Hap1p Photofootprinting as an In Vivo Assay of Repression Mechanism in Saccharomyces cerevisiae

[41]

3. 4. 5. 6.

479

UV photofootprinting in yeast

(40 ng  and 100 ng /l) in BC100 buffer. Alternatively, the coexpressed NC2 complex can be added at similar concentrations.
Incubate at 28 for 60 min. Stop with 400 l stop solution, extract with phenol/chloroform, and
precipitate with isopropanol for 1 h at 20 . Spin down for 30 min at 13,500 rpm in a microfuge, wash with 80% ethanol, and dissolve the dried pellet in 10 l loading dye. Analyze the transcripts on a 5 % gel (acrylamide:bisacrylamide 19:1) containing 8 M urea.

Reconstitution of Transcription in Nuclear Extract 1. Prepare DNA mix as described for the purified system but without adding the DNA template. For runon transcription, use linear RNA polymerase II transcription templates (20 to 200 ng), appropriate nucleotide mix and 50 to 200 ng of purified recombinant NC2 complex. RNA polymerase III transcription is readily measurable, i.e., from the adenovirus VAI promoter, but is not decreased under these conditions. 2. Incubate DNA mix with NC2 premixed in HeLa nuclear extracts
(25–50 g of total protein) for 60 min at 28 and stop and process the reaction as described previously. Acknowledgments We thank Gregor Gilfillan and the members of the Meisterernst laboratory for critical reading of the manuscript. This work has been supported by grants of the DFG, the BMBF, and the EC to M.M.

[41] Hap1p Photofootprinting as an In Vivo Assay of Repression Mechanism in Saccharomyces cerevisiae By Mitsuhiro Shimizu and Aaron P. Mitchell Gene expression levels result from the dynamic interplay of activators and repressors. These factors may influence the basal transcriptional machinery directly or indirectly, through interactions that govern each other’s activity or access to DNA. One fundamental question in analysis of a repressor is whether it acts by preventing transcriptional activators from binding to DNA target sites (i.e., UASs or enhancers). We have used a

METHODS IN ENZYMOLOGY, VOL. 370

Copyright 2003, Elsevier Inc. All rights reserved. 0076-6879/03 $35.00

480

polymerase associated factors

[41]

system to address this question that may be applicable to any repressor. The strategy employs in vivo ultraviolet (UV) photofootprinting to detect activator binding with one of the most widely used yeast reporter genes, CYC1-lacZ. The CYC1-lacZ reporter gene, developed by Guarente and colleagues,1 has been utilized for analysis of many different repressors and repression sites.2–21 The CYC1 upstream region in this reporter (plasmid pLG
312S) includes binding sites for two different transcriptional activators: Hap1p, a Zn2-Cys6 zinc binuclear cluster protein that binds to UAS1 at 335 to 346 (numbered relative to the ATG initiation codon), and Hap2p/3p/4p/5p, the yeast CCAAT-binding complex that binds to UAS2 at 284 to 296. Our assay for activator binding focuses on the Hap 1p–UAS1 interaction. UV photofootprinting has been widely used for analyzing the DNA structure and protein–DNA interaction in vitro and in vivo. This technique is based on the premise that changes in DNA structure or the formation of protein–DNA complexes will alter rates of dimerization of adjacent bases on a particular DNA strand.22–26 The sites of UV photoproducts can be 1

L. Guarente and M. Ptashne, Proc. Natl. Acad. Sci. USA 78, 2199 (1981). S. R. Hepworth, L. K. Ebisuzaki, and J. Segall, Mol. Cell. Biol. 15, 3934 (1995). 3 K. S. Bowdish and A. P. Mitchell, Mol. Cell. Biol. 13, 2172 (1993). 4 H. S. Yoo and T. G. Cooper, Mol. Cell. Biol. 9, 3231 (1989). 5 M. Shimizu, W. Li, P. A. Covitz, M. Hara, H. Shindo, and A. P. Mitchell, Nucleic Acids Res. 26, 2329 (1998). 6 P. Herrero, M. Ramirez, C. Martinez-Campa, and F. Moreno, Nucleic Acids Res. 24, 1822 (1996). 7 K. D. Mehta and M. Smith, J. Biol. Chem. 264, 8670 (1989). 8 M. Vidal, A. M. Buckley, C. Yohn, D. J. Hoeppner, and R. F. Gaber, Proc. Natl. Acad. Sci. USA 92, 2370 (1995). 9 P. G. Siliciano and K. Tatchell, Proc. Natl. Acad. Sci. USA 83, 2320 (1986). 10 J. M. Lopes, K. L. Schulze, J. W. Yates, J. P. Hirsch, and S. A. Henry, J. Bacteriol. 175, 4235 (1993). 11 A. K. Vershon, N. M. Hollingsworth, and A. D. Johnson, Mol. Cell. Biol. 12, 3706 (1992). 12 L. W. Bergman, D. C. McClinton, S. L. Madden, and L. H. Preis, Proc. Natl. Acad. Sci. USA 83, 6070 (1986). 13 S. Sagee, A. Sherman, G. Shenhar, K. Robzyk, N. Ben-Doy, G. Simchen, and Y. Kassir, Mol. Cell. Biol. 18, 1985 (1998). 14 T. Wang, Y. Luo, and G. M. Small, J. Biol. Chem. 269, 24480 (1994). 15 P. A. Covitz and A. P. Mitchell, Genes Dev. 7, 1598 (1993). 16 A. D. Johnson and I. Herskowitz, Cell 42, 237 (1985). 17 P. A. Covitz, W. Song, and A. P. Mitchell, Genetics 138, 577 (1994). 18 C. A. Keleher, M. J. Redd, J. Schultz, M. Carlson, and A. D. Johnson, Cell 68, 709 (1992). 19 H. Friesen, S. R. Hepworth, and J. Segall, Mol. Cell. Biol. 17, 123 (1997). 20 R. Rodicio, J. J. Heinisch, and C. P. Hollenberg, Gene 125, 125 (1993). 21 R. A. Sumrada and T. G. Cooper, Proc. Natl. Acad. Sci. USA 84, 3997 (1987). 2

[41]

UV photofootprinting in yeast

481

detected by primer extension mapping using sequencing gel electrophoresis.23 We have shown that binding of Hap1p to UAS1 is detectable by in vivo UV photofootprinting, following the protocol described in this article. The useful feature of the footprint is that Hap1p binding results in a positive signal and enhancement of formation of UV photoproducts.27 Thus detection is extremely sensitive compared to a protection footprint because even limited occupancy of the UAS1 site yields a detectable signal. We have assigned the enhancement to Hap1p because enhancements of UV photoproducts were observed (i) within UAS1 (nucleotides 331 and 330), the known Hap1p-binding site, (ii) in cells from a HAP1 wild-type strain and not in cells from an isogenic hap1::LEU2 mutant, which lacks functional Hap1p, and (iii) only with DNA irradiated in whole cells and not with DNA that was purified prior to irradiation (see Fig. 1 and Shimizu et al.27). Thus the location and requirements for these enhancements demonstrate that they depend on Hap1p binding in vivo. With this system, one can ask whether repressors affect binding of the Hap1p activator to DNA in vivo. For example, we used the system in characterization of the yeast repressor Rme1p, whose function is to inhibit meiosis in haploid yeast cells (Fig. 2). Analysis of the natural Rme1p repression target gene, IME1, indicated that Rme1p acts through a region far upstream of IME1, at 2146 to 1743 (relative to the AUG initiation codon). To determine whether repression by Rme1p causes inhibition of DNA binding by transcriptional activators, we placed the 2146 to 1743 region from the IME1 locus upstream of the CYC1 regulatory region in the cyc1-lacZ plasmid to create plasmid RC-CYC1-lacZ and confirmed by -galactosidase assays that Rme1p represses RC-CYC1-lacZ expression. The following protocol describes assays of Hap1p-UAS1 binding in both repressed and derepressed strains.27 In Vivo Ultraviolet PhotoFootprinting Procedure

Sample Preparation UV photofootprinting is performed as described by Axelrod and Majors23 with minor modifications.27,28 22

M. M. Becker and J. C. Wang, Nature 309, 682 (1984). J. D. Axelrod and J. Majors, Nucleic Acids Res. 17, 171 (1989). 24 B. Suter, M. Livingstone-Zatchej, and F. Thoma, Methods Enzymol. 304, 447 (1999). 25 G. P. Pfeifer and S. Tornaletti, Methods 11, 189 (1997). 26 M. Shimizu, T. Mori, T. Sakurai, and H. Shindo, EMBO J. 19, 3358 (2000). 27 M. Shimizu, W. Li, H. Shindo, and A. P. Mitchell, Proc. Natl. Acad. Sci. USA 94, 790 (1997). 28 M. R. Murphy, M. Shimizu, S. Y. Roth, A. M. Dranginis, and R. T. Simpson, Nucleic Acids Res. 21, 3295 (1993). 23

482

polymerase associated factors

[41]

UV light

Yeast cell

DNA isolation

*

*

* * * * UV photoproducts

Primer extension 32

32

32

P

P

P

* * * DNA sequencing gel autoradiography

Fig. 1. Overview of in vivo photofootprinting. Yeast cells are UV irradiated, introducing UV photoproducts into DNA. These products block primer extension and may thus be mapped by the sizes of primer extension products, as detected by autoradiography. Presence of a protein bound to DNA alters local UV sensitivity and may either enhance or prevent production of a photoproduct, causing enhanced or reduced intensity of a primer extension reaction product.

1. Yeast cells are grown in 1000 ml YPAc (or SC-Ura) medium to early exponential phase (OD600 0.2–0.5) and harvested by vacuum filtration on a 90-mm filter. 2. Cells are resuspended in 15 ml of fresh medium. 3. Two 3.5-ml aliquots of the cell suspension are placed in petri dishes. One dish is for samples C1 and C2 and the other is for C3 and C4. In addition, four 1.5-ml samples are transferred to microfuge tubes (held on ice) for DNA preparations of unirradiated cells. 4. UV (254 nm) irradiations are carried out in a Stratalinker with open petri dishes. Sample Sample Sample Sample

C1: 250 mJ (setting of 2500 with the Stratalinker) C2: 500 mJ (setting of 2500 for two irradiation intervals) C3: 750 mJ (setting of 2500 for three irradiation intervals) C4: 1000 mJ (setting of 2500 for four irradiation intervals)

[41]

UV photofootprinting in yeast

483

Fig. 2. Inhibition of Hap1p-UAS1 binding through Rme1p-dependent repression. In vivo UV photofootprints of the noncoding strand of the UAS1 region in a CYC1-lacZ plasmid that includes Rme1p-binding sites and the flanking region inserted upstream of UAS1. Expression of the CYC1-lacZ reporter is repressed in the RME1 strain (left), but not in the rme1-213 mutant strain (center) or in a strain with a functional RME1 gene that carries rgr1 and sin4 mutations. For each strain, UV photoproducts in irradiated cells (lanes C) are compared with irradiated purified DNA (lanes D). The Hap1p-UAS1 photofootprint is detectable in the two derepressed strains (center and right) but not in the repressed strain (left). From Shimizu et al.27

After the each time of the irradiation, the cells should be resuspended by shaking or swirling the petri dish. 5. After the indicated doses, 1.5-ml samples are removed to microfuge tubes, and cells are pelleted for 1 min. The unirradiated samples (step 3) are also pelleted and treated in parallel through the following steps.

484

polymerase associated factors

[41]

6. Cell pellets are resuspended in 0.5 ml of 1 M sorbitol, 0.1 M EDTA containing 0.1% 2-mercaptoethanol (added freshly). 7. Add 50 l of Zymolase solution (10 mg/ml Zymolyase 100T in 40 mM potassium phosphate buffer, pH 7.2, 1 M sorbitol, 0.5 mM phenylmethylsulfonyl fluoride, 20 mM 2-mercaptoethanol) and incubate
at 30 for 30 min. 8. Spin down the spheroplasts for 1 min in a microfuge and suspend in 0.5 ml of 50 mM Tris–HCl (pH 8.0), 20 mM EDTA.
9. Add 50 l of 10% SDS and incubate at 68 for 30 min.
10. Add 10 l of proteinase K (10 mg/ml), and incubate at 68 for 1 h. 11. Add 200 l of 5 M potassium acetate and incubate on ice for 1 h. 12. Centrifuge for 15 min, and transfer the supernatants into new tubes. 13. Centrifuge for 5 min, and transfer the supernatants into new tubes. 14. Add 0.7 ml of isopropanol to each supernatant. 15. Centrifuge for 3 min, wash the pellet with 95% ethanol, and dry. 16. Dissolve the pellet in 300 l of 10 mM Tris, 1 mM EDTA, pH 8.0.
17. Add 3 l of RNase A (10 mg/ml). Incubate at 37 for at least 2 h. 18. Extract with phenol/CHCl3 once, and with CHCl3 once. Add 1/10 volume of 3 M sodium acetate, pH 5.2, and 3 volumes of ethanol. Centrifuge, wash the pellets with 70% ethanol, and dry. 19. For UV irradiation of the naked DNA, dissolve two of the unirradiated DNA pellets in 300 l of phosphate-buffered saline (PBS) (137 mM NaCl, 2.7 mM KCl, 10 mM, Na2PO4, 2 mM KH2PO4, pH 7.4), and place the entire sample in a petri dish. UV (254 nm) irradiations are carried out in a Stratalinker with open petri dishes: Sample D1: 120 mJ (setting of 1200 at the Stratalinker) Sample D2: 240 mJ (setting of 1200 for two irradiation intervals) 20. Ethanol precipitate, wash, and dry DNA pellets D1 and D2. 21. Dissolve all DNA samples for sequencing in 300 l of 10 mM Tris–HCl, 0.1 mM EDTA (pH 8.0). Ethanol precipitate, wash the pellet with 70% ethanol, and dry the DNA pellets. 22. Dissolve each of the DNA pellets in 70 l of TE. 23. Use 10 l of each DNA sample for primer extension mapping. Primer Extension Mapping This primer extension protocol was adapted from Axelrod and Majors23 with minor modifications.27–30 The one-cycle primer extension reaction is performed to map UV photoproducts in multicopy plasmids, whereas

[41]

UV photofootprinting in yeast

485

multicycle primer extension is performed for those in the genome or on low-copy plasmids. 1. Primers are labeled radioactively as follows: 10 pmol of primer is combined with 10 l of [ -32P]ATP (6000 Ci/mmol, e.g., PB10218, Amersham Pharmacia Biotech) and 20 units of T4 polynucleotide kinase (total
25 l) and incubated at 37 for 60 min. Then, 25 l of water is added and
the reaction is terminated by heating at 65 for 20 min. Excess [ -32P]ATP P]ATP is removed by passing through a Sephadex G-50 spin column (e.g., ProbeQuant G-50 microcolumns, Amersham Pharmacia Biotech). 2. Ten microliters of DNA (containing 10–50 g of genomic DNA) is combined with 0.3 pmol of the 32P end-labeled primer (106 cpm), 5 l of 5 Taq buffer, 1 l of 5 mM dNTPs, 1.25 U of Taq polymerase, and H2O (total 25 l). In addition, 10 l of unirradiated DNA is used for control DNA sequencing reactions (to map the sites of UV photoproducts precisely). For sequencing, the reactions contain 1 l of 25 ddG, ddT, or ddC mix instead of the dNTP mix. If necessary, 25 l of mineral oil may be layered on the reaction mixture.
3a. One-cycle primer extension: The sample is heated at 94 for 5 min

(denaturation), cooled at 48 for 20 min (annealing), and incubated at 72
for 10 min (extension). Samples may then be held at 4 . 3b. Multicycle primer extension: The sample is subjected to several

cycles of primer extension as follows: 94 for 1 min, 55 for 2 min, and
72 for 2 min, repeated 15 times. (If the signal is not strong enough, primer extension cycles may be increased up to around 30.) Samples may then be
held at 4 . 4. Mineral oil is removed if necessary by the addition of 100 l CHCl3, and the DNA solution is transferred to a new tube and precipitated with ethanol. 5. The DNA pellet is dissolved in 5 l of sequencing gel-loading buffer,
heated at 95 for 5 min, and chilled on ice. Samples are electrophoresed on a 6% polyacrylamide sequencing gel containing 50% urea. Recipes Primer Design. Primers are designed as 33–38 nucleotides in length with 40–60% GþC content. If one is footprinting the CYC1-lacZ fusion template, it is important that primers anneal to the plasmid template and 29 30

M. Shimizu, S. Y. Roth, C. Szent-Gyorgyi, and R. T. Simpson, EMBO J. 10, 3033 (1991). S. Y. Roth, M. Shimizu, L. Johnson, M. Grunstein, and R. T. Simpson, Genes Dev. 6, 411 (1992).

486

polymerase associated factors

[41]

Fig. 3. UV photofootprinting of Hap1p-UAS1. (Top) Sequence of the CYC1-lacZ 50 region from plasmid pLG
312S. Sequences from the 30 end of URA3 are italicized and end at a SmaI restriction site. Sequences of UAS1 and UAS2 in the CYC1 50 region are underlined. CYC1 sequences end at a BamHI site, and the first few codons of the CYC1-lacZ fusion ORF are in bold-face type. (Bottom) In vivo UV photofootprints of the noncoding strand of the UAS1 region in a CYC1-lacZ plasmid.27 The arrow indicates sites of enhancements of UV photoproducts in irradiated cells (lanes C) compared with irradiated purified DNA (lanes D). (Left) Reactions from a wild-type (HAP1) strain with functional Hap1p; (right) reactions from a mutant (hap1::LEU2) strain that lacks functional Hap1p. The major UAS1 UV photoproduct enhancements seen in intact cells depend on expression of functional Hap1p. From Shimizu et al.27

not to genomic CYC1 sequences. For this purpose, we use primers that anneal to the junction sequences between the CYC1 upstream region and its flanking region (URA3 or an inserted repression region). For example, for footprinting of the noncoding strand of CYC1-lacZ fusion whose sequence is shown in Fig. 3, the primer TCAATTTAATTATATCAGTTATTACCCGGGAGCA would be suitable. 5 Taq buffer: 50 mM Tris–HCl, pH 8.3, 250 mM KCl, 15 mM MgCl2, 0.15% NP-40, 0.15% Tween 2031 25 ddG mix: 1.25 mM ddGTP, 0.25 mM dGTP, 2.5 mM each of dATP, dTTP, and dCTP 31

M. A. Innis, K. B. Myambo, D. H. Gelfand, and M. A. Brow, Proc. Natl. Acad. Sci. USA 85, 9436 (1988).

[42]

487

activated transcription reinitiation

25 ddA mix: 2.5 mM ddATP, 62.5 M dATP, 2.5 mM each of dGTP, dTTP, and dCTP 25 ddT mix: 2.5 mM ddTTP, 0.125 mM dTTP, 2.5 mM each of dGTP, dATP, and dCTP 25 ddC mix: 2.5 mM ddCTP, 0.125 mM dCTP, 2.5 mM each of dGTP, dATP, and dTTP Sequencing gel-loading buffer: 80% formamide, 1  TBE buffer, 0.025% bromphenol blue, and 0.025% xylene cyanol FF Troubleshooting The purity of DNA samples is very important. If the sequencing gel is smeared, the DNA samples may be purified by passing through Sephadex G-50 spin columns or by using a DNA purification resin. If the bands appear weak, the annealing temperature in the primer extension reaction may be lowered. In addition, an increase of cycles of primer extension may increase the signal intensity.

[42] Analysis of Activator-Dependent Transcription Reinitiation In Vitro By Raphael Sandaltzopoulos and Peter B. Becker The eternal struggle of Sisyphus, condemned by the Gods for unraveling their secrets, was to carry a heavy boulder to the top of a hill. Alas, every time he reached the top, the boulder would roll to the bottom of the hill and poor Sisyphus had to reinitiate his effort. Ancient Greeks perceived this seemingly unrewarded labor as the worst punishment and torture a conscious being could ever receive. In biology, many complex reactions have to occur repeatedly in order to be effective. In the case of gene transcription, where multiple initiation events are required in order to achieve appropriate mRNA levels, nature has made sure that ‘‘the boulder does not roll to the bottom of the hill, but is held up half-way’’: the reinitiation of transcription abbreviates the lengthy procedure required for the first successful initiation event. The transcription output of a gene is a function of the efficiencies of transcription initiation, elongation, and the rate of transcription reinitiation. The overall number of mRNA molecules synthesized in a cell depends on the fraction of time in which a given promoter is active, as well as on the frequency with which polymerases initiate transcription from this site. In cell-free transcription systems, where usually a large population of

METHODS IN ENZYMOLOGY, VOL. 370

Copyright 2003, Elsevier Inc. All rights reserved. 0076-6879/03 $35.00