Gp41, a superfamily SF2 helicase from bacteriophage BFK20

Virus Research 245 (2018) 7–16

Contents lists available at ScienceDirect

Virus Research journal homepage: www.elsevier.com/locate/virusres

Gp41, a superfamily SF2 helicase from bacteriophage BFK20

T

Nora Halgasova, Radka Matuskova, Daniel Kraus, Adela Tkacova, Lenka Balusikova, ⁎ Gabriela Bukovska Department of Genomics and Biotechnology, Institute of Molecular Biology, Slovak Academy of Sciences, Dubravska cesta 21, 845 51, Bratislava, Slovakia

A R T I C L E I N F O

A B S T R A C T

Keywords: Bacteriophage Corynebacterium DNA replication Helicase Protein expression Replication protein

Gp41 is one of two helicases encoded by the genome of bacteriophage BFK20. The gp41 sequence contains conserved motifs from the SF2 family of helicases. We prepared and studied three recombinant proteins: gp41HN, a wild type-like protein with an N-terminal His-Tag; gp41HC, with an S2A mutation and a C-terminal His-Tag; and gp41dC, a mutant protein with a deleted C-terminal region and His-Tags on both N- and C-termini. We tested the enzymatic activities and DNA binding abilities of these isolated proteins. We found that both gp41HN and gp41HC had strong DNA-dependent ATPase activities, but that the ATPase activity of gp41dC was significantly lower regardless of the presence of DNA. The preferred substrates for the NTP hydrolysis reactions were ATP and dATP. gp41HC and gp41HN exhibited a low helicase activity in a fluorescence-based assay using dsDNA substrates with a 3′ overhang and with a forked end in the presence of ATP. We infer that the C-terminal region of gp41 may be involved in DNA binding, since removing this region in gp41dC reduced the protein’s DNA binding ability.

1. Introduction Helicases are molecular motor proteins that use the energy from nucleoside triphosphate hydrolysis to catalyse the separation of the complementary strands of double-stranded nucleic acids. Based on conserved motifs and comparative structural and functional analysis (Gorbalenya and Koonin, 1993; Singleton et al., 2007), helicases have been divided into six superfamilies (SF). The two largest groups, SF1 and SF2, comprise enzymes that operate as monomers or dimers, while families SF3 to SF6 contain helicases that function as ring-shaped oligomers, mostly hexamers (Singleton et al., 2007). SF1 and SF2 helicases contain a conserved helicase core consisting of two RecA-like folds with SF1 and SF2 conserved motifs, and accessory N- or C-terminal domains. Recently, Fairman-Williams et al. (2010a,b) proposed a new categorization of the SF1 and SF2 helicases based on both the helicase core and the accessory domains. SF2 is the largest helicase superfamily. Helicases from this family are involved in many aspects of nucleic acid metabolism. SF2 DNA helicases participate in DNA replication, recombination and repair, maintaining genome stability, chromatin remodelling, and Holliday junction movement (Briggs et al., 2004; Rezazadeh, 2011; Gabbai and Marians, 2010; LeRoy et al., 2005; Saha et al., 2006). Mutations in genes coding for SF2 helicases result in serious human diseases, including premature aging and several forms of cancer (Harrigan and

⁎

Bohr, 2003; Suhasini and Brosh, 2013). SF2 family helicases from different kinds of organisms (eukaryotes, prokaryotes, archaea, bacteriophages) have many common features that are related to their function and specificity. Bacteriophages are a favourite model system to study DNA replication in prokaryotes, and they exhibit examples of every theoretically possible replication mechanism (Weigel and Seitz, 2006). The different molecular mechanisms driving phage DNA replication arise from the high diversity of phage-encoded replication proteins. The replication mechanism of a given bacteriophage depends not only on its own replication machinery, but also on its ability to recruit replication proteins from its bacterial host. Bacteriophage genomes have a modular structure, and phage genes encoding replication functions tend to be located close to each other in many phage genomes, resulting in phage replication modules. Four major types of phage replication modules have been identified: those containing (1) initiator genes, (2) DNA polymerase genes, (3) ΦP4α-type helicase-primase genes and (4) filamentous phage modules (Weigel and Seitz, 2006). Type (2) appears in phages that encode individual DNA polymerases, and their genomes contain genes encoding one or two helicases and a primase. Most frequently, one of these helicases is an SF4 replicative helicase, while the second belongs to the SF2 family; occasionally genes encoding helicases similar to the ΦP4α protein or from the SF1 family can also be found (Weigel and Seitz, 2006). The SF4 family helicases and those similar to

Corresponding author. E-mail address: [email protected] (G. Bukovska).

https://doi.org/10.1016/j.virusres.2017.12.005 Received 25 July 2017; Received in revised form 30 October 2017; Accepted 8 December 2017 Available online 14 December 2017 0168-1702/ © 2017 Elsevier B.V. All rights reserved.

Virus Research 245 (2018) 7–16

N. Halgasova et al.

Table 1 Oligonucleotides used for the preparation of helicase substrates. Oligonucleotide

Sequence (5′ → 3′)

Fluorophore

Labelled end

A B C D E Capture strand I Capture strand II

TAGTACCGCCACCCTCAGAACCTTTTTTTTTTTTTTTTTTTTTT TAGTACCGCCACCCTCAGAACC GGTTCTGAGGGTGGCGGTACTA TTTTTTTTTTTTTTTTTTTTTTGGTTCTGAGGGTGGCGGTACTA TTTTTTTTTTTTTTTTTAAAAAGGTTCTGAGGGTGGCGGTACTA TAGTACCGCCACCCTCAGAACC TAGTACCGCCACCCTCAGAACCTTTTT

FAM FAM BHQ1 BHQ1 BHQ1

5′ 5′ 3′ 3′ 3′

completely sequenced and annotated (EMBL AJ278322, Bukovska et al., 2006), and potential ORFs have been identified. Clusters of functionally related putative replication, regulatory, structural and lytic genes were defined. The genes ORF29-ORF46 appear to be a replication module for BFK20. Like bacteriophages T4 and T5, the BFK20 replication module belongs to type (2), encoding a putative DNA polymerase A (gp44), a RepA-like protein with a prim-pol domain and an SF4-type helicase domain (gp43), and an SF2 family helicase (gp41). However, although the replication modules of bacteriophages T4, T5 and BFK20 are of the same type and the proteins they encode have related functions, these proteins exhibit very different sequences and different closest homologues, meaning they most likely also have different origins. It is therefore very likely that their replication mechanisms and the specific functions of individual proteins, including those of the helicases, are different. Proteins gp41 and gp43 were characterised as putative BFK20 helicases. Recently, we detected ssDNA-dependent ATPase and helicase activities for gp43, and we suggested that this protein functions as an SF4 family replicative helicase (Halgasova et al., 2015). SF4 replicative helicases unwind the template DNA for polymerases at the replication fork and are responsible for unwinding the majority of dsDNA genomes, but accessory replicative helicases, mainly from the SF2 family, aid replication repair and restart. The second helicase-like protein from BFK20 is gp41. This protein contains conserved motifs from the SF2 family and a C-terminal region of unknown function. In our previous work, we detected interactions between gp41 and the host proteins DnaZX, DnaN, Dnaδ, DnaG, and SSB, and we showed that the strongest interaction was between gp41 and DnaG (Solteszova et al., 2015). In this work, we demonstrate that gp41 has ATPase and helicase activities, and we show that the gp41 C-terminal region has a DNA binding function. This more detailed characterization of gp41 contributes to understanding the helicase’s function in BFK20 genome replication, and, in addition, the function of SF2 family helicases in general.

the phage P4 alpha primase-helicase serve as replicative helicases for phage DNA replication, while the SF1 and, mainly, the SF2 helicases have auxiliary functions in replication, restart, DNA repair and recombination. SF2 helicase genes are found in many phage genomes, however, information about the structure and function for most of these proteins is limited. The most heavily studied protein is UvsW, an SF2 family helicase, encoded by the T4 phage genome. UvsW plays a unique role in phage DNA replication, recombination and repair, and, in addition to replicative helicase gp41 from the SF4 family, and the SF1 family Dda protein, is the third helicase encoded by the T4 genome. UvsW has ssDNA-dependent ATPase and branched-DNA unwinding activities (Carles-Kinch et al., 1997). The same authors found that UvsW is a functional analog of the bacterial DNA helicase RecG, and is able to dissociate RNA from R-loops. More recently, it was demonstrated that UvsW operates as a molecular switch in T4 DNA replication. T4 early origin-dependent replication uses R-loops as initiation sites. UvsW unwinds R-loops from T4 origins using its RNA-DNA helicase activity and causes a transition from origin-dependent replication to late recombination-dependent replication (Dudas and Kreuzer, 2001). UvsW unwinds a variety of DNA/DNA and RNA/DNA substrates with a preference for stalled replication forks and recombination intermediates and, additionally, contains single-stranded DNA (ssDNA) annealing activity (Nelson and Benkovic, 2007). In recent years, two SF2 family helicases from bacteriophage T5 have been characterized. D2 is an unusual bipolar helicase with both 3′ → 5′and 5′ → 3′ unwinding activities. Unwinding of DNA substrates in the 3′ → 5′ direction is more robust and can be distinguished from the 5′ → 3′ activity by a number of features, including helicase complex stability, salt sensitivity and the length of the ssDNA overhang required to initiate helicase activity (Wong et al., 2013). D10 has sequence and functional similarities with T4 UvsW, and possesses branch migration and DNA unwinding activities. Although the DNA binding and DNAdependent ATPase activity of D10 did not show any sequence specificity, initiation of substrate unwinding did show some sequence specificity (Wong et al., 2016). In addition to D2 and D10, a DnaB-like protein, similar to the Escherichia coli replicative helicase DnaB, is encoded by the T5 genome (Wong et al., 2013). Based on replication module composition, both T4 and T5 phages seem to be of type (2). The T4 DNA replication machinery is different from both the bacterial and the archaeal/eukaryotic one, with some components distantly related to bacterial proteins (e.g., the primase and replicative helicase), while others are more related to eukaryotic ones (e.g., the polymerase, clamp and clamp loader, DNA ligase, and type II DNA topoisomerase) (Forterre, 2013). However, in both cases the phage proteins exhibit low sequence similarities to their cellular homologues, being only members of the same protein family, such as Toprim primase or family B DNA polymerase. The study of the DNA replication machinery of complex DNA viruses encoding their own replication proteins would provide important information for identifying novel proteins and mechanisms even within cellular systems, and would enlarge our picture of the world of replicons. Bacteriophage BFK20 is a lytic phage of the L-lysine producer Brevibacterium flavum CCM 251. The genome of this phage has been

2. Materials and methods 2.1. Bacteria, bacteriophage, growth conditions Brevibacterium flavum CCM 251 (hse−, Aecr) were used for propagation of bacteriophage BFK20 according to Koptides et al. (1992). Isolation of BFK20 phage particles and phage DNA was performed according to Sambrook and Russel (2001). Escherichia coli XL1 Blue (Stratagene), used for cloning, were grown in LB medium supplemented with 100 μg/ml kanamycin at 37 °C. Escherichia coli BL21 (DE3) (Novagen), used for recombinant protein expression, were grown in TB medium supplemented with 100 μg/ml kanamycin at 30 °C or 37 °C. 2.2. Cloning, expression and isolation of recombinant proteins For expressing recombinant gp41HC, we prepared plasmid pET2841HC. The putative gene ORF41 was amplified using PCR with BFK20 DNA as a template on a T-Gradient thermal cycler (Whatman Biometra). The forward primer 5′-TTCCATGGCTGTGAAGCCCCG 8

Virus Research 245 (2018) 7–16

N. Halgasova et al.

Fig. 1. Bioinformatics analysis of gp41. (A) Significant matches identified in the gp41 sequence by a search against the CDD. (B) Protein sequence alignment of BFK20 gp41 and T4 UvsW (NP_049796). Identical residues are in bold. The Q, I, Ia, II, III, IV, V and VI SF2 helicase family conserved motifs were manually identified based on the alignment of SF1 and SF2 helicase protein sequences given in the Supplementary material of FairmanWilliams et al., 2010b, and are boxed. Invariant residues from conserved features are mapped to the gp41 sequence as given: ATP binding sites (▲), nucleotide-binding sites ( ). The coiled coil motif identified in the Cterminal region is shaded gray. The residues that are deleted in gp41dC are in italic.

PCR product was cloned into a pET28a+ expression vector (Novagen) and verified by sequence analysis. The resulting pET28-41HC plasmid was transformed into the expression host E. coli BL21 (DE3). This cloning strategy resulted in the synthesis of the 552 residue protein

CGA-3′, and reverse primer 5′- TCGTCGACTCGAAAAAATCCTT-3′ contained restriction sites NcoI and SalI, respectively (underlined). Amplification was performed using the Phusion High-Fidelity DNA Polymerase (Thermo Scientific) in Phusion HF buffer. The amplified 9

Virus Research 245 (2018) 7–16

N. Halgasova et al.

Fig. 2. SDS-PAGE and Western blot analysis of expressed and isolated (A) gp41HN, (B) gp41HC and (C) gp41dC. Lane M - protein size marker, lane 1 - cell lysate containing expressed gp41HN, gp41HC or gp41dC; lane 2 - soluble fraction of the cell lysate; lane 3 - purified gp41HN, gp41HC or gp41dC. Lanes 4, 5, 6 - the same loadings as in 1, 2, 3 probed with a His-Tag antibody.

expression of the 430 residue mutant protein gp41dC, we prepared a pET28-41dC plasmid. pET28-41HN was cut with BamHI and the 1130 bp fragment containing the sequence encoding the gp41 helicase core (amino acid residues 1–375) was re-cloned into pET28a+,

gp41HC with a C-terminal His-Tag. In this protein, Ser-2 was replaced by an alanine as a result of the NcoI restriction site insertion. For expression of the 573 residue protein gp41HN with an N-terminal HisTag, we used the plasmid pET28-41HN (Bukovská et al., 2014). For 10

Virus Research 245 (2018) 7–16

N. Halgasova et al.

Fig. 3. The ATPase activities of gp41HN, gp41HC and gp41dC in the presence of ssDNA, dsDNA and without DNA. (A, B): ATPase activities of gp41HN and gp41HC at a final protein concentration of 0.5 μM. (C): The ATPase activity of gp41dC with a final protein concentration of 1 μM. For each experiment, the mean ± SD was calculated from three independent experiments.

2.3. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE) and Western blot analysis Protein expression, all purification steps, and both the purity and quantity of the isolated gp41HC, gp41HN and gp41dC were monitored by SDS-PAGE according to Laemmli (1970). An Unstained Protein Molecular Weight Marker (#26610, Thermo Scientific) was used as a molecular weight marker. Proteins separated in an SDS-PAGE gel were analysed by Western blotting using a Panther semidry electroblotter (Owl). A His-Tag Monoclonal Antibody and a Goat anti-mouse IgG alkaline phosphatase conjugate (both from Novagen) were used to identify His-tagged proteins. A PageRuler Prestained Protein Ladder (#26616, Thermo Scientific) served as a molecular weight marker. 2.4. NTPase activity assay NTP hydrolysis was measured as the release of inorganic phosphate using the non-radioactive method of Lanzetta et al. (1979). We used the procedure described by Halgasova et al. (2015) with minor modifications. A standard reaction mixture for the NTPase activity assay consisted of 50 mM Tris-HCl pH 7.5, 5 mM MgCl2, 6.4 μg/ml ΦX174 ssDNA (New England Biolabs) and 1 mM NTP (Serva) or dNTP (Pharmacia Biotech). The reactions were performed at 30 °C. Three groups of samples were used to study the effect of DNA on the ATPase activities of gp41HN, gp41HC and gp41dC: one containing 6.4 μg/ml ΦX174 ssDNA, a second containing 6.4 μg/ml BFK20 dsDNA, and a third with no DNA. The concentrations of gp41HN and gp41HC in the reaction mixtures were 0.5 μM, the concentration of gp41dC was 1 μM. To determine the preferred nucleotide for the gp41HN NTPase reaction, we screened the following NTPs and dNTPs: ATP, GTP, CTP, UTP, dATP, dGTP, dCTP and dTTP. Nucleotide hydrolysis was tested separately for each of the nucleotides using a standard reaction mixture. The concentration of gp41HN in the reaction mixtures with ATP and dATP was 0.1 μM, in other NTPase reactions 1 μM gp41HN was used. Blank preparation, phosphate quantification, and calculation of average and standard deviation were done according to Halgasova et al. (2015).

Fig. 4. The NTPase and dNTPase activities of gp41HN. Nucleotide hydrolysis was tested separately for each nucleotide at 30 °C in the presence of ssDNA. The rate of NTP hydrolysis is expressed as moles of phosphate released by 1 mol of the protein in 1 min for each NTP or dNTP. The mean ± SD was calculated from four independent experiments.

resulting in expression plasmid pET28-41dC. gp41dC contained His-Tag sequences on both the N- and C- termini. For protein expression, 3 ml of starter culture were inoculated into 150 ml TB medium supplemented with 100 μg/ml kanamycin. At an optical density of 0.5 at 600 nm, isopropyl-β-D-thiogalactopyranoside was added to a final concentration of 0.5 mM. The cells were grown on an orbital shaker at 200 rpm for an additional 4 h at 30 °C (for isolation of gp41HC and gp41HN) or 3 h at 37 °C (for isolation of gp41dC). The cells were harvested by centrifugation at 2000 × g for 15 min at 4 °C, washed in physiological saline and again harvested. The pellets were suspended in 6 ml of 50 mM Tris-HCl pH 8.0, 0.5 M NaCl, 20 mM imidazole supplemented with 60 μl of Protease Inhibitor Cocktail (SigmaAldrich) and lysed using sonication 10 times for 15 s with amplitude 10 on a Soniprep 150 Plus (MSE). The cell debris were then removed by centrifugation at 20,000 × g for 30 min at 4 °C. The supernatant was loaded onto a chromatography column with 1 ml HIS-Select cobalt affinity gel (Sigma-Aldrich) equilibrated with 50 mM Tris-HCl pH 8.0, 0.5 M NaCl, 20 mM imidazole. After protein loading, the column was washed with the same buffer. Affinity chromatography was performed at 4 °C. Proteins were eluted from the column with 50 mM Tris-HCl pH 8.0, 0.5 M NaCl, 100 mM imidazole. Fractions containing the purified enzymes were pooled and dialyzed against 20 mM Tris-HCl pH 8.0, 150 mM NaCl, 40% (v/v) glycerol. The isolated proteins were quantified using the Bradford protein assay.

2.5. Helicase activity assay To detect the helicase activity of gp41HC, we used the fluorometric microplate assay described by Krawczyk et al. (2010) with minor modifications. The donor and acceptor strands used to prepare the quenched double-stranded DNA substrates for the helicase reactions and capture strands, complementary to the acceptor strands, are described in Table 1. The donor and acceptor strands were labelled with the fluorophores FAM and Black Hole Quencher (BHQ) 1, respectively, and were designed so that the unlabelled end of the DNA substrate 11

Virus Research 245 (2018) 7–16

N. Halgasova et al.

Fig. 5. Helicase activity of gp41HC and gp41HN. Helicase activity time courses were measured with a substrate with a 3′ overhang (A, a-d), with two forked DNA substrates (B, a–d; C, a–d) and with a substrate with a 5′ overhang (D, a–d). The reactions were started by the addition of ATP to a final concentration of 0.8 mM. Control samples without ATP were tested in parallel for each protein concentration. No protein controls were measured in each experiment. For each substrate and protein concentration, the mean ± SD was calculated from three independent experiments.

Galväo et al. (2004) with minor modifications. The dsDNA fragment was derived from BFK20 ORF43 and was synthesized by PCR amplification using forward and reverse primers 5′-TCCCATGGCTCAAGAGG ATTCCG-3′ and 5′-TTGTCGACGTCAATACGCACGT-3′, respectively, with BFK20 DNA as a template. 30 nM dsDNA fragment or 70 nM ΦX174 ssDNA were incubated with 5–15 μM protein in 20 μl of reaction buffer, containing 40 mM Tris-acetate pH 8.0, and 1 mM EDTA, for 20 min at 30 °C. After addition of 4 μl 6 × DNA Loading Dye (#R0611, Thermo Scientific), the samples were subjected to gel electrophoresis in 0.5% agarose gel in 40 mM Tris-acetate pH 8.0, 1 mM EDTA at 3 V/cm. After electrophoresis, the gel was stained with ethidium bromide (1 μg/ ml).

contains a 3′ or 5′ overhang, or an ssDNA fork. The oligonucleotides A and C were annealed to prepare a substrate with a 3′ overhang, oligonucleotides B and D for a substrate with a 5′ overhang, and oligonucleotides A and D or A and E for substrates with forked ends. The annealing reaction and helicase activity assay were performed according to Krawczyk et al. (2010), but with 4 mM MgCl2 rather than MnCl2 in the reaction buffer, and sodium azide was omitted. The concentrations of the dsDNA substrate and the capture strand were as described in Halgasova et al. (2015). The protein concentration in the reaction mixture ranged from 20 to 320 nM. The unwinding reaction was initiated by the addition of ATP to a final concentration of 0.8 mM. The reaction was carried out for 40 min at 30 °C in a Synergy HT MultiMode Microplate Reader (Biotek). The FAM fluorophore was excited at 485 ± 20 nm, the activity was measured at 528 ± 20 nm and the fluorescence signal was registered every 2 min.

2.7. Bioinformatics analysis A homology search on the gp41 sequence was done using the NCBI Blast Server (Altschul et al., 1997) using Blastp against the non-redundant database. A Conserved Domain Database (CDD, MarchlerBauer et al., 2017) search was used to find conserved domains and conserved motifs in the protein. Protein sequence alignment was done

2.6. DNA band-shift assay We tested the binding of gp41HN, gp41HC and gp41dC to a 1012 bp dsDNA fragment and to ΦX174 ssDNA (5386 bases) according to 12

Virus Research 245 (2018) 7–16

N. Halgasova et al.

Fig. 6. DNA binding assay of gp41HN, gp41HC and gp41dC. Binding of gp41HN, gp41HC and gp41dC to a dsDNA fragment (A) and to ΦX174 ssDNA (B) was tested using agarose gel electrophoresis. After electrophoresis, the gel was stained with ethidium bromide. In (A) and (B): Lanes 1, 12 - DNA substrate without protein; lanes 2, 3, 4 - binding of 5, 10 and 15 μM gp41HN to DNA; lanes 5, 17 - DNA substrate with BSA; lanes 6, 7, 8 - binding of 5, 10 and 15 μM gp41dC to DNA; lanes 9, 11 -Lambda DNA/ EcoRI + HindIII Marker; lane 10 - gp41dC without DNA; lanes 13, 14, 15 - binding of 5, 10 and 15 μM gp41HC to DNA; lane 16 - gp41HC without DNA.

using Clustal Omega (Sievers et al., 2011). Interactive Web Server NPS@: Network Protein Sequence Analysis (Combet et al., 2000) was used to identify the specific structural motifs of gp41.

specific hits to Superfamily II DNA or RNA helicase, involved in transcription, replication and repair (SSL2, COG1061, E-value 6.78 × 10−70); Type III restriction enzyme, restriction subunit (ResIII, pfam04851, E-value 3.52 × 10−30); Helicase superfamily C-terminal domain, associated with DEXDc-, DEAD- and DEAH- box proteins (HELICc, cd00079, E-value 1.71 × 10−15); and DEAD-like helicases superfamily (DEXDc, smart00487, E-value 5.84 × 10−14). The positions and sizes of the identified specific hits relative to the gp41 sequence are shown in Fig. 1A. Fig. 1B shows a sequence alignment of BFK20 gp41 and T4 helicase

3. Results 3.1. Bioinformatics analysis A sequence homology search against the Conserved Domain Database using the gp41 sequence as a query, produced sequence 13

Virus Research 245 (2018) 7–16

N. Halgasova et al.

of DNA.

UvsW. The two proteins show only weak homology, with a sequence identity below 19%. Moreover, gp41 lacks the N-terminal accessory region of UvsW. Based on a protein sequence alignment of SF1 and SF2 family helicases (Fairman-Williams et al., 2010b; Supplementary material) we manually identified the Q, I, Ia, II, III, IV, V and VI conserved sequence motifs found in helicases from the SF2 family in the gp41 sequence. Using the program Coiled coil prediction (Combet et al., 2000), we identified a coiled coil motif in the C-terminal region of gp41 (Fig. 1B). Such motifs facilitate protein oligomerization, act as molecular spacers, propagate conformational changes and may also function in DNA recognition and cleavage (Truebestein and Leonard, 2016).

3.5. DNA band-shift assay Two types of DNA substrates were used to test the DNA binding abilities of gp41HN, gp41HC and gp41dC. Binding of the proteins to a 1012 bp dsDNA fragment is shown in Fig. 6A, binding to phage ΦX174 ssDNA in Fig. 6B. Band shifts can be seen for both types of DNA substrates with gp41HN and gp41HC (Fig. 6A, B, lanes 2–4 and 13–15) relative to negative controls with no protein or with BSA (Fig. 6A, B, lanes 1, 12 and 5, 17). In contrast, the binding ability of gp41dC with its missing C-terminal region was significantly lower (Fig. 6A, B, lanes 6–8).

3.2. Expression and purification of gp41HN, gp41HC and gp41dC. Western blot analysis

4. Discussion Recombinant proteins gp41HN, gp41HC and gp41dC, with calculated molecular weights of 61.7, 59.6, and 46.4 kDa, respectively, were isolated from soluble cell lysate fractions by immobilized metal ion affinity chromatography using cobalt affinity gel (Fig. 2A, B, C). Yields of gp41HN, gp41HC and gp41dC isolated from 150 ml of induction culture were about 2.5, 1 and 0.4 mg, respectively. Purified gp41HN, gp41HC and gp41dC, separated by SDS-PAGE, were probed using a His-Tag Monoclonal Antibody (Fig. 2A, B, C).

SF2 is the largest helicase superfamily, and SF2 helicases are involved in many aspects of nucleic acid metabolism. Similar enzymes from this family may be found in bacteria, archaea, eukaryotes and viruses. Mutations in genes coding for SF2 helicases result in several human diseases. Helicases can be classified in various ways - according to their biological function, nucleic acid substrate specificity, translocation directionality, oligomeric state or conserved sequence motifs. According to a new classification scheme proposed by Fairman-Williams et al. (2010a,b), the SF2 superfamily can be divided into 9 families and one group: RecG-like, RecQ-like, Rad3/XPD, Ski2-like, T1R, Swi/Snf, RIG-Ilike, DEAD-box, DEAH/RHA, and NS3/NPHII. Among these, the Ski2like, RIG-I-like, RecQ-like and RecG-like helicase family proteins and the NS3/NPHII group proteins are characterized as helicases with preferred 3′ → 5′ translocation polarity. The Ski2-like, RIG-I-like, RecQlike and RecG-like proteins are specific for adenosine triphosphates. BFK20 gp41 is a helicase with a preferred 3′ → 5′ translocation polarity and is specific for ATP and dATP; we therefore suggest that gp41 belongs to one of these groups. Unfortunately, our attempts to find a stronger sequence homology to the conserved motifs of any one helicase group failed, and we found only homologies to particular motifs in proteins from different groups. Genes encoding putative SF2 helicases were also identified in many phage genomes, especially in mycobacteriophages. However, so far, only a few phage helicases from the SF2 family have been characterized in detail, for example T4 phage UvsW and the bacteriophage T5 proteins D2 and D10. Sequence homology between the BFK20 gp41 helicase core and the core helicase domains of T4 UvsW, T5 D2 and T5 D10 is very low. UvsW is able to unwind a simple duplex containing a 3′ ssDNA overhang but not a 5′ ssDNA overhang or an ssDNA fork (Nelson and Benkovic, 2007), though it is able to unwind a branched DNA substrate (Carles-Kinch et al., 1997). On the other hand, T5 D2 is a bipolar helicase with both 3′ → 5′ and 5′ → 3′ helicase activity (Wong et al., 2013). In experiments focused on the helicase activity of gp41, we detected a low ATP-dependent helicase activity on a substrate with a 3′ ssDNA overhang and an ssDNA fork. From all this, we may infer that bacteriophage SF2 family helicases are probably both highly variable and specific, and that the set of substrates unwound by each protein is different. This conclusion is consistent with the wide variability of mechanisms used by bacteriophages to replicate their genomes. When testing helicase activity, we also observed increased fluorescence from samples without ATP. This ATP-independent fluorescence increase may arise from binding of the DNA substrates by the protein in the reaction mixture, which might cause the separation of fluorophore and quencher (Lou et al., 2004). The increase in fluorescence in the absence of ATP may somewhat complicate detection of the low ATPdependent helicase activity of some proteins, such as gp41HC and gp41HN. Reynolds et al. (2015) described how the ATP-independent unwinding of a DNA substrate by the hepatitis C virus protein NS3 may be abolished by extending the substrate duplex region from 22 to 30 bp.

3.3. NTPase activity assay The ATPase activities of gp41HN, gp41HC and gp41dC were monitored in the presence of ssDNA, dsDNA and in the absence of DNA. We detected strong ssDNA-dependent ATPase activities for gp41HN and gp41HC, significantly lower, but still high, dsDNA-dependent activities for both proteins, and low activities in the absence of DNA (Fig. 3A, B). In contrast, the ATPase activity of gp41dC remained relatively unchanged regardless of the presence or absence of DNA (Fig. 3C), and was comparable to the ATPase activity of gp41HN measured without DNA. We also determined which NTP or dNTP was the preferred substrate for the NTPase reaction of gp41HN (Fig. 4). The protein showed the highest activity when using ATP and dATP, and had only low levels of activity against other NTPs (GTP, CTP, UTP) and dNTPs (dGTP, dCTP, dTTP). 3.4. Helicase activity assay To test the helicase activities of gp41HN, gp41HC and gp41dC, we used four types of fluorescently labelled dsDNA substrates: one with a 3′ ssDNA overhang, one with a 5′ ssDNA overhang and two substrates with forked ends. The substrates with 3′ and 5′ overhangs contained a 22 bp duplex region and a 22 base long 3′ or 5′ ssDNA overhang. The forked substrates contained a 22 bp duplex region and a 22 base long ssDNA fork, or a 27 bp duplex region and a 17 base long ssDNA fork. We measured an increase in fluorescence in both the presence and absence of ATP. We detected a weak ATP-dependent helicase activity for gp41HC and gp41HN. We found that gp41HC and gp41HN unwound the DNA substrates with a 3′ overhang (Fig. 5A, a–d) and with forked ends (Fig. 5B, a–d; 5C, a–d). When using these substrates, we observed a strong increase in fluorescence in the presence of ATP and a slightly lower increase in the absence of ATP. As seen in Fig. 5, gp41HC and gp41HN showed low, but clear ATP-dependent helicase activity. The activity was easier to detect at lower protein concentrations (20–80 nM protein); at higher concentrations, the difference between ATP-dependent and ATP-independent fluorescence was less distinct. We could not detect any g41HC and gp41HN ATP-dependent helicase activity in the presence of a substrate with a 5′ overhang (Fig. 5D, a–d). We also tested the helicase activity of the mutant protein gp41dC in the presence of DNA substrates with a 3′ overhang and a forked end, but could not detect any helicase activity. This result was not surprising, because gp41dC has only low ATPase activity, regardless of the presence or type 14

Virus Research 245 (2018) 7–16

N. Halgasova et al.

terminal region and His-Tag sequences on both its N- and C-termini. We detected strong DNA-dependent ATPase activities for both full-length proteins, and we found that the preferred substrates for the NTP hydrolysis reactions were ATP and dATP. The gp41dC mutant protein had only low ATPase activity regardless of the presence or absence of DNA. gp41HC and gp41HN had low ATP-dependent helicase activities in the presence of dsDNA substrates with a 3′ overhang and with forked ends. We infer that the C-terminal region of gp41 may have a DNA binding function, since removing it reduced the DNA binding ability of gp41dC. Although genes encoding putative SF2 helicases were identified in several phage genomes, so far only a few phage helicases from this family have been characterized in detail. With T4 UvsW and T5 D2 and D10 proteins, gp41 makes the fourth experimentally characterized phage helicase from the SF2 superfamily.

However, extending the DNA substrate duplex region may also disrupt the ATP-dependent helicase activity. Wong et al. (2016) showed that extending the duplex region of forked and Y-shaped substrates from 20 to 55 bp markedly affected the unwinding activity of phage T5 D10. Finding the right substrate for testing the helicase activity is often complicated. We plan to use other substrates to more comprehensively test the helicase activity of gp41 in the future. In recent years, attention has focused not only on the conserved RecA core domains in the SF1 and SF2 helicases, but also on the accessory domains, which are important for the specialized functions of particular enzymes. They are located at the helicase N- or C- termini and may function as nucleases, RNA or DNA binding domains, or domains involved in protein-protein interactions (Fairman-Williams et al., 2010a). These N-terminal and C-terminal accessory domains are usually not conserved within a family. In BFK20 gp41, there is no N-terminal accessory domain, and there is a 200 amino acid long region at the Cterminus. We found that the ATPase activity of gp41dC, a mutant protein without this C-terminal region, was significantly impaired, and that this protein also did not have the strong DNA-dependent ATPase activity of the full-length gp41HC and gp41HN proteins. The ATPase activity of gp41dC stayed at roughly the same low level regardless of the presence or absence of DNA. A DNA binding assay showed that the C-terminal region of gp41 participated in gp41 DNA binding. Another protein whose C-terminal region affects its enzyme activity, is XPB. XPB is an SF2 family helicase with ATPase and 3′ → 5′ helicase activities. It is an integral subunit of the transcription factor TFIIH, and is involved in nucleotide excision repair (Schaeffer et al., 1993). Hwang et al. (1996) showed that a recombinant version of the human XPB helicase with a frameshift mutation in the C-terminal region had only very weak helicase and ATPase activities, despite the mutation occurring outside of the helicase conserved motifs and putative DNA binding domains. A homology search on the C-terminal region of gp41 using the NCBI Blast server revealed no significant homology to other proteins. In this region we identified only a coiled coil motif: GTLEQAREAAEAEINRIA, residues 462–479. Coiled coil motifs most often promote protein dimerization, but they may also function as molecular spacers, in vesicle tethering, in accurate chromosome segregation, in centriole architecture, and in DNA recognition and cleavage (Truebestein and Leonard, 2016). It is possible that the gp41 C-terminal coiled coil motif is involved in its DNA binding, however, this still needs to be confirmed by the preparation and testing of other mutant proteins with and without this motif. gp41 is one of the two helicases encoded by the BFK20 genome. The second helicase, the gene product of ORF43, contains an N-terminal primase-polymerase domain (Halgasova et al., 2012) and C-terminal SF4 helicase domain (Halgasova et al., 2015). In previous studies, we detected interactions between gp41 and the proteins DnaZX, DnaN, Dnaδ, DnaG and SSB from the BFK20 host Brevibacterium flavum CCM 251 (Solteszova et al., 2015). We found that of the five phage proteins tested, gp40-gp44, only gp41 is involved in interactions with the host proteins. In this work, we demonstrated that gp41 has ATPase and helicase activities and binds to DNA. It seems that gp41 has multiple functions in phage DNA replication, and could be a key factor of the whole process. A detailed characterization of gp41 will help us to determine its role in BFK20 replication and may contribute to understanding the whole BFK20 replication mechanism.

Acknowledgements This work was supported by VEGA grant 2/0122/14 from the Slovak Academy of Sciences. The authors would like to thank Dr. Jacob Bauer (IMB SAS, Bratislava, Slovakia) for critical reading and revision of the manuscript. References Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Briggs, G.S., Mahdi, A.A., Weller, G.R., Wen, Q., Lloyd, R.G., 2004. Interplay between DNA replication, recombination and repair based on the structure of RecG helicase. Philos. Trans. R Soc. Lond. B Biol. Sci. 359, 49–59. Bukovská, G., Halgašová, N., Hromadová, L., Koščová, H., Bukovský, M., 2014. Immunodetection and N-terminal sequencing of DNA replication proteins of bacteriophage BFK20–lytic phage of Brevibacterium flavum. Acta Virol. 58, 152–159. Bukovska, G., Klucar, L., Vlcek, C., Adamovic, J., Turna, J., Timko, J., 2006. Complete nucleotide sequence and genome analysis of bacteriophage BFK20—A lytic phage of the industrial producer Brevibacterium flavum. Virology 348, 57–71. Carles-Kinch, K., George, J.W., Kreuzer, K.N., 1997. Bacteriophage T4 UvsW protein is a helicase involved in recombination, repair and the regulation of DNA replication origins. EMBO J. 16, 4142–4151. Combet, C., Blanchet, C., Geourjon, C., Deléage, G., 2000. NPS@: network protein sequence analysis. Trends Biochem. Sci. 25, 147–150. Dudas, K.C., Kreuzer, K.N., 2001. UvsW protein regulates bacteriophage T4 origin-dependent replication by unwinding R-loops. Mol. Cell. Biol. 21, 2706–2715. Fairman-Williams, M.E., Guenther, U.P., Jankowsky, E., 2010a. SF1 and SF2 helicases: family matters. Curr. Opin. Struct. Biol. 20, 313–324. Fairman-Williams, M.E., Guenther, U.P., Jankowsky, E., 2010b. SF1 and SF2 Helicases: Family Matters. http://dx.doi.org/10.1016/j.sbi.2010.03.011. (Supplementary material). Forterre, P., 2013. Why are there so many diverse replication machineries? J. Mol. Biol. 425, 4714–4726. Gabbai, C.B., Marians, K.J., 2010. Recruitment to stalled replication forks of the PriA DNA helicase and replisome-loading activities is essential for survival. DNA Repair 9, 202–209. Galväo, C.W., Pedrosa, F.O., Souza, E.M., Yates, M.G., Chubatsu, L.S., Steffens, M.B.R., 2004. Expression, purification, and DNA-binding activity of the Herbaspirillum seropedicae RecX protein. Protein Expression Purif. 35, 298–303. Gorbalenya, A.E., Koonin, E.V., 1993. Helicases: amino acid sequence comparisons and structure-function relationships. Curr. Opin. Struct. Biol. 3, 419–429. Halgasova, N., Mesarosova, I., Bukovska, G., 2012. Identification of a bifunctional primase-polymerase domain of corynephage BFK20 replication protein gp43. Virus Res. 163, 454–460. Halgasova, N., Solteszova, B., Pevala, V., Košťan, J., Kutejová, E., Bukovska, G., 2015. A RepA-like protein from bacteriophage BFK20 is a multifunctional protein with primase, polymerase, NTPase and helicase activities. Virus Res. 210, 178–187. Harrigan, J.A., Bohr, V.A., 2003. Human diseases deficient in RecQ helicases. Biochimie 85, 1185–1193. Hwang, J.R., Moncollin, V., Vermeulen, W., Seroz, T., van Vuuren, H., Hoeijmakers, J.H.J., Egly, J.M., 1996. A 3‘– > 5‘ XPB helicase defect in Repair/Transcription factor TFIIH of xeroderma pigmentosum group B affects both DNA repair and transcription. J. Biol. Chem. 271, 15898–15904. Koptides, M., Barak, I., Sisova, M., Baloghova, E., Ugorcakova, J., Timko, J., 1992. Characterization of bacteriophage BFK20 from Brevibacterium flavum. J. Gen. Microbiol. 138, 1387–1391. Krawczyk, M., Stankiewicz-Drogon, A., Haenni, A.-L., Boguszewska-Chachulska, A., 2010. Fluorometric assay of hepatitis C Virus NS3 helicase activity. In: In: Abdelhaleem, M.M. (Ed.), Helicases, Methods in Molecular Biology 587 Humana Press, a part of Springer Science + Business Media, LLC, 211-221. http://dx.doi.org/10.1007/978-160327-355-8_15.

5. Conclusions BFK20 gp41, an SF2 family helicase, is one of two helicases encoded by the genome of bacteriophage BFK20. We expressed and purified three recombinant proteins derived from gp41. Two of these derivatives are full-length proteins which differ in the location of a His-Tag sequence and by one changed amino-acid: gp41HN is a wild type-like protein with an N-terminal His-Tag, while gp41HC has a S2A mutation and a C-terminal His-Tag. gp41dC is a mutant protein with a deleted C15

Virus Research 245 (2018) 7–16

N. Halgasova et al.

127–148. Sambrook, J., Russel, D.W., 2001. Molecular Cloning: A Laboratory Manual, Third ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Schaeffer, L., Roy, R., Humbert, S., Moncollin, V., Vermeulen, W., Hoeijmakers, J.H., Chambon, P., Egly, J.M., 1993. DNA repair helicase: a component of BTF2 (TFIIH) basic transcription factor. Science 260, 58–63. Sievers, F., Wilm, A., Dineen, D.G., Gibson, T.J., Karplus, K., Li, W., Lopez, R., McWilliam, H., Remmert, M., Söding, J., Thompson, J.D., Higgins, D.G., 2011. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 7, 539. Singleton, M.R., Dillingham, M.S., Wigley, D.B., 2007. Structure and mechanism of helicases and nucleic acid translocases. Annu. Rev. Biochem. 76, 23–50. Solteszova, B., Halgasova, N., Bukovska, G., 2015. Interaction between phage BFK20 helicase gp41 and its host Brevibacterium flavum primase DnaG. Virus Res. 196, 150–156. Suhasini, A.N., Brosh Jr., R.M., 2013. Disease-causing missense mutations in human DNA helicase disorders. Mutat. Res. 752, 138–152. Truebestein, L., Leonard, T.A., 2016. Coiled-coils: the long and short of it. Bioessays 38, 903–916. Weigel, C., Seitz, H., 2006. Bacteriophage replication modules. FEMS Microbiol. Rev. 30, 321–381. Wong, I.N., Sayers, J.R., Sanders, C.M., 2013. Nucleic Acids Res. 41, 4587–4600. Wong, I.N., Sayers, J.R., Sanders, C.M., 2016. Bacteriophage T5 gene D10 encodes a branch-migration protein. Sci. Rep. 6, 39414.

Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Lanzetta, P.A., Alvarez, L.J., Reinach, P.S., Candia, O.A., 1979. An improved assay for nanomole amounts of inorganic phosphate. Anal. Biochem. 100, 95–97. LeRoy, G., Carroll, R., Kyin, S., Seki, M., Cole, M.D., 2005. Identification of RecQL1 as a Holliday junction processing enzyme in human cell lines. Nucleic Acids Res. 33, 6251–6257. Lou, H.J., Brister, J.R., Li, J.J., Chen, W., Muzyczka, N., Tan, W., 2004. Adeno-Associated virus Rep78/Rep68 promotes localized melting of the Rep binding element in the absence of adenosine triphosphate. Chem. Bio. Chem. 5, 324–332. Marchler-Bauer, A., Bo, Y., Han, L., He, J., Lanczycki, C.J., Lu, S., Chitsaz, F., Derbyshire, M.K., Geer, R.C., Gonzales, N.R., Gwadz, M., Hurwitz, D.I., Lu, F., Marchler, G.H., Song, J.S., Thanki, N., Wang, Z., Yamashita, R.A., Zhang, D., Zheng, C., Geer, L.Y., Bryant, S.H., 2017. CDD/SPARCLE: functional classification of proteins via subfamily domain architectures. Nucleic Acids Res. 45 (D), 200–203. Nelson, S.W., Benkovic, S.J., 2007. The T4 phage UvsW protein contains both DNA unwinding and strand annealing activities. J. Biol. Chem. 282, 407–416. Reynolds, K.A., Cameron, C.E., Raney, K.D., 2015. Melting of duplex DNA in the absence of ATP by NS3 helicase domain through specific interaction with a single-strand/ double-strand junction. Biochemistry 54, 4248–4258. Rezazadeh, S., 2011. RecQ helicases; at the crossroad of genome replication, repair, and recombination. Mol. Biol. Rep. 39, 4527–4543. Saha, A., Wittmeyer, J., Cairns, B.R., 2006. Mechanisms for nucleosome movement by ATP-dependent chromatin remodeling complexes. Results Probl. Cell Differ. 41,

16