- Email: [email protected]
Green Fluorescent Protein-Transgenic Rat: A Tool for Organ Transplantation Research
Biochemical and Biophysical Research Communications 286, 779 –785 (2001) doi:10.1006/bbrc.2001.5452, available online at http://www.idealibrary.com on
Green Fluorescent Protein-Transgenic Rat: A Tool for Organ Transplantation Research Yoji Hakamata,* Kazunori Tahara,* Hiroo Uchida,* Yasunaru Sakuma,* Masahiko Nakamura,* Akihiro Kume,* Takashi Murakami,* Masafumi Takahashi,* Riichi Takahashi,† Masumi Hirabayashi,† Masatsugu Ueda,† Ichiro Miyoshi,‡ Noriyuki Kasai,‡ and Eiji Kobayashi* ,1 *Center for Molecular Medicine, Jichi Medical School, Tochigi, Japan; †YS New Technology Institute, Inc., Tochigi, Japan; and ‡Institute for Animal Experimentation, Tohoku University School of Medicine, Sendai, Japan
Received July 27, 2001
The purpose of this study is to evaluate green fluorescent protein (GFP) transgenic rats for use as a tool for organ transplantation research. The GFP gene construct was designed to express ubiquitously. By flow cytometry, the cells obtained from the bone marrow, spleen, and peripheral blood of the GFP transgenic rats consisted of 77, 91, and 75% GFP-positive cells, respectively. To examine cell migration of GFPpositive cells after organ transplantation, pancreas graft with or without spleen transplantation, heart graft with or without lung transplantation, auxiliary liver and small bowel transplantation were also performed from GFP transgenic rat to LEW (RT1 1) rats under a 2-week course of 0.64 mg/kg tacrolimus administration. GFP-positive donor cells were detected in the fully allogenic LEW rats after organ transplantation. These results showed that GFP transgenic rat is a useful tool for organ transplantation research such as cell migration study after organ transplantation without donor cell staining. © 2001 Academic Press Key Words: transgenic rat; green fluorescent protein; transplantation; donor cell migration; flow cytometry.
Recent progression of medical treatments with organ transplantation has increased the requirement of experimental animals for organ transplantation research, such as a medical research about immunoreactions in whole animal chimeras and a pharmaceutical research for developing immunosuppressives. Donor cell migration to the host has been demonstrated both clinically and experimentally (1, 2). Numerous studies
about micro and macro chimerism after cell migration in graft tolerance have been done (1–9). Research and development of reliable immunosuppressives is indispensable to spread organ transplantation in medical treatments. In these studies, cell lineage analysis in whole animals is very important. Therefore, these animals are also required to have an easy and reliable marker to identify subpopulations of the donor migrating cells. Transgenic animal technology can give the animal a marker to identify its cell lineage by introducing a specific marker gene (10, 11). As green fluorescent protein (GFP), a fluorescent protein derived from the jellyfish, does not require any chemical substrate for visualization, it has been used for cell marking (12). The cells having GFP can be detected by direct visualization. In addition to these cellular criteria, animal size is also important for surgical treatment. Large animals such as pigs and dogs have often been used for organ transplantation research, but they are too expensive and laborious to use in ordinary experiments. Mice are superior experimental animals for daily use and transgenic mice technology has already been developed. But, they are too small to use for surgical experiments. On the other hand, rats are more suitable for organ transplantation examinations due to larger body size than mice and transgenic rats technology has been established (13). In this study, we performed organ transplantation in heart, heart/lung, intestine, liver, pancreas, and pancreas/spleen and examined a donor cell migration with transgenic rats carrying GFP gene designed to express ubiquitously in all cells. This is the first report to use GFP transgenic rats for organ transplantation research.
1
To whom correspondence should be addressed at Divisions of Organ Replacement Research, Animal Transgenic Research, and Molecular Immunology, Center for Molecular Medicine, Jichi Medical School, 3311-1, Yakushiji, Minamikawachi, Kawachi, Tochigi 329-0498, Japan. Fax: ⫹81-285-44-5365. E-mail: [email protected].
MATERIALS AND METHODS Animals. Hemizygous GFP transgenic rats of Wistar rat background (14) were used in this study. The rat carried enhanced green
779
0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
Vol. 286, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. GFP expression patterns in various tissues in GFP Tg rat. Each organ on the right was obtained from GFP Tg rats, whereas those on the left were from normal Wistar rats. Marked expressions of GFP were observed under excitation light (489 nm).
Vol. 286, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Hemogram of peripheral blood in GFP Tg rat. Leukocytes expressed extremely GFP and red blood cells did not express GFP (original magnification, ⫻200; A: visible light; B: excitation light).
fluorescent protein (EGFP) transgene prepared from cDNA fragment of EGFP derived from pEGFP vector (No. 6077-1, Clontech Laboratories, Inc., Palo Alto, CA) and pCXN2 expression vector containing cytomegarovirus enhancer, chicken -actin enhancer–promoter and rabbit -globin poly(A) signal (15). Male GFP transgenic rats were used as donors at the age of 8 to 12 weeks. Normal male LEW rats (RT1 1) originally purchased from Clea Japan (Tokyo, Japan) were used as recipients at the age of 10 to 12 weeks. Fluorescence detection of expressed GFP in tissues of transgenic rats. The GFP transgenic rats were sacrificed at the age of 6 weeks. The expression of GFP gene in various organs was examined using a CCD camera under 489-nm excitation light (fluorescent microscope, MZFL III, Leica). Mononuclear cells obtained from peripheral blood, bone marrow, spleens, and livers were prepared by the method of Ficol gradient and analyzed by flow cytometry system with confocal scanning system (Micro Radiance, Bio-Rad, Japan) as described below. Organ transplantation. Heterotropic heart transplantation (HHT) or heart/lung transplantation (H/LT) was performed in the recipient’s neck using our cuff method (16). Briefly, the en bloc H/L graft was removed from the recipient after ligation of suprahepatic IVC and left supra vena cava. Heart graft alone was donated by ligation of pulmonary artery and vein. Aorta and supra vena cava of the donor heart or heart/lung were connected with the carotid artery and cervical vein of the recipient, respectively. Finally, left pneumonectomy was done in H/LT model. A pancreas/spleen-combined graft
FIG. 3. Hemogram of bone marrow in GFP Tg rat. Immature granulocytes showed a fine fluorescence intensity, while the mature granulocytes had higher GFP expression. Lymphocytes also showed a moderate expression of GFP, but erythroblast did not express GFP (original magnification, ⫻400; A: visible light, Wright–Giemsa staining; B: excitation light; C: composition of A and B).
781
Vol. 286, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
was implanted in the neck of the recipient using a modification on our previous methods (17). Pancreas alone transplantation was conducted by immediate splenectomy after pancreas/spleen transplantation (PST). Liver graft was heterotopically transplanted into abdominal cavity (18, 19). Small bowel intestine was also transplanted into the neck of the recipient (20). Both ends of the graft intestine were exteriorized as stomas. Assessment of the graft rejection. In the case of PST and pancreas transplantation (PT), a diabetic state was initially induced in recipient rats (blood glucose level exceeding more than 300 mg/ml) and graft rejection was determined by reelevation of the blood glucose level. The patency of the heart and heart/lung grafts was confirmed daily by cardiac palpitation and the stomas of the intestinal grafts were also checked daily. The rejections were recorded daily and were defined as occurring when the heart graft stopped beating and the stomas closed. The rejection of the auxiliary liver graft was confirmed by repeated laparotomy. Finally, all grafts were examined histologically. Assessment of donor cell migration. Flow cytometry analysis was performed as follows: rat peripheral blood was drawn from GFP transgenic rats and the recipients with GFP expressing organs, and the red blood cells were lysed with ACK Buffer (150 mM NH 4Cl 10 mM KHCO 3, 0.1 mM EDTA). After hemolysis, the cells were analyzed for green fluorescence with a FACScan (Becton-Dickinson, San Jose, CA). In HHT, small bowel transplantation (SBT) and auxiliary liver transplantation (ALT) recipients, mononuclear cells were analyzed for GFP fluorescence. No polynuclear cell (granulocyte) had GFP fluorescence in these animals (data not shown). In PST animals, polynuclear cells were evaluated for GFP fluorescence in addition to mononuclear cells. The GFP gene in these cells was analyzed by PCR. Total DNAs isolated from blood in recipient rats with GFPexpressing graft were analyzed by nested PCR method. Specific primers used for the first PCR were as follows: 5⬘CCTACGGCAAGCTGACCCTGAAGTT3⬘ (sense strand) and 5⬘AGGACCATGTGATCGCGCTTCTCGT3⬘ (antisense strand). Primers for nested PCR were as follows; 5⬘CTACCCCGACCACATGAAGCAGCAC3⬘ (sense strand), 5⬘GTACTCCAGCTTGTGCCCCAGGATG3⬘ (antisense strand). The housekeeping gene glyceraldehydes-3-phosphate dehydrogenase (GAPDH) gene was used as internal control in each DNA sample. The GAPDH specific oligonucleotide primers used were as follows: 5⬘TTCAACGGCACAGTCAAG3⬘ (sense strand), 5⬘CACACCCATCACAAACAT3⬘ (antisense strand). PCR performed in a 50 l reaction mixture containing 3 mM MgCl 2, 50 mM Tris-HCl (pH 8.3), 0.25 mg/ml BSA, 0.25 mM of dNTPs, 0.5 mM of each primer, 0.025 unit of the Z-Taq DNA polymerase (TaKaRa Shuzo Co., Kyoto, Japan), and 0.5 g of whole blood DNA. Thirty-five cycles of PCR, each consisting of 15 s at 94°C, 15 s at 55°C, and 15 s at 72°C, were performed. For the nested PCR 1/50 (v/v) of the first PCR mixture was used as template DNA. The size of the PCR products was determined by 2% agarose gel electrophoresis, and the products were stained using ethidium bromide. Tacrolimus administration. To prevent graft rejection, 0.64 mg/kg of tacrolimus was intramuscularly injected from day 0 to day 13 after organ transplantation. Tacrolimus was kindly gifted by the Fujisawa Pharmaceutical Co. (Osaka, Japan).
FIG. 4. Flow-cytometrical pattern of peripheral blood cells in GFP Tg and normal rat. More than 75% GFP-positive cells of leukocytes were observed in peripheral blood: GFP Tg rat (■), normal rat (䊐).
them under excitation light. The green fluorescence of GFP was also detected in various organs and cells of adult transgenic rat (Fig. 1). The greatest degree of fluorescent intensity was observed in muscle and pancreatic tissue. Moderate fluorescent of GFP was observed in heart and lung tissues, but fluorescence was not observed in liver under the excitation light. Characteristically, marked expression of GFP was observed in the smeared preparation of peripheral blood and bone marrow. GFP-positive cells were detected under ultraviolet irradiation without any cell-staining procedures (Figs. 2 and 3). The GFP-positive cell had two peaks by flow cytometric analysis (Fig. 4), 102 to 103 and 103 to 104 under fluorescence intensity (FL1-H), and seemed to be lymphocytes and granulocytes, respectively. The percentages of GFP-positive cells obtained from bone marrow, peripheral blood, and spleen were 76.9, 75.0, and 91.3%, respectively. However, the mononuclear cells obtained from liver consisted of less than 0.2% GFP-positive cells. Donor Cell Detection in H/LT, SBT, and PST, but Not in HHT, PT, nor ALT
RESULTS GFP Expression in Organs and Cells in Transgenic Rats GFP gene introduced in rat was expressed almost ubiquitously in organs and cells. Whole body of the transgenic rats fluoresced a green fluorescence and could be easily detected at newborn stage by placing
Graft of GFP expressing organ in pancreas, pancreas/spleen, heart, heart/lung, liver and small bowel was transplanted into LEW rats under a high dose of tacrolimus. Donor cell migration in peripheral blood was estimated by the methods of PCR and flow cytometry. The survival period of graft in PST was
782
Vol. 286, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS TABLE 1
Prolongation of the Graft Survival of GFP Tg-Pancreas/Spleen, Heart/Lung, Liver and Intestine Wistar Grafts by Tacrolimus Administration and GFP-Positive “Cell” Migration after Transplantation in LEW Rats GFP positive cells (%) Procedure
n
Graft survival (days)
Pancreas Pancreas/spleen Heart Heart/Lung Liver Intestine
4 4 4 4 3 4
10, 21, 21, 21 7, 10, 30, 40 61, 64, ⬎100, ⬎100 7, 8, 40, 72 21, 28, ⬎21 55, 57, 58, 65
Days after Tx
7
14
21
0.41 6.24 a 0.00 1.68 0.14 1.04
0.22 3.30 a 0.00 1.64 0.06 1.47
0.41 10.48 a 0.00 1.58 0.01 0.56
Note. Percentage of mononuclear cells of peripheral blood in recipient is shown as mean. a Data represent total of mononuclear plus polynuclear cells.
longer than that of PT alone and a massive number of GFP-positive cells migrated in the LEW recipients of the PST model compared with that in PT alone (Table 1). Increase in the GFP-positive cells was due to polynuclear cells (Fig. 5). The heart of GFP transgenic Wistar rats survived more than 100 days after a short course treatment of tacrolimus administration. GFP-positive cells in the peripheral blood were not detected in heart graft alone
by flow cytometry, but GFP-positive cells were detected in all grafting models with PCR analysis (Fig. 6). While heart/lung graft induced a GFP positive cell migration, survival of graft in H/LT was shorter than that of HHT. In ALT model, GFP-positive cells were very few. In the SBT experiment, GFP-positive cells gradually increased to 1.47% at 2 weeks and maintained 0.5 to 2% levels under tacrolimus treatment. However, GFPpositive cells decreased in 0.01% in 6 weeks after SBT.
FIG. 5. A typical flow-cytometrical pattern of GFP-positive cells in peripheral blood cells after PT, PST, HHT, H/LT, ALT, and SBT at day 7 under a high dose of tacrolimus. Data indicate percentage of the GFP-positive cells in recipient rat. PT, PST-1, HHT, H/LT, ALT, and SBT panels show the mononuclear cell pattern; PST-2 indicates the polynuclear cell pattern. Number of polynuclear cells in the PST model increased alone.
783
Vol. 286, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 6. Detection of the GFP gene using PCR. GFP-positive cells were detected in peripheral blood cells of recipient rats after various organ transplantation at day 7: PT (lane 1), PST (lane 2), HHT (lane 3), H/LT (lane 4), ALT (lane 5), SBT (lane 6), negative control (lane 7). The GAPDH gene also was amplified as internal controls from DNA.
All GFP expressing intestinal grafts were finally rejected (data not shown). DISCUSSION Progression of medical treatments with organ transplantation has increased the importance for developing a suitable experimental animal for research work. GFP is a fluorescent protein and require no chemical substrate for visualization. Thereby organs and cells marked with GFP can be detected easily and reliably and are considered to be very useful for a migration study after organ transplantation (10, 11, 21, 22). With the development of microsurgery and molecular biology during 1990s, the mouse model for organ transplantation has been a subject for much interest (23, 24). Despite the recent enthusiasm for the mouse organ transplantation models, mouse is too small for surgical treatments and there are limitations to use mice for organ transplantation research except for the heart transplantation (19). Extremely high level of microsurgical skills is required to perform transplants in mice. Rat is ten times larger than mice in body size and can be acceptable for organ transplantation research (25). Further, rats are very economical than large animals such as dogs and pigs to use usual experiments. In this study, we have estimated GFP transgenic rats as a tool for organ transplantation research. The GFP gene introduced in rats was expressed ubiquitously and green fluorescence was detected directly in various organs and cells with a few exceptions of hair, red blood cells and liver. The expression pattern of GFP transgenic rats is similar to GFP transgenic mice carrying same transgene (12, 26) except a few points. Mononuclear cells obtained from bone marrow, peripheral blood and spleen were highly marked (77–93%) and considered to be useful for cell lineage study after organ transplantation. Because of easy experimental procedures, we introduced GFP transgene into outbred Wistar strain in this study. However, we successfully implanted various organs from GFP transgenic Wistar rat in LEW
rat under a high dose of tacrolimus immunosuppressives. A large number of GFP-positive cells were detected by flow cytometry without staining in the pancreas/spleen, heart/lung and small intestine grafts. While migration of GFP-positive cells were hardly detected by flow cytometry in the case of heart, pancreas and liver grafts, the donor cells migrated in peripheral blood of recipients after organ transplantation were detected by the nested PCR. For strict examinations, we have now been developing GFP transgenic rat with inbred strain. The survival in PST model with increase in polynuclear cells prolonged compared with that in PT alone model. In the other hands, the survival in H/LT model did not prolong than that of HHT model, though large number of donor cell in the recipient is kept at early stage after the transplantation. The number of donor cells is depended on each graft, while the quality of passenger leukocyte is often different among the grafted organ. Further studies need to elucidate characteristics of migrating donor cells after each organ transplantation (submitted). This is the first report about organ transplantation with GFP transgenic rats and preliminary results about cell migration after organ transplantation support the conclusion that GFP transgenic rat is useful tool for organ transplantation research. ACKNOWLEDGMENT We thank Dr. Furukawa (Center for Molecular Medicine, Jichi Medical School, Tochigi, Japan) for the morphological study of GFP expressed cells.
REFERENCES
784
1. Demetris, A. J., Murase, N., and Starzl, T. E. (1992) Donor dendritic cell after liver and heart allotransplantation under short-term immunosuppression. Lancet 339, 1610. 2. Starzl, T. E., Demetris, A. J., Trucco, M., Ramos, H., Zeevi, A., Rudert, W. A., Kocova, M., Ricordi, C., Ildstad, S., and Murase, N. (1992) Systemic chimerism in human female recipients of male livers. Lancet 340, 876 – 877. 3. Starzl, T. E., Demetris, A. J., Murase, N., Thomson, A. W., Trucco, M., and Ricordi, C. (1993) Donor cell chimerism permitted by immunosuppressive drugs: A new view of organ transplantation. Immunol. Today 14, 326 –332. 4. Kobayashi, E., Kamada, N., Delriviere, L., Lord, R., Goto, S., Walker, N. I., Enosawa, S., and Miyata, M. (1995) Migration of donor cell into the thymus is not essential for induction and maintenance of systemic tolerance after liver transplantation in the rat. Immunology 84, 333–336. 5. Starzl, T. E., Demetris, A. J., Murase, N., Trucco, M., Thomson, A. W., and Rao, A. S. (1996) The lost chord: Microchimerism and allograft survival. Immunol. Today 17, 577–584. 6. Hisanaga, M., Hundrieser, J., Boker, K., Uthoff, K., Raddatz, G., Wahlers, T., Wonigeit, K., Pichlmayr, R., and Schlitt, H. J. (1996) Development, stability, and clinical correlation of allogenic mi-
Vol. 286, No. 4, 2001
7.
8.
9.
10.
11.
12.
13. 14.
15.
16.
17.
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
crochimerism after solid organ transplantation. Transplantation 61, 40 – 45. McSherry, C., Jackson, A., Hertz, M. I., Bolman, R. M., 3rd, Savik, K., and Reinsmoen, N. L. (1996) Sequential measurement of peripheral blood allogenic microchimerism levels and association with pulmonary function. Transplantation 62, 1811–1818. Ko, S., Deiwick, A., Jager, M. D., Dinkel, A., Rohde, F., Fischer, R., Tsui, T. Y., Rittmann, K. L., Wonigeit, K., and Schlitt, H. J. (1999) The functional relevance of passenger leukocytes and microchimerism for heart allograft acceptance in the rat. Nat. Med. 5, 1292–1297. Curcio, M., Mosca, M., Lapi, S., Filipponi, F., Mosca, F., Italia, S., and Rizzo, G. (2000) Usefulness of direct sequencing in the detection of microchimerism in liver transplant recipients. Transplantation 69, 191. Kisseberth, W. C., Brettingen, N. T., Lohse, J. K., and Sandgren, E. P. (1999) Ubiquitous expression of marker transgenes in mice and rats. Dev. Biol. 214, 128 –138. Tashiro, Y., Miyahara, M., Shirasaki, R., Okabe, M., Heizmann, C. W., and Murakami, F. (2001) Local nonpermissive and oriented permissive cues guide vestibular axons to the cerebellum. Development 128, 973–981. Okabe, M., Ikawa, M., Kominami, K., Nakanishi, T., and Nishimune, Y. (1997) “Green mice” as a source of ubiquitous green cells. FEBS Lett. 407, 313–319. Hochi, S., Ninomiya, T., Honma, M., and Yuki, A. (1990) Successful production of transgenic rats. Anim. Biotechnol. 1, 175–184. Hirabayashi, M., Kato, M., Aoto, M., Sekimoto, A., Ueda, M., Miyoshi, I., Kasai, N., and Hochi, S. (2001) Offspring derived from intracytoplasmic injection of transgenic rat sperm. Transgenic Res., in press. Niwa, H., Yamamura, K., and Miyazaki, J. (1991) Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108, 193–200. Uchida, H., Kobayashi, E., Matsuda, K., Mizuta, K., Sugimoto, K., Kawarasaki, H., Hashizume, K., and Fujimura, A. (1999) Chronopharmacology for deoxyspergualin: Toxicity and efficacy in the rat. Transplantation 67, 1269 –1274. Kobayashi, E., Favila-Castillo, L., and Kamada, N. (1996) Anti-
18.
19.
20.
21.
22.
23.
24.
25. 26.
785
body formation in the transplanted spleen in the rat: A simple method of splenic transplantation in the rat using the cuff technique. Microsurgery 17, 221–225. Kobayashi, E., Yoshida, Y., Nozawa, M., Hishikawa, S., Yamanaka, T., Miyata, M., and Fujimura, A. (1998) Auxiliary heterotopic liver transplantation in rat. A simplified model using cuff technique and application for congenitally hyperbilirubimemic gun rat. Microsurgery 18, 97–102. Kobayashi, E. (1998) Orthotopic liver transplantation in the rat: Survival relationship between different strain combinations. In Organ Transplantation in Rats and Mice (Timmermann, W., Gassel, H. J., Ulrichs, K., Zhong, R., and Thiede, A., Eds.), pp. 527–535, Springer-Verlag, Berlin/Heidelberg/New York. Yoshida, T., Uchida, H., Kobayashi, E., Fujimura, A., and Miyata, M. (1999) Experimental small bowel transplantation using newborn intestine in rats: Some immunological studies and considerations for immunological advantage. Jpn. J. Transplant. 34, 165–173. Kawakami, N., Sakane, N., Nishizawa, F., Iwao, M., Fukada, S. I., Tsujikawa, K., Kohama, Y., Ikawa, M., Okabe, M., and Yamamoto, H. (1999) Green fluorescent protein-transgenic mice: Immune functions and their application to studies of lymphocyte development. Immunol. Lett. 70, 165–171. Ono, K., Takii, T., Onozaki, K., Ikawa, M., Okabe, M., and Sawada, M. (1999) Migration of exogenous immature hematopoietic cells in to adult mouse brain parenchyma under GFPexpressing bone marrow chimera. Biochem. Biophys. Res. Commun. 262, 610 – 614. Qian, S. G., Fung, J. J., Demetris, A. V., Ildstad, S. T., and Starzl, T. E. (1991) Orthotopic liver transplantation in the mouse. Transplantation 52, 562–564. Zhong, R., Zhang, Z., Quan, D., Garcia, B., Duff, J., Stiller, C., and Grant, D. (1993) Intestinal transplantation in the mouse. Transplantation 56, 1034 –1037. Gill, T. J., 3rd, Smith, G. J., Wissler, R. W., and Kunz, H. W. (1989) The rat as an experimental animal. Science 245, 269 –276. Ikawa, M., Yamada, S., Nakanishi, T., and Okabe, M. (1998) “Green mice” and their potential usage in biological research. FEBS Lett. 430, 83– 87.
Green Fluorescent Protein-Transgenic Rat: A Tool for Organ Transplantation Research Yoji Hakamata,* Kazunori Tahara,* Hiroo Uchida,* Yasunaru Sakuma,* Masahiko Nakamura,* Akihiro Kume,* Takashi Murakami,* Masafumi Takahashi,* Riichi Takahashi,† Masumi Hirabayashi,† Masatsugu Ueda,† Ichiro Miyoshi,‡ Noriyuki Kasai,‡ and Eiji Kobayashi* ,1 *Center for Molecular Medicine, Jichi Medical School, Tochigi, Japan; †YS New Technology Institute, Inc., Tochigi, Japan; and ‡Institute for Animal Experimentation, Tohoku University School of Medicine, Sendai, Japan
Received July 27, 2001
The purpose of this study is to evaluate green fluorescent protein (GFP) transgenic rats for use as a tool for organ transplantation research. The GFP gene construct was designed to express ubiquitously. By flow cytometry, the cells obtained from the bone marrow, spleen, and peripheral blood of the GFP transgenic rats consisted of 77, 91, and 75% GFP-positive cells, respectively. To examine cell migration of GFPpositive cells after organ transplantation, pancreas graft with or without spleen transplantation, heart graft with or without lung transplantation, auxiliary liver and small bowel transplantation were also performed from GFP transgenic rat to LEW (RT1 1) rats under a 2-week course of 0.64 mg/kg tacrolimus administration. GFP-positive donor cells were detected in the fully allogenic LEW rats after organ transplantation. These results showed that GFP transgenic rat is a useful tool for organ transplantation research such as cell migration study after organ transplantation without donor cell staining. © 2001 Academic Press Key Words: transgenic rat; green fluorescent protein; transplantation; donor cell migration; flow cytometry.
Recent progression of medical treatments with organ transplantation has increased the requirement of experimental animals for organ transplantation research, such as a medical research about immunoreactions in whole animal chimeras and a pharmaceutical research for developing immunosuppressives. Donor cell migration to the host has been demonstrated both clinically and experimentally (1, 2). Numerous studies
about micro and macro chimerism after cell migration in graft tolerance have been done (1–9). Research and development of reliable immunosuppressives is indispensable to spread organ transplantation in medical treatments. In these studies, cell lineage analysis in whole animals is very important. Therefore, these animals are also required to have an easy and reliable marker to identify subpopulations of the donor migrating cells. Transgenic animal technology can give the animal a marker to identify its cell lineage by introducing a specific marker gene (10, 11). As green fluorescent protein (GFP), a fluorescent protein derived from the jellyfish, does not require any chemical substrate for visualization, it has been used for cell marking (12). The cells having GFP can be detected by direct visualization. In addition to these cellular criteria, animal size is also important for surgical treatment. Large animals such as pigs and dogs have often been used for organ transplantation research, but they are too expensive and laborious to use in ordinary experiments. Mice are superior experimental animals for daily use and transgenic mice technology has already been developed. But, they are too small to use for surgical experiments. On the other hand, rats are more suitable for organ transplantation examinations due to larger body size than mice and transgenic rats technology has been established (13). In this study, we performed organ transplantation in heart, heart/lung, intestine, liver, pancreas, and pancreas/spleen and examined a donor cell migration with transgenic rats carrying GFP gene designed to express ubiquitously in all cells. This is the first report to use GFP transgenic rats for organ transplantation research.
1
To whom correspondence should be addressed at Divisions of Organ Replacement Research, Animal Transgenic Research, and Molecular Immunology, Center for Molecular Medicine, Jichi Medical School, 3311-1, Yakushiji, Minamikawachi, Kawachi, Tochigi 329-0498, Japan. Fax: ⫹81-285-44-5365. E-mail: [email protected].
MATERIALS AND METHODS Animals. Hemizygous GFP transgenic rats of Wistar rat background (14) were used in this study. The rat carried enhanced green
779
0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
Vol. 286, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. GFP expression patterns in various tissues in GFP Tg rat. Each organ on the right was obtained from GFP Tg rats, whereas those on the left were from normal Wistar rats. Marked expressions of GFP were observed under excitation light (489 nm).
Vol. 286, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Hemogram of peripheral blood in GFP Tg rat. Leukocytes expressed extremely GFP and red blood cells did not express GFP (original magnification, ⫻200; A: visible light; B: excitation light).
fluorescent protein (EGFP) transgene prepared from cDNA fragment of EGFP derived from pEGFP vector (No. 6077-1, Clontech Laboratories, Inc., Palo Alto, CA) and pCXN2 expression vector containing cytomegarovirus enhancer, chicken -actin enhancer–promoter and rabbit -globin poly(A) signal (15). Male GFP transgenic rats were used as donors at the age of 8 to 12 weeks. Normal male LEW rats (RT1 1) originally purchased from Clea Japan (Tokyo, Japan) were used as recipients at the age of 10 to 12 weeks. Fluorescence detection of expressed GFP in tissues of transgenic rats. The GFP transgenic rats were sacrificed at the age of 6 weeks. The expression of GFP gene in various organs was examined using a CCD camera under 489-nm excitation light (fluorescent microscope, MZFL III, Leica). Mononuclear cells obtained from peripheral blood, bone marrow, spleens, and livers were prepared by the method of Ficol gradient and analyzed by flow cytometry system with confocal scanning system (Micro Radiance, Bio-Rad, Japan) as described below. Organ transplantation. Heterotropic heart transplantation (HHT) or heart/lung transplantation (H/LT) was performed in the recipient’s neck using our cuff method (16). Briefly, the en bloc H/L graft was removed from the recipient after ligation of suprahepatic IVC and left supra vena cava. Heart graft alone was donated by ligation of pulmonary artery and vein. Aorta and supra vena cava of the donor heart or heart/lung were connected with the carotid artery and cervical vein of the recipient, respectively. Finally, left pneumonectomy was done in H/LT model. A pancreas/spleen-combined graft
FIG. 3. Hemogram of bone marrow in GFP Tg rat. Immature granulocytes showed a fine fluorescence intensity, while the mature granulocytes had higher GFP expression. Lymphocytes also showed a moderate expression of GFP, but erythroblast did not express GFP (original magnification, ⫻400; A: visible light, Wright–Giemsa staining; B: excitation light; C: composition of A and B).
781
Vol. 286, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
was implanted in the neck of the recipient using a modification on our previous methods (17). Pancreas alone transplantation was conducted by immediate splenectomy after pancreas/spleen transplantation (PST). Liver graft was heterotopically transplanted into abdominal cavity (18, 19). Small bowel intestine was also transplanted into the neck of the recipient (20). Both ends of the graft intestine were exteriorized as stomas. Assessment of the graft rejection. In the case of PST and pancreas transplantation (PT), a diabetic state was initially induced in recipient rats (blood glucose level exceeding more than 300 mg/ml) and graft rejection was determined by reelevation of the blood glucose level. The patency of the heart and heart/lung grafts was confirmed daily by cardiac palpitation and the stomas of the intestinal grafts were also checked daily. The rejections were recorded daily and were defined as occurring when the heart graft stopped beating and the stomas closed. The rejection of the auxiliary liver graft was confirmed by repeated laparotomy. Finally, all grafts were examined histologically. Assessment of donor cell migration. Flow cytometry analysis was performed as follows: rat peripheral blood was drawn from GFP transgenic rats and the recipients with GFP expressing organs, and the red blood cells were lysed with ACK Buffer (150 mM NH 4Cl 10 mM KHCO 3, 0.1 mM EDTA). After hemolysis, the cells were analyzed for green fluorescence with a FACScan (Becton-Dickinson, San Jose, CA). In HHT, small bowel transplantation (SBT) and auxiliary liver transplantation (ALT) recipients, mononuclear cells were analyzed for GFP fluorescence. No polynuclear cell (granulocyte) had GFP fluorescence in these animals (data not shown). In PST animals, polynuclear cells were evaluated for GFP fluorescence in addition to mononuclear cells. The GFP gene in these cells was analyzed by PCR. Total DNAs isolated from blood in recipient rats with GFPexpressing graft were analyzed by nested PCR method. Specific primers used for the first PCR were as follows: 5⬘CCTACGGCAAGCTGACCCTGAAGTT3⬘ (sense strand) and 5⬘AGGACCATGTGATCGCGCTTCTCGT3⬘ (antisense strand). Primers for nested PCR were as follows; 5⬘CTACCCCGACCACATGAAGCAGCAC3⬘ (sense strand), 5⬘GTACTCCAGCTTGTGCCCCAGGATG3⬘ (antisense strand). The housekeeping gene glyceraldehydes-3-phosphate dehydrogenase (GAPDH) gene was used as internal control in each DNA sample. The GAPDH specific oligonucleotide primers used were as follows: 5⬘TTCAACGGCACAGTCAAG3⬘ (sense strand), 5⬘CACACCCATCACAAACAT3⬘ (antisense strand). PCR performed in a 50 l reaction mixture containing 3 mM MgCl 2, 50 mM Tris-HCl (pH 8.3), 0.25 mg/ml BSA, 0.25 mM of dNTPs, 0.5 mM of each primer, 0.025 unit of the Z-Taq DNA polymerase (TaKaRa Shuzo Co., Kyoto, Japan), and 0.5 g of whole blood DNA. Thirty-five cycles of PCR, each consisting of 15 s at 94°C, 15 s at 55°C, and 15 s at 72°C, were performed. For the nested PCR 1/50 (v/v) of the first PCR mixture was used as template DNA. The size of the PCR products was determined by 2% agarose gel electrophoresis, and the products were stained using ethidium bromide. Tacrolimus administration. To prevent graft rejection, 0.64 mg/kg of tacrolimus was intramuscularly injected from day 0 to day 13 after organ transplantation. Tacrolimus was kindly gifted by the Fujisawa Pharmaceutical Co. (Osaka, Japan).
FIG. 4. Flow-cytometrical pattern of peripheral blood cells in GFP Tg and normal rat. More than 75% GFP-positive cells of leukocytes were observed in peripheral blood: GFP Tg rat (■), normal rat (䊐).
them under excitation light. The green fluorescence of GFP was also detected in various organs and cells of adult transgenic rat (Fig. 1). The greatest degree of fluorescent intensity was observed in muscle and pancreatic tissue. Moderate fluorescent of GFP was observed in heart and lung tissues, but fluorescence was not observed in liver under the excitation light. Characteristically, marked expression of GFP was observed in the smeared preparation of peripheral blood and bone marrow. GFP-positive cells were detected under ultraviolet irradiation without any cell-staining procedures (Figs. 2 and 3). The GFP-positive cell had two peaks by flow cytometric analysis (Fig. 4), 102 to 103 and 103 to 104 under fluorescence intensity (FL1-H), and seemed to be lymphocytes and granulocytes, respectively. The percentages of GFP-positive cells obtained from bone marrow, peripheral blood, and spleen were 76.9, 75.0, and 91.3%, respectively. However, the mononuclear cells obtained from liver consisted of less than 0.2% GFP-positive cells. Donor Cell Detection in H/LT, SBT, and PST, but Not in HHT, PT, nor ALT
RESULTS GFP Expression in Organs and Cells in Transgenic Rats GFP gene introduced in rat was expressed almost ubiquitously in organs and cells. Whole body of the transgenic rats fluoresced a green fluorescence and could be easily detected at newborn stage by placing
Graft of GFP expressing organ in pancreas, pancreas/spleen, heart, heart/lung, liver and small bowel was transplanted into LEW rats under a high dose of tacrolimus. Donor cell migration in peripheral blood was estimated by the methods of PCR and flow cytometry. The survival period of graft in PST was
782
Vol. 286, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS TABLE 1
Prolongation of the Graft Survival of GFP Tg-Pancreas/Spleen, Heart/Lung, Liver and Intestine Wistar Grafts by Tacrolimus Administration and GFP-Positive “Cell” Migration after Transplantation in LEW Rats GFP positive cells (%) Procedure
n
Graft survival (days)
Pancreas Pancreas/spleen Heart Heart/Lung Liver Intestine
4 4 4 4 3 4
10, 21, 21, 21 7, 10, 30, 40 61, 64, ⬎100, ⬎100 7, 8, 40, 72 21, 28, ⬎21 55, 57, 58, 65
Days after Tx
7
14
21
0.41 6.24 a 0.00 1.68 0.14 1.04
0.22 3.30 a 0.00 1.64 0.06 1.47
0.41 10.48 a 0.00 1.58 0.01 0.56
Note. Percentage of mononuclear cells of peripheral blood in recipient is shown as mean. a Data represent total of mononuclear plus polynuclear cells.
longer than that of PT alone and a massive number of GFP-positive cells migrated in the LEW recipients of the PST model compared with that in PT alone (Table 1). Increase in the GFP-positive cells was due to polynuclear cells (Fig. 5). The heart of GFP transgenic Wistar rats survived more than 100 days after a short course treatment of tacrolimus administration. GFP-positive cells in the peripheral blood were not detected in heart graft alone
by flow cytometry, but GFP-positive cells were detected in all grafting models with PCR analysis (Fig. 6). While heart/lung graft induced a GFP positive cell migration, survival of graft in H/LT was shorter than that of HHT. In ALT model, GFP-positive cells were very few. In the SBT experiment, GFP-positive cells gradually increased to 1.47% at 2 weeks and maintained 0.5 to 2% levels under tacrolimus treatment. However, GFPpositive cells decreased in 0.01% in 6 weeks after SBT.
FIG. 5. A typical flow-cytometrical pattern of GFP-positive cells in peripheral blood cells after PT, PST, HHT, H/LT, ALT, and SBT at day 7 under a high dose of tacrolimus. Data indicate percentage of the GFP-positive cells in recipient rat. PT, PST-1, HHT, H/LT, ALT, and SBT panels show the mononuclear cell pattern; PST-2 indicates the polynuclear cell pattern. Number of polynuclear cells in the PST model increased alone.
783
Vol. 286, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 6. Detection of the GFP gene using PCR. GFP-positive cells were detected in peripheral blood cells of recipient rats after various organ transplantation at day 7: PT (lane 1), PST (lane 2), HHT (lane 3), H/LT (lane 4), ALT (lane 5), SBT (lane 6), negative control (lane 7). The GAPDH gene also was amplified as internal controls from DNA.
All GFP expressing intestinal grafts were finally rejected (data not shown). DISCUSSION Progression of medical treatments with organ transplantation has increased the importance for developing a suitable experimental animal for research work. GFP is a fluorescent protein and require no chemical substrate for visualization. Thereby organs and cells marked with GFP can be detected easily and reliably and are considered to be very useful for a migration study after organ transplantation (10, 11, 21, 22). With the development of microsurgery and molecular biology during 1990s, the mouse model for organ transplantation has been a subject for much interest (23, 24). Despite the recent enthusiasm for the mouse organ transplantation models, mouse is too small for surgical treatments and there are limitations to use mice for organ transplantation research except for the heart transplantation (19). Extremely high level of microsurgical skills is required to perform transplants in mice. Rat is ten times larger than mice in body size and can be acceptable for organ transplantation research (25). Further, rats are very economical than large animals such as dogs and pigs to use usual experiments. In this study, we have estimated GFP transgenic rats as a tool for organ transplantation research. The GFP gene introduced in rats was expressed ubiquitously and green fluorescence was detected directly in various organs and cells with a few exceptions of hair, red blood cells and liver. The expression pattern of GFP transgenic rats is similar to GFP transgenic mice carrying same transgene (12, 26) except a few points. Mononuclear cells obtained from bone marrow, peripheral blood and spleen were highly marked (77–93%) and considered to be useful for cell lineage study after organ transplantation. Because of easy experimental procedures, we introduced GFP transgene into outbred Wistar strain in this study. However, we successfully implanted various organs from GFP transgenic Wistar rat in LEW
rat under a high dose of tacrolimus immunosuppressives. A large number of GFP-positive cells were detected by flow cytometry without staining in the pancreas/spleen, heart/lung and small intestine grafts. While migration of GFP-positive cells were hardly detected by flow cytometry in the case of heart, pancreas and liver grafts, the donor cells migrated in peripheral blood of recipients after organ transplantation were detected by the nested PCR. For strict examinations, we have now been developing GFP transgenic rat with inbred strain. The survival in PST model with increase in polynuclear cells prolonged compared with that in PT alone model. In the other hands, the survival in H/LT model did not prolong than that of HHT model, though large number of donor cell in the recipient is kept at early stage after the transplantation. The number of donor cells is depended on each graft, while the quality of passenger leukocyte is often different among the grafted organ. Further studies need to elucidate characteristics of migrating donor cells after each organ transplantation (submitted). This is the first report about organ transplantation with GFP transgenic rats and preliminary results about cell migration after organ transplantation support the conclusion that GFP transgenic rat is useful tool for organ transplantation research. ACKNOWLEDGMENT We thank Dr. Furukawa (Center for Molecular Medicine, Jichi Medical School, Tochigi, Japan) for the morphological study of GFP expressed cells.
REFERENCES
784
1. Demetris, A. J., Murase, N., and Starzl, T. E. (1992) Donor dendritic cell after liver and heart allotransplantation under short-term immunosuppression. Lancet 339, 1610. 2. Starzl, T. E., Demetris, A. J., Trucco, M., Ramos, H., Zeevi, A., Rudert, W. A., Kocova, M., Ricordi, C., Ildstad, S., and Murase, N. (1992) Systemic chimerism in human female recipients of male livers. Lancet 340, 876 – 877. 3. Starzl, T. E., Demetris, A. J., Murase, N., Thomson, A. W., Trucco, M., and Ricordi, C. (1993) Donor cell chimerism permitted by immunosuppressive drugs: A new view of organ transplantation. Immunol. Today 14, 326 –332. 4. Kobayashi, E., Kamada, N., Delriviere, L., Lord, R., Goto, S., Walker, N. I., Enosawa, S., and Miyata, M. (1995) Migration of donor cell into the thymus is not essential for induction and maintenance of systemic tolerance after liver transplantation in the rat. Immunology 84, 333–336. 5. Starzl, T. E., Demetris, A. J., Murase, N., Trucco, M., Thomson, A. W., and Rao, A. S. (1996) The lost chord: Microchimerism and allograft survival. Immunol. Today 17, 577–584. 6. Hisanaga, M., Hundrieser, J., Boker, K., Uthoff, K., Raddatz, G., Wahlers, T., Wonigeit, K., Pichlmayr, R., and Schlitt, H. J. (1996) Development, stability, and clinical correlation of allogenic mi-
Vol. 286, No. 4, 2001
7.
8.
9.
10.
11.
12.
13. 14.
15.
16.
17.
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
crochimerism after solid organ transplantation. Transplantation 61, 40 – 45. McSherry, C., Jackson, A., Hertz, M. I., Bolman, R. M., 3rd, Savik, K., and Reinsmoen, N. L. (1996) Sequential measurement of peripheral blood allogenic microchimerism levels and association with pulmonary function. Transplantation 62, 1811–1818. Ko, S., Deiwick, A., Jager, M. D., Dinkel, A., Rohde, F., Fischer, R., Tsui, T. Y., Rittmann, K. L., Wonigeit, K., and Schlitt, H. J. (1999) The functional relevance of passenger leukocytes and microchimerism for heart allograft acceptance in the rat. Nat. Med. 5, 1292–1297. Curcio, M., Mosca, M., Lapi, S., Filipponi, F., Mosca, F., Italia, S., and Rizzo, G. (2000) Usefulness of direct sequencing in the detection of microchimerism in liver transplant recipients. Transplantation 69, 191. Kisseberth, W. C., Brettingen, N. T., Lohse, J. K., and Sandgren, E. P. (1999) Ubiquitous expression of marker transgenes in mice and rats. Dev. Biol. 214, 128 –138. Tashiro, Y., Miyahara, M., Shirasaki, R., Okabe, M., Heizmann, C. W., and Murakami, F. (2001) Local nonpermissive and oriented permissive cues guide vestibular axons to the cerebellum. Development 128, 973–981. Okabe, M., Ikawa, M., Kominami, K., Nakanishi, T., and Nishimune, Y. (1997) “Green mice” as a source of ubiquitous green cells. FEBS Lett. 407, 313–319. Hochi, S., Ninomiya, T., Honma, M., and Yuki, A. (1990) Successful production of transgenic rats. Anim. Biotechnol. 1, 175–184. Hirabayashi, M., Kato, M., Aoto, M., Sekimoto, A., Ueda, M., Miyoshi, I., Kasai, N., and Hochi, S. (2001) Offspring derived from intracytoplasmic injection of transgenic rat sperm. Transgenic Res., in press. Niwa, H., Yamamura, K., and Miyazaki, J. (1991) Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108, 193–200. Uchida, H., Kobayashi, E., Matsuda, K., Mizuta, K., Sugimoto, K., Kawarasaki, H., Hashizume, K., and Fujimura, A. (1999) Chronopharmacology for deoxyspergualin: Toxicity and efficacy in the rat. Transplantation 67, 1269 –1274. Kobayashi, E., Favila-Castillo, L., and Kamada, N. (1996) Anti-
18.
19.
20.
21.
22.
23.
24.
25. 26.
785
body formation in the transplanted spleen in the rat: A simple method of splenic transplantation in the rat using the cuff technique. Microsurgery 17, 221–225. Kobayashi, E., Yoshida, Y., Nozawa, M., Hishikawa, S., Yamanaka, T., Miyata, M., and Fujimura, A. (1998) Auxiliary heterotopic liver transplantation in rat. A simplified model using cuff technique and application for congenitally hyperbilirubimemic gun rat. Microsurgery 18, 97–102. Kobayashi, E. (1998) Orthotopic liver transplantation in the rat: Survival relationship between different strain combinations. In Organ Transplantation in Rats and Mice (Timmermann, W., Gassel, H. J., Ulrichs, K., Zhong, R., and Thiede, A., Eds.), pp. 527–535, Springer-Verlag, Berlin/Heidelberg/New York. Yoshida, T., Uchida, H., Kobayashi, E., Fujimura, A., and Miyata, M. (1999) Experimental small bowel transplantation using newborn intestine in rats: Some immunological studies and considerations for immunological advantage. Jpn. J. Transplant. 34, 165–173. Kawakami, N., Sakane, N., Nishizawa, F., Iwao, M., Fukada, S. I., Tsujikawa, K., Kohama, Y., Ikawa, M., Okabe, M., and Yamamoto, H. (1999) Green fluorescent protein-transgenic mice: Immune functions and their application to studies of lymphocyte development. Immunol. Lett. 70, 165–171. Ono, K., Takii, T., Onozaki, K., Ikawa, M., Okabe, M., and Sawada, M. (1999) Migration of exogenous immature hematopoietic cells in to adult mouse brain parenchyma under GFPexpressing bone marrow chimera. Biochem. Biophys. Res. Commun. 262, 610 – 614. Qian, S. G., Fung, J. J., Demetris, A. V., Ildstad, S. T., and Starzl, T. E. (1991) Orthotopic liver transplantation in the mouse. Transplantation 52, 562–564. Zhong, R., Zhang, Z., Quan, D., Garcia, B., Duff, J., Stiller, C., and Grant, D. (1993) Intestinal transplantation in the mouse. Transplantation 56, 1034 –1037. Gill, T. J., 3rd, Smith, G. J., Wissler, R. W., and Kunz, H. W. (1989) The rat as an experimental animal. Science 245, 269 –276. Ikawa, M., Yamada, S., Nakanishi, T., and Okabe, M. (1998) “Green mice” and their potential usage in biological research. FEBS Lett. 430, 83– 87.