (q-PCR)
Experiments were performed using a completely randomized design. All statistical analyses of variance were calculated over two factors, treatments and storage time, using the SPSS statistical package (SPSS Inc., Chicago, IL, USA). The main effects were analyzed and the means were compared by Duncan’s multiple range tests, at a significance level of 0.05. In addition, we also used the R software for principal component analysis (PCA) to comprehensively evaluate the impact of GB treatment on the cold damage of zucchini fruit.
2.8. Statistical analysis
In order to investigate the molecular mechanism of GB treatment induced chilling resistance in zucchini fruit, q-PCR was used to analyze the expression patterns of the defense-related genes in zucchini fruit. These genes included: CpCu/Zn SOD (Accession number AF009734), CpCAT2 (Accession number D55646) and CpAPX1 (Accession number KF954415). Total RNA was extracted from zucchini fruit tissues using a Plant Total RNA Extraction Kit (Takara9769, Japan) according to the manufacturer’s instructions. Meanwhile, all samples were in triplicates. First-strand cDNA was synthesized from 2 μg RNA with a Reverse Transcription Kit (TakaraRR036 A, Japan) following the manufacturer’s instructions. Amplifications were performed using 7500 Fast Real-Time PCR System (Thermo Fisher Scientific, USA) and the SYBR Green Q-PCR Kit (TakaraRR420 A, Japan) on the basis of the manufacturer’s instructions. The reaction solution contained 2 μL of the synthesized cDNA, 0.4 μL of 10 μmol L−1 each forward and reverse primers and 17.5 μL of the SYBR Green PCR Master Mix (10 μL SYBR Green, 7 μL RNA-free H2O, 0.5 μL ROX Reference Dye II). The q-PCR program was initiated with a preliminary step of 30 s at 95 °C, followed by 40 cycles of 95 °C for 5 s and 60 °C for 34 s, and ended with a step of 15 s at 95 ℃, 1 min at 60 ℃ and 15 s at 95 ℃. Relative gene expression was calculated using the comparative 2-△△CT method. Primer sequences used for qPCR were designed by Beacon Design 7.0 and listed in Table 1. EF-1α (Accession number HO702383) gene expression was used to minimize
3. Results and discussion 3.1. CI index CI symptoms were first visible in zucchini fruit when stored after 3 d of storage at 1 ℃ plus 3 d at 20 ℃ and followed a sigmoidal pattern (Fig. 1). Overall, the onset of CI was delayed by GB compared with the control at 1 ℃ (Fig. 1). The degree of CI development in control fruit increased dramatically with time and became significantly severer than that of GB-treated fruit during the whole period of cold storage. Moreover, the commodity value in the control group no longer existed beyond 9 d. Similar results also have been reported in other chillingsensitive agriculture products like hot pepper (Ding et al., 2012), cucumber (Zhang et al., 2008) and loquat (Sun et al., 2014). Xu et al. (2015) also reported that treating cucumber with 10 mmol L−1 GB enhanced enzymatic activities at 4 ℃. Since the application of GB was 23
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
Fig. 4. Proline content (A), △1-pyrroline-5-carboxylate synthetase (P5CS) activity (B), proline dehydrogenase (PDH) activity (C) and ornithine d-aminotransferase (OAT) activity (D) of zucchini fruit during storage (15 d, 1 ℃). Bars represent the standard deviations of triplicate assays. Different letters above the bars indicate the statistically significant difference at P < 0.05.
acid and stearic acid than that in the control fruit except on 3 d of storage. By contrast, the contents of linoleic acid and linolenic acid showed a decreasing trend which were different with former ones (Fig. 3C and D). GB-treated fruit kept higher fatty acid levels for both the linoleic acid and linolenic acid as compared with the control fruit integrally throughout the storage period. The changes of membrane structure and composition are considered as the primary event of CI, which caused by the decrease in unsaturation of lipid fatty acids and bulk membrane lipid phase transitions (Fan, 1997). It has been reported that the decrease of lipid unsaturation was involved in the induction of CI in loquat and pear fruit (Rui et al., 2010; Shi et al., 2018). Our results supported that the development of CI in zucchini fruit was associated with the increase of palmitic and stearic acid content. GB treatment decayed the CI and enhanced chilling tolerance in zucchini fruit probably due to maintaining the high level of unsaturated fatty acid.
simple and economical, it would be considered as a beneficial preservative in the cold supply chain of zucchini fruit except for overseas markets. 3.2. LOX and PLD activities LOX activity increased before 6 d and decreased afterwards, while PLD activity increased gradually with the storage time. During low temperature storage LOX and PLD activities increased until a maximum after 6 or 9 d, respectively. GB-treated fruit followed the same pattern but with lower levels than control fruit (Fig. 2). Current study revealed that with the increase of LOX activity (Fig. 2A), content of linoleic acid and linolenic acid in membrane lipid decreased gradually (Fig. 3C and D). This may be due to the fact that LOX degraded polyunsaturated fatty acids in zucchini fruit, resulting in peroxidation of membrane lipids. GB treatment could inhibit the increase of LOX activity, thereby increasing the level of unsaturated fatty acids and improving the cold resistance in zucchini fruit. Recently, Shi et al. (2018) reported similar results in Nanguo pear. GB treatment suppressed PLD activity notably in coldstored zucchini fruit. Therefore, it could elucidate that GB treatment enhanced cold tolerance of zucchini fruit by inhibiting LOX and PLD enzymatic activities.
3.4. Proline content and P5CS, PDH and OAT activities During the storage at 1 °C the proline content of zucchini fruit increased gradually at the early stages of cold storage and decreased afterwards (Fig. 4A). The GB treatment increased proline content markedly on 6 d of storage to maximum and continued at a significantly higher level than that of control fruit during whole storage period. The activities of P5CS and OAT exhibited similar trends as the proline content (Fig. 4B and C). P5CS and OAT activities were 47.7% and 65.8% higher, respectively, in the GB-treated fruit than that in control fruit at the end of period of cold storage. For both GB-treated and control fruit the PDH showed a continuous decrease in its activity
3.3. Fatty acid quantification The palmitic acid and stearic acid exhibited similar increasing tendency both in control and GB-treated zucchini fruit (Fig. 3A and B). Furthermore, the GB-treated fruit maintained a lower level of palmitic 24
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
Fig. 5. Antioxidant enzyme activities and relative gene expressions of ascorbate peroxidase (APX) (A, B), catalase (CAT) (C, D), superoxide dismutase (SOD) (E, F) of zucchini fruit during storage (15 d, 1 ℃). Bars represent the standard deviations of triplicate assays. Different letters above the bars indicate the statistically significant difference at P < 0.05.
had benefit in enzymes and membrane stabilization (Ruggieri et al., 2018). Thus, it could be possible that exogenous GB might play a role in the accumulation of osmotic adjustment substances, such as endogenous GB, proline, GABA, which contributed to membrane protection and cold tolerance. Similar results were also observed in peach and loquat fruit (Shan et al., 2016; Zhang et al., 2016). However, the further mechanism should be explored in the future study.
during the cold storage (Fig. 4D). GB-treated zucchini fruit kept the decline of PDH activity and maintained notably at a lower level than that of control fruit. The experimental results showed that the activities of P5CS and OAT in GB-treated fruit increased, which accumulated more proline contents in zucchini fruit cells. Proline accumulation has a key role in alleviation of chilling injury same like proline accumulation induced by exogenous γ-aminobutyric acid (GABA) treatment could alleviate CI symptoms in banana peel during low temperature storage (Wang et al., 2014, 2016a,b). In fact, the proline behaves like ROS scavenger and GB could induce cold resistance in zucchini fruit by regulating proline metabolism. Moreover, GB might affect the biosynthesis of some amino acids including glycine, lysine or proline by inducing the expression of glycine-rich RNA-binding proteins, which
3.5. Antioxidant enzyme activities and relative gene expressions by quantitative RT-PCR SOD activity in GB-treated fruit was increased over the time with maximum value on 9 d of cold-storage. The control fruits revealed an 25
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
Fig. 6. Principal component analysis (PCA) of GB effects on the chilling injury of zucchini fruits included the correlations among different variables which reflected on antioxidant levels and biosynthesis of fatty acids levels of different treatments (a) and different storage periods (b). The red points were represented by negative controls and blue points were represented by GB treatments during the whole storage period in Fig. 6a; by contrast, deepening of colur in points of Fig. 6b represented the succession of storage periods contained nodes in 0, 3, 6, 9, 12 and 15 d, respectively. The percentages in PC1 and PC2 axises were revealed the degrees of explanation. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).
expression level of CpAPX1 encoding gene was maximum expression after 6 d of cold storage. CpCAT2 expression in GB-treated fruit was 153% higher relative to the expression in control fruit. The gene expression level for all relevant genes studied increased over 9 d of cold storage and dropped afterwards. Antioxidant showed a maximum activity during storage in GB-treated fruit after 6–9 d of cold storage versus the control that showed a more abrupt decrease after 3–9 d, depending on the enzyme tested. In short, GB treatment sustained a higher level of gene expression compared with control fruits throughout the period of cold storage and was a significant difference in transcript levels of all genes in GB-treated and control fruit. The producing and scavenging of intracellular ROS or free radical are in a dynamic equilibrium under normal circumstances. However, this balance is disrupted when plants are subjected to abiotic stresses, leading to the destruction of proteins, nucleic acids, and enzyme structures. To maintain antioxidant system is crucial for plants to protect themselves against temperature stress. SOD generates H2O2 and oxygen through scavenging superoxide radicals in biological cells, and
abrupt decrease in SOD activity after 3 d of storage. Meanwhile, the SOD activity was lower in control fruit than that of GB-treated fruits all over the storage. Parallel to SOD activity, GB-treated zucchini fruit also maintained a higher level of CAT activity than that of control fruits during the period of cold storage. The APX exhibited similar activity trends as CAT. The activity of APX showed trivial decline in both control and GB-treated fruit during the first three days. Later on APX activity increased marginally and went on decline afterwards. The level of APX activity was higher in GB-treated fruits than that of control fruit during the entire period of cold storage. Meanwhile, the maximum APX activity was noticed in GB-treated fruit on 6 d of storage, with 34% higher activity level than that of control fruits. GB treatment revealed a significant influence on expression level of genes concerned with regulation of the enzymatic antioxidant defense mechanism of zucchini fruits. GB-treated fruit showed a significant increase in transcript accumulation of CpCu/Zn SOD, CpCAT2 and CpAPX1 encoding genes relative to the control fruit (Fig. 5). CpCu/Zn SOD and CpCAT2 related genes showed maximum expression after 9 d of cold storage while
26
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
then H2O2 is further catalyzed by CAT to H2O and oxygen. Meanwhile, APX also has the ability to catalyze H2O2. Higher activities of SOD, CAT and APX have been found to be associated with delayed senescence of postharvest fruits. For example, Cao and Zheng (2010) reported abridged decay incidence in postharvest loquat fruit by 1-MCP that is associated with its influence of delaying fruit senescence and alleviating oxidative damage due to increased SOD, CAT and APX activities. Babalar et al. (2018) reported that arginine treatment attenuated CI of cold-stored pomegranate fruit by enhancing antioxidant enzymatic activities. Our research also showed that GB treatment increased the activities of SOD, CAT and APX as well as their gene expressions. Likewise, the reduction of chilling injury in cold-stored zucchini fruit is due to increased activities of SOD, CAT and APX as well as their gene expressions levels by GB treatment which is responsible for lower levels of ROS in zucchini fruit.
abiotic stress resistance. Environ. Exp. Bot. 59, 206–216. Babalar, M., Pirzad, F., Sarcheshmeh, M.A.A., Talaei, A., Lessani, H., 2018. Arginine treatment attenuates chilling injury of pomegranate fruit during cold storage by enhancing antioxidant system activity. Postharvest Biol. Technol. 137, 31–37. Cao, S.F., Yang, Z., Cai, Y., Zheng, Y.H., 2014. Antioxidant enzymes and fatty acid composition as related to disease resistance in postharvest loquat fruit. Food Chem. 163, 92–96. Cao, S.F., Cai, Y., Yang, Z.F., Zheng, Y.H., 2012. MeJA induces chilling tolerance in loquat fruit by regulating proline and gamma-aminobutyric acid contents. Food Chem. 133, 1466–1470. Cao, S.F., Zheng, Y.H., 2010. Effect of 1-methylcyclopropene on anthracnose rot caused by Colletotrichum acutatum and disease resistance in loquat fruit. J. Sci. Food Agric. 90, 2289–2294. Carvajal, F., Martinez, C., Jamilena, M., Garrido, D., 2011. Differential response of zucchini varieties to low storage temperature. Sci. Hortic. 130, 90–96. Carvajal, F., Palma, F., Jamilena, M., Garrido, D., 2015. Preconditioning treatment induces chilling tolerance in zucchini fruit improving different physiological mechanisms against cold injury. Ann. Appl. Biol. 166, 340–354. de Zwart, F.J., Slow, S., Payne, R.J., Lever, M., George, P.M., Gerrard, J.A., Chambers, S.T., 2003. Glycine betaine and glycine betaine analogues in common foods. Food Chem. 83, 197–204. Ding, T., Pang, J., Wang, Q., Yang, N., Gao, L.P., 2012. Effect of exogenous glycine betaine treatment on chilling injury of hot pepper. Guangdong Agric. Sci. 21, 52–55. Fan, X., 1997. Changes in jasmonic acid (JA) concentration during early development of apple fruit. Physiol. Plant 101, 328–332. Fernández-Trujillo, J.P., Martínez, J.A., 2006. Ultrastructure of the onset of chilling injury in cucumber fruit. J. Appl. Bot. Food Qual. 80, 100–110. Hariyadi, P., Parkin, K.L., 1991. Chilling-induced oxidative stress in cucumber fruits. Postharvest Biol. Technol. 1, 33–45. Holmstrom, K.O., Somersalo, S., Mandal, A., Palva, T.E., Welin, B., 2000. Improved tolerance to salinity and low temperature in transgenic tobacco producing glycine betaine. J. Exp. Bot. 51, 177–185. Hong, Y.Y., Zhao, J., Guo, L., Kim, S.C., Deng, X.J., Wang, G.L., Wang, X.M., 2016. Plant phospholipases D and C and their diverse functions in stress responses. Prog. Lipid Res. 62, 55–71. Jin, P., Duan, Y.F., Wang, L., Wang, J., Zheng, Y.H., 2014. Reducing chilling injury of loquat fruit by combined treatment with hot air and methyl jasmonate. Food Bioprocess Technol. 7, 2259–2266. Liu, H., Song, L., You, Y., Li, Y., Duan, X., Jiang, Y., Lu, W., 2011. Cold storage duration affects litchi fruit quality, membrane permeability, enzyme activities and energy charge during shelf time at ambient temperature. Postharvest Biol. Technol. 601, 24–30. Liu, Z., Li, L., Luo, Z., Zeng, F., Tang, K., 2016. Effect of brassinolide on energy status and proline metabolism in postharvest bamboo shoot during chilling stress. Postharvest Biol. Technol. 111, 240–246. Luo, Z., Li, D., Du, R., Mou, W., Mao, L., 2015. Hydrogen sulfide alleviates chilling injury of banana fruit by enhanced antioxidant capacity and proline content. Sci. Hortic. 183, 144–151. Mansour, M.M.F., 1998. Protection of plasma membrane of onion epidermal cells by glycine betaine and proline against NaCl stress. Plant Physiol. Biochem. 36, 767–772. Megías, Z., Manzano, S., Martínez, C., García, A., Aguado, E., Garrido, D., Jamilena, M., 2016a. Postharvest cold tolerance in summer squash and its association with reduced cold-induced ethylene production. Euphytica 213 (1). Megías, Z., Martínez, C., Manzano, S., García, A., del Mar Rebolloso-Fuentes, M., Valenzuela, J.L., Jamilena, M., 2016b. Ethylene biosynthesis and signaling elements involved in chilling injury and other postharvest quality traits in the non-climacteric fruit of zucchini (Cucurbita pepo). Postharvest Biol. Technol. 113, 48–57. Mirdehghan, S.H., Rahemi, M., Martínez-Romero, D., Guillén, F., Valverde, J.M., Zapata, P.J., et al., 2007. Reduction of pomegranate chilling injury during storage after heat treatment: role of polyamines. Postharvest Biol. Technol. 44, 19–25. Nayyar, H., Chander, K., Kumar, S., Bains, T., 2005. Glycine betaine mitigates cold stress damage in Chickpea. Agron. Sustain. Dev. 25, 381–388. Palma, F., Carvajal, F., Jamilena, M., Garrido, D., 2016. Putrescine treatment increases the antioxidant response and carbohydrate content in zucchini fruit stored at low temperature. Postharvest Biol. Technol. 118, 68–70. Palma, F., Carvajal, F., Lluch, C., Jamilena, M., Garrido, D., 2014. Changes in carbohydrate content in zucchini fruit (Cucurbita pepo L.) under low temperature stress. Plant Sci. 217-218, 78–86. Park, E.J., Jeknic, Z., Chen, T.H., 2006. Exogenous application of glycinebetaine increases chilling tolerance in tomato plants. Plant Cell Physiol. 47, 706–714. Rajashekar, C.B., Zhou, H., Marcum, K.B., Prakash, O., 1999. Glycine betaine accumulation and induction of cold tolerance in strawberry plants. Plant Sci. 148, 175–183. Rhodes, D., Hanson, A.D., 1993. Quaternary ammonium and tertiary sulfonium compounds in higher plants. Annu. Rev. Plant. Physiol. Plant Mol. Biol. 44, 357–384. Rodríguez-Zapata, L.C., Gil, E., Cruz-Martínez, S., Talavera-May, C.R., ContrerasMarin, F., Fuentes, G., Sauri-Duch, E., Santamaría, J.M., 2015. Preharvest foliar applications of glycine-betaine protects banana fruits from chilling injury during the postharvest stage. Chem. Biol. Technol. Agric. 2, 6–16. Ruggieri, G.M., Triassi, A., Alvarez, C.E., Gola, A., Wiggenhauser, J., Budde, C.O., Lara, M.V., Drincovich, M.F., Müller, G.L., 2018. Overexpression of glycine-rich RNAbinding protein in tomato renders fruits with higher protein content after cold storage. Biol. Plant. http://dx.doi.org/10.1007/s10535-018-0794-3. (in press). Rui, H.J., Cao, S.F., Shang, H.T., Jin, P., Wang, K.T., Zheng, Y.H., 2010. Effects of heat treatment on internal browning and membrane fatty acid in loquat fruit in response to chilling stress. J. Sci. Food Agric. 90, 1557–1561. Shan, T., Jin, P., Zhang, Y., Huang, Y., Wang, X., Zheng, Y., 2016. Exogenous glycine
3.6. Principle component analysis of GB effects on chilling injury Principle component analysis (PCA) of the correlation of CI index with antioxidant indicators and fatty acids in different treatments and different storage periods were showed in Fig. 6. GB treatments were displayed a significant separation with control (P < 0.05). By contrast, there also existed significant differences among different storage periods (P < 0.05). It was obvious that the enzymes activities of SOD, CAT, APX, P5CS and OAT were exhibited significant positive correlations among each other, however, CI index displayed considerable negative correlations with activities of SOD, CAT, APX, P5CS and OAT in varying degrees. Additionally, proline content was showed positive correlations with activities of SOD, CAT, APX, P5CS and OAT, but except for PDH activity. Meanwhile, CI index displayed distinct positive correlations with LOX and PLD activities together with contents of stearic acid and palmitic acid during all the storage periods. On the contrary, the contents of linoleic acid and linolenic acid were showed significantly negative correlations with CI index and the other two fatty acids. Moreover, the contents of linoleic acid and linolenic acid were also exhibited negative correlations with LOX and PLD activities, respectively. It was also revealed that the contents of fatty acids and their relative enzymes activities were changed in different storage periods significantly (P < 0.05), moreover, there also existed distinct separation between GB treatments and controls (P < 0.05). In summary, our data revealed that exogenous GB treatment could suppress the development of CI and could maintain quality of zucchini fruit during cold storage and subsequent shelf life. The mechanism by which GB accomplished this may be through the stimulation of the enzymatic ROS scavenging systems and relevant antioxidant enzymes gene expression, resulting in increased protection against oxidative stress and lipid peroxidation of cellular membranes. Furthermore, principal component analysis (PCA) of antioxidant levels and fatty acids metabolism of zucchini fruit displayed a clear discrimination between GB treatment and control, thus, indicating that GB could significantly alleviate chilling injury of zucchini. In addition, PCA analysis results also demonstrate that the relative variables were changed during the storage periods continuously, meanwhile, the GB effects were exhibited the most obvious performance from 9 d, because the GB treatments showed a clear discrimination with control. Acknowledgements This study was supported by the National Key Research and Development Program of China (2016YFD0400901), and the National Natural Science Foundation of China (No. 31371862). References Ashraf, M., Foolad, M.R., 2007. Roles of glycine betaine and proline in improving plant
27
Postharvest Biology and Technology 144 (2018) 20–28
W. Yao et al.
Biol. Technol. 108, 21–27. Wang, Y., Luo, Z., Mao, L., Ying, T., 2016b. Contribution of polyamines metabolism and GABA shunt to chilling tolerance induced by nitric oxide in cold-stored banana fruit. Food Chem. 197, 333–339. Wang, Z.G., Chen, L.J., Yang, H., Wang, A.J., 2015b. Effect of exogenous glycine betaine on qualities of button mushrooms (Agaricus bisporus) during postharvest storage. Eur. Food Res. Technol. 240, 41–48. Xu, L., Chen, X.N., Zhang, H.Y., Han, T., Wang, F.G., 2015. Effects of exogenous glycine betaine on oxidation metabolism in cucumbers during low-temperature storage. Agr. Sci. Technol. 16, 857–861. Yao, W., Jin, P., Xu, T., Zhu, H., Zhang, T., Zheng, Y.H., 2018. Effects of exogenous glycine betaine treatment on chilling injury and quality of cucurbita pepo L. under low temperature storage. J. Nucl. Agric. Sci (in press, Chinese article with English abstract). Zeng, F., Jiang, T., Wang, Y., Luo, Z., 2015. Effect of UV-C treatment on modulating antioxidative system and proline metabolism of bamboo shoots subjected to chilling stress. Acta Physiologiae Plantarum 37, 244. Zhang, H.Y., Wang, Y.N., Han, T., Li, L.P., Xu, L., 2008. Effect of exogenous glycine betaine on chilling injury and chilling-resistance parameters in cucumber fruits stored at low temperature. Sci. Agric. Sin. 41, 2407–2412. Zhang, T., Che, F., Zhang, H., Pan, Y., Xu, M., Ban, Q., Rao, J., 2017a. Effect of nitric oxide treatment on chilling injury, antioxidant enzymes and expression of the CmCBF1 and CmCBF3 genes in cold-stored Hami melon (Cucumis melo L.) Fruit. Postharvest Biol. Technol. 127, 88–98. Zhang, Y., Jin, P., Huang, Y., Shan, T., Wang, L., Li, Y., Zheng, Y., 2016. Effect of hot water combined with glycine betaine alleviates chilling injury in cold-stored loquat fruit. Postharvest Biol. Technol. 118, 141–147. Zhang, Z., Zhu, Q., Hu, M., Gao, Z., An, F., Li, M., Jiang, Y., 2017b. Low-temperature conditioning induces chilling tolerance in stored mango fruit. Food Chem. 219, 76–84.
betaine treatment enhances chilling tolerance of peach fruit during cold storage. Postharvest Biol. Technol. 114, 104–110. Shang, H.T., Cao, S.F., Yang, Z., Cai, Y., Zheng, Y.H., 2011. Effect of exogenous γ aminobutyric acid treatment on proline accumulation and chilling injury in peach fruit after long-term cold storage. J. Agric. Food Chem. 59, 1264–1268. Shen, Y., Zhao, Z., Zhang, L., Shi, L., Shahriar, S., Chan, R.B., Paolo, G., Min, W., 2017. Metabolic activity induces membrane phase separation in endoplasmic reticulum. Proc. Natl. Acad. Sci. U. S. A. 114, 13394. Shi, F., Zhou, X., Zhou, Q., Tan, Z., Yao, M.M., Wei, B.D., Ji, S.J., 2018. Membrane lipid metabolism changes and aroma ester loss in low-temperature stored Nanguo pears. Food Chem. 245, 446–453. Sun, Y.J., Jin, P., Shan, T.M., Xu, J., Zheng, Y.H., 2014. Effect of glycine betaine treatment on postharvest chilling injury and active oxygen metabolism in loquat fruits. Food Sci. 35, 210–215. Tatsumi, Y., Maeda, K., Murata, T., 1987. Morphological changes in cucumber fruit surfaces associated with chilling injury. J. Jpn. Soc. Hortic. Sci. 56, 187–192. Valenzuela, J.L., Manzano, S., Palma, F., Carvajal, F., Garrido, D., Jamilena, M., 2017. Oxidative stress associated with chilling injury in immature fruit: postharvest technological and biotechnological solutions. Int. J. Mol. Sci. 1467. Wang, C.Y., Buta, J.G., 1999. Methyl jasmonate improves quality of stored zucchini squash. Food Qual. 22, 663–670. Wang, C.Y., Kramer, G.F., Whitaker, B.D., Lusby, W.R., 1992. Temperature preconditioning increases tolerance to chilling injury and alters lipid composition in zucchini squash. Plant Physiol. 140, 229–235. Wang, Q., Ding, T., Zuo, J., Gao, L., Fan, L., 2016a. Amelioration of postharvest chilling injury in sweet pepper by glycine betaine. Postharvest Biol. Technol. 112, 114–120. Wang, Y., Luo, Z., Huang, X., Yang, K., Gao, S., Du, R., 2014. Effect of exogenous γaminobutyric acid (GABA) treatment on chilling injury and antioxidant capacity in banana peel. Sci. Hortic. 168, 132–137. Wang, Y., Luo, Z., Khan, Z., Mao, L., Ying, T., 2015a. Effect of nitric oxide on energy metabolism in postharvest banana fruit in response to chilling stress. Postharvest
28