- Email: [email protected]
Granisetron protects polymicrobial sepsis-induced acute lung injury in mice
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Granisetron protects polymicrobial sepsis-induced acute lung injury in mice Jun Wang a, b, c, 1, Shenhai Gong b, c, 1 , Fangzhao Wang b, c, 1, Mengwei Niu b, c , Guoquan Wei b, c , Zhanke He b, c , Tanwei Gu b, c , Yong Jiang b, c, ***, Aihua Liu a, b, c, **, Peng Chen b, c, * a
Department of Respiration, Nanfang Hospital, Southern Medical University, Guangzhou, China Department of Pathophysiology, Guangdong Provincial Key Laboratory of Proteomics, School of Basic Medical Sciences, Southern Medical University, Guangzhou, China c State Key Laboratory of Organ Failure Research, Southern Medical University, Guangzhou, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 28 November 2018 Accepted 5 December 2018 Available online xxx
Sepsis is a serious condition with a high mortality rate worldwide. Granisetron is an anti-nausea drug for patients undergoing chemotherapy. Here we aimed to identify the novel effect of granisetron on sepsisinduced acute lung injury (ALI). Our results showed that mice treated with granisetron displayed less severe lung damage than controls. Granisetron administration reduced pulmonary neutrophil recruitment after CLP. Moreover, the expressions of Cxcl1 and Cxcl2 were diminished in the presence of granisetron in THP-1 macrophages after lipopolysaccharide exposure. Additionally, granisetron could inhibit the activation of p38 MAPK and NLRP3 inflammasome both in vivo and in vitro. Collectively, granisetron protects against sepsis-induced ALI by suppressing macrophage Cxcl1/Cxcl2 expression and neutrophil recruitment in the lung. © 2018 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Keywords: Granisetron Sepsis Nlrp3 inflammasome Neutrophil Cxcl1/Cxcl2 ALI
1. Introduction Sepsis is an aggressive disease with a high case fatality rate in intensive care units (ICUs), which often leads to life-threatening organ dysfunction due to the immune response triggered by an infection [1,2]. Epidemiological studies have revealed that more than half of ICU patients die from septic shock and multiple organ dysfunction syndrome (MODS). The lung is a common site of sepsis infection due to its susceptibility. Nearly 50% of patients with severe sepsis develop acute lung injury (ALI) or its more severe form, known as acute respiratory distress syndrome (ARDS) [3,4]. The mortality rate for patients with ALI has decreased in recent
* Corresponding author. Department of Pathophysiology, Southern Medical University, Guangzhou, China. ** Corresponding author. Department of Respiration, Nanfang Hospital, Southern Medical University, Guangzhou, China. *** Corresponding author. Department of Pathophysiology, Southern Medical University, Guangzhou, China. E-mail addresses: [email protected] (Y. Jiang), [email protected] (A. Liu), [email protected] (P. Chen). 1 These authors contribute equally to this work.
decades, but remains as high as 40% [5]. The basic pathophysiological changes of ALI include an increase in the permeability of the alveolar capillary membrane, recruitment of neutrophils from blood by production of inflammatory chemokines, and accumulation of protein-rich fluids in alveolar cavities. Therefore, the inflammatory cell aggregation and inflammatory mediator release have been identified as characteristic markers of ALI [6]. The activation of inflammatory cells is critical to the pathogenesis of ALI during sepsis; in particular, macrophages play an important role in immune reactions by releasing cytokines and chemokines [7]. Many studies have shown that macrophagederived chemokines, such as Cxcl1 and Cxcl2, are important for mediating neutrophil influx into the lung interstitium [8,9]. In recent decades, clinical trials of many new drugs have failed to show improvement of clinical outcomes in the management of ALI [10]. Thus, there is an urgent need to develop therapies to relieve inflammation-related damage in lung. Granisetron, a highly selective 5-HT3 receptor antagonist, is used to treat nausea and vomiting caused by radiotherapy and chemotherapy. Previous studies confirmed that granisetron can relieve inflammation in IBD and arthritis [11,12]. However, there have been few reports of its anti-inflammatory characteristics in mice. The NLRP3
https://doi.org/10.1016/j.bbrc.2018.12.031 0006-291X/© 2018 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Please cite this article as: J. Wang et al., Granisetron protects polymicrobial sepsis-induced acute lung injury in mice, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.031
2
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
inflammasome is a well-known type of pattern recognition receptor, which can recognize pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) in the context of sepsis; notably, this component of the innate immune system initiates a downstream inflammatory cascade [13,14]. We investigated whether granisetron negatively regulates the NLRP3 inflammasome, thereby protecting septic mice. We also determined whether granisetron plays a protective role through inhibition of p38 mitogen-activated protein kinase (MAPK), which is a critical signaling pathway needed to activate the NLRP3 inflammasome in macrophages [14,15]. In brief, our study aimed to investigate the therapeutic potential and detailed molecular mechanisms of granisetron in treatment of sepsis-induced lung injury. 2. Materials and methods 2.1. Animal model of sepsis Specific pathogen-free, male C57BL/6 mice (6e8 weeks old) were used to establish the animal model in this study. The ALI model was induced by cecal ligation and puncture (CLP) surgery, as previously described [16]. In brief, mice were lightly anesthetized. A 2-cm midline incision was made; then, the cecum was exposed and 75% of the cecum was ligated. An 18-gauge needle was used to puncture the cecum between the ligation site and the end of the cecum; then, a small volume of the bowel contents was extruded through the puncture. The cecum was returned to the abdominal cavity. The abdominal cavity was then closed in layers, and the mice were resuscitated with 1 ml saline solution subcutaneously. Shamoperated animals underwent the same surgical procedure; however, the cecum was neither ligated nor punctured. All mice were allowed free access to food and water in a controlled environment throughout the course of the experiment. All experimental procedures were in accordance with the National Institutes of Health guidelines and were approved by the local Animal Care and Use Committee of Southern Medical University. 2.2. Experimental design The mice were randomized to two groups: CLP group and CLP þ GA group. Mice in the CLP þ GA group underwent CLP and received concurrent administration of granisetron, injected intraperitoneally (i.p.) at a dose of 1 mg/kg in 200 ml sterile phosphatebuffered saline (PBS). The dose was modified in accordance with a previous report [11]. Mice in the CLP group underwent CLP and received an equal volume of sterile PBS through intraperitoneal injection. For further experiments, mice were sacrificed at 12 h after CLP. 2.3. THP-1 cell culture Human THP-1 cells were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in RPMI 1640 supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 mg/ml streptomycin. THP-1 cells were differentiated into macrophages in RPMI-1640 medium containing phorbol 12-myristate 13-acetate (PMA, 5 ng/ml) over 48 h [17,22]. For studies of mRNA and protein expression, PMA-differentiated THP-1 macrophages were concurrently stimulated with lipopolysaccharide (LPS, 500 ng/ml) and granisetron (1 mmol/L). 2.4. qPCR analysis Total RNA was extracted from tissues or THP-1 cells using TRIzol
reagent, in accordance with the manufacturer's instructions; reverse transcription was performed with a reverse transcription enzyme (TOYOBO), in accordance with the manufacturer's instructions. After extraction and quantification of total RNA, the transcriptional levels of target genes were quantified by real-time PCR using a standard SYBR Green PCR protocol on an ABI 7500 real-time PCR system. Relative expression was calculated using the comparative threshold cycle (Ct) and expressed relative to control (DDCt method). The relative expression levels of the mRNAs mentioned above were normalized to 18S expression in each sample. The primers are listed in Table 1. 2.5. Western blot analysis Total protein in lung tissue and THP-1 cells was extracted with a commercial lysis buffer containing protease inhibitor (Thermo Scientific). Protein concentration was determined by the BCA protein assay kit (Thermo Scientific). Western blot analysis was performed with primary antibodies targeting NLRP3 (Cell Signaling Technology), Caspase-1/p20/p10 (Proteintech), p38 (Cell Signaling Technology), p-p38 (Cell Signaling Technology), JNK (Cell Signaling Technology), p-JNK (Cell Signaling Technology), ERK (Cell Signaling Technology), p-ERK (Cell Signaling Technology), and Actin (Cell Signaling Technology). 2.6. Histopathological examination All mice were sacrificed and the right lung lobe was obtained for histologic examination. The excised tissue was fixed in 10% formalin for 48 h, embedded in paraffin, and then sliced into 5-mm sections, which were prepared for routine hematoxylin and eosin (H&E) staining. The histological score was assessed in accordance with previous reports [18]. H&E staining was used to compare morphological changes in lung tissue sections between the two groups. Under 200 magnification, sections were randomly selected and 6e8 fields of view were photographed. The histological score of the lung was scored on the basis of the following parameters: alveolar congestion, hemorrhage, aggregation of neutrophils or leukocyte infiltration, and thickness of the alveolar wall, graded on a scale of 0e4; 0 was defined as “absent” and 4 was defined as “severe.” The sum of all scores was combined to calculate a composite score, designated as the histological score of the lung. 2.7. Myeloperoxidase activity assay Myeloperoxidase (MPO) activity was detected by using the Myeloperoxidase Activity Colorimetric Assay Kit (Biovision). Lung
Table 1 Primers for qPCR.
mouse-18s mouse-Htr3a mouse-Tnf-a mouse- Il-6 mouse-Ccl2 mouse-Ccl3 mouse-Ccl7 mouse-Cxcl1 mouse-Cxcl2 mouse-Cxcl10 human-18s human- Cxcl1 human-Cxcl2
Left primer(50 -30 )
Right primer(50 -30 )
CGATCCGAGGGCCTCACTA CTGTGGCGATCACCGGAAG CCACCACGCTCTTCTGTCTAC TGATGCACTTGCAGAAAACA CCTGCTGTTCACAGTTGCC ACCATGACACTCTGCAACCA CTGCTTTCAGCATCCAAGTG ACCCAAACCGAAGTCATAGC CGGTCAAAAAGTTTGCCTTG CTCATCCTGCTGGGTCTGAG AGGAATTCCCAGTAAGTGCG AACAGCCACCAGTGAGCTTC TGTCTCAACCCCGCATCG
AGTCCCTGCCCTTTGTACACA GGCTGACTGCGTAGAATAAAGG AGGGTCTGGGCCATAGAACT ACCAGAGGAAATTTTCAATAGGC ATTGGGATCATCTTGCTGGT GTGGAATCTTCCGGCTGTAG TTCCTCTTGGGGATCTTTTG TCTCCGTTACTTGGGGACAC TCCAGGTCAGTTAGCCTTGC CCTATGGCCCTCATTCTCAC GCCTCACTAAACCATCCAA GAAAGCTTGCCTCAATCCTG AGGAACAGCCACCAATAAGC
IL, interleukin; TNF, tumor necrosis factor; Ccl, chemokine (CeC motif) ligands; Cxcl, chemokine (C-X-C motif) ligands.
Please cite this article as: J. Wang et al., Granisetron protects polymicrobial sepsis-induced acute lung injury in mice, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.031
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3
tissues were homogenized in four volumes of MPO Assay Buffer. After centrifugation (13000g for 10 min), the supernatant was diluted in reaction solution, then incubated at 25 C for 90 min. The reaction was stopped and TNB Reagent was added to all samples. After 5e10 min, the absorbance was measured at 412 nm and MPO activity was calculated in accordance with the manufacturer's instructions.
anti-Ly6G antibody (InVivoMab) at 4 C overnight, followed by staining with the corresponding secondary antibody at 37 C for 30 min. Under 200 magnification, 10 fields of view were photographed randomly. The integrated optical density (IOD) values were quantified by ImageJ software.
2.8. Immunohistochemistry
Reactive oxygen species (ROS) levels were measured by detecting fluorescence intensity after dihydroethidium (DHE) staining. Frozen sections of lung tissues were washed three times with PBS (pH 7.4), then incubated with the fluorescent probe DHE
The infiltration of neutrophils in lung tissue was detected by immunohistochemistry. Lung tissue sections were incubated with
2.9. Measurement of reactive oxygen species levels
Fig. 1. Granisetron protected mice against polymicrobial sepsis-induced lung damage. Male mice (6e8 weeks old) underwent cecal ligation and puncture (CLP) and received concurrent treatment with granisetron (GA, 1 mg/kg) or phosphate-buffered saline (PBS). Mice were sacrificed 12 h after CLP and tissues were collected for further analysis. (A) 5-HT3 receptor (5-Ht3ra) mRNA level. (B) Hematoxylin and eosin staining of lung tissue. (C) Histological score of lung tissue. (D) mRNA levels of pulmonary pro-inflammatory factors. (E) Terminal deoxynucleotidyl transferase dUTP nick end-labeling staining. (F) Quantification of apoptotic cells in the lung. n ¼ 4e8. *p < 0.05 by two-tailed Student's t-test. Scale bar ¼ 100 mm. GA, granisetron.
Please cite this article as: J. Wang et al., Granisetron protects polymicrobial sepsis-induced acute lung injury in mice, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.031
4
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
(2 mM, Invitrogen), and evaluated by fluorescence microscopy. Under 100 magnification, 6e8 fields of view were photographed randomly. Fluorescence intensity measurements were performed by ImageJ software. 2.10. Terminal deoxynucleotidyl transferase dUTP nick end-labeling assay Apoptotic cells exhibited red fluorescence and were counted across 6e8 visual fields at 100 magnification. Apoptotic cells in lung tissues were detected by terminal deoxynucleotidyl transferase dUTP nick end-labeling (TUNEL) staining of mouse lung tissue sections using a TUNEL kit (KeyGene), in accordance with the manufacturer's instructions. 2.11. Statistical analysis Data are expressed as the mean ± standard error of the mean. A two-tailed Student's t-test was used for statistical evaluation. Differences between groups were compared using a significance level of p < 0.05. 3. Results 3.1. Granisetron protected mice against polymicrobial sepsisinduced lung damage After CLP surgery in mice, we found that the expression of 5-HT3 receptor in the lung of CLP-treated mice was significantly increased at 12 h after CLP, compared with that of control mice who underwent sham operation (Fig. 1A); this indicated that 5-HT3 receptor signaling may be involved in development of ALI. Next, we observed that substantial pathologic changes (e.g., alveolar collapse, edema, hemorrhage, and infiltration of inflammatory cells) were improved in mice treated with granisetron, compared with the pathology of tissue from mice treated with PBS (Fig. 1BeC). In sepsis, a large release of pro-inflammatory cytokines and chemokines from macrophages is the primary manifestation of the “cytokine storm.” [19] As shown in Fig. 1D, pulmonary mRNA levels of pro-inflammatory cytokines and chemokines, including Il-6, Ccl2, Ccl3, Ccl7, and Cxcl10, were reduced by granisetron. In addition, we performed TUNEL analysis to assess the onset of apoptosis in pulmonary tissues of the mice (Fig. 1E). The number of TUNELpositive cells was reduced in the granisetron-treated group, compared with the group without granisetron (Fig. 1F). In brief, we revealed that mice treated with granisetron showed less severe lung injury, including lung inflammation, apoptosis, and histopathological changes of the lung, compared with control mice after CLP. 3.2. Granisetron treatment attenuated neutrophil recruitment and reduced the expression of Cxcl1 and Cxcl2 Neutrophils play an anti-infection and traumatic repair role with their high number and rapid action, upon recruitment by chemokines [20]. The migration of neutrophils is crucially mediated by Cxcl1 and Cxcl2, which attract and draw neutrophils to sites of infection [8]. However, excess neutrophil activation can cause tissue damage during sepsis [21]. Thus, we examined neutrophil infiltration by assessing MPO activity and determined Ly6G expression in lung tissues by immunohistochemical staining. We investigated the expression of Ly6G in lung tissue sections by immunohistochemical staining. As presented in Fig. 2A and B, Ly6G expression was suppressed by treatment with granisetron. Moreover, MPO activity in the lung was reduced in granisetron-treated
Fig. 2. Granisetron diminished neutrophil recruitment in the lung and reduced the expression of Cxcl1 and Cxcl2. Male mice (6e8 weeks old) underwent severe cecal ligation and puncture (CLP) and received concurrent treatment with granisetron (GA, 1 mg/kg) or phosphate-buffered saline (PBS). Mice were sacrificed at 12 h after CLP. (A) Representative images of Ly6G immunohistochemistry. (B) Ly6G immunohistochemistry quantification. (C) Myeloperoxidase (MPO) activity in lung tissue. (D-E, G-H) Cxcl1 and Cxcl2 mRNA levels in lung and PLF. (F, I) Cxcl1 and Cxcl2 mRNA levels in PMA-differentiated THP-1 macrophages upon lipopolysaccharide (LPS, 500 ng/ml) stimulation and concurrent administration of GA (1 mmol/L) for 6 h. n ¼ 4e8. *p < 0.05 by two-tailed Student's t-test. Scale bar ¼ 100 mm; GA, granisetron; IOD, integrated optical density; PMA, phorbol 12myristate 13-acetate; PLF, peritoneal lavage fluid.
mice, compared with PBS-treated mice, at 12 h after CLP (Fig. 2C), in a manner similar to that of Ly6G expression in lung tissues. The integrated optical density, calculated as a product of the staining area, was reduced in the granisetron-treated group. In addition, Our data showed that the expression of Cxcl1 and Cxcl2 was lessened in peritoneal lavage fluid and lung tissue of granisetron-treated mice at 12 h after CLP, compared with PBS-treated mice (Fig. 2DeE,G-H). Granisetron treatment also caused a remarkable reduction in the expression of these two chemokines in PMA-differentiated THP-1 macrophages after LPS challenge (Fig. 2F,I). Taken together, granisetron treatment reduced neutrophil extravasation into the alveolar cavities was associated with reduced production of Cxcl1 and Cxcl2 in the lung. 3.3. Granisetron inhibited the activation of the NLRP3 inflammasome in vivo and in vitro NLRP3 deletion has been reported to selectively reduce Cxcl1 and Cxcl2 production and neutrophil recruitment in the lungs after infection [20]. Nlrp3 is a pattern recognition receptor that can
Please cite this article as: J. Wang et al., Granisetron protects polymicrobial sepsis-induced acute lung injury in mice, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.031
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
recognize both endogenous and exogenous danger signals (PAMPs and DAMPs); its activation is related to the activity of caspase-1. Caspase-1 exists in the cytoplasm in the form of inactive enzyme (pro-caspase-1). When extracellular or intracellular stimuli interact with cells, the intracellular inflammasome forms pro-caspase-1, which self-hydrolyzes to produce p10 and p20 dimers; these form tetramers, and ultimately result in activated caspase-1 [22]. We hypothesized that granisetron could reduce Cxcl1 and Cxcl2 expression by inhibiting activation of the NLRP3 inflammasome during sepsis. Fig. 3 (A-B) showed that pulmonary NLRP3 activation in granisetron-treated mice was significantly reduced, compared with pulmonary NLRP3 activation in PBS-treated mice. Consistent with this finding, expression levels of cleaved caspase-1 p20 were also reduced in granisetron-treated mice. Moreover, expression levels of NLRP3 and cleaved caspase-1 p20 were suppressed in granisetron-treated THP-1 macrophages (Fig. 3CeF). These findings suggest that granisetron acts as an inhibitor of the NLRP3 inflammasome.
5
3.4. Granisetron-mediated inhibition of the NLRP3 inflammasome was associated with reduced phosphorylation of p38 MAPK signaling and production of ROS A previous study showed that significant elevations in the expression of NLRP3 and cleavage of caspase-1 were accompanied by activation of p38 MAPK [14,15]. The Toll-like receptor 4-p38NLRP3 axis is a classic signaling pathway that activates NLRP3. We detected phosphorylation of p38 MAPK by Western blot. Fig. 4A showed that granisetron decreased p-p38 levels in mice. These data suggested that granisetron could downregulate p-p38 activation in the lung after sepsis-induced ALI. To further confirm whether granisetron could reduce p38 activation, PMA-differentiated THP-1 macrophages were stimulated with LPS in the presence and absence of granisetron. We observed a significant inhibitory effect of granisetron on phosphorylation of p38 MAPK (Fig. 4D); however, there were negligible effects on JNK and ERK (Fig. 4BeC,E-F). It is well-established that mitochondrial dysfunction, which
Fig. 3. Granisetron inhibited activation of the NLRP3 inflammasome. Male mice (6e8 weeks old) underwent severe cecal ligation and puncture (CLP) and received concurrent treatment with granisetron (GA, 1 mg/kg) or phosphate-buffered saline (PBS). Mice were sacrificed at 12 h after CLP. The activation of NLRP3 inflammasome were analyzed by western blot in vivo and in vitro. (AeB) Representative images and quantification of NLRP3 and caspase-1 p20 expression in lung. (CeD) Representative images and quantification of NLRP3 expression in PMA-differentiated THP-1 macrophages upon lipopolysaccharide (LPS, 500 ng/ml) stimulation and concurrent administration of GA (1 mmol/L) for 4 h. (EeF) Representative images and quantification of caspase-1 p20 expression in PMA-differentiated THP-1 macrophages primed with lipopolysaccharide (LPS, 500 ng/ml) stimulation for 4h and subsequently treated with inflammasome activators (ATP, 5 mM) for 30min, at the absent and present of GA (1 mmol/L). n ¼ 3e6. *p < 0.05 by two-tailed Student's t-test. GA, granisetron; PMA, phorbol 12-myristate 13-acetate; Pro-CASP1, pro-caspase-1; ATP, adenosine triphosphate.
Please cite this article as: J. Wang et al., Granisetron protects polymicrobial sepsis-induced acute lung injury in mice, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.031
6
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 4. Granisetron decreased the phosphorylation of p38 MAPK and the generation of reactive oxygen species. Male mice (6e8 weeks old) underwent severe cecal ligation and puncture (CLP) and received concurrent treatment with granisetron (GA, 1 mg/kg) or phosphate-buffered saline (PBS). Mice were sacrificed at 12 h after CLP. The activation of MAPKs were analyzed by western blot in vivo and in vitro. (AeC) Representative images and quantification of p38, JNK and ERK expression in lung. (DeF) Representative images and quantification of p38, JNK and ERK expression in PMA-differentiated THP-1 cells upon lipopolysaccharide (LPS, 500 ng/ml) stimulation and GA (1 mmol/L) co-treatment for 15 min. MAPK levels were detected by Western blot. (G) Representative images of DHE immunofloscense in lung sections. (H) Quantification of ROS production in the lung. n ¼ 3e6. *p < 0.05 by two-tailed Student's t-test. Scale bar ¼ 100 mm. GA, granisetron; Flu, fluorescence; PMA, phorbol 12-myristate 13-acetate.
generates excessive ROS, can initiate the assembly of NLRP3 inflammasome complexes and result in caspase-1 activation [23]. To investigate whether granisetron-induced inhibition of the NLRP3 inflammasome is linked with ROS generation, we measured the levels of superoxide in lung tissue from granisetron-treated mice (Fig. 4G). Granisetron-treated mice exhibited significant reduction of superoxide production, compared with PBS-treated mice (Fig. 4H). These results indicated that granisetron can suppress p-38 activation and ROS production during sepsis. 4. Discussion Granisetron, a highly selective 5-HT3 receptor antagonist, is used for clinical treatment of patients with nausea and vomiting caused by radiotherapy and chemotherapy. In the current study, we investigated the protective effect of granisetron in ALI caused by polymicrobial sepsis. The underlying mechanisms of granisetron in sepsis-induced ALI involve NLRP3 activation and Cxcl1/Cxcl2 expression, which contribute to neutrophil recruitment. Cxcl1 and Cxcl2, produced in macrophages, are activated by LPS and other microbial products; they play a key role in neutrophil recruitment during progression of ALI. Both NLRP3 and caspase-1
deficiency resulted in reduced expression of Cxcl1 and Cxcl2 through direct or indirect pathways, as well as the recruitment of key inflammatory cell populations [8,20]. Macrophages play a key role in recruitment of neutrophils and perpetuation of lung injury [7,24]. We focused on macrophages to explore whether granisetron downregulates the NLRP3 inflammasome, thereby reducing recruitment of neutrophils during sepsis. We demonstrated that inhibition of the NLRP3 inflammasome by granisetron was involved in ROS accumulation and p38 MAPK activation. During activation of the NLRP3 inflammasome, caspase-1 promotes the maturation of inflammation factors; furthermore, it accelerates cell death, known as pyroptosis [25]. Granisetron may also be involved in the process of pyroptosis; this warrants further research. MAPK cascades regulate diverse cellular biological functions, including cell multiplication, differentiation, apoptosis, and stress responses. p38 MAPK and JNK/SAPK are primarily activated by inflammatory cytokines or stress stimuli, while ERK is primarily activated by mitogenic stimuli [15,26]. It is well-documented that p38 MAPK plays a central role in the regulation of macrophage function [27]. Notably, inhibition of p38 MAPK improved survival in a model of polymicrobial sepsis [28]. Thus, we chose the p38 MAPK signaling pathway to investigate anti-inflammatory mechanisms in sepsis. In the present study, we demonstrated that the antiinflammatory effects of granisetron were dependent on the p38 MAPK signaling pathway, but not on signaling through JNK or ERK; however, phosphorylation of ERK was partially reduced by treatment with granisetron. In the clinic, sepsis-induced ALI remains a difficult problem without effective pharmacotherapies, except early administration of antibiotics. Therapeutic targets should not only focus on primary diseases, but should involve restriction of ALI progression in all patients; high levels of inflammation should be controlled. Our study shows that granisetron relieved sepsis-induced lung damage in mice. The protection conferred by granisetron is likely to be mediated by the 5-HT3 receptor, because these effects were alleviated by concurrent administration of granisetron. Thus, we propose that the 5-HT3 receptordNLRP3dCxcl1/Cxcl2 axis may serve as a common signaling pathway that mediates neutrophil recruitment in macrophages. Further studies are necessary to confirm this hypothesis. In brief, granisetron, a 5HT3 receptor antagonist, may serve as a promising anti-inflammatory drug in the future. This new anti-inflammation target could be a therapeutic window for sepsis, which is worthy of being the key point in future research. Conflicts of interest All authors have no potential conflicts of interest to declare. Financial support This study was supported in part by the funding from State Key Laboratory of Organ Failure Research (201804), the Natural Science Funds for Distinguished Young Scholar of Guangdong province (2016A030306043) and the award of Young Pearl Scholars of Guangdong province and to PC. The Grant of NSFC-Guangdong Joint Foundation of China (U1601225), National Natural Science Foundation of China (81372030) and Key Scientific and Technological Program of Guangzhou City (201607020016) to YJ, Guangdong Provincial Science and Technology Projects (No. 2016A020216015) to AL. Author contributions Wang J, Gong S, Wang F, Niu M, He Z, Wei G and Gu T performed the experiments and analyzed the data; Jiang Y, Liu A and Chen P
Please cite this article as: J. Wang et al., Granisetron protects polymicrobial sepsis-induced acute lung injury in mice, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.031
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
conceived and supervised the study; Chen P and Wang J wrote the manuscript. Acknowledgments We thank Guangyan Wu and Zhengzheng Yan from Southern Medical University for the excellent technical assistance. References [1] Y. Hattori, K. Hattori, T. Suzuki, N. Matsuda, Recent advances in the pathophysiology and molecular basis of sepsis-associated organ dysfunction: novel therapeuticimplications and challenges, Pharmacol. Therapeut. 177 (2017) 56e66. [2] F. Verdonk, A. Blet, A. Mebazaa, The new sepsis definition, limitations and contribution to research and diagnosis of sepsis, Current Opin. Anaesthesiol. 30 (2017) 200e204. [3] G.M. Mutlu, G.R. Budinger, Incidence and outcomes of acute lung injury, New England J. Med. 354 (2006) 416e417, author reply 416-417,2006. [4] J. Villar, D. Sulemanji, R.M. Kacmarek, The acute respiratory distress syndrome, incidence and mortality, has it changed? Current Opin. Crit. Care 20 (2014) 3e9. [5] G. Bellani, J.G. Laffey, T. Pham, E. Fan, L. Brochard, A. Esteban, L. Gattinoni, F. van Haren, A. Larsson, D.F. McAuley, et al., Epidemiology, patterns of care, and mortality for patients with acute respiratory distress syndrome in intensive care units in 50 countries, JAMA 315 (2016) 788e800. [6] J. Cohen, The immunopathogenesis of sepsis, Nature 420 (2002) 885e891. [7] J. Lomas-Neira, C.S. Chung, M. Perl, S. Gregory, W. Biffl, A. Ayala, Role of alveolar macrophage and migrating neutrophils in hemorrhage-induced priming for ALI subsequent to septic challenge, Am. J. Physiol. Lung Cell Mol. Physiol. 290 (2006) L51eL58. [8] D.R. Call, J.A. Nemzek, S.J. Ebong, G.R. Bolgos, D.E. Newcomb, G.K. Wollenberg, D.G. Remick, Differential local and systemic regulation of the murine chemokines KC and MIP2, Shock 15 (2001) 278e284. [9] Q. Chaochao, G. Lou, Y. Yang, Y. Liu, Y. Hu, Z. Min, P. Chen, J. He, Z. Chen, Macrophage inflammatory protein-2 in high mobility group box 1 secretion of macrophage cells exposed to lipopolysaccharide, Cell Physiol. Biochem. 42 (2017) 913e928. [10] M.P. Fink, H.S. Warren, Strategies to improve drug development for sepsis, Nat. Rev. Drug Discover. 13 (2014) 741e758. [11] G. Fakhfouri, R. Rahimian, A. Daneshmand, A. Bahremand, M.R. Rasouli, A.R. Dehpour, S.E. Mehr, K. Mousavizadeh, Granisetron ameliorates acetic acid-induced colitis in rats, Hum. Exp. Toxicol. 29 (2010) 321e328. [12] Y.M. Ahmed, B.A. Messiha, A.A. Abo-Saif, Granisetron and carvedilol can protect experimental rats againstadjuvant-induced arthritis, Immunopharmacol. Immunotoxicol. 39 (2017) 97e104. [13] N. Song, Z.S. Liu, W. Xue, Z.F. Bai, Q.Y. Wang, J. Dai, X. Liu, Y.J. Huang, H. Cai, X.Y. Zhan, et al., NLRP3 phosphorylation is an essential priming event for inflammasome activation, Mol. cell 68 (2017) 185e197, e6.
7
[14] D. Li, W. Ren, Z. Jiang, L. Zhu, Regulation of the NLRP3 inflammasome and macrophage pyroptosis by the p38 MAPK signaling pathway in a mouse model of acute lung injury, Mol. Med. Rep. 18 (2018) 4399e4409. [15] J.S. Moon, S. Lee, M.A. Park, I.I. Siempos, M. Haslip, P.J. Lee, M. Yun, C.K. Kim, J. Howrylak, S.W. Ryter, et al., UCP2-induced fatty acid synthase promotes NLRP3 inflammasome activation during sepsis, J. Clin. Invest. 125 (2015) 665e680. [16] M. Deng, T. Ma, Z. Yan, K.R. Zettel, M.J. Scott, H. Liao, A. Frank, A.E. Morelli, C.P. Sodhi, D.J. Hackam, et al., Toll-like receptor 4 signaling on dendritic cells suppresses polymorphonuclear leukocyte CXCR2 expression and trafficking via interleukin 10 during intra-abdominal sepsis, J. Infect. Dis. 213 (2016) 1280e1288. [17] E.K. Park, H.S. Jung, H.I. Yang, M.C. Yoo, C. Kim, K.S. Kim, Optimized THP-1 differentiation is required for the detection of responses to weak stimuli, Inflamm. Res. 56 (2007) 45e50. [18] Y.P. Luo, L. Jiang, K. Kang, D.S. Fei, X.L. Meng, C.C. Nan, S.H. Pan, M.R. Zhao, M.Y. Zhao, Hemin inhibits NLRP3 inflammasome activation in sepsis-induced acute lung injury, involving heme oxygenase-1, Int. Immunopharmacol. 20 (2014) 24e32. [19] B.G. Chousterman, F.K. Swirski, G.F. Weber, Cytokine storm and sepsis disease pathogenesis, Semin Immunopathol. 39 (2017) 517e528. [20] P.G. Thomas, P. Dash, J.R. Jr Aldridge, A.H. Ellebedy, C. Reynolds, A.J. Funk, W.J. Martin, M. Lamkanfi, R.J. Webby, K.L. Boyd, et al., The intracellular sensor NLRP3 mediates key innate and healing responses to influenza A virus via the regulation of caspase-1, Immunity 30 (2009) 566e575. [21] T. Narasaraju, E. Yang, R.P. Samy, H.H. Ng, W.P. Poh, A.A. Liew, M.C. Phoon, N. van Rooijen, V.T. Chow, Excessive neutrophils and neutrophil extracellular traps contribute to acute lung injury of influenza pneumonitis, Am. J. Pathol. 179 (2011) 199e210. [22] M. Xie, Y. Yu, R. Kang, S. Zhu, L. Yang, L. Zeng, X. Sun, M. Yang, T.R. Billiar, H. Wang, et al., PKM2-dependent glycolysis promotes NLRP3 and AIM2 inflammasome activation, Nat. Commun. 7 (2016), 13280. [23] M.E. Heid, P.A. Keyel, C. Kamga, S. Shiva, S.C. Watkins, R.D. Salter, Mitochondrial reactive oxygen species induces NLRP3-dependent lysosomal damage and inflammasome activation, J. Immunol. 191 (2013) 5230e5238. [24] E. Kolaczkowska, P. Kubes, Neutrophil recruitment and function in health and inflammation, Nat. Rev. Immunol. 13 (2013) 159e175. [25] S.M. Man, R. Karki, T.D. Kanneganti, Molecular mechanisms and functions of pyroptosis, inflammatory caspases and inflammasomes in infectious diseases, Immunol. Rev. 277 (2017) 61e75. [26] A. Garai, A. Zeke, G. Gogl, I. Toro, F. Fordos, H. Blankenburg, T. Barkai, J. Varga, A. Alexa, D. Emig, et al., Specificity of linear motifs that bind to a common mitogen-activated protein kinase docking groove, Sci. Signal 5 (2012) ra74. [27] J.A. Nick, S.K. Young, K.K. Brown, N.J. Avdi, P.G. Arndt, B.T. Suratt, M.S. Janes, P.M. Henson, G.S. Worthen, Role of p38 mitogen-activated protein kinase in a murine model of pulmonary inflammation, J. Immunol. 164 (2000) 2151e2159. [28] G.Y. Song, C.S. Chung, D. Jarrar, I.H. Chaudry, A. Ayala, Evolution of an immune suppressive macrophage phenotype as a product of p38 MAPK activation in polymicrobial sepsis, Shock 15 (2001) 42e48.
Please cite this article as: J. Wang et al., Granisetron protects polymicrobial sepsis-induced acute lung injury in mice, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.031
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Granisetron protects polymicrobial sepsis-induced acute lung injury in mice Jun Wang a, b, c, 1, Shenhai Gong b, c, 1 , Fangzhao Wang b, c, 1, Mengwei Niu b, c , Guoquan Wei b, c , Zhanke He b, c , Tanwei Gu b, c , Yong Jiang b, c, ***, Aihua Liu a, b, c, **, Peng Chen b, c, * a
Department of Respiration, Nanfang Hospital, Southern Medical University, Guangzhou, China Department of Pathophysiology, Guangdong Provincial Key Laboratory of Proteomics, School of Basic Medical Sciences, Southern Medical University, Guangzhou, China c State Key Laboratory of Organ Failure Research, Southern Medical University, Guangzhou, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 28 November 2018 Accepted 5 December 2018 Available online xxx
Sepsis is a serious condition with a high mortality rate worldwide. Granisetron is an anti-nausea drug for patients undergoing chemotherapy. Here we aimed to identify the novel effect of granisetron on sepsisinduced acute lung injury (ALI). Our results showed that mice treated with granisetron displayed less severe lung damage than controls. Granisetron administration reduced pulmonary neutrophil recruitment after CLP. Moreover, the expressions of Cxcl1 and Cxcl2 were diminished in the presence of granisetron in THP-1 macrophages after lipopolysaccharide exposure. Additionally, granisetron could inhibit the activation of p38 MAPK and NLRP3 inflammasome both in vivo and in vitro. Collectively, granisetron protects against sepsis-induced ALI by suppressing macrophage Cxcl1/Cxcl2 expression and neutrophil recruitment in the lung. © 2018 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Keywords: Granisetron Sepsis Nlrp3 inflammasome Neutrophil Cxcl1/Cxcl2 ALI
1. Introduction Sepsis is an aggressive disease with a high case fatality rate in intensive care units (ICUs), which often leads to life-threatening organ dysfunction due to the immune response triggered by an infection [1,2]. Epidemiological studies have revealed that more than half of ICU patients die from septic shock and multiple organ dysfunction syndrome (MODS). The lung is a common site of sepsis infection due to its susceptibility. Nearly 50% of patients with severe sepsis develop acute lung injury (ALI) or its more severe form, known as acute respiratory distress syndrome (ARDS) [3,4]. The mortality rate for patients with ALI has decreased in recent
* Corresponding author. Department of Pathophysiology, Southern Medical University, Guangzhou, China. ** Corresponding author. Department of Respiration, Nanfang Hospital, Southern Medical University, Guangzhou, China. *** Corresponding author. Department of Pathophysiology, Southern Medical University, Guangzhou, China. E-mail addresses: [email protected] (Y. Jiang), [email protected] (A. Liu), [email protected] (P. Chen). 1 These authors contribute equally to this work.
decades, but remains as high as 40% [5]. The basic pathophysiological changes of ALI include an increase in the permeability of the alveolar capillary membrane, recruitment of neutrophils from blood by production of inflammatory chemokines, and accumulation of protein-rich fluids in alveolar cavities. Therefore, the inflammatory cell aggregation and inflammatory mediator release have been identified as characteristic markers of ALI [6]. The activation of inflammatory cells is critical to the pathogenesis of ALI during sepsis; in particular, macrophages play an important role in immune reactions by releasing cytokines and chemokines [7]. Many studies have shown that macrophagederived chemokines, such as Cxcl1 and Cxcl2, are important for mediating neutrophil influx into the lung interstitium [8,9]. In recent decades, clinical trials of many new drugs have failed to show improvement of clinical outcomes in the management of ALI [10]. Thus, there is an urgent need to develop therapies to relieve inflammation-related damage in lung. Granisetron, a highly selective 5-HT3 receptor antagonist, is used to treat nausea and vomiting caused by radiotherapy and chemotherapy. Previous studies confirmed that granisetron can relieve inflammation in IBD and arthritis [11,12]. However, there have been few reports of its anti-inflammatory characteristics in mice. The NLRP3
https://doi.org/10.1016/j.bbrc.2018.12.031 0006-291X/© 2018 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Please cite this article as: J. Wang et al., Granisetron protects polymicrobial sepsis-induced acute lung injury in mice, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.031
2
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
inflammasome is a well-known type of pattern recognition receptor, which can recognize pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) in the context of sepsis; notably, this component of the innate immune system initiates a downstream inflammatory cascade [13,14]. We investigated whether granisetron negatively regulates the NLRP3 inflammasome, thereby protecting septic mice. We also determined whether granisetron plays a protective role through inhibition of p38 mitogen-activated protein kinase (MAPK), which is a critical signaling pathway needed to activate the NLRP3 inflammasome in macrophages [14,15]. In brief, our study aimed to investigate the therapeutic potential and detailed molecular mechanisms of granisetron in treatment of sepsis-induced lung injury. 2. Materials and methods 2.1. Animal model of sepsis Specific pathogen-free, male C57BL/6 mice (6e8 weeks old) were used to establish the animal model in this study. The ALI model was induced by cecal ligation and puncture (CLP) surgery, as previously described [16]. In brief, mice were lightly anesthetized. A 2-cm midline incision was made; then, the cecum was exposed and 75% of the cecum was ligated. An 18-gauge needle was used to puncture the cecum between the ligation site and the end of the cecum; then, a small volume of the bowel contents was extruded through the puncture. The cecum was returned to the abdominal cavity. The abdominal cavity was then closed in layers, and the mice were resuscitated with 1 ml saline solution subcutaneously. Shamoperated animals underwent the same surgical procedure; however, the cecum was neither ligated nor punctured. All mice were allowed free access to food and water in a controlled environment throughout the course of the experiment. All experimental procedures were in accordance with the National Institutes of Health guidelines and were approved by the local Animal Care and Use Committee of Southern Medical University. 2.2. Experimental design The mice were randomized to two groups: CLP group and CLP þ GA group. Mice in the CLP þ GA group underwent CLP and received concurrent administration of granisetron, injected intraperitoneally (i.p.) at a dose of 1 mg/kg in 200 ml sterile phosphatebuffered saline (PBS). The dose was modified in accordance with a previous report [11]. Mice in the CLP group underwent CLP and received an equal volume of sterile PBS through intraperitoneal injection. For further experiments, mice were sacrificed at 12 h after CLP. 2.3. THP-1 cell culture Human THP-1 cells were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in RPMI 1640 supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 mg/ml streptomycin. THP-1 cells were differentiated into macrophages in RPMI-1640 medium containing phorbol 12-myristate 13-acetate (PMA, 5 ng/ml) over 48 h [17,22]. For studies of mRNA and protein expression, PMA-differentiated THP-1 macrophages were concurrently stimulated with lipopolysaccharide (LPS, 500 ng/ml) and granisetron (1 mmol/L). 2.4. qPCR analysis Total RNA was extracted from tissues or THP-1 cells using TRIzol
reagent, in accordance with the manufacturer's instructions; reverse transcription was performed with a reverse transcription enzyme (TOYOBO), in accordance with the manufacturer's instructions. After extraction and quantification of total RNA, the transcriptional levels of target genes were quantified by real-time PCR using a standard SYBR Green PCR protocol on an ABI 7500 real-time PCR system. Relative expression was calculated using the comparative threshold cycle (Ct) and expressed relative to control (DDCt method). The relative expression levels of the mRNAs mentioned above were normalized to 18S expression in each sample. The primers are listed in Table 1. 2.5. Western blot analysis Total protein in lung tissue and THP-1 cells was extracted with a commercial lysis buffer containing protease inhibitor (Thermo Scientific). Protein concentration was determined by the BCA protein assay kit (Thermo Scientific). Western blot analysis was performed with primary antibodies targeting NLRP3 (Cell Signaling Technology), Caspase-1/p20/p10 (Proteintech), p38 (Cell Signaling Technology), p-p38 (Cell Signaling Technology), JNK (Cell Signaling Technology), p-JNK (Cell Signaling Technology), ERK (Cell Signaling Technology), p-ERK (Cell Signaling Technology), and Actin (Cell Signaling Technology). 2.6. Histopathological examination All mice were sacrificed and the right lung lobe was obtained for histologic examination. The excised tissue was fixed in 10% formalin for 48 h, embedded in paraffin, and then sliced into 5-mm sections, which were prepared for routine hematoxylin and eosin (H&E) staining. The histological score was assessed in accordance with previous reports [18]. H&E staining was used to compare morphological changes in lung tissue sections between the two groups. Under 200 magnification, sections were randomly selected and 6e8 fields of view were photographed. The histological score of the lung was scored on the basis of the following parameters: alveolar congestion, hemorrhage, aggregation of neutrophils or leukocyte infiltration, and thickness of the alveolar wall, graded on a scale of 0e4; 0 was defined as “absent” and 4 was defined as “severe.” The sum of all scores was combined to calculate a composite score, designated as the histological score of the lung. 2.7. Myeloperoxidase activity assay Myeloperoxidase (MPO) activity was detected by using the Myeloperoxidase Activity Colorimetric Assay Kit (Biovision). Lung
Table 1 Primers for qPCR.
mouse-18s mouse-Htr3a mouse-Tnf-a mouse- Il-6 mouse-Ccl2 mouse-Ccl3 mouse-Ccl7 mouse-Cxcl1 mouse-Cxcl2 mouse-Cxcl10 human-18s human- Cxcl1 human-Cxcl2
Left primer(50 -30 )
Right primer(50 -30 )
CGATCCGAGGGCCTCACTA CTGTGGCGATCACCGGAAG CCACCACGCTCTTCTGTCTAC TGATGCACTTGCAGAAAACA CCTGCTGTTCACAGTTGCC ACCATGACACTCTGCAACCA CTGCTTTCAGCATCCAAGTG ACCCAAACCGAAGTCATAGC CGGTCAAAAAGTTTGCCTTG CTCATCCTGCTGGGTCTGAG AGGAATTCCCAGTAAGTGCG AACAGCCACCAGTGAGCTTC TGTCTCAACCCCGCATCG
AGTCCCTGCCCTTTGTACACA GGCTGACTGCGTAGAATAAAGG AGGGTCTGGGCCATAGAACT ACCAGAGGAAATTTTCAATAGGC ATTGGGATCATCTTGCTGGT GTGGAATCTTCCGGCTGTAG TTCCTCTTGGGGATCTTTTG TCTCCGTTACTTGGGGACAC TCCAGGTCAGTTAGCCTTGC CCTATGGCCCTCATTCTCAC GCCTCACTAAACCATCCAA GAAAGCTTGCCTCAATCCTG AGGAACAGCCACCAATAAGC
IL, interleukin; TNF, tumor necrosis factor; Ccl, chemokine (CeC motif) ligands; Cxcl, chemokine (C-X-C motif) ligands.
Please cite this article as: J. Wang et al., Granisetron protects polymicrobial sepsis-induced acute lung injury in mice, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.031
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3
tissues were homogenized in four volumes of MPO Assay Buffer. After centrifugation (13000g for 10 min), the supernatant was diluted in reaction solution, then incubated at 25 C for 90 min. The reaction was stopped and TNB Reagent was added to all samples. After 5e10 min, the absorbance was measured at 412 nm and MPO activity was calculated in accordance with the manufacturer's instructions.
anti-Ly6G antibody (InVivoMab) at 4 C overnight, followed by staining with the corresponding secondary antibody at 37 C for 30 min. Under 200 magnification, 10 fields of view were photographed randomly. The integrated optical density (IOD) values were quantified by ImageJ software.
2.8. Immunohistochemistry
Reactive oxygen species (ROS) levels were measured by detecting fluorescence intensity after dihydroethidium (DHE) staining. Frozen sections of lung tissues were washed three times with PBS (pH 7.4), then incubated with the fluorescent probe DHE
The infiltration of neutrophils in lung tissue was detected by immunohistochemistry. Lung tissue sections were incubated with
2.9. Measurement of reactive oxygen species levels
Fig. 1. Granisetron protected mice against polymicrobial sepsis-induced lung damage. Male mice (6e8 weeks old) underwent cecal ligation and puncture (CLP) and received concurrent treatment with granisetron (GA, 1 mg/kg) or phosphate-buffered saline (PBS). Mice were sacrificed 12 h after CLP and tissues were collected for further analysis. (A) 5-HT3 receptor (5-Ht3ra) mRNA level. (B) Hematoxylin and eosin staining of lung tissue. (C) Histological score of lung tissue. (D) mRNA levels of pulmonary pro-inflammatory factors. (E) Terminal deoxynucleotidyl transferase dUTP nick end-labeling staining. (F) Quantification of apoptotic cells in the lung. n ¼ 4e8. *p < 0.05 by two-tailed Student's t-test. Scale bar ¼ 100 mm. GA, granisetron.
Please cite this article as: J. Wang et al., Granisetron protects polymicrobial sepsis-induced acute lung injury in mice, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.031
4
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
(2 mM, Invitrogen), and evaluated by fluorescence microscopy. Under 100 magnification, 6e8 fields of view were photographed randomly. Fluorescence intensity measurements were performed by ImageJ software. 2.10. Terminal deoxynucleotidyl transferase dUTP nick end-labeling assay Apoptotic cells exhibited red fluorescence and were counted across 6e8 visual fields at 100 magnification. Apoptotic cells in lung tissues were detected by terminal deoxynucleotidyl transferase dUTP nick end-labeling (TUNEL) staining of mouse lung tissue sections using a TUNEL kit (KeyGene), in accordance with the manufacturer's instructions. 2.11. Statistical analysis Data are expressed as the mean ± standard error of the mean. A two-tailed Student's t-test was used for statistical evaluation. Differences between groups were compared using a significance level of p < 0.05. 3. Results 3.1. Granisetron protected mice against polymicrobial sepsisinduced lung damage After CLP surgery in mice, we found that the expression of 5-HT3 receptor in the lung of CLP-treated mice was significantly increased at 12 h after CLP, compared with that of control mice who underwent sham operation (Fig. 1A); this indicated that 5-HT3 receptor signaling may be involved in development of ALI. Next, we observed that substantial pathologic changes (e.g., alveolar collapse, edema, hemorrhage, and infiltration of inflammatory cells) were improved in mice treated with granisetron, compared with the pathology of tissue from mice treated with PBS (Fig. 1BeC). In sepsis, a large release of pro-inflammatory cytokines and chemokines from macrophages is the primary manifestation of the “cytokine storm.” [19] As shown in Fig. 1D, pulmonary mRNA levels of pro-inflammatory cytokines and chemokines, including Il-6, Ccl2, Ccl3, Ccl7, and Cxcl10, were reduced by granisetron. In addition, we performed TUNEL analysis to assess the onset of apoptosis in pulmonary tissues of the mice (Fig. 1E). The number of TUNELpositive cells was reduced in the granisetron-treated group, compared with the group without granisetron (Fig. 1F). In brief, we revealed that mice treated with granisetron showed less severe lung injury, including lung inflammation, apoptosis, and histopathological changes of the lung, compared with control mice after CLP. 3.2. Granisetron treatment attenuated neutrophil recruitment and reduced the expression of Cxcl1 and Cxcl2 Neutrophils play an anti-infection and traumatic repair role with their high number and rapid action, upon recruitment by chemokines [20]. The migration of neutrophils is crucially mediated by Cxcl1 and Cxcl2, which attract and draw neutrophils to sites of infection [8]. However, excess neutrophil activation can cause tissue damage during sepsis [21]. Thus, we examined neutrophil infiltration by assessing MPO activity and determined Ly6G expression in lung tissues by immunohistochemical staining. We investigated the expression of Ly6G in lung tissue sections by immunohistochemical staining. As presented in Fig. 2A and B, Ly6G expression was suppressed by treatment with granisetron. Moreover, MPO activity in the lung was reduced in granisetron-treated
Fig. 2. Granisetron diminished neutrophil recruitment in the lung and reduced the expression of Cxcl1 and Cxcl2. Male mice (6e8 weeks old) underwent severe cecal ligation and puncture (CLP) and received concurrent treatment with granisetron (GA, 1 mg/kg) or phosphate-buffered saline (PBS). Mice were sacrificed at 12 h after CLP. (A) Representative images of Ly6G immunohistochemistry. (B) Ly6G immunohistochemistry quantification. (C) Myeloperoxidase (MPO) activity in lung tissue. (D-E, G-H) Cxcl1 and Cxcl2 mRNA levels in lung and PLF. (F, I) Cxcl1 and Cxcl2 mRNA levels in PMA-differentiated THP-1 macrophages upon lipopolysaccharide (LPS, 500 ng/ml) stimulation and concurrent administration of GA (1 mmol/L) for 6 h. n ¼ 4e8. *p < 0.05 by two-tailed Student's t-test. Scale bar ¼ 100 mm; GA, granisetron; IOD, integrated optical density; PMA, phorbol 12myristate 13-acetate; PLF, peritoneal lavage fluid.
mice, compared with PBS-treated mice, at 12 h after CLP (Fig. 2C), in a manner similar to that of Ly6G expression in lung tissues. The integrated optical density, calculated as a product of the staining area, was reduced in the granisetron-treated group. In addition, Our data showed that the expression of Cxcl1 and Cxcl2 was lessened in peritoneal lavage fluid and lung tissue of granisetron-treated mice at 12 h after CLP, compared with PBS-treated mice (Fig. 2DeE,G-H). Granisetron treatment also caused a remarkable reduction in the expression of these two chemokines in PMA-differentiated THP-1 macrophages after LPS challenge (Fig. 2F,I). Taken together, granisetron treatment reduced neutrophil extravasation into the alveolar cavities was associated with reduced production of Cxcl1 and Cxcl2 in the lung. 3.3. Granisetron inhibited the activation of the NLRP3 inflammasome in vivo and in vitro NLRP3 deletion has been reported to selectively reduce Cxcl1 and Cxcl2 production and neutrophil recruitment in the lungs after infection [20]. Nlrp3 is a pattern recognition receptor that can
Please cite this article as: J. Wang et al., Granisetron protects polymicrobial sepsis-induced acute lung injury in mice, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.031
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
recognize both endogenous and exogenous danger signals (PAMPs and DAMPs); its activation is related to the activity of caspase-1. Caspase-1 exists in the cytoplasm in the form of inactive enzyme (pro-caspase-1). When extracellular or intracellular stimuli interact with cells, the intracellular inflammasome forms pro-caspase-1, which self-hydrolyzes to produce p10 and p20 dimers; these form tetramers, and ultimately result in activated caspase-1 [22]. We hypothesized that granisetron could reduce Cxcl1 and Cxcl2 expression by inhibiting activation of the NLRP3 inflammasome during sepsis. Fig. 3 (A-B) showed that pulmonary NLRP3 activation in granisetron-treated mice was significantly reduced, compared with pulmonary NLRP3 activation in PBS-treated mice. Consistent with this finding, expression levels of cleaved caspase-1 p20 were also reduced in granisetron-treated mice. Moreover, expression levels of NLRP3 and cleaved caspase-1 p20 were suppressed in granisetron-treated THP-1 macrophages (Fig. 3CeF). These findings suggest that granisetron acts as an inhibitor of the NLRP3 inflammasome.
5
3.4. Granisetron-mediated inhibition of the NLRP3 inflammasome was associated with reduced phosphorylation of p38 MAPK signaling and production of ROS A previous study showed that significant elevations in the expression of NLRP3 and cleavage of caspase-1 were accompanied by activation of p38 MAPK [14,15]. The Toll-like receptor 4-p38NLRP3 axis is a classic signaling pathway that activates NLRP3. We detected phosphorylation of p38 MAPK by Western blot. Fig. 4A showed that granisetron decreased p-p38 levels in mice. These data suggested that granisetron could downregulate p-p38 activation in the lung after sepsis-induced ALI. To further confirm whether granisetron could reduce p38 activation, PMA-differentiated THP-1 macrophages were stimulated with LPS in the presence and absence of granisetron. We observed a significant inhibitory effect of granisetron on phosphorylation of p38 MAPK (Fig. 4D); however, there were negligible effects on JNK and ERK (Fig. 4BeC,E-F). It is well-established that mitochondrial dysfunction, which
Fig. 3. Granisetron inhibited activation of the NLRP3 inflammasome. Male mice (6e8 weeks old) underwent severe cecal ligation and puncture (CLP) and received concurrent treatment with granisetron (GA, 1 mg/kg) or phosphate-buffered saline (PBS). Mice were sacrificed at 12 h after CLP. The activation of NLRP3 inflammasome were analyzed by western blot in vivo and in vitro. (AeB) Representative images and quantification of NLRP3 and caspase-1 p20 expression in lung. (CeD) Representative images and quantification of NLRP3 expression in PMA-differentiated THP-1 macrophages upon lipopolysaccharide (LPS, 500 ng/ml) stimulation and concurrent administration of GA (1 mmol/L) for 4 h. (EeF) Representative images and quantification of caspase-1 p20 expression in PMA-differentiated THP-1 macrophages primed with lipopolysaccharide (LPS, 500 ng/ml) stimulation for 4h and subsequently treated with inflammasome activators (ATP, 5 mM) for 30min, at the absent and present of GA (1 mmol/L). n ¼ 3e6. *p < 0.05 by two-tailed Student's t-test. GA, granisetron; PMA, phorbol 12-myristate 13-acetate; Pro-CASP1, pro-caspase-1; ATP, adenosine triphosphate.
Please cite this article as: J. Wang et al., Granisetron protects polymicrobial sepsis-induced acute lung injury in mice, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.031
6
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 4. Granisetron decreased the phosphorylation of p38 MAPK and the generation of reactive oxygen species. Male mice (6e8 weeks old) underwent severe cecal ligation and puncture (CLP) and received concurrent treatment with granisetron (GA, 1 mg/kg) or phosphate-buffered saline (PBS). Mice were sacrificed at 12 h after CLP. The activation of MAPKs were analyzed by western blot in vivo and in vitro. (AeC) Representative images and quantification of p38, JNK and ERK expression in lung. (DeF) Representative images and quantification of p38, JNK and ERK expression in PMA-differentiated THP-1 cells upon lipopolysaccharide (LPS, 500 ng/ml) stimulation and GA (1 mmol/L) co-treatment for 15 min. MAPK levels were detected by Western blot. (G) Representative images of DHE immunofloscense in lung sections. (H) Quantification of ROS production in the lung. n ¼ 3e6. *p < 0.05 by two-tailed Student's t-test. Scale bar ¼ 100 mm. GA, granisetron; Flu, fluorescence; PMA, phorbol 12-myristate 13-acetate.
generates excessive ROS, can initiate the assembly of NLRP3 inflammasome complexes and result in caspase-1 activation [23]. To investigate whether granisetron-induced inhibition of the NLRP3 inflammasome is linked with ROS generation, we measured the levels of superoxide in lung tissue from granisetron-treated mice (Fig. 4G). Granisetron-treated mice exhibited significant reduction of superoxide production, compared with PBS-treated mice (Fig. 4H). These results indicated that granisetron can suppress p-38 activation and ROS production during sepsis. 4. Discussion Granisetron, a highly selective 5-HT3 receptor antagonist, is used for clinical treatment of patients with nausea and vomiting caused by radiotherapy and chemotherapy. In the current study, we investigated the protective effect of granisetron in ALI caused by polymicrobial sepsis. The underlying mechanisms of granisetron in sepsis-induced ALI involve NLRP3 activation and Cxcl1/Cxcl2 expression, which contribute to neutrophil recruitment. Cxcl1 and Cxcl2, produced in macrophages, are activated by LPS and other microbial products; they play a key role in neutrophil recruitment during progression of ALI. Both NLRP3 and caspase-1
deficiency resulted in reduced expression of Cxcl1 and Cxcl2 through direct or indirect pathways, as well as the recruitment of key inflammatory cell populations [8,20]. Macrophages play a key role in recruitment of neutrophils and perpetuation of lung injury [7,24]. We focused on macrophages to explore whether granisetron downregulates the NLRP3 inflammasome, thereby reducing recruitment of neutrophils during sepsis. We demonstrated that inhibition of the NLRP3 inflammasome by granisetron was involved in ROS accumulation and p38 MAPK activation. During activation of the NLRP3 inflammasome, caspase-1 promotes the maturation of inflammation factors; furthermore, it accelerates cell death, known as pyroptosis [25]. Granisetron may also be involved in the process of pyroptosis; this warrants further research. MAPK cascades regulate diverse cellular biological functions, including cell multiplication, differentiation, apoptosis, and stress responses. p38 MAPK and JNK/SAPK are primarily activated by inflammatory cytokines or stress stimuli, while ERK is primarily activated by mitogenic stimuli [15,26]. It is well-documented that p38 MAPK plays a central role in the regulation of macrophage function [27]. Notably, inhibition of p38 MAPK improved survival in a model of polymicrobial sepsis [28]. Thus, we chose the p38 MAPK signaling pathway to investigate anti-inflammatory mechanisms in sepsis. In the present study, we demonstrated that the antiinflammatory effects of granisetron were dependent on the p38 MAPK signaling pathway, but not on signaling through JNK or ERK; however, phosphorylation of ERK was partially reduced by treatment with granisetron. In the clinic, sepsis-induced ALI remains a difficult problem without effective pharmacotherapies, except early administration of antibiotics. Therapeutic targets should not only focus on primary diseases, but should involve restriction of ALI progression in all patients; high levels of inflammation should be controlled. Our study shows that granisetron relieved sepsis-induced lung damage in mice. The protection conferred by granisetron is likely to be mediated by the 5-HT3 receptor, because these effects were alleviated by concurrent administration of granisetron. Thus, we propose that the 5-HT3 receptordNLRP3dCxcl1/Cxcl2 axis may serve as a common signaling pathway that mediates neutrophil recruitment in macrophages. Further studies are necessary to confirm this hypothesis. In brief, granisetron, a 5HT3 receptor antagonist, may serve as a promising anti-inflammatory drug in the future. This new anti-inflammation target could be a therapeutic window for sepsis, which is worthy of being the key point in future research. Conflicts of interest All authors have no potential conflicts of interest to declare. Financial support This study was supported in part by the funding from State Key Laboratory of Organ Failure Research (201804), the Natural Science Funds for Distinguished Young Scholar of Guangdong province (2016A030306043) and the award of Young Pearl Scholars of Guangdong province and to PC. The Grant of NSFC-Guangdong Joint Foundation of China (U1601225), National Natural Science Foundation of China (81372030) and Key Scientific and Technological Program of Guangzhou City (201607020016) to YJ, Guangdong Provincial Science and Technology Projects (No. 2016A020216015) to AL. Author contributions Wang J, Gong S, Wang F, Niu M, He Z, Wei G and Gu T performed the experiments and analyzed the data; Jiang Y, Liu A and Chen P
Please cite this article as: J. Wang et al., Granisetron protects polymicrobial sepsis-induced acute lung injury in mice, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.031
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
conceived and supervised the study; Chen P and Wang J wrote the manuscript. Acknowledgments We thank Guangyan Wu and Zhengzheng Yan from Southern Medical University for the excellent technical assistance. References [1] Y. Hattori, K. Hattori, T. Suzuki, N. Matsuda, Recent advances in the pathophysiology and molecular basis of sepsis-associated organ dysfunction: novel therapeuticimplications and challenges, Pharmacol. Therapeut. 177 (2017) 56e66. [2] F. Verdonk, A. Blet, A. Mebazaa, The new sepsis definition, limitations and contribution to research and diagnosis of sepsis, Current Opin. Anaesthesiol. 30 (2017) 200e204. [3] G.M. Mutlu, G.R. Budinger, Incidence and outcomes of acute lung injury, New England J. Med. 354 (2006) 416e417, author reply 416-417,2006. [4] J. Villar, D. Sulemanji, R.M. Kacmarek, The acute respiratory distress syndrome, incidence and mortality, has it changed? Current Opin. Crit. Care 20 (2014) 3e9. [5] G. Bellani, J.G. Laffey, T. Pham, E. Fan, L. Brochard, A. Esteban, L. Gattinoni, F. van Haren, A. Larsson, D.F. McAuley, et al., Epidemiology, patterns of care, and mortality for patients with acute respiratory distress syndrome in intensive care units in 50 countries, JAMA 315 (2016) 788e800. [6] J. Cohen, The immunopathogenesis of sepsis, Nature 420 (2002) 885e891. [7] J. Lomas-Neira, C.S. Chung, M. Perl, S. Gregory, W. Biffl, A. Ayala, Role of alveolar macrophage and migrating neutrophils in hemorrhage-induced priming for ALI subsequent to septic challenge, Am. J. Physiol. Lung Cell Mol. Physiol. 290 (2006) L51eL58. [8] D.R. Call, J.A. Nemzek, S.J. Ebong, G.R. Bolgos, D.E. Newcomb, G.K. Wollenberg, D.G. Remick, Differential local and systemic regulation of the murine chemokines KC and MIP2, Shock 15 (2001) 278e284. [9] Q. Chaochao, G. Lou, Y. Yang, Y. Liu, Y. Hu, Z. Min, P. Chen, J. He, Z. Chen, Macrophage inflammatory protein-2 in high mobility group box 1 secretion of macrophage cells exposed to lipopolysaccharide, Cell Physiol. Biochem. 42 (2017) 913e928. [10] M.P. Fink, H.S. Warren, Strategies to improve drug development for sepsis, Nat. Rev. Drug Discover. 13 (2014) 741e758. [11] G. Fakhfouri, R. Rahimian, A. Daneshmand, A. Bahremand, M.R. Rasouli, A.R. Dehpour, S.E. Mehr, K. Mousavizadeh, Granisetron ameliorates acetic acid-induced colitis in rats, Hum. Exp. Toxicol. 29 (2010) 321e328. [12] Y.M. Ahmed, B.A. Messiha, A.A. Abo-Saif, Granisetron and carvedilol can protect experimental rats againstadjuvant-induced arthritis, Immunopharmacol. Immunotoxicol. 39 (2017) 97e104. [13] N. Song, Z.S. Liu, W. Xue, Z.F. Bai, Q.Y. Wang, J. Dai, X. Liu, Y.J. Huang, H. Cai, X.Y. Zhan, et al., NLRP3 phosphorylation is an essential priming event for inflammasome activation, Mol. cell 68 (2017) 185e197, e6.
7
[14] D. Li, W. Ren, Z. Jiang, L. Zhu, Regulation of the NLRP3 inflammasome and macrophage pyroptosis by the p38 MAPK signaling pathway in a mouse model of acute lung injury, Mol. Med. Rep. 18 (2018) 4399e4409. [15] J.S. Moon, S. Lee, M.A. Park, I.I. Siempos, M. Haslip, P.J. Lee, M. Yun, C.K. Kim, J. Howrylak, S.W. Ryter, et al., UCP2-induced fatty acid synthase promotes NLRP3 inflammasome activation during sepsis, J. Clin. Invest. 125 (2015) 665e680. [16] M. Deng, T. Ma, Z. Yan, K.R. Zettel, M.J. Scott, H. Liao, A. Frank, A.E. Morelli, C.P. Sodhi, D.J. Hackam, et al., Toll-like receptor 4 signaling on dendritic cells suppresses polymorphonuclear leukocyte CXCR2 expression and trafficking via interleukin 10 during intra-abdominal sepsis, J. Infect. Dis. 213 (2016) 1280e1288. [17] E.K. Park, H.S. Jung, H.I. Yang, M.C. Yoo, C. Kim, K.S. Kim, Optimized THP-1 differentiation is required for the detection of responses to weak stimuli, Inflamm. Res. 56 (2007) 45e50. [18] Y.P. Luo, L. Jiang, K. Kang, D.S. Fei, X.L. Meng, C.C. Nan, S.H. Pan, M.R. Zhao, M.Y. Zhao, Hemin inhibits NLRP3 inflammasome activation in sepsis-induced acute lung injury, involving heme oxygenase-1, Int. Immunopharmacol. 20 (2014) 24e32. [19] B.G. Chousterman, F.K. Swirski, G.F. Weber, Cytokine storm and sepsis disease pathogenesis, Semin Immunopathol. 39 (2017) 517e528. [20] P.G. Thomas, P. Dash, J.R. Jr Aldridge, A.H. Ellebedy, C. Reynolds, A.J. Funk, W.J. Martin, M. Lamkanfi, R.J. Webby, K.L. Boyd, et al., The intracellular sensor NLRP3 mediates key innate and healing responses to influenza A virus via the regulation of caspase-1, Immunity 30 (2009) 566e575. [21] T. Narasaraju, E. Yang, R.P. Samy, H.H. Ng, W.P. Poh, A.A. Liew, M.C. Phoon, N. van Rooijen, V.T. Chow, Excessive neutrophils and neutrophil extracellular traps contribute to acute lung injury of influenza pneumonitis, Am. J. Pathol. 179 (2011) 199e210. [22] M. Xie, Y. Yu, R. Kang, S. Zhu, L. Yang, L. Zeng, X. Sun, M. Yang, T.R. Billiar, H. Wang, et al., PKM2-dependent glycolysis promotes NLRP3 and AIM2 inflammasome activation, Nat. Commun. 7 (2016), 13280. [23] M.E. Heid, P.A. Keyel, C. Kamga, S. Shiva, S.C. Watkins, R.D. Salter, Mitochondrial reactive oxygen species induces NLRP3-dependent lysosomal damage and inflammasome activation, J. Immunol. 191 (2013) 5230e5238. [24] E. Kolaczkowska, P. Kubes, Neutrophil recruitment and function in health and inflammation, Nat. Rev. Immunol. 13 (2013) 159e175. [25] S.M. Man, R. Karki, T.D. Kanneganti, Molecular mechanisms and functions of pyroptosis, inflammatory caspases and inflammasomes in infectious diseases, Immunol. Rev. 277 (2017) 61e75. [26] A. Garai, A. Zeke, G. Gogl, I. Toro, F. Fordos, H. Blankenburg, T. Barkai, J. Varga, A. Alexa, D. Emig, et al., Specificity of linear motifs that bind to a common mitogen-activated protein kinase docking groove, Sci. Signal 5 (2012) ra74. [27] J.A. Nick, S.K. Young, K.K. Brown, N.J. Avdi, P.G. Arndt, B.T. Suratt, M.S. Janes, P.M. Henson, G.S. Worthen, Role of p38 mitogen-activated protein kinase in a murine model of pulmonary inflammation, J. Immunol. 164 (2000) 2151e2159. [28] G.Y. Song, C.S. Chung, D. Jarrar, I.H. Chaudry, A. Ayala, Evolution of an immune suppressive macrophage phenotype as a product of p38 MAPK activation in polymicrobial sepsis, Shock 15 (2001) 42e48.
Please cite this article as: J. Wang et al., Granisetron protects polymicrobial sepsis-induced acute lung injury in mice, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.12.031