- Email: [email protected]
GPI-anchored SKS proteins regulate root development through controlling cell polar expansion and cell wall synthesis
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
GPI-anchored SKS proteins regulate root development through controlling cell polar expansion and cell wall synthesis Ke Zhou FAFU-UCR Joint Center for Horticultural Biology and Metabolomics, Haixia Institute of Science and Technology, Fujian Agriculture and Forestry University, Fuzhou, 350002, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 6 December 2018 Accepted 12 December 2018 Available online xxx
Glycosylphosphatidylinositol-anchored proteins were reported to be involved in many developmental progresses in Arabidopsis. Here I report that, a group of homologous glycosylphosphatidylinositolanchored proteins from SKU5-Similar family regulate seedling root development of Arabidopsis through controlling cell polar expansion and cell wall synthesis. Due to the irregular expansion of root cells and the defective synthesis of cell walls, their knockout mutants generated shorter roots with irregularly shaped root cells, and thicker cell walls. © 2018 Elsevier Inc. All rights reserved.
Keywords: Arabidopsis GPI-anchored protein Root Cell polar expansion Cell wall synthesis SKU5-Similar
1. Introduction Glycosylphosphatidylinositol (GPI) modification is present among lower and higher eukaryotes, about 0.5% of total proteins were predicted to be GPI-anchored proteins (GAPs) [5]. This glycolipid modification includes a fatty acid tail anchored in the inner membrane leaflet of the endoplasmic reticulum (lumen side) then within the outer leaflet of the plasma membrane bilayer after secretion of the modified protein [6]. It allows tethering GAPs, which possess no transmembrane region, to the external surface of the plasma membrane bilayer through lipid modification [7]. In mammals and yeasts, GAPs play various and important roles in many biological processes, such as, cell surface receptors [8,9], cell adhesion [10,11]. To now, 248 potential GPI-anchored proteins (GAPs) were predicted by proteomic and genomic analysis, and classified as several families in Arabidopsis, including classical AGPs (arabinogalactan proteins), AG peptides, Fasciclin-like AGPs, COBRA family, LORELEI family, several members form SKU5-Similar family, and receptorlike protein TMM [12,13]. They were reported to be involved into many processes of growth and development, such as fertilization
Abbreviations: GPI, glycosylphosphatidylinositol; PM, plasmamembrane; CW, cell wall; TEM, transmission electron microscopy; PI, propidium iodide; SKS, SKU5Similar. E-mail address: [email protected].
[14,15], cell wall composition [16e19], pollen tube guidance [14], cell division and programmed cell death [20]. Broadly disrupted GPI-anchors synthesis system in Arabidopsis caused irregular cell wall synthesis and morphogenesis [21], as well as MAPK cascaderelative defects, such as clustering stomatas, male gametes fertility, which could be rescued by constitutively active YODA (MAPKKK4) [22]. Recent approaches revealed their surprising roles in signaling pathway: LORELEI family chaperon transmembrane Leucine-Rich-Repeat (LRR) Receptor-Like-Kinases (RLK) from ER to the out surface of plasmamembrane, and work as coreceptors with them during perceiving their ligands [23e27]; TMM works as coreceptor of surface RLKs SERK/BAK1 when perceiving their ligands [28,29]. Although SKU5 had been supposed to dock the controversial Auxin Binding Protein 1 (ABP1) on the out surface of Plasma membrane [30], the SKU5-Similar (SKS) family was not well studied. To now, we only know that, SKU5 belongs to a conserved SKU5Similar (SKS) family containing 19 members, among which, phylogenetically close members, SKS1 (SKU5-similar 1), SKS2, SKS3 and SKU5 were reported or predicted to be modified by GPI anchors during maturation [12,13], knockout of SKU5 aggravated natural twisting bias of Arabidopsis [31,32], but the mechanism was not revealed. In this work, we set out to investigate the function of these homologous GPI-anchored SKS members during root development. Here I report that, among these GPI-anchored members, only SKS1,
https://doi.org/10.1016/j.bbrc.2018.12.081 0006-291X/© 2018 Elsevier Inc. All rights reserved.
Please cite this article as: K. Zhou, GPI-anchored SKS proteins regulate root development through controlling cell polar expansion and cell wall synthesis, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.081
2
K. Zhou / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
SKS3 and SKU5 were transcribed during seedling root development, and regulated cell polar expansion and cell wall synthesis. Knockout of these genes resulted in abnormal expansion of root cells and defective cell wall synthesis, which made their cell morphogenesis irregular and cell wall thicker. These unexpected alterations finally resulted in shorter roots with disorientated and aberrant cell files.
2. Materials and methods 2.1. Methods for in silico analyses The amino acid sequence and nucleic acid sequence were acquired from NCBI and TAIR database. GPI modification and cleavage sites were predicted by various GPI anchor prediction tools, which were big-PI Predictor, PredGPI and DGPI [1e3]. Amino acid sequence alignment was performed by ClustalW multiple alignment analysis tool, and phylogenetic trees were calculated by Neighbor-Joining method [4].
2.2. Plant materials and growth conditions Mutants acquired in the study were T-DNA insertion lines. sks1 (FLAG_521F09), sks2 (FLAG_415F09) and sku5 (FLAG_386B03) in Ws background were from Arabidopsis Thaliana Resource Center of Institute Jean-Pierre Bourgin (IJPB), and sks3 (SALK_067925) in Col0 background was from Arabidopsis Biological Resource Center (ABRC). All cross lines were in Ws x Col-0 hybrid background. Seeds were surface sterilized by 75% ethanol and plated on 1/2MS medium containing 0.8% agar. After 48 h vernalization at 4 C in dark, they were plated at 22 C under 16/8 h light. About 7 days growth, seedlings were transferred into soil in green house.
2.3. RNA extraction, cDNA synthesis and quantitative PCR Total RNAs were extracted and cDNAs were synthesized by oligo d(T) primers. Then these cDNA were utilized for quantitative PCR through CFX96 Touch Real-Time PCR detection system and the expression of TUB4 was utilized for inner reference. Primers for Real-time PCR: SKS1-F: CGGATCACAAACCCCGAGGAGGAT; SKS1-R: CACCGAGGCGAGCAACACCATTAG; SKS2-F: ACCCTGAGGAAAACGGAAGTACGG; SKS2-R: TGTGGCCGAGCTGTGATGTTGTTC; SKS3-F: ACTACGCAGGTGTTTCCTGG; SKS3-R: TGGCCAAGATACCATGAGGC; SKU5-F: CGAATTCGGACACCCTGACAATGTTC; SKU5-R: TGAATCCAATGCTCTTCGATGCCGA; TUB4-F, GGTCAATACGTCGGCGATTC; TUB4-R: TCTGACCGAACGGACCAGAT.
3. Results 3.1. In silico analyses of SKU5-Similar (SKS) gene family SKU5 belongs to a conserved gene family containing 19 members, which was called SKU5-Similar (SKS) family. Among these members, SKS1, SKS2 and SKS3 were phylogenetically close to SKU5 (Fig. 1A), and were the only four members possessed hydrophobic omega domain at C-terminus (Fig. 1B). These hydrophobic regions were predicted or proven to guide the synthesis of GPI-anchors and the attachment to the membrane system during protein maturation by various bioinformatic tools (described in methods) and proteomics data [12]. 3.2. Expression pattern of GPI-SKS genes during developmental progresses Before functional charactorization of SKS1, SKS2, SKS3 and SKU5 (GPI-SKS) genes, their expression patterns were investigated. Total RNA from Arabidopsis seedlings, seedling roots and other organs were generated, and then cDNA were synthesized and utilized for quantitative PCR. It showed the markedly different expression pattern of SKS1, SKS2, SKS3 and SKU5 (Fig. 1C): SKS1 was transcribed in seedling roots, opening flowers and siliques; SKS2 was mainly transcribed in reproductive organs, but extremely low or undetectable during seedling development; SKS3 and SKU5 were widely expressed in whole plants, whereas SKS3 was at markedly lower level than SKU5. It suggested that, only SKS1, SKS3 and SKU5 could be transcribed and exercised their functions during root development. 3.3. GPI-SKS play essential roles during root cell development For functional characterization, T-DNA insertion mutant lines of sks1, sks2 and sku5 on Ws background and sks3 on col-0 background were obtained from IJPB and SALK seeds stock respectively. The insertion sites and references were included (Fig. 2A). All these mutants, which could generate generally normal roots on vertical 1/2 MS medium (Fig. 2BeC), were crossed, and all double, triple and quadruple mutant lines were generated. Interestingly, similar shorter and defective roots, where the cell file orientation was disordered, were only found in sks1,sks3, sks1,sku5, sks1,sks3,sku5, sks1,sks2,sks3, sks1,sks2,sku5, and sks1,sks2,sks3,sku5 (Fig. 2BeC). Considering SKS2 was not transcribed during root development, but highly transcribed in reproductive organs, it was not surprisingly to find that, with additional SKS2 mutation, sks1,sks2,sks3, sks1,sks2,sku5, and sks1,sks2,sks3,sku5 generated similar defective roots as sks1,sks3, sks1,sku5, and sks1,sks3,sku5, but produced much fewer seeds, or even no seeds, and suffered from more postembryonic defects during germination (data not shown). 3.4. Genetical relationship between SKS1, SKS3 and SKU5
2.4. Macroscopy and microscopy PI staining: 1 mg propidium iodide was dissolved into 1 ml water to make stock solution, and diluted for 40 times before use. 7day-old seedlings were stained by working solution for 2 min and their roots were observed under Leica SP8 confocal microscopy. Calcofluor White staining: Calcofluor White Stain was bought from Sigma-Aldrich (18909), which could stain cellulose of plant cell walls. 7-day-old seedlings roots were merged into 3.5% agarose, and then made into 80 mm slices by Leica VT1000S vibrating-blade microtome. These slices were merged into Calcofluor White Stain with a drop of 1N NaOH, and then observed under Leica SP8 confocal microscopy.
Interestingly, the same defective roots as sks1,sks3,sku5 triple mutant were also found in sks1,sks3 and sks1,sku5 double mutants. It suggested that, genetically, SKS1 and the unit of SKS3/SKU5 played redundantly roles during seedling root development. Absence of any member of the SKS3/SKU5 unit would disactivate this unit. Therefore, we utilized sks1,sks3, sks1,sku5 and sks1,sks3,sku5 to further investigate the function of GPI-SKS genes during root development. 3.5. Defective roots were due to altered root cell morphogenesis Further investigation showed that, these phenotypic defects
Please cite this article as: K. Zhou, GPI-anchored SKS proteins regulate root development through controlling cell polar expansion and cell wall synthesis, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.081
K. Zhou / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3
Fig. 1. In silico analysis of SKS family and expression pattern of GPI-SKS genes (A) Phylogenetical analysis of SKS members. The evolutionary history was inferred using the Neighbor-Joining method, and all SKS proteins predicted to be produced by SKS gene family were included. The calculation has been repeated for 10000 times and bootstraps were indicated (>70 could be considered credible). The calde containing SKU5, SKS1, SKS2 and SKS3 were in red. bar: 0.1 billion years. The optimal tree with the sum of branch length ¼ 3.02156407 is shown. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the p-distance method and are in the units of the number of amino acid differences per site. The analysis involved 25 amino acid sequences. All positions containing gaps and missing data were eliminated. There were a total of 435 positions in the final dataset. Evolutionary analyses were conducted in MEGA5. (B) C-terminus alignment of SKS precursors. Hydrophobic C-terminus were only identified in SKS1, SKS2, SKS3 and SKU5 precursors, which were shown in grey background. (C) Expression pattern of GPI-SKS genes in Arabidopsis Thaliana through quantitative PCR assay. At least 40 seedlings or seedling roots, 20 leaves, 20 flowers, 20 siliques were harvested and utilized for generating total RNA, ant then cDNAs were synthesized by oligo d(T) and utilized for quantitative PCR. Transcription of TUB4 gene was utilized as the internal reference and relative transcriptional levels of GPI-SKS genes were normalized. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
were due to aberrant cell morphogenesis. Unlike neatly arranged cell files from wildtype, sks1,sks3, sks1,sku5 and sks1,sks3,sku5 mutant generated irregularly shaped root cells (Fig. 3AeD). After well expanded, their irregular cells looked much shorter but thicker (Fig. 3EeH). Transverse sections confirmed their irregularity on cell morphogenesis: cells in significantly different sizes and irregular shapes crowded together and squeezed one another (Fig. 3I-L). It strongly indicated that, polar expansion of root cells were largely affected in these mutant lines.
not only showed the crowded irregular root cells (Fig. 4A and B), but also small puckers and protrusions on cell walls of sks1,sks3,sku5 mutant (arrowed in Fig. 4C and D). These small puckers and protrusions should be due to the extrusion between those nonpolar expanded and crowded irregular cells, because they could only be found between neighbor cells, but not at the out surface. And surprisingly, sks1,sks3,sku5 mutant produced much thicker cell walls than wild-type (Fig. 4EeG). It suggested that, both polarity and quantity control of cell wall synthesis was defective in sks1,sks3,sku5 mutant lines.
3.6. Defective cell wall synthesis in sks1,sks3,sku5 mutant 4. Discussion For further investigation, transverse sections of 7-day-old seedling roots from wild-type and sks1,sks3,sku5 mutant were observed under transmission electron microscopy (TEM), which
GPI-anchored proteins were found more and more important in plants, especially after their roles during perceiving extracelluar
Please cite this article as: K. Zhou, GPI-anchored SKS proteins regulate root development through controlling cell polar expansion and cell wall synthesis, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.081
4
K. Zhou / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 2. GPI-SKS knockout mutant lines and their root defects. (A) T-DNA insertion knockout mutant lines of GPI-SKS genes. The insertion sites and references were shown on the picture. (B) Root length of all single, double, triple and quadruple mutant line. At lease 12 roots from 7-day-old seedlings were measured and compared to their wiltype background. (C) Defective cell files on root tips from sks1,sks3, sks1,sks2,sks3, sks1,sku5, sks1,sks2,sku5, sks1,sks3,sku5 and sks1,sks2,sks3,sku5 mutant lines. Bar: 200 mm.
Fig. 3. Defective roots generated by sks knockout mutant lines. (AeD) PI stained root tips from A, Wildtype, B, sks1,sks3, C,sks1,sku5, D, sks1,sks3,sku5 under confocal microscopy. Bar: 50 mm. (EeH) PI stained differential zone of roots from E, Wildtype, F, sks1,sks3, G,sks1,sku5, H, sks1,sks3,sku5 under confocal microscopy. Bar: 50 mm. (IeJ) Calcofluor white stained transverse sections of roots from I, wildtype and J, sks1,sks3,sku5. Bar: 20 mm.
Please cite this article as: K. Zhou, GPI-anchored SKS proteins regulate root development through controlling cell polar expansion and cell wall synthesis, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.081
K. Zhou / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 4. Cell wall observation under Transmission Electron Microscopy (TEM). (AeB), 7-day-old seedling roots from Wildtype (A) and sks1,sks3,sku5 (B) were observed under TEM. The puckers and protrusions on cell wall of sks1,sks3,sku5 were in white boxes. Bar: 10 mm. (CeD), The enlarged cell wall in white boxes of 4B. Bar, 2 mm. (EeF) Neighbor cells of Wildtype (E) and sks1,sks3,sku5 (F). (G) Cell wall thickness of Wildtype and sks1,sks3,sku5 mutant lines. Six neighbor cells from three transverse sections of both wildtype and sks1,sks3,sku5 mutant lines were chosen, and the distance between their cytosol were considered as double cell wall thickness and measured for 10 times each. P < 0.05.
siganling peptides as coreceptors with their RLK partners were revealed recently [22e28]. SKU5-similar (SKS) gene family has 19 members, among which, a subfamily containing four members encode GPI-anchored proteins, SKS1, SKS2, SKS3 and SKU5. Although the first study on SKU5, which described its function on root growth, has been reported for more than 15 year, no further investigation was reported on any other members until now. So I focused on this subfamily and tried to explore more. More attention was paid on the roles they palyed during root development, as severely defective roots were identified when generating multiple knockout mutant lines: sks1,sks3, sks1,sks2,sks3, sks1,sku5, sks1,sks2,sku5, sks1,sks3,sku5 and sks1,sks2,sks3,sku5 mutant could generate similarly defected roots, which were shorter and with disordered cell files. But differently, with additional SKS2 mutation, sks1,sks2,sks3, sks1,sks2,sku5 and sks1,sks2,sks3,sku5 could generate much fewer seeds than respective mutant without SKS2 mutation, or even no seed; moreover, a lot of their seeds suffered from severe postembryonic defects. At the meantime, expression pattern showed that, SKS2 was not transcribed during root development, but only highly transcribed in reproductive organs. In other words, SKS2 neither was transcribed during root development, nor contributed to generate defective roots. So we utilized roots from sks1,sks3, sks1,sku5 and sks1,sks3,sku5 mutant lines to investigate the roles GPI-anchored SKS proteins played during root development. It also suggested the broad and essential roles GPI-SKS genes played in Arabidopsis. Through investigating the defective roots from sks1,sks3, sks1,sku5 and sks1,sks3,sku5 mutant lines, the mechanism of how
these defects occurred was revealed: disrupted cell polar expansion resulted in irregular shaped root cells, which were shorter but thicker than wild-type, that caused shorter roots with disordered cell files. Moreover, mutation of GPI-SKS resulted in oversynthesized and thicker cell walls. These data suggested that, GPI-anchored SKS proteins could regulate root development through controlling cell polar expansion and cell wall synthesis. In plants, cell wall and cytoskeleton, including microtubules and actin filaments, provide outer and inner support respectively to cells, and determine their morphogenesis [33]. Interestingly, cell polar expansion was reported to be determined by the array of cytoskeleton, as cell wall components were transported through cytoskeleton to the outracellular space to form cell walls [33e35]. Besides, alteration of MTs, such as knockout of MT genes [36], microtubule inhibitor treatment [37], knockout, or overpressing Microtubule-Associated Priotein (MAP) [38e41] would resulted in similar disordered root cell files as our sks1,sks3,sku5 mutant lines. It suggested that, plasma membrane-associated GPI-anchored SKS proteins might work on organizing cytoskeleton to control the transport of cell wall components. Besides functional characterization of GPI-anchored SKS1, SKS3 and SKU5 proteins during root development, the interplay between these three proteins was also very interesting. The similar defective roots as sks1,sks3,sku5 triple mutant line were only observed in sks1,sks3 and sks1,sku5 mutant lines, but not sks3,sku5 mutant line, which means that, only presence of SKS3 or SKU5 could not maintain the general function of these GPI-anchored SKS proteins, but SKS1 could. It suggests that, SKS3 and SKU5 may work together
Please cite this article as: K. Zhou, GPI-anchored SKS proteins regulate root development through controlling cell polar expansion and cell wall synthesis, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.081
6
K. Zhou / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
as a unit, which played redundant role with SKS1 during root development, losing any one of them may deactivate this unit.
[20]
Transparency document
[21]
Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.12.081.
[22]
References [1] B. Eisenhaber, G. Schneider, M. Wildpaner, F. Eisenhaber, A sensitive predictor for potential GPI lipid modification sites in fungal protein sequences and its application to genome-wide studies for Aspergillus nidulans, Candida albicans Neurospora crassa, Saccharomyces cerevisiae and Schizosaccharomyces pombe, J. Mol. Biol. 337 (2) (Mar. 2004) 243e253. [2] G. Poisson, C. Chauve, X. Chen, A. Bergeron, FragAnchor: a large-scale predictor of glycosylphosphatidylinositol anchors in eukaryote protein sequences by qualitative scoring, Genom. Proteom. Bioinform. 5 (2) (2007) 121e130. [3] A. Pierleoni, P. Martelli, R. Casadio, PredGPI: a GPI-anchor predictor, BMC Bioinf. 9 (1) (2008) 392. [4] J.D. Thompson, D.G. Higgins, T.J. Gibson, ClustalW: improving the sensitivity of progressive multiple sequence aligment through sequence weighting, position specific gap penalties and weight matrix choice, Nucleic Acids Res. 22 (22) (1994) 4673e4680. [5] B. Eisenhaber, P. Bork, F. Eisenhaber, Post-translational GPI lipid anchor modification of proteins in kingdoms of life: analysis of protein sequence data from complete genomes, Protein Eng. 14 (1) (2001) 17e25. [6] S. Mayor, H. Riezman, Sorting GPI-anchored proteins, Nat. Rev. Mol. Cell Biol. 5 (2) (Feb. 2004) 110e120. [7] M.A. Ferguson, S.W. Homans, R.A. Dwek, T.W. Rademacher, Glycosyl-phosphatidylinositol moiety that anchors Trypanosoma brucei variant surface glycoprotein to the membrane, Science (80-. ) 239 (4841) (Feb. 1988), p. 753 LP-759. [8] S.D. Weitman, et al., Distribution of the folate receptor GP38 in normal and malignant cell lines and tissues, Cancer Res. 52 (12) (Jun. 1992), p. 3396 LP3401. [9] I. Zanoni, et al., CD14 controls the LPS-induced endocytosis of Toll-like Receptor 4, Cell 147 (4) (2012) 868e880. [10] T. Elkins, M. Hortsch, a J. Bieber, P.M. Snow, C.S. Goodman, Drosophila fasciclin-I is a novel homophilic adhesion molecule that along with fasciclinIII can mediate cell sorting, J. Cell Biol. 110 (5) (1990) 1825e1832. [11] O. Huber, M. Sumper, Algal-CAMs: isoforms of a cell adhesion molecule in embryos of the alga Volvox with homology to Drosophila fasciclin I, EMBO J. 13 (18) (1994) 4212e4222. [12] G.H.H. Borner, K.S. Lilley, T.J. Stevens, P. Dupree, Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis, Plant Physiol. 132 (2) (2003) 568e577. [13] G.H.H. Borner, D.J. Sherrier, T.J. Stevens, I.T. Arkin, P. Dupree, Prediction of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A genomic analysis, Plant Physiol. 129 (2) (2002) 486e499. [14] A. Capron, et al., Maternal control of male-gamete delivery in Arabidopsis involves a putative GPI-anchored protein encoded by the LORELEI gene, Plant Cell 20 (11) (2008) 3038e3049. [15] T. Tsukamoto, Y. Qin, Y. Huang, D. Dunatunga, R. Palanivelu, A role for LORELEI, a putative glycosylphosphatidylinositol-anchored protein, in Arabidopsis thaliana double fertilization and early seed development, Plant J. 62 (4) (2010) 571e588. [16] J.P. Vogel, T.K. Raab, C. Schiff, S.C. Somerville, PMR6, a pectate lyase-like gene required for powdery mildew susceptibility in Arabidopsis, Plant Cell 14 (9) (2002) 2095e2106. [17] G. Schindelman, et al., COBRA encodes a putative GPI-anchored protein, which is polarly localized and necessary for oriented cell expansion in arabidopsis, Genes Dev. 15 (9) (2001) 1115e1127. [18] Jae-Heung Ko, Jeong Hoe Kim, Sastry S. Jayanty, Gregg A. Howe, KyungHwan Han1, Loss of function of COBRA, a determinant of oriented cell expansion, invokes cellular defence responses in Arabidopsis thaliana, J. Exp. Bot. 57 (12) (2006) 2923e2936. [19] F. Roudier, COBRA, an arabidopsis extracellular glycosyl-phosphatidyl inositol-anchored protein, specifically controls highly anisotropic expansion
[23]
[24]
[25]
[26] [27]
[28] [29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
[40]
[41]
through its involvement in cellulose microfibril orientation, Plant Cell 17 (6) (2005) 1749e1763. G.J. Seifert, K. Roberts, The biology of arabinogalactan proteins, Annu. Rev. Plant Biol. 58 (1) (May 2007) 137e161. C.S. Gillmor, et al., Glycosylphosphatidylinositol-anchored proteins are required for cell wall synthesis and morphogenesis in arabidopsis, Plant Cell 17 (4) (2005) 1128e1140. M.G.R. Bundy, P.Z. Kosentka, A.H. Willet, L. Zhang, E.J. Miller, E.D. Shpak, A mutation in the catalytic subunit of the glycosylphosphatidylinositol transamidase disrupts growth, fertility and stomata formation in Arabidopsis, Plant Physiol. 171 (June) (2016) pp.00339.2016. M. Stegmann, et al., The receptor kinase FER is a RALF-regulated scaffold controlling plant immune signaling, Science (80-. ) 355 (6322) (2017) 287e289. X. Meng, et al., A MAPK cascade downstream of ERECTA receptor-like protein kinase regulates Arabidopsis inflorescence architecture by promoting localized cell proliferation, Plant Cell 24 (12) (2012) 4948e4960. Q. Duan, D. Kita, C. Li, A.Y. Cheung, H.-M. Wu, FERONIA receptor-like kinase regulates RHO GTPase signaling of root hair development, Proc. Natl. Acad. Sci. Unit. States Am. 107 (41) (2010) 17821e17826. C. Li, H. Wu, A.Y. Cheung, FERONIA and her pals: functions and mechanisms, Plant Physiol. 171 (August) (2016) 2379e2392. C. Li, et al., Glycosylphosphatidylinositol-anchored proteins as chaperones and co-receptors for FERONIA receptor kinase signaling in Arabidopsis, Elife 4 (JUNE) (2015) 1e21. , et al., ERECTA and BAK1 receptor like kinases interact to regulate L. Jorda immune responses in Arabidopsis, Front. Plant Sci. 7 (June) (2016) 897. X.G. Xiangzong Meng, Xin Chen, Hyunggon Mang, Chenglong Liu, Yu Xiao, L. S. Keiko U. Torii, Ping He, Differential function of arabidopsis SERK family receptor-like kinases in stomatal patterning, Curr. Biol. 33 (4) (2015) 395e401. S. Shimomura, Identification of a glycosylphosphatidylinositol-anchored plasma membrane protein interacting with the C-terminus of auxin-binding protein 1: a photoaffinity crosslinking study, Plant Mol. Biol. 60 (5) (2006) 663e677. J.C. Sedbrook, K.L. Carroll, K.F. Hung, P.H. Masson, C.R. Somerville, The arabidopsis SKU5 gene encodes an extracellular glycosyl phosphatidylinositolanchored glycoprotein involved in directional root growth, Plant Cell 14 (7) (2002) 1635e1648. R. Rutherford, P.H. Masson, Arabidopsis thaliana sku mutant seedlings show exaggerated surface-dependent alteration in root growth vector, Plant Physiol. 111 (4) (1996) 987e998. Z. Liu, S. Persson, Y. Zhang, The connection of cytoskeletal network with plasma membrane and the cell wall, J. Integr. Plant Biol. 57 (4) (2015) 330e340. Y. Nagashima, S. Tsugawa, A. Mochizuki, T. Sasaki, H. Fukuda, Y. Oda, A Rhobased reaction-diffusion system governs cell wall patterning in metaxylem vessels, Sci. Rep. 8 (1) (2018) 1e17. maty, et al., A receptor-like kinase mediates the response of arabidopsis K. He cells to the inhibition of cellulose synthesis, Curr. Biol. 17 (11) (2007) 922e931. T. Abe, S. Thitamadee, T. Hashimoto, Microtubule defects and cell morphogenesis in the lefty1lefty2 tubulin mutant of Arabidopsis thaliana, Plant Cell Physiol. 45 (2) (2004) 211e220. K. Naoi, A semidominant mutation in an arabidopsis mitogen-activated protein kinase phosphatase-like gene compromises cortical microtubule organization, Plant Cell 16 (7) (2004) 1841e1853. X. Wang, et al., Arabidopsis microtubule-associated protein18 functions in directional cell growth by destabilizing cortical microtubules, Plant Cell 19 (3) (2007) 877e889. K. Nakajima, I. Furutani, H. Tachimoto, H. Matsubara, T. Hashimoto, SPIRAL1 encodes a plant-specific microtubule-localized protein required for directional control of rapidly expanding Arabidopsis cells, Plant Cell 16 (5) (2004) 1178e1190. T. Shoji, et al., Plant-specific microtubule-associated protein SPIRAL2 is required for anisotropic growth in Arabidopsis, Plant Physiol. 136 (4) (2004) 3933e3944. K. Nakajima, T. Kawamura, T. Hashimoto, Role of the SPIRAL1 gene family in anisotropic growth of Arabidopsis thaliana, Plant Cell Physiol. 47 (4) (2006) 513e522.
Please cite this article as: K. Zhou, GPI-anchored SKS proteins regulate root development through controlling cell polar expansion and cell wall synthesis, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.081
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
GPI-anchored SKS proteins regulate root development through controlling cell polar expansion and cell wall synthesis Ke Zhou FAFU-UCR Joint Center for Horticultural Biology and Metabolomics, Haixia Institute of Science and Technology, Fujian Agriculture and Forestry University, Fuzhou, 350002, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 6 December 2018 Accepted 12 December 2018 Available online xxx
Glycosylphosphatidylinositol-anchored proteins were reported to be involved in many developmental progresses in Arabidopsis. Here I report that, a group of homologous glycosylphosphatidylinositolanchored proteins from SKU5-Similar family regulate seedling root development of Arabidopsis through controlling cell polar expansion and cell wall synthesis. Due to the irregular expansion of root cells and the defective synthesis of cell walls, their knockout mutants generated shorter roots with irregularly shaped root cells, and thicker cell walls. © 2018 Elsevier Inc. All rights reserved.
Keywords: Arabidopsis GPI-anchored protein Root Cell polar expansion Cell wall synthesis SKU5-Similar
1. Introduction Glycosylphosphatidylinositol (GPI) modification is present among lower and higher eukaryotes, about 0.5% of total proteins were predicted to be GPI-anchored proteins (GAPs) [5]. This glycolipid modification includes a fatty acid tail anchored in the inner membrane leaflet of the endoplasmic reticulum (lumen side) then within the outer leaflet of the plasma membrane bilayer after secretion of the modified protein [6]. It allows tethering GAPs, which possess no transmembrane region, to the external surface of the plasma membrane bilayer through lipid modification [7]. In mammals and yeasts, GAPs play various and important roles in many biological processes, such as, cell surface receptors [8,9], cell adhesion [10,11]. To now, 248 potential GPI-anchored proteins (GAPs) were predicted by proteomic and genomic analysis, and classified as several families in Arabidopsis, including classical AGPs (arabinogalactan proteins), AG peptides, Fasciclin-like AGPs, COBRA family, LORELEI family, several members form SKU5-Similar family, and receptorlike protein TMM [12,13]. They were reported to be involved into many processes of growth and development, such as fertilization
Abbreviations: GPI, glycosylphosphatidylinositol; PM, plasmamembrane; CW, cell wall; TEM, transmission electron microscopy; PI, propidium iodide; SKS, SKU5Similar. E-mail address: [email protected].
[14,15], cell wall composition [16e19], pollen tube guidance [14], cell division and programmed cell death [20]. Broadly disrupted GPI-anchors synthesis system in Arabidopsis caused irregular cell wall synthesis and morphogenesis [21], as well as MAPK cascaderelative defects, such as clustering stomatas, male gametes fertility, which could be rescued by constitutively active YODA (MAPKKK4) [22]. Recent approaches revealed their surprising roles in signaling pathway: LORELEI family chaperon transmembrane Leucine-Rich-Repeat (LRR) Receptor-Like-Kinases (RLK) from ER to the out surface of plasmamembrane, and work as coreceptors with them during perceiving their ligands [23e27]; TMM works as coreceptor of surface RLKs SERK/BAK1 when perceiving their ligands [28,29]. Although SKU5 had been supposed to dock the controversial Auxin Binding Protein 1 (ABP1) on the out surface of Plasma membrane [30], the SKU5-Similar (SKS) family was not well studied. To now, we only know that, SKU5 belongs to a conserved SKU5Similar (SKS) family containing 19 members, among which, phylogenetically close members, SKS1 (SKU5-similar 1), SKS2, SKS3 and SKU5 were reported or predicted to be modified by GPI anchors during maturation [12,13], knockout of SKU5 aggravated natural twisting bias of Arabidopsis [31,32], but the mechanism was not revealed. In this work, we set out to investigate the function of these homologous GPI-anchored SKS members during root development. Here I report that, among these GPI-anchored members, only SKS1,
https://doi.org/10.1016/j.bbrc.2018.12.081 0006-291X/© 2018 Elsevier Inc. All rights reserved.
Please cite this article as: K. Zhou, GPI-anchored SKS proteins regulate root development through controlling cell polar expansion and cell wall synthesis, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.081
2
K. Zhou / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
SKS3 and SKU5 were transcribed during seedling root development, and regulated cell polar expansion and cell wall synthesis. Knockout of these genes resulted in abnormal expansion of root cells and defective cell wall synthesis, which made their cell morphogenesis irregular and cell wall thicker. These unexpected alterations finally resulted in shorter roots with disorientated and aberrant cell files.
2. Materials and methods 2.1. Methods for in silico analyses The amino acid sequence and nucleic acid sequence were acquired from NCBI and TAIR database. GPI modification and cleavage sites were predicted by various GPI anchor prediction tools, which were big-PI Predictor, PredGPI and DGPI [1e3]. Amino acid sequence alignment was performed by ClustalW multiple alignment analysis tool, and phylogenetic trees were calculated by Neighbor-Joining method [4].
2.2. Plant materials and growth conditions Mutants acquired in the study were T-DNA insertion lines. sks1 (FLAG_521F09), sks2 (FLAG_415F09) and sku5 (FLAG_386B03) in Ws background were from Arabidopsis Thaliana Resource Center of Institute Jean-Pierre Bourgin (IJPB), and sks3 (SALK_067925) in Col0 background was from Arabidopsis Biological Resource Center (ABRC). All cross lines were in Ws x Col-0 hybrid background. Seeds were surface sterilized by 75% ethanol and plated on 1/2MS medium containing 0.8% agar. After 48 h vernalization at 4 C in dark, they were plated at 22 C under 16/8 h light. About 7 days growth, seedlings were transferred into soil in green house.
2.3. RNA extraction, cDNA synthesis and quantitative PCR Total RNAs were extracted and cDNAs were synthesized by oligo d(T) primers. Then these cDNA were utilized for quantitative PCR through CFX96 Touch Real-Time PCR detection system and the expression of TUB4 was utilized for inner reference. Primers for Real-time PCR: SKS1-F: CGGATCACAAACCCCGAGGAGGAT; SKS1-R: CACCGAGGCGAGCAACACCATTAG; SKS2-F: ACCCTGAGGAAAACGGAAGTACGG; SKS2-R: TGTGGCCGAGCTGTGATGTTGTTC; SKS3-F: ACTACGCAGGTGTTTCCTGG; SKS3-R: TGGCCAAGATACCATGAGGC; SKU5-F: CGAATTCGGACACCCTGACAATGTTC; SKU5-R: TGAATCCAATGCTCTTCGATGCCGA; TUB4-F, GGTCAATACGTCGGCGATTC; TUB4-R: TCTGACCGAACGGACCAGAT.
3. Results 3.1. In silico analyses of SKU5-Similar (SKS) gene family SKU5 belongs to a conserved gene family containing 19 members, which was called SKU5-Similar (SKS) family. Among these members, SKS1, SKS2 and SKS3 were phylogenetically close to SKU5 (Fig. 1A), and were the only four members possessed hydrophobic omega domain at C-terminus (Fig. 1B). These hydrophobic regions were predicted or proven to guide the synthesis of GPI-anchors and the attachment to the membrane system during protein maturation by various bioinformatic tools (described in methods) and proteomics data [12]. 3.2. Expression pattern of GPI-SKS genes during developmental progresses Before functional charactorization of SKS1, SKS2, SKS3 and SKU5 (GPI-SKS) genes, their expression patterns were investigated. Total RNA from Arabidopsis seedlings, seedling roots and other organs were generated, and then cDNA were synthesized and utilized for quantitative PCR. It showed the markedly different expression pattern of SKS1, SKS2, SKS3 and SKU5 (Fig. 1C): SKS1 was transcribed in seedling roots, opening flowers and siliques; SKS2 was mainly transcribed in reproductive organs, but extremely low or undetectable during seedling development; SKS3 and SKU5 were widely expressed in whole plants, whereas SKS3 was at markedly lower level than SKU5. It suggested that, only SKS1, SKS3 and SKU5 could be transcribed and exercised their functions during root development. 3.3. GPI-SKS play essential roles during root cell development For functional characterization, T-DNA insertion mutant lines of sks1, sks2 and sku5 on Ws background and sks3 on col-0 background were obtained from IJPB and SALK seeds stock respectively. The insertion sites and references were included (Fig. 2A). All these mutants, which could generate generally normal roots on vertical 1/2 MS medium (Fig. 2BeC), were crossed, and all double, triple and quadruple mutant lines were generated. Interestingly, similar shorter and defective roots, where the cell file orientation was disordered, were only found in sks1,sks3, sks1,sku5, sks1,sks3,sku5, sks1,sks2,sks3, sks1,sks2,sku5, and sks1,sks2,sks3,sku5 (Fig. 2BeC). Considering SKS2 was not transcribed during root development, but highly transcribed in reproductive organs, it was not surprisingly to find that, with additional SKS2 mutation, sks1,sks2,sks3, sks1,sks2,sku5, and sks1,sks2,sks3,sku5 generated similar defective roots as sks1,sks3, sks1,sku5, and sks1,sks3,sku5, but produced much fewer seeds, or even no seeds, and suffered from more postembryonic defects during germination (data not shown). 3.4. Genetical relationship between SKS1, SKS3 and SKU5
2.4. Macroscopy and microscopy PI staining: 1 mg propidium iodide was dissolved into 1 ml water to make stock solution, and diluted for 40 times before use. 7day-old seedlings were stained by working solution for 2 min and their roots were observed under Leica SP8 confocal microscopy. Calcofluor White staining: Calcofluor White Stain was bought from Sigma-Aldrich (18909), which could stain cellulose of plant cell walls. 7-day-old seedlings roots were merged into 3.5% agarose, and then made into 80 mm slices by Leica VT1000S vibrating-blade microtome. These slices were merged into Calcofluor White Stain with a drop of 1N NaOH, and then observed under Leica SP8 confocal microscopy.
Interestingly, the same defective roots as sks1,sks3,sku5 triple mutant were also found in sks1,sks3 and sks1,sku5 double mutants. It suggested that, genetically, SKS1 and the unit of SKS3/SKU5 played redundantly roles during seedling root development. Absence of any member of the SKS3/SKU5 unit would disactivate this unit. Therefore, we utilized sks1,sks3, sks1,sku5 and sks1,sks3,sku5 to further investigate the function of GPI-SKS genes during root development. 3.5. Defective roots were due to altered root cell morphogenesis Further investigation showed that, these phenotypic defects
Please cite this article as: K. Zhou, GPI-anchored SKS proteins regulate root development through controlling cell polar expansion and cell wall synthesis, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.081
K. Zhou / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3
Fig. 1. In silico analysis of SKS family and expression pattern of GPI-SKS genes (A) Phylogenetical analysis of SKS members. The evolutionary history was inferred using the Neighbor-Joining method, and all SKS proteins predicted to be produced by SKS gene family were included. The calculation has been repeated for 10000 times and bootstraps were indicated (>70 could be considered credible). The calde containing SKU5, SKS1, SKS2 and SKS3 were in red. bar: 0.1 billion years. The optimal tree with the sum of branch length ¼ 3.02156407 is shown. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the p-distance method and are in the units of the number of amino acid differences per site. The analysis involved 25 amino acid sequences. All positions containing gaps and missing data were eliminated. There were a total of 435 positions in the final dataset. Evolutionary analyses were conducted in MEGA5. (B) C-terminus alignment of SKS precursors. Hydrophobic C-terminus were only identified in SKS1, SKS2, SKS3 and SKU5 precursors, which were shown in grey background. (C) Expression pattern of GPI-SKS genes in Arabidopsis Thaliana through quantitative PCR assay. At least 40 seedlings or seedling roots, 20 leaves, 20 flowers, 20 siliques were harvested and utilized for generating total RNA, ant then cDNAs were synthesized by oligo d(T) and utilized for quantitative PCR. Transcription of TUB4 gene was utilized as the internal reference and relative transcriptional levels of GPI-SKS genes were normalized. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
were due to aberrant cell morphogenesis. Unlike neatly arranged cell files from wildtype, sks1,sks3, sks1,sku5 and sks1,sks3,sku5 mutant generated irregularly shaped root cells (Fig. 3AeD). After well expanded, their irregular cells looked much shorter but thicker (Fig. 3EeH). Transverse sections confirmed their irregularity on cell morphogenesis: cells in significantly different sizes and irregular shapes crowded together and squeezed one another (Fig. 3I-L). It strongly indicated that, polar expansion of root cells were largely affected in these mutant lines.
not only showed the crowded irregular root cells (Fig. 4A and B), but also small puckers and protrusions on cell walls of sks1,sks3,sku5 mutant (arrowed in Fig. 4C and D). These small puckers and protrusions should be due to the extrusion between those nonpolar expanded and crowded irregular cells, because they could only be found between neighbor cells, but not at the out surface. And surprisingly, sks1,sks3,sku5 mutant produced much thicker cell walls than wild-type (Fig. 4EeG). It suggested that, both polarity and quantity control of cell wall synthesis was defective in sks1,sks3,sku5 mutant lines.
3.6. Defective cell wall synthesis in sks1,sks3,sku5 mutant 4. Discussion For further investigation, transverse sections of 7-day-old seedling roots from wild-type and sks1,sks3,sku5 mutant were observed under transmission electron microscopy (TEM), which
GPI-anchored proteins were found more and more important in plants, especially after their roles during perceiving extracelluar
Please cite this article as: K. Zhou, GPI-anchored SKS proteins regulate root development through controlling cell polar expansion and cell wall synthesis, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.081
4
K. Zhou / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 2. GPI-SKS knockout mutant lines and their root defects. (A) T-DNA insertion knockout mutant lines of GPI-SKS genes. The insertion sites and references were shown on the picture. (B) Root length of all single, double, triple and quadruple mutant line. At lease 12 roots from 7-day-old seedlings were measured and compared to their wiltype background. (C) Defective cell files on root tips from sks1,sks3, sks1,sks2,sks3, sks1,sku5, sks1,sks2,sku5, sks1,sks3,sku5 and sks1,sks2,sks3,sku5 mutant lines. Bar: 200 mm.
Fig. 3. Defective roots generated by sks knockout mutant lines. (AeD) PI stained root tips from A, Wildtype, B, sks1,sks3, C,sks1,sku5, D, sks1,sks3,sku5 under confocal microscopy. Bar: 50 mm. (EeH) PI stained differential zone of roots from E, Wildtype, F, sks1,sks3, G,sks1,sku5, H, sks1,sks3,sku5 under confocal microscopy. Bar: 50 mm. (IeJ) Calcofluor white stained transverse sections of roots from I, wildtype and J, sks1,sks3,sku5. Bar: 20 mm.
Please cite this article as: K. Zhou, GPI-anchored SKS proteins regulate root development through controlling cell polar expansion and cell wall synthesis, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.081
K. Zhou / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 4. Cell wall observation under Transmission Electron Microscopy (TEM). (AeB), 7-day-old seedling roots from Wildtype (A) and sks1,sks3,sku5 (B) were observed under TEM. The puckers and protrusions on cell wall of sks1,sks3,sku5 were in white boxes. Bar: 10 mm. (CeD), The enlarged cell wall in white boxes of 4B. Bar, 2 mm. (EeF) Neighbor cells of Wildtype (E) and sks1,sks3,sku5 (F). (G) Cell wall thickness of Wildtype and sks1,sks3,sku5 mutant lines. Six neighbor cells from three transverse sections of both wildtype and sks1,sks3,sku5 mutant lines were chosen, and the distance between their cytosol were considered as double cell wall thickness and measured for 10 times each. P < 0.05.
siganling peptides as coreceptors with their RLK partners were revealed recently [22e28]. SKU5-similar (SKS) gene family has 19 members, among which, a subfamily containing four members encode GPI-anchored proteins, SKS1, SKS2, SKS3 and SKU5. Although the first study on SKU5, which described its function on root growth, has been reported for more than 15 year, no further investigation was reported on any other members until now. So I focused on this subfamily and tried to explore more. More attention was paid on the roles they palyed during root development, as severely defective roots were identified when generating multiple knockout mutant lines: sks1,sks3, sks1,sks2,sks3, sks1,sku5, sks1,sks2,sku5, sks1,sks3,sku5 and sks1,sks2,sks3,sku5 mutant could generate similarly defected roots, which were shorter and with disordered cell files. But differently, with additional SKS2 mutation, sks1,sks2,sks3, sks1,sks2,sku5 and sks1,sks2,sks3,sku5 could generate much fewer seeds than respective mutant without SKS2 mutation, or even no seed; moreover, a lot of their seeds suffered from severe postembryonic defects. At the meantime, expression pattern showed that, SKS2 was not transcribed during root development, but only highly transcribed in reproductive organs. In other words, SKS2 neither was transcribed during root development, nor contributed to generate defective roots. So we utilized roots from sks1,sks3, sks1,sku5 and sks1,sks3,sku5 mutant lines to investigate the roles GPI-anchored SKS proteins played during root development. It also suggested the broad and essential roles GPI-SKS genes played in Arabidopsis. Through investigating the defective roots from sks1,sks3, sks1,sku5 and sks1,sks3,sku5 mutant lines, the mechanism of how
these defects occurred was revealed: disrupted cell polar expansion resulted in irregular shaped root cells, which were shorter but thicker than wild-type, that caused shorter roots with disordered cell files. Moreover, mutation of GPI-SKS resulted in oversynthesized and thicker cell walls. These data suggested that, GPI-anchored SKS proteins could regulate root development through controlling cell polar expansion and cell wall synthesis. In plants, cell wall and cytoskeleton, including microtubules and actin filaments, provide outer and inner support respectively to cells, and determine their morphogenesis [33]. Interestingly, cell polar expansion was reported to be determined by the array of cytoskeleton, as cell wall components were transported through cytoskeleton to the outracellular space to form cell walls [33e35]. Besides, alteration of MTs, such as knockout of MT genes [36], microtubule inhibitor treatment [37], knockout, or overpressing Microtubule-Associated Priotein (MAP) [38e41] would resulted in similar disordered root cell files as our sks1,sks3,sku5 mutant lines. It suggested that, plasma membrane-associated GPI-anchored SKS proteins might work on organizing cytoskeleton to control the transport of cell wall components. Besides functional characterization of GPI-anchored SKS1, SKS3 and SKU5 proteins during root development, the interplay between these three proteins was also very interesting. The similar defective roots as sks1,sks3,sku5 triple mutant line were only observed in sks1,sks3 and sks1,sku5 mutant lines, but not sks3,sku5 mutant line, which means that, only presence of SKS3 or SKU5 could not maintain the general function of these GPI-anchored SKS proteins, but SKS1 could. It suggests that, SKS3 and SKU5 may work together
Please cite this article as: K. Zhou, GPI-anchored SKS proteins regulate root development through controlling cell polar expansion and cell wall synthesis, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.081
6
K. Zhou / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
as a unit, which played redundant role with SKS1 during root development, losing any one of them may deactivate this unit.
[20]
Transparency document
[21]
Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.12.081.
[22]
References [1] B. Eisenhaber, G. Schneider, M. Wildpaner, F. Eisenhaber, A sensitive predictor for potential GPI lipid modification sites in fungal protein sequences and its application to genome-wide studies for Aspergillus nidulans, Candida albicans Neurospora crassa, Saccharomyces cerevisiae and Schizosaccharomyces pombe, J. Mol. Biol. 337 (2) (Mar. 2004) 243e253. [2] G. Poisson, C. Chauve, X. Chen, A. Bergeron, FragAnchor: a large-scale predictor of glycosylphosphatidylinositol anchors in eukaryote protein sequences by qualitative scoring, Genom. Proteom. Bioinform. 5 (2) (2007) 121e130. [3] A. Pierleoni, P. Martelli, R. Casadio, PredGPI: a GPI-anchor predictor, BMC Bioinf. 9 (1) (2008) 392. [4] J.D. Thompson, D.G. Higgins, T.J. Gibson, ClustalW: improving the sensitivity of progressive multiple sequence aligment through sequence weighting, position specific gap penalties and weight matrix choice, Nucleic Acids Res. 22 (22) (1994) 4673e4680. [5] B. Eisenhaber, P. Bork, F. Eisenhaber, Post-translational GPI lipid anchor modification of proteins in kingdoms of life: analysis of protein sequence data from complete genomes, Protein Eng. 14 (1) (2001) 17e25. [6] S. Mayor, H. Riezman, Sorting GPI-anchored proteins, Nat. Rev. Mol. Cell Biol. 5 (2) (Feb. 2004) 110e120. [7] M.A. Ferguson, S.W. Homans, R.A. Dwek, T.W. Rademacher, Glycosyl-phosphatidylinositol moiety that anchors Trypanosoma brucei variant surface glycoprotein to the membrane, Science (80-. ) 239 (4841) (Feb. 1988), p. 753 LP-759. [8] S.D. Weitman, et al., Distribution of the folate receptor GP38 in normal and malignant cell lines and tissues, Cancer Res. 52 (12) (Jun. 1992), p. 3396 LP3401. [9] I. Zanoni, et al., CD14 controls the LPS-induced endocytosis of Toll-like Receptor 4, Cell 147 (4) (2012) 868e880. [10] T. Elkins, M. Hortsch, a J. Bieber, P.M. Snow, C.S. Goodman, Drosophila fasciclin-I is a novel homophilic adhesion molecule that along with fasciclinIII can mediate cell sorting, J. Cell Biol. 110 (5) (1990) 1825e1832. [11] O. Huber, M. Sumper, Algal-CAMs: isoforms of a cell adhesion molecule in embryos of the alga Volvox with homology to Drosophila fasciclin I, EMBO J. 13 (18) (1994) 4212e4222. [12] G.H.H. Borner, K.S. Lilley, T.J. Stevens, P. Dupree, Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis, Plant Physiol. 132 (2) (2003) 568e577. [13] G.H.H. Borner, D.J. Sherrier, T.J. Stevens, I.T. Arkin, P. Dupree, Prediction of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A genomic analysis, Plant Physiol. 129 (2) (2002) 486e499. [14] A. Capron, et al., Maternal control of male-gamete delivery in Arabidopsis involves a putative GPI-anchored protein encoded by the LORELEI gene, Plant Cell 20 (11) (2008) 3038e3049. [15] T. Tsukamoto, Y. Qin, Y. Huang, D. Dunatunga, R. Palanivelu, A role for LORELEI, a putative glycosylphosphatidylinositol-anchored protein, in Arabidopsis thaliana double fertilization and early seed development, Plant J. 62 (4) (2010) 571e588. [16] J.P. Vogel, T.K. Raab, C. Schiff, S.C. Somerville, PMR6, a pectate lyase-like gene required for powdery mildew susceptibility in Arabidopsis, Plant Cell 14 (9) (2002) 2095e2106. [17] G. Schindelman, et al., COBRA encodes a putative GPI-anchored protein, which is polarly localized and necessary for oriented cell expansion in arabidopsis, Genes Dev. 15 (9) (2001) 1115e1127. [18] Jae-Heung Ko, Jeong Hoe Kim, Sastry S. Jayanty, Gregg A. Howe, KyungHwan Han1, Loss of function of COBRA, a determinant of oriented cell expansion, invokes cellular defence responses in Arabidopsis thaliana, J. Exp. Bot. 57 (12) (2006) 2923e2936. [19] F. Roudier, COBRA, an arabidopsis extracellular glycosyl-phosphatidyl inositol-anchored protein, specifically controls highly anisotropic expansion
[23]
[24]
[25]
[26] [27]
[28] [29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
[40]
[41]
through its involvement in cellulose microfibril orientation, Plant Cell 17 (6) (2005) 1749e1763. G.J. Seifert, K. Roberts, The biology of arabinogalactan proteins, Annu. Rev. Plant Biol. 58 (1) (May 2007) 137e161. C.S. Gillmor, et al., Glycosylphosphatidylinositol-anchored proteins are required for cell wall synthesis and morphogenesis in arabidopsis, Plant Cell 17 (4) (2005) 1128e1140. M.G.R. Bundy, P.Z. Kosentka, A.H. Willet, L. Zhang, E.J. Miller, E.D. Shpak, A mutation in the catalytic subunit of the glycosylphosphatidylinositol transamidase disrupts growth, fertility and stomata formation in Arabidopsis, Plant Physiol. 171 (June) (2016) pp.00339.2016. M. Stegmann, et al., The receptor kinase FER is a RALF-regulated scaffold controlling plant immune signaling, Science (80-. ) 355 (6322) (2017) 287e289. X. Meng, et al., A MAPK cascade downstream of ERECTA receptor-like protein kinase regulates Arabidopsis inflorescence architecture by promoting localized cell proliferation, Plant Cell 24 (12) (2012) 4948e4960. Q. Duan, D. Kita, C. Li, A.Y. Cheung, H.-M. Wu, FERONIA receptor-like kinase regulates RHO GTPase signaling of root hair development, Proc. Natl. Acad. Sci. Unit. States Am. 107 (41) (2010) 17821e17826. C. Li, H. Wu, A.Y. Cheung, FERONIA and her pals: functions and mechanisms, Plant Physiol. 171 (August) (2016) 2379e2392. C. Li, et al., Glycosylphosphatidylinositol-anchored proteins as chaperones and co-receptors for FERONIA receptor kinase signaling in Arabidopsis, Elife 4 (JUNE) (2015) 1e21. , et al., ERECTA and BAK1 receptor like kinases interact to regulate L. Jorda immune responses in Arabidopsis, Front. Plant Sci. 7 (June) (2016) 897. X.G. Xiangzong Meng, Xin Chen, Hyunggon Mang, Chenglong Liu, Yu Xiao, L. S. Keiko U. Torii, Ping He, Differential function of arabidopsis SERK family receptor-like kinases in stomatal patterning, Curr. Biol. 33 (4) (2015) 395e401. S. Shimomura, Identification of a glycosylphosphatidylinositol-anchored plasma membrane protein interacting with the C-terminus of auxin-binding protein 1: a photoaffinity crosslinking study, Plant Mol. Biol. 60 (5) (2006) 663e677. J.C. Sedbrook, K.L. Carroll, K.F. Hung, P.H. Masson, C.R. Somerville, The arabidopsis SKU5 gene encodes an extracellular glycosyl phosphatidylinositolanchored glycoprotein involved in directional root growth, Plant Cell 14 (7) (2002) 1635e1648. R. Rutherford, P.H. Masson, Arabidopsis thaliana sku mutant seedlings show exaggerated surface-dependent alteration in root growth vector, Plant Physiol. 111 (4) (1996) 987e998. Z. Liu, S. Persson, Y. Zhang, The connection of cytoskeletal network with plasma membrane and the cell wall, J. Integr. Plant Biol. 57 (4) (2015) 330e340. Y. Nagashima, S. Tsugawa, A. Mochizuki, T. Sasaki, H. Fukuda, Y. Oda, A Rhobased reaction-diffusion system governs cell wall patterning in metaxylem vessels, Sci. Rep. 8 (1) (2018) 1e17. maty, et al., A receptor-like kinase mediates the response of arabidopsis K. He cells to the inhibition of cellulose synthesis, Curr. Biol. 17 (11) (2007) 922e931. T. Abe, S. Thitamadee, T. Hashimoto, Microtubule defects and cell morphogenesis in the lefty1lefty2 tubulin mutant of Arabidopsis thaliana, Plant Cell Physiol. 45 (2) (2004) 211e220. K. Naoi, A semidominant mutation in an arabidopsis mitogen-activated protein kinase phosphatase-like gene compromises cortical microtubule organization, Plant Cell 16 (7) (2004) 1841e1853. X. Wang, et al., Arabidopsis microtubule-associated protein18 functions in directional cell growth by destabilizing cortical microtubules, Plant Cell 19 (3) (2007) 877e889. K. Nakajima, I. Furutani, H. Tachimoto, H. Matsubara, T. Hashimoto, SPIRAL1 encodes a plant-specific microtubule-localized protein required for directional control of rapidly expanding Arabidopsis cells, Plant Cell 16 (5) (2004) 1178e1190. T. Shoji, et al., Plant-specific microtubule-associated protein SPIRAL2 is required for anisotropic growth in Arabidopsis, Plant Physiol. 136 (4) (2004) 3933e3944. K. Nakajima, T. Kawamura, T. Hashimoto, Role of the SPIRAL1 gene family in anisotropic growth of Arabidopsis thaliana, Plant Cell Physiol. 47 (4) (2006) 513e522.
Please cite this article as: K. Zhou, GPI-anchored SKS proteins regulate root development through controlling cell polar expansion and cell wall synthesis, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.081