Group IV cytosolic phospholipase A2 mediates arachidonic acid release in H9c2 rat cardiomyocyte cells in response to hydrogen peroxide

Prostaglandins & other Lipid Mediators 78 (2005) 55–66

Group IV cytosolic phospholipase A2 mediates arachidonic acid release in H9c2 rat cardiomyocyte cells in response to hydrogen peroxide Michelle V. Winstead, Karin Killermann Lucas, Edward A. Dennis ∗ Department of Chemistry and Biochemistry and Department of Pharmacology, School of Medicine, University of California, San Diego, La Jolla, CA 92093-0601, USA Received 13 December 2004; received in revised form 1 February 2005; accepted 15 March 2005 Available online 31 May 2005

Abstract Damaging reactive oxygen species are released during episodes of ischemia and reperfusion. Some cellular adaptive responses are triggered to protect the injured organ, while other cascades are triggered which potentiate the damage. In these studies, we demonstrate that rat cardiomyocte H9c2 cells release arachidonic acid in response to hydrogen peroxide. In H9c2 cells, arachidonic acid release is attenuated by methyl arachidonyl fluorophosphonate (MAFP) and pyrrophenone, indicating that a phospholipase A2 Group IV enzyme mediates arachidonic acid mobilization. Moreover, hydrogen peroxide alters the cellular morphology of the H9c2 cells, causing drastic cell shrinkage. Because MAFP and pyrrophenone prevent the morphological alterations caused by hydrogen peroxide, these studies show that phospholipase A2 Group IV activity is likely integrally involved in the damage initiated by hydrogen peroxide. © 2005 Elsevier Inc. All rights reserved. Keywords: H9c2 cells; Arachidonic acid; Hydrogen peroxide; Phospholipase A2

∗

Corresponding author. Tel.: +1 858 534 3055; fax: +1 858 534 7390. E-mail address: [email protected] (E.A. Dennis).

1098-8823/$ – see front matter © 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.prostaglandins.2005.03.004

56

M.V. Winstead et al. / Prostaglandins & other Lipid Mediators 78 (2005) 55–66

1. Introduction Reactive oxygen species, such as H2 O2 and superoxide, generated during ischemia and reperfusion, interact with cellular lipids, nucleotides and proteins. Oxidative stress, which causes lipid peroxidation and/or the formation of DNA adducts leads to the activation of numerous signaling cascades and causes apoptosis in cardiomyocytes [1]. Cultured cardiomyocytes, which do not undergo apoptosis or necrosis in response to H2 O2 become hypertrophied, which is an adaptive response to oxidative damage [2]. In rat cardiomyocytes, the outcome of cell death or hypertrophy upon H2 O2 (250 ␮M) exposure is dependent on the intracellular free thiol concentration, demonstrating that the abundance of antioxidant species in the cell determine its fate [3]. Cellular outcome is also H2 O2 -dose dependent; low doses (<30 ␮M) lead to hypertrophy, moderate doses (100–200 ␮M) cause apoptosis and high doses (>300 ␮M) lead to both necrosis and apoptosis [4]. There remains a dispute over which signaling pathways are activated under hypertrophy inducing conditions versus cell-death-related conditions [5]. However, a number of laboratories have shown that in the 100–250 ␮M range, H2 O2 induces the mitogen-activated protein kinase (MAPK) family, including extracellular signal-regulated kinases (ERKs) [4], c-Jun NH2 -terminal kinases (JNKs) [6–8], and p38 MAPK [6]. H2 O2 has been shown to have many other effects as well, including increasing arachidonic acid (AA) mobilization in U937 cells [9], RAW 264.7 cells [10], mesangial cells [11] and coronary artery smooth muscle cells [12], which implicate the involvement of phospholipase A2 (PLA2 ) enzymes. The PLA2 superfamily of enzymes is comprised of at least 19 distinct mammalian proteins, all of which catalyze the hydrolysis of phospholipids, releasing a free fatty acid and lysophospholipid [13]. Two distinct subclasses of PLA2 enzymes have emerged: (1) low molecular mass enzymes (≤18 kDa) which utilize a catalytic histidine (PLA2 Groups IB, IIA–F, III, V and X, collectively known as secretory PLA2 s); and (2) high molecular mass enzymes (>40 kDa) which utilize a catalytic serine (PLA2 Groups IVA–C and VI–VIII, A and B). While the physiological and pathological functions of these various enzymes overlap in some cases and are distinct in others [13,14], the responsiveness of the discrete PLA2 enzymes to H2 O2 remains ambiguous. H2 O2 -induced AA mobilization has been attributed to PLA2 Group VI (GVI) in RAW 264.7 murine macrophages [10] and U937 phagocytes [9], to PLA2 GIVC in human embryonic kidney 293 cells overexpressing the PLA2G4C gene [15], to PLA2 Group IVA (GIVA) in rat mesangial cells [11], to the secretory PLA2 s (sPLA2 s) in J774 murine histiocytic lymphoma cells [16] and to PLA2 GIVA, with a regulatory role for PLA2 Groups IIA and V in murine mesangial cells [17]. Given the disparity of these results, it seems likely that phospholipase A2 responsiveness to hydrogen peroxide is a complex process involving multiple enzymes and multiple pathways, which may differ in different cell systems. Because cardiomyocytes are a critical target of hydrogen peroxide damage, it is important to identify the pathways involved in oxidative damage in these cells. The H9c2 cardiomyocyte cell line is derived from rat ventricles and has been analyzed by a number of groups for responsiveness to H2 O2 . Additionally, H9c2 cells and primary cardiomyocytes respond to H2 O2 similarly [2]. Thus, H9c2 cells provide an important system for which the role of the PLA2 enzymes in response to H2 O2 needs to be delineated.

M.V. Winstead et al. / Prostaglandins & other Lipid Mediators 78 (2005) 55–66

57

2. Materials and methods 2.1. Materials H9c2 and WISH cells were obtained from the America Type Culture Collection (Manassas, VA). Dulbelco’s modified eagle medium (DMEM) and fetal bovine serum were from Mediatech (Herndon, VA). [5,6,8,9,11,12,14,15-3 H]Arachidonic acid (specific activity, 100 Ci/mmol) and [9,10-3 H]oleic acid (specific activity 55 Ci/mmol) were purchased from Perkin-Elmer (Boston, MA). All other cell culture reagents (unless otherwise noted) were from Invitrogen (Carlsbad, CA) and all chemicals (unless otherwise noted) were from Sigma–Aldrich (St. Louis, MI). Total rat RNA and the DNA-free DNase treatment system were from Ambion (Austin, TX). Trizol reagent, M-MLV reverse transcriptase and the pCR-Blunt II-TOPO vector were from Invitrogen (Carlsbad, CA). The Primer Express 1.0 software was purchased from Applied Biosystems (Foster City, CA). Precast precise protein gels were purchased from Pierce Biotechnology (Rockford, IL). Immobilon-p was from Millipore (Billerica, MA). Streptavidin horseradish peroxidase, and biotinylated goat antirabbit F(ab )2 fragments were from Vector Laboratories (Burlingame, CA). Horseradish peroxidase-conjugated protein A and enhanced chemiluminescence reagents were from Amersham Biosciences (Piscataway, NJ). Bromoenol lactone (BEL) was from Biomol (Plymouth Meeting, PA) and methyl arachidonyl fluorophosphonate (MAFP) was from Cayman Chemical (Ann Arbor, MI). The secretory PLA2 inhibitor LY311727 was generously provided by Dr. Edward Mihelich (Lilly Research Laboratories). The secretory PLA2 inhibitor indoxam and the specific PLA2 GIVA inhibitor pyrrophenone were generously provided by Dr. K. Seno (Shionogi Co., Osaka, Japan). Group VIA PLA2 antiserum was generously provided by Dr. Simon Jones (Genetics Institute, Cambridge, MA). Group IVA PLA2 antibodies were kindly provided by Dr. Ruth Kramer (Lilly Research Laboratories, Indianapolis, IN). 2.2. Methods 2.2.1. Cell culture H9c2 cells were maintained in DMEM with 4.5 g/ml glucose, 10% fetal bovine serum, 2 mM glutamine, 100 units/ml penicillin, 100 ␮g/ml streptomycin, and nonessential amino acids. The cells were subcultured twice weekly by trypsinization at a split ratio of 1:4. For use in experiments, 1 × 105 H9c2 or 2 × 105 WISH cells were plated per well in a 12-well plate and cultured for 36 h before treatment with H2 O2 . Cell viability was routinely determined by the trypan blue exclusion assay. 2.2.2. Fatty acid release Radiolabeling of the cells was achieved by incubation with 0.5 ␮Ci/ml [3 H]AA or 3 [ H]OA during a 36 h culturing period. Unincorporated fatty acids were removed by washing the cells three times in phosphate buffered saline containing 1 mg/ml bovine serum albumin (BSA). Cells were incubated with an inhibitor or vehicle in serum-free DMEM containing 0.1 mg/ml BSA for 30 min. Cells were then treated with H2 O2 in serum-free DMEM containing 0.1 mg/ml BSA for the indicated time. Following the period

M.V. Winstead et al. / Prostaglandins & other Lipid Mediators 78 (2005) 55–66

58

of oxidative stress, the medium was removed and centrifuged to remove detached cells. The amount of radioactivity release to the medium was measured by liquid scintillation counting. Figures showing these results are expressed as the amount of [3 H]AA or [3 H]OA released. Because the degree of peroxidation to the fatty acids themselves is not known, these terms are representative of all metabolites, whether nascent or peroxidized. 2.2.3. cDNA preparation mRNA was extracted from rat cardiomyocytes using the TRIzol method and contaminating DNA was eliminated by DNA-free treatment following the manufacturer’s instructions (Ambion). The concentration of the resulting DNA-free RNA was determined spectrophotometrically. cDNA was prepared using M-MLV reverse transcriptase and oligo dT as the primer. Following cDNA preparation the samples were incubated with RNase H for 20 min at 37 ◦ C to remove RNA. 2.2.4. PCR Gene specific primers were designed using the Primer3 program (http://wwwgenome.wi.mit.edu/cgi-bin/primer/primer3.cgi/) or Primer Express 1.0. Primers were designed to encompass introns in the genomic sequence. For each gene PCR product was also amplified from total rat RNA to verify that the primers and PCR conditions were working. Standard thermocycling conditions were used: 10 min at 95 ◦ C for polymerase activation, 40 cycles of 15 s at 95 ◦ C, and 1 min at 60 ◦ C. Primers and PCR conditions are listed in Table 1. Primer concentrations listed are the final concentrations in the assay. 2.2.5. PLA2 gene fragment cloning PLA2 gene fragments were generated by PCR using the primers listed in Table 1. The resulting fragments were purified from an agarose gel and cloned into the pCR-Blunt Table 1 PCR primers Gene

Primer

Sequence (5 to 3 )

[Primer] (nM)

IB

F R

CTCCAAGGTCCCCTACAACA GAAGTGGGGTGACAGCCTAA

500 500

74

IIA

F R

TGAACAAGAAGCCATACCACCAT AGGAGGACCTTCATGCTGTCA

900 900

59

IIC

F R

CTCCACCCTACCCAGGTACA AGCCTCTGGCATTGGTAGAA

500 500

149

IVA

F R

GACTTTTCTGCAAGGCCAAG CTTCAATCCTTCCCGATCAA

300 300

125

V

F R

CCATCCGGACCCAGTCCTAT CTTCCGGTCACAAGCACAAA

300 300

100

VI

F R

GCCTTCGCAGGTATCAAAAG GGGAATCTGGTGAAAGTCCA

500 500

130

X

F R

CAGGGACCTTGGATTGTGTT TGAGCCTGAGAGTAGCAGCA

500 500

145

Fragment size (bp)

M.V. Winstead et al. / Prostaglandins & other Lipid Mediators 78 (2005) 55–66

59

II-TOPO vector. Inserts were sequenced to verify their identity and vector concentration was determined spectrophotometrically. 2.2.6. Immunoblot analyses Cells were overlaid with a buffer consisting of 10 mM Hepes, 0.5% Triton X-100, 1 mM sodium vanadate, 1 mM phenylmethylsulfonyl fluoride, 20 ␮M leupeptin, 20 ␮M aprotinin, pH 7.5. Samples from cell extracts (10 ␮g) were separated by electrophoresis using an 8–16% gradient precast SDS-polyacrylamide gel and transferred to immobilon-p. Nonspecific binding was blocked with 5% bovine serum albumin and 5% non-fat dried milk in 10 mM Tris–HCl, 150 mM NaCl, 1 mM EDTA, 0.1% Triton X-100. Membranes were then incubated with the indicated antisera in a dilution of 1:5000. The secondary antibody used with the PLA2 GIVA antisera was horseradish peroxidase-conjugated protein A (1:1000 dilution). For PLA2 GVIA detection, the primary antisera incubation was followed by an incubation with biotinylated goat anti-rabbit F(ab )2 fragments (1:5000 dilution) and lastly, an incubation with streptavidin horseradish peroxidase (1:10,000 dilution). Protein visualization was by enhanced chemiluminescence according to the manufacturer’s protocol (Amersham Biosciences).

3. Results 3.1. Arachidonic acid release from H9c2 cells The rat cardiomyocyte cell line H9c2 was prelabeled with [3 H]AA and assayed for the extracellular release of [3 H]AA upon treatment with various concentrations of H2 O2 for 75 min (Fig. 1A). At concentrations of 100 ␮M and greater, the H9c2 cells had an altered morphology, including cell shrinkage. At concentrations ≥250 ␮M, cell detachment was evident and >75% of cells were dead as assessed by trypan blue staining. Fig. 1B shows the time-dependence of [3 H]AA release in H9c2 cells following treatment with 100 ␮M H2 O2 . After an early lag of ≤20 min, the release of [3 H]AA from H2 O2 -treated cells was at least 7-fold higher than basal [3 H]AA release, peaking at ≥15-fold higher at 3 h. By 6 h all cells treated with 100 ␮M H2 O2 were detached. 3.2. Inhibition of arachidonic acid release In order to determine whether hydrogen peroxide induced arachidonic acid release is mediated by PLA2 , various inhibition studies were undertaken. As shown in Fig. 2, neither LY311727 nor indoxam had any effect on H2 O2 induced [3 H]AA release, indicating that low molecular mass PLA2 s do not mediate arachidonic acid release in response to H2 O2 in H9c2 cells under the conditions employed. Similarly, 10 ␮M BEL only slightly reduced [3 H]AA release in response to H2 O2 (p > 0.05, statistically insignificant) suggesting that neither PLA2 GVIA nor GVIB are responsive to 100 ␮M hydrogen peroxide in H9c2 cells. Lower concentrations of BEL had no effect on [3 H]AA release and higher BEL concentrations were toxic to the cells (data not shown). However, 25 ␮M MAFP, which inhibits the PLA2 GIV and PLA2 GVI enzymes, reduced H2 O2 -induced [3 H]AA release by ∼60%. Furthermore,

60

M.V. Winstead et al. / Prostaglandins & other Lipid Mediators 78 (2005) 55–66

Fig. 1. H2 O2 -induced [3 H]AA release to the medium from H9c2 cells. (A) Dose–response of [3 H]AA release upon exposure to H2 O2 for 75 min (as compared to untreated cells); (B) time-course of [3 H]AA release upon exposure to 100 ␮M H2 O2 (as compared to untreated cells).

pretreatment of the cells with 1 ␮M of the PLA2 Group IV inhibitor pyrrophenone decreased the [3 H]AA release in response to hydrogen peroxide by ∼80%. Taken together, these results indicate that a PLA2 Group IV enzyme mediate arachidonic acid release in response to hydrogen peroxide treatment in H9c2 cells. 3.3. Oleic acid release from H9c2 cells in response to hydrogen peroxide In order to further clarify the involvement of PLA2 enzymes in hydrogen peroxide signaling in H9c2 cells, we also analyzed [3 H]oleic acid release. Other groups have shown that in stimulated cells where arachidonic acid release is mediated by PLA2 GIVA activity, no appreciable oleic acid release from stimulated cells could be detected [17,18]. In contrast, oleic acid release is significant and readily detected from cells in which non-arachidonyl selective enzymes, such as PLA2 Group V and VIA are active [9,19]. To investigate the release of oleic acid from H9c2 cells, the cells were prelabeled with [3 H]oleic acid or [3 H]AA and were treated with hydrogen peroxide for 100 ␮M H2 O2 for 75 min. [3 H]AA

M.V. Winstead et al. / Prostaglandins & other Lipid Mediators 78 (2005) 55–66

61

Fig. 2. Effect of PLA2 inhibitors on H2 O2 -induced [3 H]AA release to the medium. H9c2 cells were pre-treated with the indicated inhibitors (25 ␮M LY311727, 20 ␮M indoxam, 10 ␮M BEL, 25 ␮M MAFP, and 1 ␮M pyrrophenone) for 30 min and subsequently exposed to 100 ␮M H2 O2 for 75 min. Values shown are relative to vehicle-treated controls.

release from H9c2 cells in the presence of H2 O2 was >15 times greater than [3 H]AA release from untreated cells (Fig. 3). [3 H]Oleic acid release, while only ∼4-fold greater from H2 O2 treated cells compared to controls was still significant (p < 0.01). These data indicate that arachidonic acid is preferentially recognized and released from H9c2 cells and suggest that an arachidonyl-preferring enzyme (PLA2 GIVA) is involved in H2 O2 -induced [3 H]AA release, although other PLA2 ’s may also play some role. 3.4. RNA message for PLA2 Groups IB, IVA, V and VI is expressed in H9c2 cells To determine the presence or absence of PLA2 message in the cells, sequence specific primers were chosen to surround a splice junction for each rat PLA2 gene available in the public database and RT-PCR was performed on RNA isolated from the cardiomyocytes. Resulting fragments were then purified and sequenced to verify their identity. RNA message was detected for the low molecular mass PLA2 Groups IB and V, but not for PLA2 Groups IIA, IIC, or X (Fig. 4). Positive expression was also found for PLA2 Groups IVA and VIA (Fig. 4). A positive control of total rat RNA was used to verify that primers for these genes do indeed amplify these sequences. 3.5. PLA2 Groups IVA and VIA expression does not change with hydrogen peroxide treatment In order to confirm the presence of PLA2 protein in H9c2 cells, immunoblotting of H9c2 cells under normal conditions and in the presence of various concentrations of H2 O2 was

62

M.V. Winstead et al. / Prostaglandins & other Lipid Mediators 78 (2005) 55–66

Fig. 3. H2 O2 -induced oleic acid release from H9c2 cells. Cells were pre-labeled with [3 H]oleic acid or [3 H]AA and treated with 100 ␮M H2 O2 for 75 min. Data are shown as the relative increase of fatty acid released to the medium compared with untreated cells.

performed. As shown in Fig. 5, both PLA2 Groups IVA and VIA were detected in treated and untreated cells. The expression levels of both PLA2 GIVA and GVIA did not change with regard to H2 O2 treatment or concentration. Previous studies have shown that PLA2 Group IVA may be cleaved by caspase-3 in cells undergoing apoptosis [20], but under the conditions employed herein, we did not detect a decrease in the amount of full-length PLA2 Group IVA protein.

Fig. 4. PLA2 mRNA expression. Gene expression was determined by RT-PCR. The first lane of each gel is a 25 base pair molecular weight ladder. Gel A is the GIB PLA2 PCR product: lane 2, no-template control; lane 3, 10 ng cDNA; lane 4, 100 ng cDNA. Gel B is the GIVA PLA2 PCR product: lane 2, 10 ng cDNA; lane 3, 100 ng cDNA; lane 4, no-template control. Gel C is the GV PLA2 PCR product: lane 2, no-template control; lane 3, 10 ng cDNA; lane 4, 100 ng cDNA. Gel D is the GVI PLA2 PCR product: lane 2, 10 ng cDNA; lane 3, 100 ng cDNA; lane 4, no template control.

M.V. Winstead et al. / Prostaglandins & other Lipid Mediators 78 (2005) 55–66

63

Fig. 5. Expression of PLA2 Groups IVA and VIA in H9c2 cells. Immunoblot with 10 ␮g total protein from H9c2 cells isolated from cells treated with the indicated amounts of H2 O2 (0, 10, 50, 100 and 200 ␮M).

3.6. Pyrrophenone and MAFP, but not BEL, are protective to hydrogen peroxide induced cellular damage in H9c2 cells Upon treatment with doses of hydrogen peroxide ≥100 ␮M, morphological changes consistent with cells undergoing apoptosis (cell shrinkage and nuclear condensation) were evident in the H9c2 cells after 1 h. Fig. 6A is a light microscopy photograph of H9c2 cells untreated; whereas, as seen in Fig. 6E, H9c2 cells are drastically smaller and rounded after H2 O2 exposure. Also visible are cellular debris and/or apoptotic bodies. BEL had no effect on reducing the altered morphology of the H2 O2 -treated H9c2 cells, as the cells are all rounded and smaller in Fig. 6F (BEL pretreated, H2 O2 -treated) compared with Fig. 6B (BEL pretreated, no H2 O2 ). Interestingly, however, both MAFP and pyrrophenone drastically increased the proportion of H2 O2 -treated cells retaining a normal morphology (Fig. 6C, D, G and H), suggesting that PLA2 GIV is integral to the processes involved in the cellular pathology of oxidative damage in H9c2 cells.

4. Discussion These studies demonstrate that (1) hydrogen peroxide induces arachidonic acid release from H9c2 cells; (2) the phospholipase A2 enzyme mediating AA mobilization from H2 O2 treated H9c2 cells is a PLA2 GIV protein; and (3) PLA2 GIV is integral to the gross cellular pathology of H2 O2 -treated H9c2 cells. Exogenous hydrogen peroxide is highly reactive with the lipid bilayer and polyunsaturated fatty acids, such as arachidonic acid, comprise a major substrate for oxidative damage. Oxidative damage of the acyl chains has been shown to disorder the bilayer interior [21] and increase membrane fluidity [22]. The bilayer can sustain only limited oxidation before losing its structural integrity; therefore, enzymes, which can remove peroxidized fatty acids, are vitally important for cell maintenance and survival. Nakamura et al. have shown that the treatment of red blood cells with tert-butyl hydroperoxide results in drastic increases of oxidized derivatives of arachidonic acid, namely epoxyeicosatrienoic acids (EETs) and monohydroxyeicosatetranoic acids (HETEs) [23]. Although the degree of peroxidation to labeled arachidonic acid was not analyzed in the experiments described herein, it is likely that the radiolabel scintillation count included AA, EETs and HETEs released by PLA2 , as well as downstream metabolites.

64

M.V. Winstead et al. / Prostaglandins & other Lipid Mediators 78 (2005) 55–66

Fig. 6. MAFP and pyrrophenone but not BEL diminished the morphological changes induced by H2 O2 treatment of H9c2 cells. H9c2 cells were untreated (photos A–D); or treated with 100 ␮M H2 O2 for 75 min (photos E–H). Photos A and E show the morphological changes in the absence of inhibitors, photos B and F are in the presence of 10 ␮M BEL, photos C and G are with 25 ␮M MAFP and photos D and H are with 1 ␮M pyrrophenone. Photos A and E are magnified 40×, B and F are 200×. All others are 100×. The images shown are representative of experiments performed at least three times in triplicate.

M.V. Winstead et al. / Prostaglandins & other Lipid Mediators 78 (2005) 55–66

65

Platelet activating factor acetylhydrolase (PLA2 GVII) effectively removes oxidized fatty acids up to nine carbons in length and as such, is generally regarded as a protective enzyme, which minimizes the effects of lipid peroxidation [24]. Because the PLA2 GIV enzyme does not demonstrate a substrate preference for peroxidized fatty acids, increased release of peroxidized fatty acids attributable to these enzymes is likely due to membrane alterations, which render them more accessible to enzymatic hydrolysis. Interestingly, in this work, the inhibition of PLA2 Group IV resulted in the restoration of a normal cellular morphology, indicating that PLA2 Group IV is not a protective enzyme, but rather, may potentiate the damage in H9c2 cells undergoing oxidative stress. Reactive oxygen species such as hydrogen peroxide are well documented as cellular toxins, but hydrogen peroxide also functions as a second messenger, capable of inducing signal transduction pathways [25]. In rat mesangial cells, hydrogen peroxide in combination with platelet-derived growth factor leads to the activation of ERK and p38 MAPK, which in turn phosphorylate PLA2 GIVA [11]. In human embryonic kidney 293 cells overexpressing the PLA2G4C gene, hydrogen peroxide causes protein tyrosine kinase activation which in turn leads to the activation of PLA2 GIVC [15]. In H9c2 cells, p38 MAPK and c-Jun NH2 terminal kinase were activated by 200 ␮M H2 O2 exposure [6]. Interestingly, however under the conditions employed by Turner et al., 100 ␮M H2 O2 was not sufficient to cause the phosphorylation of p38 MAPK. Future studies are necessary to determine whether the conditions used in the present studies which coupled 100 ␮M hydrogen peroxide exposure with serum starvation are sufficient to activate p38 MAPK and whether PLA2 is a downstream target of a mitogen-activated protein kinase pathways in H9c2 cells.

Acknowledgments We thank Dr. Christina Johnson for technical assistance and helpful discussions and Dr. David Six and Ray Deems for insightful comments. This work was supported by NIH grant GM64611. MVW was the recipient of a Postdoctoral Fellowship HL 10385 from the National Institute of Health.

References [1] MacLellan WR, Schneider MD. Death by design. Programmed cell death in cardiovascular biology and disease. Circ Res 1997;81(2):137–44. [2] Chen QM, Tu VC, Wu Y, Bahl JJ. Hydrogen peroxide dose dependent induction of cell death or hypertrophy in cardiomyocytes. Arch Biochem Biophys 2000;373(1):242–8. [3] Tanaka H, Sakurai K, Takahashi K, Fujimoto Y. Requirement of intracellular free thiols for hydrogen peroxideinduced hypertrophy in cardiomyocytes. J Cell Biochem 2003;89(5):944–55. [4] Kwon SH, Pimentel DR, Remondino A, Sawyer DB, Colucci WS. H(2)O(2) regulates cardiac myocyte phenotype via concentration-dependent activation of distinct kinase pathways. J Mol Cell Cardiol 2003;35(6):615–21. [5] Clerk A. The radical balance between life and death. J Mol Cell Cardiol 2003;35(6):599–602. [6] Turner NA, Xia F, Azhar G, Zhang X, Liu L, Wei JY. Oxidative stress induces DNA fragmentation and caspase activation via the c-Jun NH2 -terminal kinase pathway in H9c2 cardiac muscle cells. J Mol Cell Cardiol 1998;30(9):1789–801.

66

M.V. Winstead et al. / Prostaglandins & other Lipid Mediators 78 (2005) 55–66

[7] Mizukami Y, Okamura T, Miura T, et al. Phosphorylation of proteins and apoptosis induced by c-Jun N-terminal kinase1 activation in rat cardiomyocytes by H(2)O(2) stimulation. Biochim Biophys Acta 2001;1540(3):213–20. [8] Chae HJ, Kim HR, Kwak YG, Ko JK, Joo CU, Chae SW. Signal transduction of nitric oxide donor-induced protection in hydrogen peroxide-mediated apoptosis in H9c2 cardiomyoblasts. Immunopharmacol Immunotoxicol 2001;23(2):187–204. [9] Balboa MA, Balsinde J. Involvement of calcium-independent phospholipase A2 in hydrogen peroxideinduced accumulation of free fatty acids in human U937 cells. J Biol Chem 2002;277(43):40384–9. [10] Martinez J, Moreno JJ. Role of Ca2+ -independent phospholipase A2 on arachidonic acid release induced by reactive oxygen species. Arch Biochem Biophys 2001;392(2):257–62. [11] Hayama M, Inoue R, Akiba S, Sato T. ERK and p38 MAP kinase are involved in arachidonic acid release induced by H(2)O(2) and PDGF in mesangial cells. Am J Physiol Renal Physiol 2002;282(3):F485–91. [12] Barlow RS, El-Mowafy AM, White RE. H(2)O(2) opens BK(Ca) channels via the PLA(2)-arachidonic acid signaling cascade in coronary artery smooth muscle. Am J Physiol Heart Circ Physiol 2000;279(2):H475–83. [13] Six DA, Dennis EA. The expanding superfamily of phospholipase A(2) enzymes: classification and characterization. Biochim Biophys Acta 2000;1488(1/2):1–19. [14] Kudo I, Murakami M. Phospholipase A2 enzymes. Prostag Other Lipid Mediat 2002;68/69:3–58. [15] Asai K, Hirabayashi T, Houjou T, Uozumi N, Taguchi R, Shimizu T. Human Group IVC phospholipase A2 (cPLA2gamma). Roles in the membrane remodeling and activation induced by oxidative stress. J Biol Chem 2003;278(10):8809–14. [16] Zhao M, Brunk UT, Eaton JW. Delayed oxidant-induced cell death involves activation of phospholipase A2. FEBS Lett 2001;509(3):399–404. [17] Han WK, Sapirstein A, Hung CC, Alessandrini A, Bonventre JV. Cross-talk between cytosolic phospholipase A2 alpha (cPLA2 alpha) and secretory phospholipase A2 (sPLA2) in hydrogen peroxide-induced arachidonic acid release in murine mesangial cells: sPLA2 regulates cPLA2 alpha activity that is responsible for arachidonic acid release. J Biol Chem 2003;278(26):24153–63. [18] Hernandez M, Burillo SL, Crespo MS, Nieto ML. Secretory phospholipase A2 activates the cascade of mitogen-activated protein kinases and cytosolic phospholipase A2 in the human astrocytoma cell line 1321N1. J Biol Chem 1998;273(1):606–12. [19] Balsinde J, Balboa MA, Yedgar S, Dennis EA. Group V phospholipase A(2)-mediated oleicacid mobilization in lipopolysaccharide-stimulated P388D(1) macrophages. J Biol Chem 2000;275(7):4783–6. [20] Adam-Klages S, Schwandner R, Luschen S, Ussat S, Kreder D, Kronke M. Caspase-mediated inhibition of human cytosolic phospholipase A2 during apoptosis. J Immunol 1998;161(10):5687–94. [21] Megli FM, Sabatini K. EPR studies of phospholipid bilayers after lipoperoxidation. 1. Inner molecular order and fluidity gradient. Chem Phys Lipids 2003;125(2):161–72. [22] Gabbita SP, Subramaniam R, Allouch F, Carney JM, Butterfield DA. Effects of mitochondrial respiratory stimulation on membrane lipids and proteins: an electron paramagnetic resonance investigation. Biochim Biophys Acta 1998;1372(2):163–73. [23] Nakamura T, Bratton DL, Murphy RC. Analysis of epoxyeicosatrienoic and monohydroxyeicosatetraenoic acids esterified to phospholipids in human red blood cells by electrospray tandem mass spectrometry. J Mass Spectrom 1997;32(8):888–96. [24] Stafforini DM, McIntyre TM, Zimmerman GA, Prescott SM. Platelet-activating factor acetylhydrolases. J Biol Chem 1997;272(29):17895–8. [25] Hensley K, Robinson KA, Gabbita SP, Salsman S, Floyd RA. Reactive oxygen species, cell signaling, and cell injury. Free Radic Biol Med 2000;28(10):1456–62.