Granulocyte colony stimulating factor (GCSF) improves memory and neurobehavior in an amyloid-β induced experimental model of Alzheimer's disease

Pharmacology, Biochemistry and Behavior 110 (2013) 46–57

Contents lists available at SciVerse ScienceDirect

Pharmacology, Biochemistry and Behavior journal homepage: www.elsevier.com/locate/pharmbiochembeh

Granulocyte colony stimulating factor (GCSF) improves memory and neurobehavior in an amyloid-β induced experimental model of Alzheimer's disease Ajay Prakash a, Bikash Medhi b,⁎, Kanwaljit Chopra a a b

Pharmacology Division, University Institute of Pharmaceutical Sciences, Panjab University, Chandigarh, India Department of Pharmacology, Postgraduate Institute of Medical Education & Research, Chandigarh 160012, India

a r t i c l e

i n f o

Article history: Received 14 July 2012 Received in revised form 21 May 2013 Accepted 25 May 2013 Available online 10 June 2013 Keywords: Alzheimer's disease GCSF HSCs

a b s t r a c t GCSF is an endogenous neuronal hematopoietic factor that displays robust in vitro and in vivo neuroprotective activity. The present study aimed to evaluate the effect of GCSF on Aβ-induced memory loss in an Alzheimer's disease model of rats. A total of 42 male adult Wistar rats weighing 200–250 g were used in the study and were divided into 7 experimental groups. Animals were subjected to intracerebroventricular (ICV) injection stereotaxically at day 0 to instill amyloid-β1–42 (Aβ1–42) or PBS (sham operated group) at 10 μl (5 μl bilaterally). GCSF treatment was given from day 7 to 12 of Aβ injection. On day 21, behavioral tests (short term memory, exploratory behavior and motor coordination) in all groups were evaluated. Biochemical parameters and RNA expression were measured to ensure the efficacy of GCSF. GCSF (35 and 70 μg/kg, s.c.) showed statistically significant improvement in memory as compared to control and sham operated groups (p b 0.05). Mean time spent in the platform placed quadrant was found to be significantly increased in the GCSF (70 μg/kg, s.c.) as compared to GCSF (35 μg/kg, s.c.) and GCSF (10 μg/kg, s.c.) groups (p b 0.001). GCSF (35 and 70 μg/kg, s.c.) also improved motor coordination and exploratory behavior significantly as compared to naïve sham operated and GCSF (10 μg/kg, s.c.) groups (p b 0.05). Improvement in memory by GCSF (35 and 70 μg/kg, s.c.) was coupled with marked reduction of lipid peroxidation, acetylcholinesterase levels and a significant increase in antioxidant enzymes as well as total RNA expression in the brain. Additionally, GCSF (35 and 70 μg/kg, s.c.) significantly increased progenitor cells (iPSCs) and surface marker CD34+ in the brain and hence induced neurogenesis. The present findings demonstrate an improvement of memory and neurobehavioral function with GCSF in Aβ-induced Alzheimer's disease model in rats. © 2013 Elsevier Inc. All rights reserved.

1. Introduction Alzheimer's disease (AD) is a progressive, chronic neurodegenerative disease, which is considered as the 5th leading cause of death for those older than the age of 65 and 7th leading cause of death in the United States of America (Jacobsen et al., 2005; Zhao et al., 2008). An epidemiological study reveals that the number of Alzheimer cases is expected to double every 20 years; however, overall dementia was found in more than 35 million people worldwide (Querfurth and LaFerla, 2010). Experimental studies affirmed that the degeneration in the hippocampus and

Abbreviations: GCSF, granulocyte colony-stimulating factor; ICV, intracerebroventricular; AD, Alzheimer's disease; Aβ1–42, amyloid-beta (1–42); DG, dentate gyrus; NMDA, N-methyl-D-aspartate; EPO, erythropoietin; BDNF, brain-derived neurotrophic factors; NBT, nitro blue tetrazolium; EDTA, ethylenediamine tetrachloroacetic acid; TBA, thiobarbituric acid; TLT, transfer latency time; GSH, reduced glutathione; SOD, superoxide dismutase; CAT, catalase; nAChR, nicotinic receptor; mAChR, muscarinic receptor. ⁎ Corresponding author at: Department of Pharmacology, PGIMER, Chandigarh, India. Tel.: +91 1722755250 (office), +91 9815409652 (mobile); fax: +91 1722744043. E-mail address: [email protected] (B. Medhi). 0091-3057/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.pbb.2013.05.015

dentate gyrus (DG) leads to progressive loss of cognition and learning (Salloway et al., 2008; Fernández-Verdecia et al., 2009). Anticholinesterases and N-methyl-D-aspartate (NMDA) antagonists are the major treatment modalities available for symptomatic relief. Replacement therapy with stem cells and growth factors is the proposed latest strategy for the management of Alzheimer's disease (Salloway et al., 2008; Hou and Hong, 2008; Fernández-Verdecia et al., 2009). Growth factors such as erythropoietin (EPO) (Solaroglu et al., 2003; Assaraf et al., 2007), granulocyte colony stimulating factor (GCSF) (Park et al., 2005; Sanchez-Ramos et al., 2009), and brainderived neurotrophic factors (BDNFs) (Schabitz et al., 2000; Angelucci et al., 2010) come second to stem cells as new interventions in neurological disorders and demonstrate their efficacy by inducing the progenitor stem cells in the circulation. These have been tried in neurotrauma (Kulbatski et al., 2005), stroke (Schabitz et al., 2000; Gibson et al., 2005; Sprigg et al., 2006), Alzheimer's disease (Rowe et al., 2009; Sanchez-Ramos et al., 2009; Querfurth and LaFerla, 2010) and Parkinson's Disease (Zhao et al., 2008; Hou and Hong, 2008). Experimental evidence showed accumulation of Aβ as a primary pathological change in the development of Alzheimer's disease (AD).

A. Prakash et al. / Pharmacology, Biochemistry and Behavior 110 (2013) 46–57

47

Cleary et al. (2005) provided first experimental evidence that a defined molecular species of the Aβ protein interferes with cognitive function and showed that soluble trimers and dimers Aβ were necessary and sufficient to disrupt learned behavior. In addition, recently it was shown that soluble Aβ disrupted the memory of a learned behavior in normal rats and that the mechanism involved metabotropic glutamate receptors and N-methyl-D-aspartate (NMDA) receptors (Shankar et al., 2008). GCSF is a multi-modal hematopoietic growth factor which has been approved by the US-FDA to decrease the incidence of infection manifested by febrile neutropenia in patients receiving myelosuppressive anticancer drugs. Sanchez-Ramos et al. (2009) demonstrated that the GCSF significantly decreased brain amyloid β and reversed cognitive impairment in Alzheimer's mice. Experimental studies have demonstrated that GCSF has the neuroprotective activity in stroke and neurotrauma (Kleinschnitz et al., 2004; Kulbatski et al., 2005; Gibson et al., 2005a). Sprigg et al. (2006) showed that GCSF effectively mobilized bone marrow CD34+ stem cells in patients with recent ischemic stroke and proved it to be a neuroprotective agent. Hence, based on the previous studies, the present study was designed to evaluate GCSF in improving the memory and neurobehavioral deficit in Alzheimer's disease in rats. Moreover, an attempt was made to delineate its mechanism of action.

The Aβ aggregate was prepared from a solution of amyloid-β1–42 (Sigma-Aldrich Inc.) in PBS, pH 7.4. The solution was incubated at 37 °C for 3 days to form the aggregated Aβ and stored at −70 °C. Animals were anesthetized with 40 mg/kg, i.p. sodium pentobarbital, and the injection of aggregated Aβ was made bilaterally into lateral ventricle using a 27-gauge needle connected to a micro syringe (Hamilton) with the help of stereotactic apparatus at coordinates: AP: 0.8 mm to bregma; lateral: 1.5 mm to sagittal suture and 3.6 mm beneath the surface of the brain (Sharma and Gupta, 2002). Total volume of ICV injection was 10 μl of aggregated Aβ or PBS bilaterally (5 μl/burr hole) and thereafter, the rats were housed and observed for 7 days for AD symptoms to develop (Stephan et al., 2001; Yan et al., 2001).

2. Materials and methods

3.2. Learning and memory behavioral study

2.1. Animals

3.2.1. Morris water maze test The rats were tested for memory in a spatial version of Morris water maze test (Morris et al., 1982; Tuzcu and Baydas, 2006) using computer tracking system with EthoVision software (Noldus Information Technology, Wageningen, Netherlands). The apparatus consisted of a circular water tank (180 cm in diameter and 60 cm high). A platform (12.5 cm in diameter and 38 cm high) invisible to the rats, was set 2 cm below the water level inside the tank with water maintained at 25.5 ± 2 °C at a height of 40 cm. The tank was located in a large room where there were several brightly colored cues external to the maze; these were visible from the pool and could be used by the rats for spatial orientation. The position of the cues remained unchanged throughout the study. The rats received four consecutive daily training trials in the following 5 days, with each trial having a ceiling time of 90 s and a trial interval of approximately 30 s. For each trial, each animal was put into the water at one of four starting positions, the sequence of which being selected randomly. During test trials, the rats were placed into the water tank at the same starting point, with their heads facing the wall. The animal had to swim until it climbed onto the platform submerged underneath the water. After climbing onto the platform, the animal remained there for 20 s before the commencement of the next trial. The escape platform was kept in the same position relative to the distal cues. If the animal failed to reach the escape platform within the maximally allowed time of 90 s, it was guided with the help of a rod and allowed to remain on the platform for 20 s. The time to reach the platform (escape latency in seconds) and total distance traveled to reach the platform (path length in cm) was measured as parameter of memory assessment.

A total of 42 adult Wistar male rats weighing 200–250 g were obtained from the Central Animal House of the Institute. The animals were housed in standard laboratory conditions at 25 ± 2 °C, humidity of 60 ± 2% and 12 h light:dark cycle. The experimental protocols were approved by the Institutional Animal Ethics Committee (IAEC) of Panjab University and performed in accordance with the guidelines of the Committee for Control and Supervision of Experimentation on Animals (CPCSEA), Government of India. The animals had free access to standard laboratory rat chow diet and tap water. The animals were acclimatized to the laboratory conditions 1 week prior to experimentation. All experiments were conducted daily between 09:00 am and 03:00 pm. 2.2. Drugs and chemicals The amyloid-β1–42 (Aβ) was purchased from Sigma-Aldrich Inc. (St. Louis, MO, USA) to induce Alzheimer's disease in the rats. GCSF (filgrastim), marketed product of Dr. Reddy's Laboratories Ltd. was directly purchased from the market. RNA extraction kit was obtained from Real Biotech Corporation, Taiwan. 3. Methods Experiment was carried out in a parallel design method and the rats were divided into the following six groups; Control group (n = 6): Group represented, healthy normal rats which were treated with the vehicle (PBS, pH 7.4) subcutaneous (s.c.) from 7 to 12 days and assessed on days 0, 7, 14, and 21; Control (GCSF) group (n = 6): Comprised of healthy normal rats treated with GCSF 70 μg/kg, s.c. from 7 to 12 days and assessed on days 0, 7, 14, and 21. Sham operated group (n = 6): Rats were exposed to stereotactic/intracerebroventricular PBS injection and assessed on days 0, 7, 14, and 21; Dementia (Aβ) group (n = 6): Rats were exposed to stereotaxic surgery and Aβ(1–42) was injected in a volume of 10 μl of Aβ(1–42) aggregate (5 μl bilateral) in PBS, pH 7.4 and allowed to develop the symptoms of AD for 7 days and assessed on days 0, 7, 14, and 21; GCSF 10 group: After administration of Aβ(1–42)-aggregates, rats were treated with GCSF (10 μg/kg, s.c.) from 7 to 12 days and assessed on days 0, 7, 14, and 21; GCSF 35 group: After administration of Aβ(1–42)-aggregates, rats were treated with GCSF (35 μg/kg, s.c.) from 7 to 12 days and assessed on days 0, 7,

14, and 21, and GCSF 70 group: After administration of Aβ-aggregates, rats were treated with GCSF (70 μg/kg, s.c.) from 7 to 12 days and assessed on days 0, 7, 14, and 21. On day 22, the neurobehavioral parameters, brain biochemical assessment, and GCSF-induced RNA expression were assessed. Immunohistopathological study was performed to study the pathological changes in lateral ventricles and hippocampus region of rat brain. Brief experimental design is explained in Fig. 1. 3.1. Alzheimer's disease model development

3.2.2. Memory consolidation test Test was performed to observe the consolidation process of memory described earlier by Tuzcu and Baydas (2006). This is based on the principle that the total time spent in the target quadrant (quadrant in which platform was hided) indicates the degree of memory consolidation that has taken place after learning. Briefly, the rats were placed into the water maze as in the training, except that the hidden platform was removed from targeted quadrant and the time spent for crossing targeted quadrant was recorded for 90 s. 3.2.3. Short-term memory evaluation using elevated plus maze Plus maze consisted of 2 open (16 × 5 cm) and two enclosed (16 × 5 × 12 cm) arms, connected by a central platform. The apparatus

48

A. Prakash et al. / Pharmacology, Biochemistry and Behavior 110 (2013) 46–57

Fig. 1. Study design of the protocol; the rats were trained for 4 days in the Morris water for short term memory assessment and then assessed at days 0 (baseline), 7, 14 and 21 after treatment with GCSF. Alzheimer's disease (AD) like symptoms were induced by the amyloid-β1–42 insult intracerebroventrically (ICV), once at day 1 in the volume of 10 μl bilaterally (5 μl in each burr hole) and the memory was assessed on day 7. Thereafter, treatments were done from day 7 to 12. Thereafter, on day 21, neurobehavioral assessments were done. The rats were sacrificed and brain was isolated and processed for antioxidant tests, GCSF induced RNA expression and immunohistochemistry.

was elevated to a height of 50 cm above the floor in a dimly lit room. All the rats were fasted for 24 h and given a single training to approach a reward (food pellet) in the enclosed arm on the next day. Each rat was individually placed at the end of open arm facing away from the central platform of the maze. The time taken by the rats, to rich reward from open arm into the enclosed arm was recorded as transfer latency time (TLT). The animals that did not enter the closed arm within cutoff time (90 s) were excluded from study. The memory retention was studied on days 0, 7, 14, and 22 (Itoh et al., 1990). 3.2.4. Locomotion assessment Spontaneous locomotor activity was measured on day 22 using digital actophotometer and closed field activity was measured to preclude the interference of change in locomotion activity in the parameters of memory function. The apparatus was placed in a darkened, light and sound attenuated testing room. Values were expressed as counts per 3 min (Sharma and Gupta, 2001a,b). 3.2.5. Rotarod test This test was employed to evaluate fore and hind limb motor coordination by Cartimell et al. (1991). The apparatus consists of a horizontal metal revolving rod coated with rubber. The animals which had demonstrated their ability to remain on the revolving rod for at least 1 min was used for the test. Each rat was subjected to Rotarod test at days 0, 7, 14 and 22. The change in percentage of animals falling during the test was evaluated. 3.3. Biochemical tests 3.3.1. Estimation of lipid peroxidation The malondialdehyde content, a measure of lipid peroxidation, was assayed in the form of thiobarbituric acid-reactive substances by the method of Wills (1965). Briefly, 0.5 ml of supernatant and 0.5 ml of Tris–HCl were incubated at 37 °C for 2 h. After incubation, 1 ml of 10% trichloroacetic acid was added and centrifuged at 1000 g for 10 min. To 1 ml of supernatant, 1 ml of 0.67% thiobarbituric acid was added and the tubes were kept in boiling water for 10 min. After cooling, 1 ml double distilled water was added and absorbance was measured at 532 nm. Thiobarbituric acid-reactive substances were quanti-Wed using an extinction coefficient of 1.56 × 105 M−1 cm−1 and expressed as nmol of malondialdehyde per mg protein. Tissue protein was estimated using the Biuret method and the brain malondialdehyde content expressed as nmol of malondialdehyde per mg of protein. 3.3.2. Estimation of reduced glutathione Reduced glutathione (GSH) was assayed by the method of Jollow et al. (1974). Briefly, 1.0 ml of post-mitochondrial supernatant (10%) was precipitated with 1.0 ml of sulfosalicylic acid (4%). The samples

were kept at 4 °C for at least 1 h and then subjected to centrifugation at 1200 g for 15 min at 4 °C. The assay mixture contained 0.1 ml supernatant, 2.7 ml phosphate buffer (0.1 M, pH 7.4) and 0.2 ml 5,5,dithiobis (2-nitro benzoic acid) (Ellman's reagent, 0.1 mM, pH 8.0) in a total volume of 3.0 ml. The yellow color developed was read immediately at 412 nm. 3.3.3. Estimation of superoxide dismutase Cytosolic superoxide dismutase (SOD) activity was assayed by the method of Kono (1978). The assay system consisted of 0.1 mM EDTA, 50 mM sodium carbonate and 96 mM of nitro blue tetrazolium (NBT). In the cuvette, 2 ml of above mixture was taken and to it 0.05 ml of post mitochondrial supernatant and 0.05 ml of hydroxylamine hydrochloride (adjusted to pH 6.0 with NaOH) were added. The auto-oxidation of hydroxylamine was observed by measuring the change in optical density at 560 nm for 2 min at 30/60 s intervals. 3.3.4. Estimation of catalase Catalase (CAT) activity was assayed by the method of Claiborne (1985). Briefly, the assay mixture consisted of 1.95 ml phosphate buffer (0.05 M, pH 7.0), 1.0 ml hydrogen peroxide (0.019 M) and 0.05 ml post mitochondrial supernatant (10%) in a final volume of 3.0 ml. Changes in absorbance were recorded at 240 nm. 3.3.5. Nitrite estimation Nitrite was estimated in the cortex and hippocampus regions using the Griess reagent and served as an indicator of nitric oxide production. A measure of 500 μl of Griess reagent (1:1 solution of 1% sulfanilamide in 5% phosphoric acid and 0.1% naphthylamine diamine dihydrochloric acid in water) was added to 100 μl of post mitochondrial supernatant and absorbance was measured at 546 nm (Green et al., 1982). Nitrite concentration was calculated using a standard curve for sodium nitrite and expressed as μg/ml. 3.3.6. Acetylcholinesterase activity Cholinergic dysfunction was assessed by acetylcholinesterase activity. The quantitative measurement of acetylcholinesterase levels in whole brain were performed according to the method of Ellman et al. (1961). The assay mixture contained 0.05 ml of supernatant, 3 ml of 0.01 M sodium phosphate buffer (pH 8), 0.10 ml of acetylthiocholine iodide and 0.10 ml 5,5,dithiobis (2-nitro benzoic acid) (Ellman reagent). The change in absorbance was measured at 412 nm for 5 min. Results were calculated using molar extinction coefficient of chromophore (1.36 × 104 M− 1 cm− 1) and expressed as percentage of control. 3.3.7. Detection of G-CSF induced RNA in brain sample RNA was isolated using the RNeasy Micro Kit (RBC). Briefly, after first- and second-strand cDNA synthesis, RNA was transcribed with

A. Prakash et al. / Pharmacology, Biochemistry and Behavior 110 (2013) 46–57

the T7 MEGAscript Kit at 37 °C for 16 h. Amplified anti-sense RNA was purified with the RNeasy Mini Kit and precipitated. First-strand cDNA was synthesized using random primers, which was followed by second-strand synthesis. PCR was performed for G-CSF (GCSF-790 s, GGAGCTCTAAGCTTCTAGATC; GCSF-1154as, TAGGGACTTCGTTCCTGTG AG, product length 364 bp) under the following conditions: G-CSF was amplified over 50 cycles at an annealing temperature of 64 °C. Product was visualized by agarose gel (1%) electrophoresis and ethidium bromide staining (Itoh et al., 1990). 3.3.8. Immunohistochemistry Horizontal cryostat brain sections (5 μm) were prepared from rat brain and fixed on glass slides. The brain sections were rinsed with PBS. Then, they were treated with the Primary antibody rabbit-Aβ (1:250) for 2 h at 37 °C. Washing was done with PBS at every 5 min till clear the section. Horseradish peroxidase (HRP) labeled secondary antibody anti-rabbit antibody (1:100) for 1 and 0.5 h at 37 °C. Thereafter, sections were treated with the diaminobenzidine (DAB), thereafter sections were kept for 5–10 min at 37 °C till color developed. Reaction was stopped by rinsing the sections in the distilled water. Slides were dried and mounted with DPX.

49

3.3.9. Processing whole blood samples for the induced progenitor stem cell (iPSC) Blood was withdrawn using standard, 8 ml Vacutainer Cell Processing Tubes (sodium citrate/sodium heparin; BD Biosciences; Franklin Lakes, NJ, USA). Vacutainers were processed within 1–2 h of collection. Briefly, the peripheral blood mononuclear cells (PBMC) containing upper phase (Buffy coat) was collected and washed with ice-cold PBS (Invitrogen; Carlsbad, CA, USA). Samples were treated with Histopaque (Sigma Aldrich; St. Louis, MO, USA) to minimize the number of red blood cells (RBCs) and centrifuged at 2000 rpm for 20 min continuously. The interface containing the PBMCs was removed with histopaque and cells washed again with chilled PBS, centrifuged at 6000 g for 15 min and used directly for purification. The PBMCs were counted under light microscope and the cell suspension containing at least 1 × 106cells/ml were used for the lineage markers, of CD34 with mouse monoclonal anti-CD34+ tagged with fluorescein (FITC) and the cells were analyzed with flow cytometry. 3.3.10. Statistical analysis Data were entered into the data base program SPSS version 12.0, for intra and inter group comparison. Data was expressed as mean ± SEM

Fig. 2. A: Morris Water maze test; effect of GCSF (10/35/70 μg/kg, s.c.) (n = 6/group) on latency time of memory retrieval in rat model of Alzheimer's disease after 21 days. B: Effect of GCSF (10/35/70 μg/kg, s.c.) (n = 6/group) on memory retrieval in Morris water maze test in rat model of Alzheimer's disease; Figure showed path to hidden platform of rats in Morris water maze test at different observation days (Noldus Ethovision 3.1 version). C: Morris Water maze test; mean distance moved of rats to reach the hidden platform; Effect of GCSF (10/35/70 μg/kg, s.c.) (n = 6/group) on memory retrieval in rat model of Alzheimer's disease after 21 days. D: Morris Water maze test; effect of GCSF (10/35/70 μg/kg, s.c.) (n = 6/group) on memory consolidation in rat model of Alzheimer's disease after 21 days.

50

A. Prakash et al. / Pharmacology, Biochemistry and Behavior 110 (2013) 46–57

Fig. 2 (continued).

and analyzed using one way analysis of variance (ANOVA) followed by Bonferroni's post hoc test. Estimation of behavioral parameters, densitometry analysis of gel (RNA), CD34+ PBPC counts, lipid peroxidation, catalase, superoxide dismutase, glutathione and acetylcholinesterase level were analyzed using one way analysis of variance (ANOVA) followed by Bonferroni' post hoc test. There was direct control group to the GCSF treated groups and inter group comparison was made by using two way ANOVA. The p-value b 0.05 was considered statistically significant. 4. Results 4.1. Behavioral outcome of the study 4.1.1. Effect of GCSF on the memory Morris water maze test, a gold standard model for assessment of memory was used to assess the memory of Aβ-injected rats. The memory was assessed following the training of rats, once every day for 4 days. During training, mean transfer latency was reduced on 4th day of training, hence on day 0, the transfer latency was minimum in all

experimental groups. Thereafter, on day 0, Aβ was instilled in all groups except control, GCSF per se and sham groups. On day 7 after the Aβ administration, there was a significant increase in the transfer latency of all rats of Aβ-insulted group compared to the control groups or sham group (p b 0.001; 66.58 ± 7.22 vs 13.58 ± 3.27 s). GCSF (35 μg/kg, s.c.) and GCSF (70 μg/kg, s.c.) markedly reduced it, however, there was no significant difference between GCSF (35 μg/kg, s.c.) and GCSF (70 μg/kg, s.c.) treatment groups (Fig. 2A, B and C). Total distance moved by the rats in the water maze was significantly increased, about 12 fold as compared to the day 0 in all Aβ-insulted groups, except control and sham groups. Treatment with GCSF 35/70 μg/kg, s.c. had shown significant reduction at day 14 and 21. However, there was promising reduction in GCSF 70 μg/kg, s.c. as compared to Aβ-insulted group, GCSF 10 and 35 μg/kg, s.c. (Fig. 2B & C) and found to be comparable to control (GCSF) group. In addition, memory consolidation (time spent in target quadrant) was significantly reduced in the Aβ group as compared to the control or sham group (p b 0.001; 18 ± 7 vs 79 ± 9 s) whereas treatment with the GCSF (35 μg/kg, s.c.) and GCSF (70 μg/kg, s.c.) significantly improved the memory consolidation in the rats as compared to the Aβ group (Fig. 2 D). (p b 0.001; 56 ± 8, 86 ± 11 section vs 18 ± 7 s)

A. Prakash et al. / Pharmacology, Biochemistry and Behavior 110 (2013) 46–57

GCSF (70 μg/kg, s.c.) was found to be more effective in improving the memory consolidation as compared to GCSF (35 μg/kg, s.c.) (p b 0.05; 56 ± 8 vs 86 ± 11 s) (Fig. 2A & B). Elevated plus maze test was also performed to ensure the promising effect of GCSF on memory. The time to reach the targeted arm was significantly reduced on the day 0 of protocol as compared to training day (day — 1) in all the groups (p b 0.05). On day 7, the Aβ group showed significant increase in the transfer latency time (TLT) as compared to the control and sham groups (p b 0.05; 67.88 ± 11.14 vs 45.5 ± 19.33 and 47.33 ± 5.90 s). Dose dependant improvement in cognition was observed the all three treatment groups at the day 22 of the study (p b 0.05; 49.75 ± 9.54 vs 37.75 ± 11.43 vs 31 ± 1.41 respectively) (Fig. 3). 4.1.2. Effect of GCSF on the muscle coordination Muscle coordination was assessed as per the percentage fall of animal in the test period of 120 s. On day 0, no animal fall was observed but, after Aβ insult, there was significant increase in the percentage of animal fall in all groups on day 7. In the treatment groups, GCSF (10 μg/kg, s.c.) did not show any improvement in the muscle coordination at 22 days of treatment compared to the Aβ group. However, GCSF (35 μg/kg, s.c.) and GCSF (70 μg/kg, s.c.) significantly reduced the percentage fall of rats as compared to the Aβ group on day 22 (p b 0.05; 50%, 66.67% vs 100%) (Fig. 4). 4.1.3. Effect of GCSF on the exploratory behavior On day 7, after the Aβ insult; there was a significant increase in the exploratory behavior as compared to the day 0 activity. Treatment with the all three doses of GCSF reduced the exploratory behavior of the rats as compared to the Aβ group on day 14. (p b 0.05) GCSF (70 μg/kg, s.c.) showed the highest improvement in the exploratory behavior as compared to the GCSF (10 μg/kg, s.c.) and GCSF (35 μg/kg, s.c.) (p b 0.05; 46.83 ± 3.16 vs 53.17 ± 2.04 vs 51.17 ± 3.27) on day 22 (Fig. 5).

51

Enzymatic antioxidant levels of SOD, CAT and GSH were significantly reduced after the Aβ administration which were significantly and dose dependently increased after the GCSF treatment (p b 0.05). 4.2.2. Nitrite level assessment Nitrite level was found to be significantly increased in the Aβ group as compared to the control group (p b 0.001). GCSF (10/35/70 μg/kg, s.c.) treatment reduced it significantly in a dose dependent manner (p b 0.05) (Table 1). 4.2.3. Acetylcholinesterase level assessment Acetylcholinesterase level was found to be increased in the Aβ group significantly as compared to the control or sham operated group. GCSF treatment in all three doses significantly reduced the acetylcholinesterase level in the brain. The efficacy of GCSF in reducing the acetylcholinesterase level was found to be dose dependant (Table 1). 4.3. Assessment of GCSF induced gene expression Total RNA expression was analyzed by northern blotting technique by ethidium bromide-stained gel containing rat brain samples. Densitometric analysis showed significantly decreased gene expression in Aβ-insult group as compared to control and sham operated groups whereas GCSF treatment significantly increased the GCSF-induced gene expression as about 4 fold in GCSF 10, 4.5 fold in GCSF 35 and about 6 fold in GCSF 70 group (Fig. 6). 4.4. Immunohistochemical analysis The Aβ-load in the hippocampus of rat brain was significantly high in the Aβ-insulted rats (Fig. 7C) as compared to the control, control (GCSF) and sham operated groups. Treatment with GCSF 10 μg/kg, s.c. was not able to reduce the level of Aβ aggregate on day 22 as compared to other 2 test groups.

4.2. Effect of GCSF on biochemical parameters 4.2.1. Anti-oxidant level assessment (Table 1) Lipid peroxidation was significantly increased in the Aβ group whereas it was dose dependently reduced after GCSF (10/35/70 μg/kg, s.c.) treatment. The reduction with GCSF (70 μg/kg, s.c.) was up to 4 fold as compared to the control groups (p b 0.05).

4.5. Effect of GCSF on whole blood for the induced progenitor stem cell (iPSC) Hematopoietic progenitor cells expressing CD34+ represent a very small fraction of the cell population but it is a good biomarker for the induced progenitor cells in the peripheral blood. GCSF significantly

*p<0.05, compared to the day(-1) of training; # p<0.05, compared to the day(-1) of training; ^ p < 0.05, compared to the Day 0 (D0); @ p<0.001, compared to the baseline value at day 7 (D7); b p<0.001, compared to Aβ group: Value given in mean ± SEM; One way ANOVA followed by Post Hoc Bonferroni test was applied [D (-1)= Rat training day 1; D0= Day 0, D7= Day 7, D14= Day 14 and D21= Day 21] Fig. 3. Elevated plus maze test; effect of GCSF (10/35/70 μg/kg, s.c.) (n = 6/group) on memory in rat model of Alzheimer's disease after 21 days.

52

A. Prakash et al. / Pharmacology, Biochemistry and Behavior 110 (2013) 46–57

* p<0.05, compared to the Day 0 (D0); @ p<0.001, compared to day 7 (D7); # p<0.001, compared to Aβ group; b p<0.05, compared to the GCSF10 group: Value given in mean ± SEM; One way ANOVA followed by Post Hoc Bonferroni test was applied; [D0= Day 0, D7= Day 7, D14= Day 14 and D21= Day 21] Fig. 4. Effect of GCSF (10/35/70 μg/kg, s.c.) (n = 6/group) on muscle coordination in rat model of Alzheimer's disease after 21 days.

improved the percentage positive iPSC which is characterized by the lineage marker CD34+ cells in circulating peripheral blood as compared to control, control (GCSF) and sham operated groups. The effect was dose dependant in induction of CD34+ cells. GCSF 35 and GCSF 70 significantly increased the iPSC to about 44.8 and 98% respectively as compared to control group (Fig. 8A & B). 5. Discussion To the best of our knowledge, this is the first study which demonstrates that GCSF induces neurogenesis, reduces hippocampal Aβ-load and thus improves memory and neurobehavioral profile.

GCSF is used clinically to facilitate hematopoietic recovery after bone marrow transplantation, to mobilize peripheral blood progenitor cells in healthy donors, and to treat severe congenital neutropenia, and thus, it is safe to select the drug for the long term use (Bensinger et al., 1995; Kocherlakota and La Gamma, 1997; Carlsson et al., 2004). Moreover, growth factors are being evaluated as neuroprotective agents for various types of neurological disorders. Previous studies have shown that G-CSF stimulates the development of induced progenitor cells to neutrophils and also modulates neutrophil actions and their distribution in the body (Demetri and Griffin, 1991). In the present study, it was found that Aβ significantly deteriorated learning and memory but 6 days treatment of GCSF (35/70 μg/kg, s.c.)

* p<0.05, compared to the Day 0 (D0); @ p<0.001, compared to the baseline value at day 7 (D7); b p<0.001, compared to Aβ group: Value given in mean ± SEM; One way ANOVA followed by Post Hoc Bonferroni test was applied [D0= Day 0, D7= Day 7, D14= Day 14 and D21= Day 21] Fig. 5. Effect of GCSF (10/35/70 μg/kg, s.c.) (n = 6/group) on exploratory behavior in rat model of Alzheimer's disease after 21 days.

A. Prakash et al. / Pharmacology, Biochemistry and Behavior 110 (2013) 46–57

53

Table 1 Effect of GCSF (10/35/70 μg/kg, s.c.) (n = 6/group) on enzymatic and non-enzymatic oxidant level such as MDA, nitrite, SOD, CAT, GSH and Acetyl Cholinesterase level in rat model of Alzheimer's disease after 21 day of treatment. Parameters

Control group

Control group Sham group (GCSF)

LPO (nmole of TBARS formed/min/mg protein) 0.89 ± 0.26 0.67 ± 0.16 Nitrite (μg/ml) 40.67 ± 15.62 35.67 ± 9.62 SOD (IU/mg protein) 7.38 ± 0.61 6.18 ± 0.72 Catalase (μmol of H2O2 consumed/min/mg protein) 2.68 ± 0.30 2.14 ± 0.20 Glutathione (IU/mg protein) 46.01 ± 9.19 47.01 ± 6.29 Acetylcholinesterase (μM substrate hydrolyzed/min/mg 0.63 ± 0.088 0.51 ± 0.06 of protein)

1.98 28.83 5.27 0.89 37.83 1.05

± ± ± ± ± ±

Aβ group

Aβ + GCSF 10

Aβ + GCSF 35

Aβ + GCSF 70

1.89 ± 0.30# 1.03 ± 0.35# 0.90 4.11 ± 0.47⁎ 2.17 ± 0.34# 38.94 135.67 ± 41.20⁎ 91.23 ± 18.22# 66.83 ± 13.42# 47.17 ± 15.23# 0.83# 2.70 ± 0.14⁎ 4.77 ± 0.83# 5.36 ± 1.28# 5.38 ± 0.60# 0.19 0.97 ± 0.17⁎ 1.58 ± 0.30# 1.47 ± 0.31# 2.20 ± 0.23# 4.88 15.45 ± 5.12⁎ 38.67 ± 6.62# 42.5 ± 7.4# 46.67 ± 10.86# 0.52 3.83 ± 0.41⁎ 2.12 ± 0.63# 1.67 ± 0.52# 0.17 ± 0.41#

n = 6, value (mean ± SEM), p b 0.05#: compared with Aβ group, p b 0.001⁎: compared with control, control (GCSF) and sham operated group. One way ANOVA followed by Post Hoc Bonferroni's test, drugs given in the dosages; GCSF: 10 μg/kg, s.c., GCSF: 35 μg/kg, s.c., and GCSF: 70 μg/kg, s.c.

resulted in marked improvement of memory. One of the most probable reasons for restoration of memory may be reduction of oxidative stress in Aβ-injected rats. Generally, oxidative stress results due to imbalance between production and removal of reactive oxygen species (ROS) and leads to neuronal injury. Previous studies have demonstrated that ROS in AD brain leads to protein oxidation (Hensley et al., 1995; Castegna et al., 2002; Butterfield, 2004), lipid peroxidation (Markesbery and Lovell,

1998; Butterfield and Lauderback, 2002), DNA and RNA oxidation (Smith et al., 2002) which further resulted in the neuronal dysfunction or death. It is suggested that in the early stage of the AD, lipid peroxidation and the oxidative stress are major concerns for loss of cognition (Butterfield and Boyd-Kimball, 2004, 2005). Present study reveals that level of lipid peroxidation was increased significantly following Aβ-insult. Significant reduction of glutathione may impair H2O2 clearance and promote hydroxyl radical formation,

*p<0.05, compared to control and control (GCSF) group; # p<0.05, compared to Aβ group; @ p<0.001, compared to sham group; b p<0.001, compared to GCSF 10 and 35 and control (GCSF): Value given in mean ± SEM; One way ANOVA followed by Post Hoc Bonferroni test was applied Fig. 6. Figure showing GCSF induced gene expression in the hippocampus and dentate gyrus region of brain of GCSF treated rats following Aβ-insult. Expressed by ethidium bromide-stained gel containing samples of total RNA isolated from rat brain. (C = Control group; CG = Control (GCSF) group; S = Sham group; D = Aβ group; 10 = Aβ + GCSF 10 (10 μg/kg, s.c.); 35 = Aβ + GCSF 35 (35 μg/kg, s.c.); 70 = Aβ + GCSF 70 (70 μg/kg, s.c.)); (n = 6/group).

54

A. Prakash et al. / Pharmacology, Biochemistry and Behavior 110 (2013) 46–57

Fig. 7. Immunohistochemical evaluation of Aβ-load in the hippocampus of rat brain in GCSF treatment groups. (A) Control group, (B) control (GCSF) group, (C) sham operated group, (D) Aβ group, (E) Aβ + GCSF 10 (10 μg/kg, s.c), (F) Aβ + GCSF 35 (35 μg/kg, s.c.), and (G) Aβ + GCSF 70 (70 μg/kg, s.c.).

resulting in free radical load, which triggers loss of cognition. The glutathione levels were found to be restored by the GCSF treatment. Other antioxidants like SOD, catalase levels were also found to increase following GCSF treatment. Hence, GCSF is found to exhibit antioxidant activity against neuronal oxidative stress induced by the Aβ load. Receptors of acetylcholine and glutamate are cellular membrane proteins whose functions are highly dependent on the environment of lipid compositions. Guan (2008) suggested that there exists a close relationship between oxidative stress and the modifications of nicotinic receptors (nAChR), muscarinic receptors (mAChR), and NMDA receptors which play important roles in the pathogenesis of AD. These receptors are highly vulnerable to the oxidative stress related injury, since brain utilizes more oxygen and its cellular membranes are preferentially enriched in oxyradical-sensitive polyunsaturated fatty acids (Ding et al., 2004). Moreover, in in vitro studies of mixed astrocyte and neuron

culture model, DNA and RNA oxidation has been observed commonly in neurodegenerative disease where RNA appeared to undergo a greater degree of oxidation than DNA (Nunomura et al., 1999; Shan et al., 2007). Studies suggest that RNA oxidation is involved in early stage of Alzheimer's disease, resulting in alteration in protein synthesis in vitro and in vivo (Nunomura et al., 1999). In a clinical study of old human subjects, Hofer et al. (2008) demonstrated an increased RNA oxidation, correlated to increased levels of non-heme iron (Sultana et al., 2004). Hence, RNA oxidation is closely related to the pathophysiology of Alzheimer's disease and its improvement gives significant indication of rectification of learning and memory. Another probable reason for beneficial effect of GCSF can be postulated to be amelioration of neuro-inflammatory environment. Present study described that GCSF decreased the acetyl cholinesterase levels in the brain, resulting in the improvement in cognition. Das (2007) reported that patients with chronic disease like Alzheimer's disease

A. Prakash et al. / Pharmacology, Biochemistry and Behavior 110 (2013) 46–57

55

A

B

# p<0.05, compared to Aβ group; a p<0.05, compared to control (GCSF) group; b p<0.001, compared to control and sham group; c p<0.001, compared to GCSF 10; d p<0.001, compared to GCSF 35: Value given in mean ± SEM; One way ANOVA followed by Post Hoc Bonferroni test was applied Fig. 8. A: Effect of GCSF in expanding hematopoietic and progenitor stem cells lineage marker CD34+ in PBPC. B: Effect of GCSF in expanding hematopoietic and progenitor stem cells lineage marker CD34+ in PBPC; #, p b 0.05, compared to Aβ group; a, p b 0.001, compared to control and control (GCSF) group; b p b 0.001, compared to sham group; b, p b 0.001, compared to GCSF 10 and 35.

and diabetes mellitus have elevated levels of acetylcholinesterase and butyrylcholinesterase which is a marker of low grade systemic inflammation, resulting in low plasma acetylcholine (ACh) levels. ACh has been reported to inhibit the production of tumor necrosis factor, interleukin-1, macrophage migration inhibitory factor, and high mobility group box-1 and suppress the activation of nuclear factor-kappa B expression, comprising “cholinergic anti-inflammatory pathway”. Further, findings of Nizri et al. (2006) showed that acetylcholinesterase inhibitors (AChEI) increase the concentration of extracellular acetylcholine (ACh) and suppressed lymphocyte proliferation and pro-inflammatory cytokine production, as well as extracellular esterase activity. Anti-inflammatory activity was mediated by the α7 nicotinic acetylcholine receptor (neuronal). Recent report by Yoshiyama et al. (2010) has shown that donepezil (AChEI), showed anti-inflammatory activity in a Tau-transgenic (Tg) mice. Neuropathological improvement in GCSF treated rats may also involve contribution through induction of CD34+ iPSC. GCSF induces expression of early lineage markers, such as CD34+ cells. CD34+ cells possess characteristics that make them an ideal blood cell to reprogram.

However, their low numbers in circulating blood have made them a less desirable cell type for reprogramming because large volumes of blood were predicted to be required for the generation of iPSCs. In patients with primary intracerebral hemorrhage (ICH), the circulating levels of CD34+ progenitor cells at the day 7 of onset is correlated well with good functional outcome at 3 months (Sobrino et al., 2011). Experimental studies suggested that iPSCs exerted beneficial effects in ICH models as evidenced by reduced tissue loss, immature neuron formation, synaptogenesis, neuronal migration and neurological improvement (Seyfried et al., 2006, 2008; Zhang et al., 2006). CD34+ cells have been shown to release VEGF, IGF-1, EGF-2 and accelerate neovascularisation (Majka et al., 2001). We also found that GCSF (35 and 70 μg/kg, s.c.) could significantly expand CD34+ cells as measured by flow cytometry. This increased number of progenitor cells might have led to neuronal repair, thus translating into cognitive improvement. The present study thus concluded that GCSF improves the cognition and neurobehavioral profile in rats. The probable mechanism of action is postulated to be induction of progenitor cell which acts neurocerebrally to reduce amyloidosis and oxidant load (Fig. 9).

56

A. Prakash et al. / Pharmacology, Biochemistry and Behavior 110 (2013) 46–57

Fig. 9. Possible sites of GCSF action in Aβ-induced cognitive dysfunction cascade: (⇧) = Induction; (⇩) = Inhibition.

Acknowledgments The Senior Research Fellowship (Ajay Prakash) of the Indian Council of Medical Research (ICMR), New Delhi, is gratefully acknowledged. A part of this study was presented at the Neuroscience 2011, Washington DC, USA, 12–16 November 2011. References Angelucci F, Spalletta G, di Iulio F, Ciaramella A, Salani F, Colantoni L, et al. Alzheimer's disease (AD) and Mild Cognitive Impairment (MCI) patients are characterized by increased BDNF serum levels. Curr Alzheimer Res 2010;7:15–20. Assaraf MI, Diaz Z, Liberman A, Miller Jr WH, Arvanitakis Z, Li Y, et al. Brain erythropoietin receptor expression in Alzheimer disease and mild cognitive impairment. J Neuropathol Exp Neurol 2007;66:389–98. Bensinger WI, Weaver CH, Appelbaum FR, Rowley S, Demirer T, Sanders J, et al. Transplantation of allogeneic peripheral blood stem cells mobilized by recombinant human granulocyte colony stimulating factor. Blood 1995;85:1655–8. Butterfield DA. Proteomics: a new approach to investigate oxidative stress in Alzheimer's disease brain. Brain Res 2004;1000:1–7. Butterfield DA, Boyd-Kimball D. Amyloid beta-peptide (1–42) contributes to the oxidative stress and neurodegeneration found in Alzheimer disease brain. Brain Pathol 2004;14:426–32. Butterfield DA, Boyd-Kimball D. The critical role of methionine 35 in Alzheimer's amyloid beta-peptide (1–42)-induced oxidative stress and neurotoxicity. Biochim Biophys Acta 2005;1703:149–56. Butterfield DA, Lauderback CM. Lipid peroxidation and protein oxidation in Alzheimer's disease brain: potential causes and consequences involving amyloid beta-peptide-associated free radical oxidative stress. Free Radic Biol Med 2002;32:1050–60. Carlsson G, Ahlin A, Dahllof G, Elinder G, Henter JI, Palmblad J. Efficacy and safety of two different rG-CSF preparations in the treatment of patients with severe congenital neutropenia. Br J Haematol 2004;126:127–32. Cartimell SM, Grelgor L, Mitchell D. A revised Rotarod procedure for measuring the effect of antinociceptive drugs on motor function in the rat. J Pharmacol Methods 1991;26:149–59. Castegna A, Aksenov M, Aksenova M, Thongboonkerd V, Klein JB, Pierce WM, et al. Proteomic identification of oxidatively modified proteins in Alzheimer's disease brain. Part I: creatine kinase BB, glutamine synthase, and ubiquitin carboxy-terminal hydrolase L-1. Free Radic Biol Med 2002;33:562–71. Claiborne A. Catalase activity. In: Greenwald RA, editor. Handbook of methods for oxygen radical research. Boca Raton: CRC; 1985. p. 283–4. Cleary JP, Walsh DM, Hofmeister JJ, Shankar GM, Kuskowski MA, Selkoe DJ, et al. Natural oligomers of the amyloid-β protein specifically disrupt cognitive function. Nat Neurosci 2005;8:79–84. Das UN. Acetylcholinesterase and butyrylcholinesterase as possible markers of low-grade systemic inflammation. Med Sci Monit 2007;13(12):RA214–21. Demetri GD, Griffin JD. Granulocyte colony-stimulating factor and its receptor. Blood 1991;78:2791–808. Ding Q, Dimayuga E, Markesbery WR, Keller JN. Proteasome inhibition increases DNA and RNA oxidation in astrocyte and neuron cultures. J Neurochem 2004;91:1211–8. Ellman GL, Courtney DK, Andres V, Featherstone RM. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem Pharmacol 1961;7: 88–95.

Fernández-Verdecia CI, Díaz del Guante MA, Castillo-Díaz L, Alvarez-Blanco J. Neurogenesis as a therapeutic target for Alzheimer's disease. Rev Neurol 2009;9: 193–201. Gibson CL, Bath PM, Murphy SP. G-CSF reduces infarct volume and improves functional outcome after transient focal cerebral ischemia in mice. J Cereb Blood Flow Metab 2005a;25:431–9. Gibson CL, Jones NC, Prior MJ, Bath PM, Murphy SP. G-CSF suppresses edema formation and reduces interleukin-1β expression after cerebral ischemia in mice. J Neuropathol Exp Neurol 2005b;64:763–9. Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR. Analysis of nitrate, nitrite, and [15N] nitrate in biological fluids. Anal Biochem 1982;126: 131–8. Guan ZZ. Cross-talk between oxidative stress and modifications of cholinergic and glutaminergic receptors in the pathogenesis of Alzheimer's disease. Acta Pharmacol Sin 2008;29:773–80. Hensley K, Hall N, Subramaniam R, Cole P, Harris M, Aksenov M, et al. Brain regional correspondence between Alzheimer's disease histopathology and biomarkers of protein oxidation. J Neurochem 1995;65:2146–56. Hofer T, Marzetti E, Xu J, Seo AY, Gulec S, Knutson MD, et al. Increased iron content and RNA oxidative damage in skeletal muscle with aging and disuse atrophy. Exp Gerontol 2008;43:563–70. Hou L, Hong T. Stem cells and neurodegenerative diseases. Sci China C Life Sci 2008;51: 287–94. Itoh J, Nabeshima T, Kameyama T. Utility of an elevated plus maze for the evaluation of memory in mice. Effects of nootropic scopolamine and electroconvulsive shock. Psychopharmacology 1990;101:27–32. Jacobsen JS, Reinhart P, Pangalos MN. Current concepts in therapeutic strategies targeting cognitive decline and disease modification in Alzheimer's disease. NeuroRx 2005;2:612–26. Jollow DJ, Mitchell JR, Zampaglione N, Gillette JR. Bromobenzene induced liver necrosis: protective role of glutathione and evidence for 3,4-bromobenzenoxide as the hepatotoxic intermediate. Pharmacology 1974;11:151–69. Kleinschnitz C, Schroeter M, Jander S, Stoll G. Induction of granulocyte colonystimulating factor mRNA by focal cerebral ischemia and cortical spreading depression. Brain Res Mol Brain Res 2004;131:73–8. Kocherlakota P, La Gamma E. Human granulocyte colony-stimulating factor may improve outcome attributable to neonatal sepsis complicated by neutropenia. Pediatrics 1997;100:E6. Kono Y. Generation of superoxide radical during autoxidation of hydroxylamine and an assay for superoxide dismutase. Arch Biochem Biophys 1978;186:189–95. Kulbatski I, Mothe AJ, Nomura H, Tator CH. Endogenous and exogenous CNS derived stem/progenitor cell approaches for neurotrauma. Curr Drug Targets 2005;6:111–26. Majka M, Janowska-Wieczorek A, Ratajczak J, Ehrenman K, Pietrzkowski Z, Kowalska MA, et al. Numerous growth factors, cytokines, and chemokines are secreted by human CD34(+) cells, myeloblasts, erythroblasts, and megakaryoblasts and regulate normal hematopoiesis in an autocrine/paracrine manner. Blood 2001;97(10): 3075–85. Markesbery WR, Lovell MA. Four-hydroxynonenal, a product of lipid peroxidation, is increased in the brain in Alzheimer's disease. Neurobiol Aging 1998;19:33–6. Morris RG, Garrud P, Rawlins JN, O'Keefe J. Place navigation impaired in rats with hippocampal lesions. Nature 1982;297:681–3. Nizri E, Hamra-Amitay Y, Sicsic C, Lavon I, Brenner T. Anti-inflammatory properties of cholinergic up-regulation: a new role for acetylcholinesterase inhibitors. Neuropharmacology 2006;50(5):540–7. Nunomura A, Perry G, Pappolla MA, Wade R, Hirai K, Chiba S, et al. RNA oxidation is a prominent feature of vulnerable neurons in Alzheimer's disease. J Neurosci 1999;19: 1959–64. Park HK, Chu K, Lee ST, Jung KH, Kim EH, Lee KB, et al. Granulocyte colony-stimulating factor induces sensorimotor recovery in intracerebral hemorrhage. Brain Res 2005;1041: 125–31. Querfurth HW, LaFerla FM. Alzheimer's disease. N Engl J Med 2010;362:329–44. Rowe A, Eberhard J, Sanchez-Ramos J. Hematopoietic growth factors: novel therapeutic strategy for Alzheimer's disease. Drugs Fut 2009;34:977–89. Salloway S, Mintzer J, Weiner MF, Cummings JL. Disease-modifying therapies in Alzheimer's disease. Alzheimers Dement 2008;4:65–79. Sanchez-Ramos J, Song S, Sava V, Catlow B, Lin X, Mori T, et al. Granulocyte colony stimulating factor decreases brain amyloid burden and reverses cognitive impairment in Alzheimer's mice. Neuroscience 2009;163:55–72. Schabitz WR, Sommer C, Zoder W, Kiessling M, Schwaninger M, Schwab S. Intravenous brain-derived neurotrophic factor reduces infarct size and counterregulates Bax and Bcl-2 expression after temporary focal cerebral ischemia. Stroke 2000;31: 2212–7. Seyfried D, Ding J, Han Y, Li Y, Chen J, Chopp M. Effects of intravenous administration of human bone marrow stromal cells after intracerebral hemorrhage in rats. J Neurosurg 2006;104:313–8. Seyfried DM, Han Y, Yang D, Ding J, Savant-Bhonsale S, Shukairy MS, et al. Mannitol enhances delivery of marrow stromal cells to the brain after experimental intracerebral hemorrhage. Brain Res 2008;1224:12–9. Shan X, Chang Y, Lin CL. Messenger RNA oxidation is an early event preceding cell death and causes reduced protein expression. FASEB J 2007;21:2753–64. Shankar GM, Li S, Mehta TH, Garcia-Munoz A, Shepardson NE, Smith I, et al. Amyloid-β protein dimers isolated directly from Alzheimer's brains impair synaptic plasticity and memory. Nat Med 2008;14:837–42. Sharma M, Gupta YK. Effect of chronic treatment of melatonin on learning, memory and oxidative deficiencies induced by intracerebroventricular streptozotocin in rats. Pharmacol Biochem Behav 2001a;70:325–31.

A. Prakash et al. / Pharmacology, Biochemistry and Behavior 110 (2013) 46–57 Sharma M, Gupta YK. Intracerebroventricular injection of streptozotocin in rats produces both oxidative stress in the brain and cognitive impairment. Life Sci 2001b;68: 1021–9. Sharma M, Gupta YK. Chronic treatment with transresveratrol prevents intracerebroventricular streptozotocin induced cognitive impairment and oxidative stress in rats. Life Sci 2002;71:2489–98. Smith MA, Casadesus G, Joseph JA, Perry G. Amyloid-beta and tau serve antioxidant functions in the aging and Alzheimer brain. Free Radic Biol Med 2002;33: 1194–9. Sobrino T, Arias S, Pérez-Mato M, Agulla J, Brea D, Rodríguez-Yáñez M, et al. CD34+ progenitor cells likely are involved in the good functional recovery after intracerebral hemorrhage in humans. J Neurosci Res 2011;89:979–85. Solaroglu I, Solaroglu A, Kaptanoglu E, Dede S, Haberal A, Beskonakli E, et al. Erythropoietin prevents ischemia–reperfusion from inducing oxidative damage in fetal rat brain. Childs Nerv Syst 2003;19:19–22. Sprigg N, Bath PM, Zhao L, Willmot MR, Gray LJ, Walker MF, et al. Granulocyte-colonystimulating factor mobilizes bone marrow stem cells in patients with subacute ischemic stroke: the Stem cell Trial of recovery Enhancement after Stroke (STEMS) pilot randomized, controlled trial (ISRCTN 16784092). Stroke 2006;37:2979–83. Stephan A, Laroche S, Davis S. Generation of aggregated beta-amyloid in the rat hippocampus impairs synaptic transmission and plasticity and causes memory deficits. J Neurosci 2001;21:5703–14.

57

Sultana R, Newman S, Mohmmad-Abdul H, Keller JN, Butterfield DA. Protective effect of the xanthate, D609, on Alzheimer's amyloid beta-peptide (1–42)-induced oxidative stress in primary neuronal cells. Free Radic Res 2004;38:449–58. Tuzcu M, Baydas G. Effect of melatonin and vitamin E on diabetes-induced learning and memory impairment in rats. Eur J Pharmacol 2006;537:106–10. Wills ED. Mechanism of lipid peroxide formation in animals. Biochem J 1965;99: 667–76. Yan JJ, Cho JY, Kim HS, Kim KL, Jung JS, Huh SO, et al. Protection against beta-amyloid peptide toxicity in vivo with long-term administration of ferulic acid. Protection against beta-amyloid peptide toxicity in vivo with long-term administration of ferulic acid. Br J Pharmacol 2001;133:89–96. Yoshiyama Y, Kojima A, Ishikawa C, Arai K. Anti-inflammatory action of donepezil ameliorates tau pathology, synaptic loss, and neurodegeneration in a tauopathy mouse model. J Alzheimers Dis 2010;22:295–306. Zhang H, Huang Z, Xu Y, Zhang S. Differentiation and neurological benefit of the mesenchymal stem cells transplanted into the rat brain following intracerebral hemorrhage. Neurol Res 2006;28:104–12. Zhao B, Zhong M, Jin K. Neurogenesis and neurodegenerative diseases in human. Panminerva Med 2008;50:55–64.