cystine ratio at constant sulfur amino acid levels

Aquaculture 518 (2020) 734869

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Growth and metabolic responses of juvenile grouper (Epinephelus coioides) to dietary methionine/cystine ratio at constant sulfur amino acid levels Hanmo Feng, Kui Yi, Xiaoli Qian, Xingjian Niu, Yunzhang Sun, Jidan Ye

T

⁎

Xiamen Key Laboratory for Feed Quality Testing and Safety Evaluation, Fisheries College of Jimei University, Xiamen 361021, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Cystine Epinephelus coioides Methionine mTOR Performance

An eight-week feeding trial was conducted to investigate the effects of dietary methionine/cystine (Met/Cys) ratio on juvenile grouper growth performance, hepatic metabolic enzymes, serum immune-related parameters, liver antioxidant indices, and relative expression of genes in the mTOR pathway. Six isonitrogenous, isocaloric experimental diets with a fixed Met and Cys level (1.78%) and variable Met/Cys ratio (0.76–4.50) were formulated. Each diet was randomly assigned to triplicate groups of 30 juvenile fish with an average initial weight of 11.66 g. The fish were fed twice daily for 2 months. Weight gain and specific growth rates, feed efficiency and intake, and protein efficiency ratio had positive linear and/or quadratic responses to the dietary Met/Cys ratio. In contrast, the variations in dietary Met/Cys ratio had no apparent effect on the hepatosomatic index, condition factor, whole-body moisture, protein, lipid or ash content, or hepatic betaine homocysteine methyltransferase or S-adenosylhomocysteine hydrolase. Hepatic methionine synthase, cystathionine β-synthase, glutathione peroxidase, superoxide dismutase, and catalase activity, serum acid phosphatase, alkaline phosphatase, and lysozyme activity, and serum IgM and C3 content had positive linear and/or quadratic responses to the dietary Met/Cys ratio. In contrast, the malondialdehyde content had negative linear and/or quadratic responses to the dietary Met/Cys ratio. Hepatic RagA/B, RagC/D, Raptor, and eIF4B mRNA levels were unaffected by the dietary Met/ Cys ratio. On the contrary, muscular upstream and downstream mTOR signal pathway gene mRNA levels had positive linear and/or quadratic responses to the dietary Met/Cys ratio. However, the 4E-BP mRNA levels had negative linear and quadratic responses to the dietary Met/Cys ratio. Cys could replace up to 41% of the Met in the fish diets. The use of appropriate Met/Cys ratios (range 1.93–2.77) in the feed may help improve grouper growth performance, immune function, and antioxidant ability and positively regulate genes in the mTOR signaling pathway.

1. Introduction Methionine (Met) is a sulfur-containing amino acid. It is limiting in plant protein based diets (Ahmed, 2014; Farhat Khan, 2014). It plays unique and vital roles in protein structure and metabolism (Brosnan et al., 2007; Martinez et al., 2017). The metabolism of Met includes transmethylation, remethylation, and transsulfuration (Brosnan et al.,

2007). Cystine (Cys) is a non-essential sulfur-containing amino acid irreversibly synthesized from Met by transsulfuration (Farhat Khan, 2014). As a metabolic intermediate of Met, Cys enzymatically produces glutathione and taurine which, in turn, participate in certain important metabolic processes, thereby conserving Met. Therefore, the amount of Met supplementation required in fish feed is contingent on the quantity of Cys present in it (Luo et al., 2005a). The requirement for sulfur-

Abbreviations: 4E-BP, Eukaryotic initiation factor 4E binding protein; ACP, serum acid phosphatase; AKP, alkaline phosphatase; BHMT, betaine homocysteine methyltransferase; C3, complement component 3; CAT, catalase; CBS, cystathionine-β-synthase; CF, condition factor; Cys, cystine; DO, dissolved oxygen; EAA, essential amino acids; eIF4B, Eukaryotic initiation factor 4B; ELISA, enzyme-linked immunosorbent assay; FE, feeding efficiency; FI, feeding intake; FM, fishmeal; GEF, guanine exchange factor; GSH-Px, hepatic glutathione peroxidase; HSI, hepatosomatic index; IgM, immunoglobin M; LZM, lysozyme; MDA, malondialdehyde; Met, methionine; mLST8, target of rapamycin complex subunit LST8; MS, hepatic methionine synthase; mTOR, mammalian target of rapamycin; PER, protein efficiency ratio; PFA, performic acid; qRT-PCR, quantitative real-time polymerase chain reaction; RagA/B, Ragulator-Rag complex A/B; RagC/D, Ragulator-Rag complex C/D; Raptor, regulatory-associated protein of mTOR; RPLC, reversed-phase liquid chromatography; S6, ribosomal protein S6; S6K, ribosomal protein S6 kinase; SAHH, S-adenosylhomocysteine hydrolase; SGR, specific growth rate; SOD, superoxide dismutase; SPI, soy protein isolate; V-ATPase, vacuolar-type H+ATPase; WGR, weight gain rate ⁎ Corresponding author at:Fisheries College of Jimei University, Yindou Road 43, Jimei District, Xiamen 361021, China. E-mail address: [email protected] (J. Ye). https://doi.org/10.1016/j.aquaculture.2019.734869 Received 12 November 2019; Received in revised form 15 December 2019; Accepted 15 December 2019 Available online 16 December 2019 0044-8486/ © 2019 Elsevier B.V. All rights reserved.

Aquaculture 518 (2020) 734869

H. Feng, et al.

containing amino acids in fish is met both by methionine supplementation and the correct Met/Cys ratio in the aquafeed formulation (Nguyen and Davis, 2009). Previous studies showed that excess Met or Cys caused metabolic acidosis in weanling rats (Wamberg et al., 2010) and hepatic coma in dogs (Merino et al., 1975). Hence, the appropriate Met/Cys ratio must be considered during fish feed preparation. Total sulfur-containing amino acid requirements have already been established for numerous cultured fish species (Santiago and Lovell, 1988; Moon and Gatlin, 1991; Kim et al., 1992; Keembiyehetty and Gatlin III, 1993; Simmons et al., 1999; Twibell et al., 2000; Nguyen and Davis, 2009; Farhat Khan, 2014; Klatt et al., 2016; Poppi et al., 2017). However, there are few reports addressing the sparing effect of Cys on Met in farmed fish, poultry, and livestock. Earlier fish studies revealed that Cys can replace Met by ≤40–60% (Harding et al., 1977; Moon and Gatlin, 1991; Kim et al., 1992; Griffin et al., 1994; Nguyen and Davis, 2009). The extent to which Cys substitutes for Met varies with fish species and dietary protein level (Rodehutscord et al., 1995; Twibell et al., 2000; Nguyen and Davis, 2009; Abidi and Khan, 2011). The mammalian target of rapamycin (mTOR) is a highly conserved protein kinase. It is the molecular target of the immunosuppressant rapamycin and occurs widely in eukaryotes (Heitman et al., 1991; Loewith et al., 2002). The mTOR has two structurally and functionally distinct complexes called mTORC1 and mTORC2. The former responds to amino acids, stressors, oxygen tension, and energy and growth factors (Wullschleger et al., 2006). In fish and mammals, mTORC1 promotes cellular growth, proliferation, and metabolism by stimulating protein synthesis via the 4EBP1 and 70S6K pathways (Sarbassov et al., 2005; Seiliez et al., 2008). In contrast, mTORC2 responds only to growth factors, controls various metabolic processes, and promotes cell proliferation and survival (Vélez et al., 2014). Several reports demonstrated that essential amino acids (EAAs) activate the mTOR pathway (Kim and Guan, 2011). The mTORC1 pathway is mediated by Rag GTPase in response to various amino acid signals (Kim et al., 2008; Sancak et al., 2008). Earlier studies showed that mTORC1 senses lysosomal amino acids via V-ATPase-Ragulator interactions. The amino acid signals are transmitted to mTORC1 through Rag GTPase (Zoncu et al., 2011; Jewell et al., 2013). In recent experiments on fish, the responses of the mTOR signaling pathway to different amino acids have been investigated (Zhao et al., 2012; Tang et al., 2013; Ren et al., 2015; Liang et al., 2016; Wu et al., 2017; Su et al., 2018; Li et al., 2019; Zhou et al., 2019). Nevertheless, most of the research has focused on downstream gene (mTOR, 4E-BP, and S6K) regulation when fish are maintained on diets with graded amino acid levels. On the other hand, little is known about the upstream mTOR pathways signals such as VATPase, Ragulator, and Rag GTPase that influence protein synthesis. Dietary Met deficiency and excess had different effects on the hepatic expression of the genes related to intermediary metabolism in rainbow trout (Skiba-Cassy et al., 2016). Thus, Met regulates mTORC1 signalingassociated protein synthesis in fish. Grouper have been cultured in several Southeast Asian countries as they grow fast and have high market value (Boonyaratpalin, 1997). In China, grouper is ranked the third most heavily maricultured fish species after large yellow croaker and seabass. Annual grouper production in China reached 159,600 t in 2018 (China Fishery Statistics Yearbook, 2019). Accordingly, the demand for grouper feed has also rapidly increased. Great progress has been made in research on fish nutrition and feed composition (Millamena, 2002; Luo et al., 2004, 2005a, 2005b; Huang et al., 2017; Wang et al., 2017; Shen et al., 2019; Wang et al., 2019). So far, several studies have determined the protein requirement of grouper, the range of which is 40%–56% (Teng and Chua, 1978; Luo et al., 2004; Tuan and Williams, 2007; Rahimnejad et al., 2015; Jiang et al., 2016; Huang et al., 2017). However, the research on the requirements of sulfur amino acid of grouper was less involved (Luo et al., 2005a). Here, six experimental diets with constant sulfur amino acid levels and different Met/Cys ratios were prepared and their effects on grouper (Epinephelus coioides) growth performance, immunity,

Table 1 Formulation and composition of experimental diets (as-fed basis). Ingredients (%) a

Fish meal Soybean protein isolateb Corn starch Amino acid mixture (Table 2) Blend oil⁎ Vitamin premixc Mineral premixd Stay-C 35% Ca(H2PO4)2 Choline chloride Methionine Cystine Microcrystalline cellulose Taurine Sodium alginate Nutrient level (analyzed values) Dry matter (%) Crude protein (%) Crude lipid (%) Ash (%) Methionine (%) Cystine (%) Met/Cys ratio Gross energy (kJ g−1)

Diet 1

Diet 2

Diet 3

Diet 4

Diet 5

Diet 6

15 28 21 13.79 8 0.5 0.7 0.05 1.5 0.6 0 0.71 7.65 1 1.5

15 28 21 13.79 8 0.5 0.7 0.05 1.5 0.6 0.14 0.57 7.65 1 1.5

15 28 21 13.79 8 0.5 0.7 0.05 1.5 0.6 0.28 0.43 7.65 1 1.5

15 28 21 13.79 8 0.5 0.7 0.05 1.5 0.6 0.43 0.28 7.65 1 1.5

15 28 21 13.79 8 0.5 0.7 0.05 1.5 0.6 0.57 0.14 7.65 1 1.5

15 28 21 13.79 8 0.5 0.7 0.05 1.5 0.6 0.71 0 7.65 1 1.5

96.56 49.78 8.27 6.29 0.77 1.01 0.76 14.96

95.85 49.31 8.18 6.34 0.93 0.87 1.07 14.85

96.27 49.58 8.34 6.07 1.06 0.74 1.43 14.96

95.28 49.05 8.13 6.25 1.18 0.61 1.93 14.79

96.08 49.21 8.21 6.24 1.3 0.47 2.77 14.85

94.78 49.08 8.15 6.12 1.44 0.32 4.5 14.80

Fish oil, soy oil and soy lecithin were obtained from Jiakang Feed Co. Ltd., Xiamen, China. a Fish meal was obtained from Jiakang Feed Co. Ltd., Xiamen, China, imported from Peru (crude protein 68.34%, crude lipid 9.06%). b Soybean protein isolate was obtained from Shandong Shansong Biological Co., Ltd., Linyi, China. (crude protein 90.5%). c Vitamin premix (mg kg−1 diet): vitamin A, 15; vitamin D3, 15; vitamin E, 75; vitamin K3, 50; vitamin B1, 50; vitamin B2, 75; vitamin B6, 75; vitamin B12, 0.3; nicotinic acid, 200; inositol, 350; D‑calcium pantothenate, 200; folic acid, 9; D-biotin, 0.5. d Mineral premix (mg kg−1 diet): FeSO4·7H2O, 278; CuSO4·5H2O, 41; ZnSO4·7H2O, 463; MnSO4·4H2O, 57; MgSO4·7H2O, 2009; CoSO4·7H2O, 3; Na2SeO3 0.6, Ca(IO3)2, 5. ⁎ Blend oil: fish oil:soy oil:soy lecithin = 3:3:2.

antioxidant capacity, and mTOR pathway gene expression were investigated. The aims were to determine whether dietary Met/Cys ratios affect grouper growth and feed utilization and/or directly activate the associated genes in the mTOR pathway.

2. Materials and methods 2.1. Experimental diets Six isonitrogenous and isocaloric experimental diets were formulated using fish meal and soy protein isolate as the protein sources and fish oil, soybean oil, and soybean lecithin as the lipid sources (Table 1). The Met and Cys levels were fixed at 1.78% but the Met/Cys ratios were variable [0.76 (Diet 1), 1.06 (Diet 2), 1.43 (Diet 3), 1.93 (Diet 4), 2.77 (Diet 5), and 4.50 (Diet 6)]. Dietary Cys accounted for 57%, 48%, 41%, 34%, 27%, and 18%, respectively, of the total Met + Cys content in each formulation. The amino acid composition of the experimental diets was prepared to simulate the amino acid composition in whole chicken egg (48% protein) except for the Met and Cys content (Table 2). The coarse dry feed ingredients were ground in a hammer mill, weighed, and homogenized. The liquid ingredients (fish oil, soybean oil, soya lecithin, and water) were then added to the dry feed ingredients and a mash was prepared. This dough was extruded into strands and pelletized through a 2.5-mm die using cold press extrusion (CD4XITS, South China University of Technology, Guangzhou, 2

Aquaculture 518 (2020) 734869

H. Feng, et al.

tubes at −80 °C for subsequent biochemical parameter analyses. The liver samples of 4 fish per tank were aseptically removed and pooled into one 5-mL tube per tank and stored at −80 °C until the analyse of the biochemical parameters. Liver and dorsal muscle samples from the remaining 4 fish were respectively pooled into one tube for each tank and stored at −80 °C until the analyse of mTOR pathway-related gene expression levels. Another four fish per tank were randomly captured, pooled in plastic bags, and stored at −20 °C until determination of whole-body composition. Proximate compositions of the ingredients, diets, and whole-body fish samples were determined according to standard methods (AOAC, 2005). Dry matter was evaluated by drying the samples in an oven at 105 °C to a constant weight. Crude protein was determined by the Kjeldahl method (N × 6.25) using Kjeltec TM 8400 Auto Sample Systems (Foss Tecator AB, Sweden). Crude lipid was determined by the Soxtec extraction method by using Soxtec Avanti 2050 (Foss Tecator AB). Ash was measured in the residues of samples burned in a muffle furnace at 550 °C for 8 h. The fish samples were autoclaved at 121 °C for 20 min, homogenized, and dried at 65 °C for 24 h prior to compositional analysis. Hepatic methionine synthase (MS), betaine homocysteine methyltransferase (BHMT), S-adenosylhomocysteine hydrolase (SAHH), and cystathionine-β-synthase (CBS) activity and serum IgM and C3 content were measured using enzyme-linked immunosorbent assay (ELISA) kits (Shanghai Zhuocai Biotechnology Co., Ltd., Shanghai, China). Serum acid phosphatase (ACP), alkaline phosphatase (AKP), and lysozyme (LZM) activity and hepatic glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), catalase (CAT), and malondialdehyde (MDA) activity were determined using prepared kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

Table 2 Amino acid composition of ingredients (as-fed basis). AA provided by 15% fish meal

AA provided by 28% soybean protein isolate

AA provided by crystalline AA

Total AA

48% whole chicken egg protein

EAA Met Val Ile Leu Thr Phe Lys His Arg Trp

0.37 0.48 0.42 0.71 0.43 0.44 0.93 0.29 0.59 0.09

0.41 1.13 1.16 1.92 0.97 1.47 1.68 0.67 1.85 0.26

variable 1.61 1.06 1.75 1.1 0.85 0.69 0.3 0.68 0.37

variable 3.22 2.64 4.38 2.5 2.76 3.3 1.26 3.12 0.72

1.62 3.22 2.64 4.38 2.5 2.76 3.3 1.26 3.12 0.72

NEAA Cys Asp Tyr Ser Glu Pro Gly Ala

0.07 0.86 0.36 0.43 1.32 0.48 0.75 0.66

0.27 2.92 1.53 1.51 4.67 1.43 1.04 1.12

variable 1.38 0.31 1.86 0.75 0 0 1.08

variable 5.16 2.2 3.8 6.74 1.91 1.79 2.86

0.16 5.16 2.2 3.8 6.74 1.86 1.78 2.86

Amino acids

The amino acid profile of 48% whole chicken egg protein was used as a reference amino acid profile to formulate the test diets.

Guangdong, China). The pellets were dried in a ventilated oven at 50 °C for 12 h and then stored at room temperature for 1 d before being sealed in plastic bags and stored at −20 °C. 2.2. Feeding trial

2.4. Amino acid assay

This experiment was conducted at Fujian Dabeinong Fisheries Technology Company (Zhangzhou, Fujian, China). Before the trial, the fish were acclimated in a concrete pool and maintained on Diet 1 for 2 wks. Seven hundred and twenty healthy fish (initial mean body weight = 11.66 g) were randomly distributed into twenty-four 500-L fiberglass tanks at a density of 30 fish per tank. They were provided with a continuous flow of sand-filtered seawater and with continuous aeration to maintain the dissolved oxygen level above saturation. Groups of four tanks were administered one of the six diets to apparent satiation twice daily (07 h00 and 16 h00) for 8 wks. Uneaten feed was collected and the feces were removed by siphoning the tanks for 30 min after each feeding. The collected feed was dried and weighed to determine the net feed consumption. Water-quality conditions were checked weekly. During the feeding period, the aquaculture system was maintained under a natural light regime. The water temperature ranged between 22 and 29 °C, salinity ranged from 29 to 32‰, the dissolved oxygen (DO) concentration ranged from 5.3 to 7.8 mg L−1, and the ammonia nitrogen was < 0.2 mg L−1 during the feeding period.

All fishmeal (FM), soy protein isolate (SPI), and diet samples were pretreated before amino acid determination. To quantify all amino acids except Trp, Met, and Cys, the samples were hydrolyzed in 6 N hydrochloric acid (HCl) at 110 °C for 24 h and the supernatants were processed in an automatic AA analyzer (Hitachi L8900, Tokyo, Japan). For Met and Cys determination (Chinese Standards, 2018), the same samples were oxidized in performic acid solution at 0 °C for 16 h, hydrolyzed with 6 N HCl at 110 °C for 24 h, and analyzed in the aforementioned Hitachi L8900. To determine the Trp content (Chinese Standards, 2000), the samples were hydrolyzed in 4 N lithium hydroxide (LiOH) at 110 °C for 24 h and subjected to reversed-phase liquid chromatography (RPLC; Agilent 1100 Series, Agilent Technologies, Alpharetta, GA, USA).

2.5. Quantitative real-time (qRT-)PCR analysis Total RNA was extracted from the liver and muscle samples with an E.Z.N.A.® total RNA kit II (Omega Bio-Tek Inc., Norcross, GA, USA). The RNA quantity and quantity were detected using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) and 1% agarose gel electrophoresis. The cDNA was synthesized with a PrimeScript RT reagent kit (Thermo Fisher Scientific, Wilmington, DE, USA) according to the manufacturer's instructions. For the qRT-PCR, the primers were designed with Primer v. 5.0 based on the grouper sequences. The primer sequences are shown in Table 3. β-actin served as the reference gene to normalize cDNA loading. Target and housekeeping gene amplification efficiencies were calculated according to specific gene standard curves generated from tenfold serial dilutions. The expression levels of the target genes were analyzed by the 2-ΔΔCt method (Schmittgen and Livak, 2008).

2.3. Sample collection and chemical analysis At the end of the 8-wk feeding phase, fish in each tank were caught, anesthetized with MS-222 (100 mg L−1), batch-weighed, and counted to determine the weight gain rate (WGR), the feeding intake (FI), the feed efficiency (FE), and the survival rate. Thirty-two fish per treatment (eight fish per tank) were randomly caught and individually weighed to calculate the hepatosomatic index (HSI) and the condition factor (CF). Blood samples were drawn from the caudal vein of 8 fish per tank using a sterile 2-mL syringe, transferred to 1.5-mL Eppendorf tubes, and stored at 4 °C overnight, about 1.5 ml blood was collected per fish. The blood samples were centrifuged at 850 ×g and 4 °C for 10 min. The sera were separated, pooled for each tank, and stored in 1.5-mL Eppendorf 3

Aquaculture 518 (2020) 734869

H. Feng, et al.

Table 3 Grouper primer sequences used in real-time PCR. Gene

KEGG number

Forward primer sequence (5′ → 3′)

Reverse primer sequence (5′ → 3′)

V-ATPase Ragulator RagA/B RagC/D Raptor mTOR mLST8 Tel2 4E-BP S6K eIF4E eIF4B S6 β-actin

K02145 K20397 K16185 K16186 K07204 K07203 K08266 K11137 K07205 K04688 K03259 K03258 K02991 –

AGGCGAACCCTCCAACAAA AGGCGAACCCTCCAACAAA TTTAAGTAACCGTGCGACCCT TTGATTGGAATGGCTGCTTG GGTCGCACAAACAATCCTGG GTAAAGGTGTCCCCTGCCATA GAGGCATTGGTGATGAGGTGA TCTCCGCTCTTCAAACACTCC CCCAGCAATAACACCAACCA CAAACACGATGGCTGAGGGT TCGGTGAGTCGTTTGATGAGG GGCTCAAGGGCTTTGGCTAT TGGGCTTCTTGCCTTCTTTAG TTCACCACCACAGCCGAGA

GCTTCCCATCAGCATTTTCAC GCTTCCCATCAGCATTTTCAC CATTGCTGTGCTTGACATCCC GATGCGAGTGACTTGGCTGAA CGCTGCCCTACAACTTTCTGA TCGCCATTGTGAGTCTGATTG TGGAATCGGGGCTGAACTT ATTCCCTCCATCAGCACCAG GTCCATTTCAAACTGGGCATC AGGTCGGCTATCACAGGCTTA TTGTGATGATGCGGTTTGGT CCTTCGGTTTCCCAGGTTCT TGCTCAACTTGGTCATCGTCA TGGTCTCGTGGATTCCGCAG

observed for the group of fish that consumed Diet 5. FI had a positive quadratic response (P = .01) to the dietary Met/Cys ratio and reached a maximum in the Diet 4 treatment group. However, neither HSI nor CF significantly differed across dietary treatment groups (P > .05).

2.6. Calculations and statistical analysis

Weight gain rate (WGR,%) = 100 × (final body weight (g/fish) − initial body weight (g/fish)) /initial body weight (g/fish)

3.2. Whole-body composition

(1)

Specific growth rate (SGR,%/d)

Table 5 shows no significant effects of increasing dietary Met/Cys ratio on whole-body moisture, crude protein, crude lipid and ash content (P > .05).

= 100 × (ln (final body weight (g/fish)) –ln (initial body weight (g/fish)))/d

(2)

3.3. Hepatic metabolic enzyme

Feed efficiency (FE,%) = 100 × (final body weight (g/fish) − initial body weight (g/fish)) /feed intake (g/fish)

Table 6 shows the liver metabolic enzyme activity in the fish on the various diets with different Met/Cys ratios. Dietary Met/Cys ratio did not significantly (P > .05) influence BHMT or SAHH activity. In contrast, MS activity had a positive linear response to the dietary Met/ Cys-ratio (P = .026). The peak response was established for the Diet 5 treatment group. Moreover, CBS activity also had positive linear and quadratic responses to the dietary Met/Cys ratio (P < .001). The maximum level was identified for the Diet 6 treatment group.

(3)

Feed intake (FI,%/d) = 100 × (feed consumption /((final fish weight (g/fish) + initial fish weight (g/fish))/2 × d)) (4)

Protein efficiency ratio (PER,%) = 100 × (wet weight gain (g/fish)/protein intake (g/fish))

3.4. Serum immune-related parameters

(5)

Table 7 shows that all serum immune parameters had positive linear and quadratic responses (P < .05) to the dietary Met/Cys ratio. Peak values were determined for ACP in the Diet 3 treatment group, for C3 and LZM in the Diet 4 treatment group, and for IgM and AKP in the Diet 5 treatment group.

Hepatosomatic index (HSI,%) = 100 × (hepatic weight (g/fish)/body weight (g/fish))

(6)

Condition factor (CF, g cm−3) = 100 × (body weight (g/fish)/(body length (cm))3)

(7) 3.5. Liver antioxidant indices

Data were subjected to one-way ANOVA and Student-Neuman-Keuls multiple comparison tests in SPSS Statistics v. 22.0 (IBM Corp., Armonk, NY, USA). Responses to increasing dietary Met/Cys ratios were evaluated by linear and quadratic polynomial orthogonal contrasts. Kolmogorov-Smirnov tests were run to assess data normality. Levene's test was used to determine variance homogeneity before applying ANOVA. Data expressed as % or ratios were subjected to arcsine transformation prior to statistical analysis. P < .05 was considered statistically significant.

Table 8 shows the grouper liver antioxidant parameters. GSH-Px and CAT activity had positive linear and quadratic responses to the dietary Met/Cys ratio (P < .05). The maximum gain was observed in the Diet 5 treatment group. Nevertheless, the MDA content had negative linear and quadratic responses (P < .001) to the dietary Met/Cys ratio. The lowest MDA level was detected in the Diet 6 treatment group. SOD had a positive quadratic response to the dietary Met/Cys ratio (P = .003) and reached a peak in the Diet 4 treatment group.

3. Results 3.6. Relative mTOR gene mRNA expressions in liver and muscle 3.1. Growth performance The relative mRNA expressions of the genes in the hepatic and muscular mTOR signaling pathway are presented in Table 9. The RagA/ B, RagC/D, Raptor, and eIF4B mRNA levels in the liver were not affected (P > .05) by the dietary Met/Cys ratio. Nevertheless, the aforementioned parameters in the muscle had positive linear and

All fish accepted the diets and there was zero mortality during the experimental period. Growth performance data are shown in Table 4. WGR, SGR, FE, and PER had positive linear and quadratic responses (P < .001) to the dietary Met/Cys ratio. Maximum gains were 4

Aquaculture 518 (2020) 734869

H. Feng, et al.

Table 4 Effects of dietary Met/Cys ratio on growth performance of Epinephelus coioides. Parameters

WGR (%) SGR (% d−1) FE FI (% d−1) PER (%) HSI (%) CF (g cm−3)

Diets (Met/Cys ratio)

Pooled SEM

Diet 1 (0.76)

Diet 2 (1.07)

Diet 3 (1.43)

Diet 4 (1.93)

Diet 5 (2.77)

Diet 6 (4.50)

121.71c 1.42c 0.80c 1.70 1.61d 1.87 2.90

154.74b 1.67b 0.87b 1.79 1.76c 1.69 2.80

172.14ab 1.79ab 0.91b 1.80 1.84bc 1.82 2.70

179.35ab 1.84ab 0.92b 1.83 1.91b 1.72 2.80

200.29a 1.96a 1.00a 1.79 2.00a 1.83 2.75

154.71ab 1.67ab 0.89b 1.75 1.85bc 1.88 2.65

5.96 0.04 0.01 0.01 0.03 0.04 0.04

Linear

Quadratic 2

P-value

R

< 0.001 < 0.001 < 0.001 0.062 < 0.001 0.956 0.102

0.545 0.577 0.592 0.191 0.592 0.035 0.150

P-value

R2

< 0.001 < 0.001 < 0.001 0.010 < 0.001 0.323 0.273

0.826 0.821 0.808 0.440 0.804 0.032 0.150

Values in the same row with different superscripts show significant difference (P < .05). CF, condition factor; FE, feed efficiency; FI, feed intake; HSI, hepatosomatic index; PER, protein efficiency ratio SGR, specific growth rate; WGR, weight gain rate.

reported for fingerling Labeo rohita (33%) (Abidi and Khan, 2011) but lower than those reported for Nile tilapia (Oreochromis niloticus) (49%) (Nguyen and Davis, 2009) and channel catfish (60%) (Harding et al., 1977). The discrepancies of results from the aforementioned studies may be explained by the use of different fish species and/or life cycle stages (He et al., 2016). In the present study, there was no linear and quadratic response between whole-body moisture, crude protein, crude lipid, or ash content with the dietary Met/Cys ratio. However, the lowest whole-body crude protein content was measured for the fish maintained on Diet 1 (Met/Cys ratio = 0.76) according to multiple comparisons, which may be associated with dietary Met deficiency as this amino acid initiates protein synthesis in eukaryotes (Brosnan et al., 2007). Similar results were found in other reports (Kim et al., 1992; Ruchimat et al., 1997; Luo et al., 2005a; Zhou et al., 2011; Wang et al., 2016). Met also plays an important role in cellular metabolism as a methyl donor. Forty-eight percent of all dietary Met metabolism occurs in the liver (Corrales et al., 2002; Kwasek et al., 2014). MS and BHMT are major enzymes in the remethylation pathway. The enzyme SAHH regulates transmethylation, transsulfuration, and purine metabolism (Kloor and Osswald, 2004). In this study, hepatic BHMT and SAHH activity did not vary across dietary treatments. Therefore, the Met cycle was relatively balanced. However, its performance in fish on diets with low Met/Cys ratios was inferior to that for fish on diets with high Met/ Cys ratios. The MS level had a positive linear response to the dietary Met/Cys ratio. A similar observation was made for turbot (Scophthalmus maximus L.) (Gao et al., 2019). CBS is a key enzyme in the transsulfuration pathway. It catalyzes the conversion of homocysteine to cystathionine and thence to cysteine (Brosnan et al., 2007). In a study on rats, Ohuchi et al. (2009) reported that CBS expression was influenced by high dietary protein but not by dietary Met supplementation. However, Gao et al. (2019) noted that hepatic CBS gene expression in turbot (Scophthalmus maximus L.) decreased with increasing dietary Met. This finding resembled that reported for chickens (Aggrey et al., 2017). In contrast, hepatic CBS activity in fish fed a diet with the lowest Met/Cys ratio was lower than those for the fish on the other diets in the current study. The same discovery was made for rats fed a Met-deficient diet (Finkelstein et al., 1986). Dietary Cys levels varied among these experiments. Here, the dietary Cys level was set as a variable. In other

quadratic responses to the dietary Met/Cys ratio (P < .05). Ragulator and 4E-BP mRNA expression levels in the liver and muscle had positive and negative quadratic responses to the dietary Met/Cys ratio respectively (P < .05). There were positive linear and quadratic correlations between the V-ATPase mRNA expression level in the liver and muscle and dietary Met/Cys ratio (P < .05). The same mRNA expression pattern followed by other genes such as mLST8, mTOR, S6K, and eIF4E in response to dietary Met/Cys ratio (P < .05). The S6 mRNA level had a positive quadratic response to the dietary Met/Cys ratio (P < .05) in the liver and muscle but a positive linear response to the dietary Met/ Cys ratio (P < .05) only in the muscle. 4. Discussion Fish growth is strongly associated with amino acid utilization (Kroeckel et al., 2015). Here, growth rate, feed efficiency, protein efficiency rate, and daily feed intake had positive linear and quadratic responses to the dietary Met/Cys ratio. Similar results were reported for turbot (Scophthalmus maximus L.) (Gao et al., 2019), Japanese flounder (Paralichthys olivaceus) (Alam et al., 2015) and Atlantic salmon (Espe et al., 2014). However, fish receiving the lowest Met/Cys ratio (0.76) presented with reduced WGR, SGR, FE, and PER relative to those on the other diets. Thus, dietary Met deficiency may inhibit grouper growth. This hypothesis accords with the findings reported for previous studies on cobia (Rachycentron canadum) (Wang et al., 2016), Nile tilapia (Oreochromis niloticus) (Michelato et al., 2018; He et al., 2015), rainbow trout (Oncorhynchus mykiss) (Rolland et al., 2015), and grass carp (Ctenopharyngodon idella) (Su et al., 2018). Met plays vital roles in fish growth and feed utilization. In terms of WGR and SGR, the highest values of them were observed for the fish maintained on Diet 5 (27% TSAA as Cys). Nevertheless, with increasing Cys up to Diet 3 (41% TSAA as Cys), WGR was not significantly different from that of Diet 5, but when dietary Cys increased from Diet 3 to Diet 2, WGR significantly decreased vs. Diet 5. Therefore, Cys could replace up to 41% of the dietary Met without any adverse effect on fish growth. This conclusion resembled those reported for red drum (Sciaenops ocellatus) (40%) (Moon and Gatlin, 1991), barramundi (Lates calcarifer) (40%) (Poppi et al., 2017), and rainbow trout (Oncorhynchus mykiss) (42%) (Kim et al., 1992). On the other hand, our result was higher than those

Table 5 Effects of dietary Met/Cys ratio on whole-body composition (%, wet weight basis) of Epinephelus coioides. Parameters

Moisture Crude protein Crude lipid Ash

Diets (Met/Cys ratio)

Pooled SEM

Diet 1 (0.76)

Diet 2 (1.07)

Diet 3 (1.43)

Diet 4 (1.93)

Diet 5 (2.77)

Diet 6 (4.50)

71.46 16.27b 5.79 4.80

71.69 17.12a 4.89 4.83

71.62 16.97a 5.17 4.62

71.63 16.85a 5.69 4.42

71.77 17.00a 5.64 4.42

71.66 17.12a 5.14 4.68

Values in the same row with different superscripts show significant difference (P < .05). 5

0.05 0.09 0.11 0.06

Linear

Quadratic

P-value

R2

P-value

R2

0.191 0.074 0.838 0.094

0.105 0.135 0.002 0.165

0.300 0.113 0.946 0.072

0.148 0.153 0.007 0.296

Aquaculture 518 (2020) 734869

H. Feng, et al.

Table 6 Effects of dietary Met/Cys ratios on metabolic enzymes activity in liver of Epinephelus coioides. Parameters

Diets (Met/Cys ratio)

MS (U L−1) BHMT (U L−1) SAHH (U L−1) CBS (U L−1)

Pooled SEM

Diet 1 (0.76)

Diet 2 (1.07)

Diet 3 (1.43)

Diet 4 (1.93)

Diet 5 (2.77)

Diet 6 (4.50)

83.20 7.13 54.93 40.92d

86.07 7.07 55.08 42.14cd

87.53 7.00 55.23 43.27bcd

87.73 7.05 56.24 44.26bc

89.27 7.08 56.46 45.05b

88.75 7.28 56.02 47.22a

0.85 0.06 0.30 0.49

Linear

Quadratic 2

P-value

R

0.026 0.504 0.0832 < 0.001

0.229 0.021 0.130 0.749

P-value

R2

0.056 0.367 0.213 < 0.001

0.229 0.091 0.137 0.753

Values in the same row with different superscripts show significant difference (P < .05). BHMT, betaine homocysteine methyltransferase; CBS, cystathionine β-synthase; MS, methionine synthase; SAHH, S-adenosylhomocysteine hydrolase. Table 7 Effects of dietary Met/Cys ratios on serum immune parameters in Epinephelus coioides. Parameters

Diets (Met/Cys ratio)

IgM (mg mL-l) C3 (μg mL-l) ACP (U L-l) AKP (U L-l) LZM (U mL-l)

Pooled SEM

Diet 1 (0.76)

Diet 2 (1.07)

Diet 3 (1.43)

Diet 4 (1.93)

Diet 5 (2.77)

Diet 6 (4.50)

1.37c 119.97b 1.36b 3.26b 5.03

1.53bc 139.33ab 1.80a 3.96ab 6.44

1.72abc 178.20ab 2.13a 4.17a 8.96

2.20ab 203.40a 2.09a 4.42a 11.99

2.37a 188.45ab 2.03a 4.50a 8.93

2.36a 184.00ab 2.06a 4.26a 9.34

0.11 8.80 0.07 0.12 0.77

Linear

Quadratic 2

P-value

R

< 0.001 0.004 0.002 0.003 0.039

0.560 0.413 0.349 0.333 0.180

P-value

R2

< 0.001 0.002 < 0.001 < 0.001 0.027

0.567 0.555 0.570 0.492 0.290

Values in the same row with different superscripts show significant difference (P < .05). ACP, acid phosphatase; AKP, alkaline phosphatase; LZM, lysozyme. Table 8 Effects of dietary Met/Cys ratios on antioxidant capacity in liver of Epinephelus coioides. Parameters

Diets (Met/Cys ratio)

GSH-Px(U g−1 prot) SOD (U mg−1 prot) CAT (U mg−1 prot) MDA (nmol mg−1 prot)

Pooled SEM

Diet 1 (0.76)

Diet 2 (1.07)

Diet 3 (1.43)

Diet 4 (1.93)

Diet 5 (2.77)

Diet 6 (4.50)

120.74d 331.58c 45.97b 1.82a

126.21d 418.07b 55.90ab 1.90a

138.05cd 461.40b 70.35ab 1.72ab

187.09b 643.98a 73.38ab 1.69ab

222.18a 430.04b 84.49a 1.20b

166.96bc 435.71b 73.21ab 1.15b

8.58 18.52 3.65 0.08

Linear

Quadratic 2

P-value

R

< 0.001 0.142 0.002 < 0.001

0.511 0.110 0.396 0.543

P-value

R2

0.002 0.003 0.001 < 0.001

0.560 0.479 0.502 0.580

Values in the same row with different superscripts show significant difference (P < .05). CAT, catalase; GSH-Px, glutathione peroxidase; MDA, malondialdehyde; SOD, superoxide dismutase. Table 9 Effects of dietary Met/Cys ratios on relative mRNA expressions of genes in mTOR signaling pathway in liver and muscle of Epinephelus coioides. Parameters

V-ATPase Ragulator RagA/B RagC/D Raptor mLST8 mTOR 4E-BP S6K eIF4E eIF4B S6

Diets (Met/Cys ratio)

liver muscle liver muscle liver muscle liver muscle liver muscle liver muscle liver muscle liver muscle liver muscle liver muscle liver muscle liver muscle

Pooled SEM

Diet 1 (0.76)

Diet 2 (1.07)

Diet 3 (1.43)

Diet 4 (1.93)

Diet 5 (2.77)

Diet 6 (4.50)

0.80b 0.54d 1.78a 1.71a 0.74 0.32c 0.87 0.70b 0.67 0.63c 0.75 0.59b 0.56b 0.51c 1.65a 0.93a 0.46c 0.49c 0.80c 0.35c 0.65c 0.48b 0.46b 0.60b

0.78b 1.13bc 1.95a 1.86a 0.87 0.54b 1.03 1.02a 0.67 0.80bc 0.79 0.61b 0.89a 0.75bc 0.82b 0.62bc 0.63b 0.79b 0.90bc 0.78b 0.82b 0.91a 0.72b 0.75a

0.72b 1.33a 1.82a 1.85a 0.81 0.70ab 0.98 0.97a 0.64 0.76bc 0.79 0.63b 1.05a 0.74bc 0.66b 0.54bc 0.62ab 0.82b 0.88bc 0.99ab 0.84b 1.01a 0.74b 0.89a

1.03a 1.16bc 1.92a 2.00a 0.79 0.82a 0.93 1.11a 0.73 0.94ab 0.96 0.93a 1.08a 0.75bc 0.66b 0.69bc 0.88b 0.99ab 1.19a 0.91ab 1.04a 1.04a 0.88a 1.02a

0.81b 1.27ab 2.11a 2.21a 0.86 0.78a 0.95 1.15a 0.84 0.88ab 0.92 0.86a 1.09a 1.11a 0.58b 0.41c 0.95a 1.19a 1.21a 1.11a 0.90ab 0.98a 0.95a 0.97a

1.03a 1.03c 1.22b 1.18b 0.93 0.68ab 1.01 0.97a 0.78 1.03a 0.90 0.76ab 0.99a 0.98b 0.91b 0.77ab 0.74a 0.98ab 1.03ab 0.88b 0.97ab 1.04a 0.62b 0.94a

Values in the same row with different superscripts show significant difference (P < .05). 6

0.03 0.07 0.09 0.11 0.03 0.05 0.02 0.04 0.05 0.04 0.03 0.04 0.06 0.06 0.10 0.05 0.05 0.06 0.05 0.07 0.04 0.06 0.05 0.04

Linear

Quadratic 2

P-value

R

0.012 0.035 0.171 0.262 0.193 0.004 0.425 0.051 0.230 < 0.001 0.006 0.006 0.001 < 0.001 0.079 0.309 0.008 < 0.001 0.002 0.003 0.350 0.016 0.085 0.007

0.334 0.246 0.139 0.032 0.127 0.514 0.050 0.206 0.089 0.730 0.386 0.348 0.571 0.691 0.235 0.009 0.459 0.665 0.550 0.471 0.055 0.348 0.212 0.332

P-value

R2

0.032 < 0.001 0.013 0.019 0.435 < 0.001 0.653 0.001 0.482 < 0.001 0.015 0.008 < 0.001 0.001 < 0.001 0.004 0.005 < 0.001 0.003 < 0.001 0.461 0.004 0.005 0.024

0.369 0.824 0.517 0.454 0.129 0.909 0.069 0.664 0.093 0.713 0.428 0.400 0.906 0.666 0.834 0.307 0.613 0.795 0.645 0.848 0.098 0.561 0.586 0.309

Aquaculture 518 (2020) 734869

H. Feng, et al.

Raptor and hepatic mLST8 and mTOR mRNA expression compared with the fish maintained on the other diets in this study. Amino acid deprivation inactivated Rags via the mTORC1 pathway (Bar-Peled et al., 2012). Raptor is a scaffold protein that regulates mTORC1 assembly, localization, and substrate binding (Laplante and Sabatini, 2012). Moreover, AA supplementation induces Raptor and mLST8 to activate mTOR (Kim et al., 2002; Hara et al., 2002). Similarly, Gao et al. (2015) reported that mRNA levels of Raptor, mLST8, and mTOR were markedly increased with the optimal addition of leucine or histidine in bovine mammary epithelial cells. Amino acids activate mTORC1 and phosphorylate the downstream translation regulatory factors 4E-BP and S6K. The latter two are substrates that affect protein synthesis mainly by initiating mRNA translation. Previous studies showed that leucine, tryptophan, arginine, and isoleucine promote fish protein synthesis by altering S6K and 4E-BP gene expression in the mTOR pathway (Zhao et al., 2012; Tang et al., 2013; Ren et al., 2015; Tu et al., 2015; Liang et al., 2016; Zhou et al., 2019). Jiang et al. (2017) found that Met deprivation suppressed TOR signaling via reduced S6K, S6, and 4E-BP1 phosphorylation. In the present study, compared with the other diets, the lowest Met/Cys ratio (0.76) regimen significantly downregulated S6K, eIF4E, eIF4B, and S6 mRNA but upregulated 4E-BP mRNA in the liver and muscle. Similar findings were reported for juvenile grass carp (Pan et al., 2016; Su et al., 2018). The aforementioned data approximately paralleled to the results of WGR, which suggest that an appropriate Met/Cys ratio (range 1.93–2.77) is conducive to up-stream genes expression of TOR pathway thereby promote growth of fish. The low body protein content and inferior growth observed in the grouper maintained on Diet 1 (Met/Cys ratio = 0.76) may be explained by the fact that this regimen downregulated the mTOR pathway genes related to protein synthesis. In juvenile grouper, growth rate, feed utilization, feed intake, and methionine synthase and cystathionine β-synthase activity all increased with dietary Met/Cys ratio. Serum immune and hepatic antioxidant parameters also showed positive linear and/or quadratic responses to the dietary Met/Cys ratio. Dietary Met/Cys ratio did not affect the mRNA levels of RagA/B, RagC/D, Raptor, or eIF4B in the liver but did influence the mRNA levels of the upstream and downstream genes in the muscle. In the latter case, the levels of all mRNAs except 4E-BP had positive linear and quadratic responses to the dietary Met/Cys ratio. The 4E-BP mRNA had linear and quadratic responses to the dietary Met/Cys ratio. However, it remains to be empirically determined how the degree of phosphorylation of the signaling genes in the mTOR pathway regulate fish growth.

studies, however (Kwasek et al., 2014; Michelato et al., 2018; Gao et al., 2019), the Cys supplementation level was fixed. The aforementioned inconsistencies may be explained by varying degrees of Cys feed supplementation efficacy. Moreover, the diets with relatively lower Met/ Cys ratios had a certain impact on transsulfuration. Alterations in this process may adversely affect fish immunity and antioxidant capacity. Relative increases in serum LZM, ACP, and AKP activity and IgM and C3 content reflect enhanced immune function in fish (Zhang et al., 2014). For juvenile Jian carp (Cyprinus carpio var. Jian) (Tang et al., 2009) and Nile tilapia (Oreochromis niloticus) (He et al., 2015), the immunomodulatory effect of Met was determined to be the consequence of increased serum C3 and IgM content and LZM activity induced by Met supplementation. In the current study, the values of the aforementioned parameters were all lower for grouper maintained on Met-deficient diets than those receiving Diets 2–6. Thus, even a low Met/Cys ratio or a low feed Met content is still adequate for normal immune function in grouper. Moreover, optimal dietary DL-methionylDL-methionine (Met-Met) or Met-hydroxy analog (MHA) supplementation increased LZM and ACP activity and C3 and IgM content in the head kidney, spleen, and/or intestine of juvenile grass carp (Pan et al., 2016; Su et al., 2018). Therefore, adequate dietary Met activates immune system function which, in turn, increases immunoglobulin and complement biosynthesis (Blachier et al., 2013; Liu et al., 2013). Met also plays a prominent role in the antioxidant system because it generates glutathione via its sulfur metabolite (Wei et al., 2019). Generally, in the present study, hepatic antioxidant enzyme activity increased with the dietary Met/Cys ratio. A similar observation was also reported for grouper (Chi et al., 2015) and Nile tilapia (Oreochromis niloticus) (He et al., 2015). Nevertheless, Perez-Jimenez et al. (2012) stated that dietary Met supplementation did not alter hepatic CAT or GSH-Px activity in gilthead sea bream (Sparus aurata). These discrepancies might be ascribed to the differences among the studies in terms of fish species, growth stage, or growth environment. A recent study on broilers found that Met deficiency decreased SOD, GSH-Px, and CAT activity as well as cecal tonsil injury (Wu et al., 2018). Unlike antioxidant enzyme activity, hepatic MDA content had negative linear and quadratic responses to the dietary Met/Cys ratio in this study. Decreased serum MDA was reported for Nile tilapia maintained on Metsupplementing diets (He et al., 2015). Improvement of antioxidant status and reduction of lipid peroxidation in fish fed diets with high Met/Cys ratios or Met content may be explained by the fact that Met synthesizes the low-molecular-weight antioxidant glutathione (Blachier et al., 2013; Hansen and Grunnet, 2013). On the other hand, Met also chelates lead and removes it from tissues, thereby diminishing oxidative stress (Patra et al., 2001). The restricted EAA levels in the experimental diets may have retarded fish growth by inhibiting protein synthesis (Wang et al., 2016). This process is regulated predominantly by the mTOR pathway (Jewell et al., 2013). Here, we evaluated the expression levels of the upstream (V-ATPase, Ragulator, RagA/B, RagC/D, mLST8, Raptor, and mTOR) and downstream (4E-BP, S6K, eIF4E, eIF4B, and S6) genes in the mTOR pathway. It is generally recognized that EAA are major signals activating the mTORC1 pathway (Wang et al., 1998; Sancak et al., 2008; Jewell et al., 2013). The mTORC1 is activated in the lysosomes. It is mediated by an amino acid-sensing cascade comprising Rag GTPase, Ragulator, and V-ATPase (Jewell et al., 2013). V-ATPase is a positive regulator of the mTORC1 pathway (Zoncu et al., 2011). It induces Ragulator guanine exchange factor (GEF) activity (Jewell et al., 2013). Here, the hepatic RagA/B, RagC/D, and Raptor mRNA levels were not affected by the dietary Met/Cys ratio. However, the muscular mRNA levels of all upstream genes except Ragulator increased with dietary Met/Cys ratio. Ragulator activity declined with rising dietary Met/Cys ratio. Thus, adequate Met supply may enhance the expression of the upstream genes in the hepatic and especially the muscular mTOR pathways. On the other hand, fish fed the lowest-Met/Cys ratio diet (Diet 1) presented with downregulated muscular RagA/B, RagC/D, and

Funding sources This study was supported by the funding from the National Natural Science Foundation of China (Grant Nos. 31772861 and 31372546), and the Science and Technology Major/Special Project of Fujian Province (No. 2016NZ0001–3). Declaration of Competing Interest The authors declare no conflict of interest. References Abidi, S., Khan, M., 2011. Total Sulphur amino acid requirement and cystine replacement value for fingerling rohu, Labeo rohita: effects on growth, nutrient retention and body composition. Aquac. Nutr. 17, 583–594. Aggrey, S.E., González-Cerón, F., Rekaya, R., Mercier, Y., 2017. Gene expression differences in the methionine remethylation and transsulphuration pathways under methionine restriction and recovery with D,L-methionine or D,L-HMTBA in meat-type chickens. J. Anim. Physiol. Anim. Nutr. 102, e468–e475. Ahmed, I., 2014. Dietary amino acid L-methionine requirement of fingerling Indian catfish, Heteropneustes fossilis (Bloch-1974) estimated by growth and haemato-biochemical parameters. Aquac. Res. 45, 243–258. Alam, M.S., Teshima, S., Ishikawa, M., Koshio, S., Yaniharto, D., 2015. Methionine

7

Aquaculture 518 (2020) 734869

H. Feng, et al.

protein-bound lysine from casein and fish meal in juvenile turbot (Psetta maxima). Brit. J. Nutr. 113, 718–727. Kwasek, K., Terova, G., Lee, B.J., Bossi, E., Saroglia, M., Dabrowski, K., 2014. Dietary methionine supplementation alters the expression of genes involved in methionine metabolism in salmonids. Aquaculture 433, 223–228. Laplante, M., Sabatini, D.M., 2012. mTOR signaling in growth control and disease. Cell 149, 274–293. Li, X., Wu, X., Dong, Y., Gao, Y., Yao, W., Zhou, Z., 2019. Effects of dietary lysine levels on growth, feed utilization and related gene expression of juvenile hybrid grouper (Epinephelus fuscoguttatus ♀×Epinephelus lanceolatus ♂). Aquaculture 502, 153–161. Liang, H., Ren, M., Habte-Tsion, H.M., Ge, X., Xie, J., Mi, H., Xi, B., Miao, L., Liu, B., Zhou, Q., Fang, W., 2016. Dietary arginine affects growth performance, plasma amino acid contents and gene expressions of the TOR signaling pathway in juvenile blunt snout bream, Megalobrama amblycephala. Aquaculture 461, 1–8. Liu, W., Liu, W., Zhang, X., Pu, Q., 2013. Effects of different methionine sources on performance, immune indices and antioxidant function of broiler breeders. Chin. J. Anim Nutr. 25, 2118–2125. Loewith, R., Jacinto, E., Wullschleger, S., Lorberg, A., Crespo, J.L., Bonenfant, D., Oppliger, W., Jenoe, P., Hall, M.N., 2002. Two TOR complexes, only one of which is rapamycin sensitive, have distinct roles in cell growth control. Mol. Cell 10, 457–468. Luo, Z., Liu, Y.J., Mai, K.S., Tian, L.X., Liu, D.H., Tan, X.Y., 2004. Optimal dietary protein requirement of grouper Epinephelus coioides fed isoenergetic diets in floating net cages. Aquac. Nutr. 10, 247–252. Luo, Z., Liu, Y.J., Mai, K.S., Tian, L.X., Yang, H.J., Tan, X.Y., Liu, D.H., 2005a. Dietary Lmethionine requirement of juvenile grouper Epinephelus coioides at a constant dietary cystine level. Aquaculture 249, 409–418. Luo, Z., Liu, Y.J., Mai, K.S., Tian, L.X., Liu, D.H., Tan, X.Y., Lin, H.Z., 2005b. Effect of dietary lipid level on growth performance, feed utilization and body composition of grouper Epinephelus coioides juveniles fed isonitrogenous diets in floating netcages. Aquac. Int. 13, 57–269. Martinez, Y., Li, X., Liu, G., Bin, P., Yan, W., Más, D., Valdivié5, M., Hu, C.A.A., Ren, W., Yin, Y., 2017. The role of methionine on metabolism, oxidative stress, and diseases. Amino Acids 49, 2091–2098. Merino, G.E., Jetzer, T., Doizakl, W.M.D., Najarian, J.S., 1975. Methionine-induced hepatic coma in dogs. Am. J. Surg. 130, 41–46. Michelato, M., Furuya, W.M., Gatlin III, D.M., 2018. Metabolic responses of Nile tilapia Oreochromis niloticus to methionine and taurine supplementation. Aquaculture 485, 66–72. Millamena, O.M., 2002. Replacement of fish meal by animal by-product meals in a practical diet for grow-out culture of grouper Epinephelus coioides. Aquaculture 204, 75–84. Moon, H.Y., Gatlin, D.M., 1991. Total sulfur amino acid requirement of juvenile red drum, Sciaenops Ocellatus. Aquaculture 95, 97–106. Nguyen, T.N., Davis, D.A., 2009. Re-evaluation of total Sulphur amino acid requirement and determination of replacement value of cystine for methionine in semi-purified diets of juvenile Nile tilapia, Oreochromis niloticus. Aquac. Nutr. 15, 247–253. Ohuchi, S., Morita, T., Mori, M., Sugiyama, K., 2009. Hepatic cystathionine B-synthase activity does not increase in response to methionine supplementation in rats fed a low casein diet: association with plasma homocysteine concentrations. J. Nutr. Sci. Vitaminol. 55, 178–185. Pan, F.Y., Feng, L., Jiang, W.D., Jiang, J., Wu, P., Kuang, S.Y., Tang, L., Tang, W.N., Zhang, Y.A., Zhou, X.Q., Liu, Y., 2016. Methionine hydroxy analogue enhanced fish immunity via modulation of NF-kB, TOR, MLCK, MAPKs and Nrf2 signaling in young grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 56, 208–228. Patra, R.C., Swarup, D., Dwivedi, S.K., 2001. Antioxidant effects of α tocopherol, ascorbic acid and l-methionine on lead induced oxidative stress to the liver, kidney and brain in rats. Toxicol. 162, 81–88. Perez-Jimenez, A., Peres, H., Rubio, V.C., Oliva-Teles, A., 2012. The effect of dietary methionine and white tea on oxidative status of gilthead sea bream (Sparus aurata). Brit. J. Nutr. 108, 1202–1209. Poppi, D.A., Moore, S.S., Glencross, B.D., 2017. Redefining the requirement for total sulfur amino acids in the diet of barramundi (Lates calcarifer) including assessment of the cystine replacement value. Aquaculture 471, 213–222. Rahimnejad, S., Bang, I.C., Park, J.Y., Sade, A., Choi, J., Lee, S.M., 2015. Effects of dietary protein and lipid levels on growth performance, feed utilization and body composition of juvenile hybrid grouper, Epinephelus fuscoguttatus × E. lanceolatus. Aquaculture 446, 283–289. Ren, M., Habte-Tsion, H.M., Liu, B., Miao, L., Ge, X., Xie, J., Liang, H., Zhou, Q., Pan, L., 2015. Dietary leucine level affects growth performance, whole body composition, plasma parameters and relative expression of TOR and TNF-ɑ in juvenile blunt snout bream, Megalobrama amblycephala. Aquaculture 448, 162–168. Rodehutscord, M., Jacobs, S., Pack, M., Pfeffer, E., 1995. Response of rainbow trout (Oncorhynchus mykiss) growing from 50 to 150 g to supplements of DL-methionine in a semipurified diet containing low or high levels of cystine. J. Nutr. 125, 964–969. Rolland, M., Dalsgaard, J., Holm, J., Dalsgaard, J., Skov, P.V., 2015. Effect of plant proteins and crystalline amino acid supplementation on postprandial plasma amino acid profiles and metabolic response in rainbow trout (Oncorhynchus mykiss). Aquac. Int. 23, 1071–1087. Ruchimat, T., Masumoto, T., Hosokawa, H., Shimeno, S., 1997. Quantitative methionine requirement of yellowtail (Seriola quinqueradiata). Aquaculture 150, 113–122. Sancak, Y., Peterson, T.R., Shaul, Y.D., Lindquist, R.A., Thoreen, C.C., Bar-Peled, L., Sabatini, D.M., 2008. The rag GTPases bind raptor and mediate amino acid signaling to mTORC1. Science 320, 1496–1501. Santiago, C.B., Lovell, R.T., 1988. Amino acid requirements for growth of Nile tilapia. J. Nutr. 118, 1540–1546. Sarbassov, D.D., Guertin, D.A., Ali, S.M., Sabatini, D.M., 2005. Phosphorylation and

requirement of juvenile Japanese flounder Paralichthys olivaceus estimated by the oxidation of radioactive methionine. Aquac. Nutr. 7, 201–209. AOAC, 2005. Official Methods of Analysis. Association of Analytical Chemists, Arlington, VA, USA. Bar-Peled, L., Schweitzer, L.D., Zoncu, R., Sabatini, D.M., 2012. Ragulator is a GEF for the Rag GTPases that signal amino acid levels to mTORC1. Cell 150, 1196–1208. Blachier, F., Wu, G., Yin, Y., 2013. Nutritional and Physiological Functions of Amino Acids in Pigs. Boonyaratpalin, M., 1997. Nutrient requirements of marine food fish cultured in Southeast Asia. Aquaculture 151, 283–313. Brosnan, J.T., Brosnan, M.E., Bertolo, R.F.P., Brunton, J.A., 2007. Methionine: a metabolically unique amino acid. Life Sci. 112, 2–7. Chi, S.Y., Wang, X.W., Tan, B.P., Yang, Q.H., Dong, X.H., Liu, H.Y., Zhang, S., 2015. Effects of dietary methionine on the growth performance, anti-oxidation and activities of gluconeogenesis-related enzyme in juvenile groupers, Epinephelus coioides. Acta Hydrobiologica Sinica 4, 645–652. China Fishery Statistics Yearbook, 2019. Bureau of Fisheries. Ministry of Agriculture, China Agriculture Press, Beijing, China. Corrales, F.J., Pérez-Mato, I., Sánchez del Pino, M.M., Ruiz, F., Castro, C., GarcíaTrevijano, E.R., Latasa, U., Martínez-Chantar, M.U., Martínez-Cruz, A., Avila, M.A., Mato, J.M., 2002. Regulation of mammalian liver methionine adenosyltransferase. J. Nutr. 132 (8 Suppl), 2377S–2381S. Espe, M., Andersen, S.M., Holen, E., Rønnestad, I., Veiseth-Kent, E., Zerrahn, J.E., Aksnes, A., 2014. Methionine deficiency does not increase polyamine turnover through depletion of hepatic S-adenosylmethionine in juvenile Atlantic salmon. Br. J. Nutr. 112, 1274–1285. Farhat Khan, M.A., 2014. Total sulfur amino acid requirement and cystine replacement value for fingerling stinging catfish, Heteropneustes fossilis (Bloch). Aquaculture 426, 270–281. Finkelstein, J.D., Martin, J.J., Harris, B.J., 1986. Effect of dietary Cystine on methionine metabolism in rat liver. J. Nutr. 116, 985–990. Gao, H., Hu, H., Zheng, N., Wang, J., 2015. Leucine and histidine independently regulate milk protein synthesis in bovine mammary epithelial cells via mTOR signaling pathway. J. Zhejiang Univ-Sci. B (Biomed & Biotechnol). 16, 560–572. Gao, Z., Wang, X., Tan, C., Zhou, H., Mai, K., He, G., 2019. Effect of dietary methionine levels on growth performance, amino acid metabolism and intestinal homeostasis in turbot (Scophthalmus maximus L.). Aquaculture 498, 335–342. Griffin, M.E., White, M.R., Brown, P.B., 1994. Total sulfur amino acid requirement and cysteine replacement value for juvenile hybrid striped bass (Morone saxatilis × M. chrysops). Camp. Biochem. Physiol. 108, 423–429. Hansen, S.H., Grunnet, N., 2013. Taurine, glutathione and bioenergetics. Oxygen Transport to Tissue XXXIII 776, 3–12. Hara, K., Maruki, Y., Long, X., Yoshino, K., Oshiro, N., Hidayat, S., Tokunaga, C., Avruch, J., Yonezawa, K., 2002. Raptor, a binding partner of target of rapamycin (TOR), mediates TOR action. Cell 110, 177–189. Harding, D.E., Allen, O.W.Jr., Wilson, R.P., 1977. Sulfur amino acid requirement of channel catfish: L-methionine and L-cystine. J. Nutr. 107, 2031–2035. He, J.Y., Long, W.Q., Han, B., Tian, L.X., Yang, H.J., Zeng, S.L., Liu, Y.J., 2015. Effect of dietary L-methionine concentrations on growth performance, serum immune and antioxidative responses of juvenile Nile tilapia, Oreochromis niloticus. Aquac. Res. 48, 665–674. He, J.Y., Han, B., Tian, L.X., Yang, H.J., Zeng, S.L., Liu, Y.J., 2016. The sparing effect of cystine on methionine at a constant TSAA level in practical diets of juvenile Nile tilapia Oreochromis niloticus. Aquac. Res. 47, 2031–2039. Heitman, J., Movva, N.R., Hall, M.N., 1991. Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast. Science 23, 905–909. Huang, Y., Li, J., Wang, X.X., Wang, K., Ye, J.D., 2017. Effects of different dietary protein and starch levels on the growth and liver metabolism of grouper, Epinephelus coioides. J. Fish. China 41, 746–756. Jewell, J.L., Russell, R.C., Guan, K.L., 2013. Amino acid signalling upstream of mTOR. Nat. Rev. Mol. Cell Biol. 14, 133–139. Jiang, S.T., Wu, X.Y., Luo, Y., Wu, M.J., Lu, S.D., Jin, Z.B., Yao, W., 2016. Optimal dietary protein level and protein to energy ratio for hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂) juveniles. Aquaculture 465, 28–36. Jiang, H., Bian, F., Zhou, H., Wang, X., Wang, K., Mai, K., He, G., 2017. Nutrient sensing and metabolic changes after methionine deprivation in primary muscle cells of turbot (Scophthalmus maximus L.). J. Nutr. Biochem. 50, 74–82. Keembiyehetty, C.N., Gatlin III, D.M., 1993. Total sulfur amino acid requirement of juvenile hybrid striped bass (Morone chrysops×M. saxatilis). Aquaculture 110, 331–339. Kim, J., Guan, K.L., 2011. Amino acid signaling in TOR activation. Annu. Rev. Biochem. 80, 1001–1032. Kim, K.I., Kayes, T.B., Amundson, C.H., 1992. Requirements for sulfur amino acids and utilization of D-methionine by rainbow trout (Oncorhynchus Mykiss). Aquaculture 101, 95–103. Kim, D.H., Sarbassov, D.D., Ali, S.M., King, J.E., Latek, R.R., Erdjument-Bromage, H., Tempst, P., Sabatin, D.M., 2002. mTOR interacts with raptor to form a nutrientsensitive complex that signals to the cell growth machinery. Cell 110, 163–175. Kim, E., Goraksha-Hicks, P., Li, L., Neufeld, T.P., Guan, K.L., 2008. Regulation of TORC1 by rag GTPases in nutrient response. Nat. Cell Biol. 10, 935–945. Klatt, S.F., Danwitz, A.V., Hasler, M., Susenbeth, A., 2016. Determination of the lower and upper critical concentration of methionine + Cystine in diets of juvenile turbot (Psetta maxima). Aquaculture 452, 12–23. Kloor, D., Osswald, H., 2004. S-Adenosylhomocysteine hydrolase as a target for intracellular adenosine action. Trends Pharmacol. Sci. 25, 294–297. Kroeckel, S., Dietz, C., Schulz, C., Susenbeth, A., 2015. Bioavailability of free lysine and

8

Aquaculture 518 (2020) 734869

H. Feng, et al.

Wamberg, S., Engel, K., Kildeberg, P., 2010. Methionine-induced acidosis in the weanling rat. Acta Physiol. Scand. 129, 575–583. Wang, X., Campbell, L.E., Miller, C.M., Proud, C.G., 1998. Amino acid availability regulates p70 S6 kinase and multiple translation factors. Biochem. J. 334, 261–267. Wang, Z., Mai, K., Xu, W., Zhang, Y., Liu, Y., Ai, Q., 2016. Dietary methionine level influences growth and lipid metabolism via GCN2 pathway in cobia (Rachycentron canadum). Aquaculture 454, 148–156. Wang, X.X., Zhou, M.W., Huang, Y., Wang, K., Ye, J.D., 2017. Effects of dietary taurine level on growth performance and body composition of juvenile grouper (Epinephelus coioides) at different growth periods. Chin. J. Anim. Nutr. 29, 1810–1818. Wang, Y., Zhou, M., Li, J., He, L., Ye, J., 2019. Effects of dietary taurine on growth performance, body composition, expression of taurine transporter (TauT) mRNA and key enzyme activities of taurine synthesis in juvenile grouper (Epinephelus coioides). J. Fish. China 43, 1116–1125. Wei, H., Zhao, X., Xia, M., Tan, C., Gao, J., Htoo, J.K., Xu, C., Peng, J., 2019. Different dietary methionine to lysine ratios in the lactation diet: effects on the performance of sows and their offspring and methionine metabolism in lactating sows. J. Anim. Sci. Biotechnol. 10, 76. Wu, M., Lu, S., Wu, X., Jiang, S., Luo, Y., Yao, W., Jin, Z., 2017. Effects of dietary amino acid patterns on growth, feed utilization and hepatic IGF-I, TOR gene expression levels of hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) juveniles. Aquaculture 468, 508–514. Wu, B.Y., Zhu, M., Ruan, T., Li, L.J., Lyu, Y.N., Wang, H.S., 2018. Oxidative stress, apoptosis and abnormal expression of apoptotic protein and gene and cell cycle arrest in the cecal tonsil of broilers induces by dietary methionine deficiency. Res. Vet. Sci. 121, 65–75. Wullschleger, S., Loewith, R., Hall, M.N., 2006. TOR signaling in growth and metabolism. Cell 124, 471–484. Zhang, C.N., Li, X.F., Jiang, G.Z., Zhang, D.D., Tian, H.Y., Li, J.Y., Liu, W.B., 2014. Effects of dietary fructooligosaccharide levels and feeding modes on growth, immune responses, antioxidant capability and disease resistance of blunt snout bream (Megalobrama amblycephala). Fish Shellfish Immunol. 41, 560–569. Zhao, J., Yang, L., Jiang, J., Wu, P., Chen, G., Jiang, W., Li, S., Tang, L., Kuang, S., Feng, L., Zhou, X., 2012. Effects of dietary isoleucine on growth, the digestion and absorption capacity and gene expression in hepatopancreas and intestine of juvenile Jian carp (Cyprinus carpio var. Jian). Aquaculture 368-369, 117–128. Zhou, F., Xiao, J.X., Hua, Y., Ngandzali, B.O., Shao, Q.J., 2011. Dietary L-methionine requirement of juvenile black sea bream (Sparus macrocephalus) at a constant dietary cystine level. Aquac. Nutr. 17, 469–481. Zhou, Z., Wang, X., Wu, X., Gao, Y., Li, X., Dong, Y., Yao, W., 2019. Effects of dietary leucine levels on growth, feed utilization, neuro-endocrine growth axis and TORrelated signaling genes expression of juvenile hybrid grouper (Epinephelus fuscoguttatus ♀×Epinephelus lanceolatus ♂). Aquaculture 504, 172–181. Zoncu, R., Bar-Peled, L., Efeyan, A., Wang, S., Sancak, Y., Sabatini, D.M., 2011. mTORC1 senses lysosomal amino acids through an inside-out mechanism that requires the Vacuolar H+-ATPase. Science 334, 678–683.

regulation of Akt/PKB by the rictor-mTOR complex. Science 307, 1098–1101. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 3, 1101–1108. Seiliez, I., Gabillard, J.C., Skiba-Cassy, S., Garcia-Serrana, D., Gutie’rrez, J., Kaushik, S., Panserat, S., Tesseraud, S., 2008. An in vivo and in vitro assessment of TOR signaling cascade in rainbow trout (Oncorhynchus mykiss). Am. J. Phys. 295, 329–335. Shen, G.P., Wang, S.H., Dong, J.Y., Feng, J.H., Xu, J.J., Wang, X.X., Ye, J.D., 2019. Metabolic effect of dietary taurine supplementation on grouper: a 1H-NMR-based metabolomics study. Molecules 24, 2253. Simmons, L., Moccia, R.D., Bureau, D.P., 1999. Dietary methionine requirement of juvenile Arctic charr Salvelinus alpinus (L.). Aquac. Nutr. 5, 93–100. Skiba-Cassy, S., Geurden, I., Panserat, S., Seiliez, I., 2016. Dietary methionine imbalance alters the transcriptional regulation of genes involved in glucose, lipid and amino acid metabolism in the liver of rainbow trout (Oncorhynchus mykiss). Aquaculture 454, 56–65. Standards, C., 2000. Standards Office-Peoples Republic of China, GB/T 18246–2000. China Standards Press, Beijing, China. Standards, C., 2018. Standards Office-Peoples Republic of China, GB/T 15399–2018. China Standards Press, Beijing, China. Su, Y.N., Wu, P., Feng, L., Jiang, W.D., Jiang, J., Zhang, Y.A., Figueiredo-Silva, C., Zhou, X.Q., Liu, Y., 2018. The improved growth performance and enhanced immune function by DL-methionyl-DL-methionine are associated with NF-κB and TOR signalling in intestine of juvenile grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 74, 101–118. Tang, L., Wang, G.X., Jiang, J., Feng, L., Yang, L., Li, S.H., Kuang, S.Y., Zhou, X.Q., 2009. Effect of methionine on intestinal enzymes activities, microflora and humoral immune of juvenile Jian carp (Cyprinus carpio var. Jian). Aquac. Nutr. 15, 477–483. Tang, L., Feng, L., Sun, C.Y., Chen, G.F., Jiang, W.D., Hu, K., Liu, Y., Jiang, J., Li, S.H., Kuang, S.Y., Zhou, X.Q., 2013. Effect of tryptophan on growth, intestinal enzyme activities and TOR gene expression in juvenile Jian carp (Cyprinus carpio var. Jian): studies in vivo and in vitro. Aquaculture 412–413, 23–33. Teng, S.K., Chua, T.E., 1978. Effect of stocking density on the growth of estuary grouper, Epinephelus salmoides Maxwell, cultured in floating net-cages. Aquaculture 15, 273–287. Tu, Y., Xie, S., Han, D., Yang, Y., Jin, J., Zhu, X., 2015. Dietary arginine requirement for gibel carp (Carassis auratus gibelio var. CAS III) reduces with fish size from 50 g to 150 g associated with modulation of genes involved in TOR signaling pathway. Aquaculture 449, 37–47. Tuan, L.A., Williams, K.C., 2007. Optimum dietary protein and lipid specifications for juvenile Malabar grouper (Epinephelus malabaricus). Aquaculture 267, 129–138. Twibell, R.G., Wilson, K.A., Brown, P.B., 2000. Dietary sulfur amino acid requirement of juvenile yellow perch fed the maximum cystine replacement value for methionine. J. Nutr. 130, 612–616. Vélez, E.J., Lutfi, E., Jiménez-Amilburu, V., Riera-Codina, M., Capilla, E., Navarro, I., Gutiérrez, J., 2014. IGF-I and amino acids effects through TOR signaling on proliferation and differentiation of gilthead sea bream cultured myocytes. Gen. Comp. Endocrinol. 205, 296–304.

9