Harmine induced apoptosis in Spodoptera frugiperda Sf9 cells by activating the endogenous apoptotic pathways and inhibiting DNA topoisomerase I activity

Pesticide Biochemistry and Physiology 155 (2019) 26–35

Contents lists available at ScienceDirect

Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest

Harmine induced apoptosis in Spodoptera frugiperda Sf9 cells by activating the endogenous apoptotic pathways and inhibiting DNA topoisomerase I activity

T

Benshui Shua,b,c,1, Jingjing Zhanga,c,1, Zhiyan Jianga,c, Gaofeng Cuia,c, Sethuraman Veerana,c, ⁎ Guohua Zhonga,c, a b c

Key Laboratory of Crop Integrated Pest Management in South China, Ministry of Agriculture, South China Agricultural University, Guangzhou, China Guangzhou City Key Laboratory of Subtropical Fruit Trees Outbreak Control, Zhongkai University of Agriculture and Engineering, Guangzhou, China Key Laboratory of Natural Pesticide and Chemical Biology, Ministry of Education, South China Agricultural University, Guangzhou, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Harmine Apoptosis Mitochondria Lysosomes Topoisomerase I

Harmine, a useful botanical compound, has demonstrated insecticidal activity against some pests. However, harmine's mechanism of action has not been thoroughly elucidated to date. To preliminarily explore harmine's insecticidal mechanisms, the cytotoxicity of harmine against Spodoptera frugiperda Sf9 cells was comprehensively investigated. Our results indicated that harmine induced apoptosis in Sf9 cells, as evidenced by cellular and nuclear morphological changes, DNA laddering and increases in caspase-3-like activities. In addition, activation of the mitochondrial apoptotic pathway by harmine was confirmed by the generation of ROS, opening of mitochondrial permeability transition pores (MPTPs), increase in cytosolic Ca2+, changes in mRNA expression levels of genes involved in the mitochondrial apoptotic pathway and increase and release of Cytochrome c. Furthermore, lysosomal membrane permeabilization, release of cathepsin L from the lysosome into the cytosol and cleavage of caspase-3 were also triggered, which indicated that lysosomes were involved in this physiological process. Moreover, the effect of harmine on DNA topoisomerase I activity was investigated by in vivo and molecular docking experiments. These data not only verified that harmine induced apoptosis via comprehensive activation of the mitochondrial and lysosomal pathways and inhibition of DNA topoisomerase I activity in Sf9 cells but also revealed a mechanism of harmine insecticidal functions for pest control.

1. Introduction With the increasingly prominence of pest resistance and pesticide contamination in the environment, the insecticidal activity of botanical pesticides is of wide-spread interest (Sethuraman et al., 2017). Many botanical pesticides have been shown to possess insecticidal effects against insects. For example, the most promising, efficient and environmentally friendly compound azadirachtin, which is extracted from Azadirachta indica (A. Juss), has been demonstrated to be effective against > 550 species of pests (Khosravi and Sendi, 2013). In addition, camptothecin has also shown significant insecticidal activity against Nilaparvata lugens, Brevicoryne brassicae, and Chilo suppressalis (Ma et al., 2010). Likewise, the extract of Peganum harmala L. also has insecticidal activity. The methanolic extract of P. harmala has shown

pronounced effects of larval mortality, growth inhibition and adult morphological changes in Tribolium castaneum (Jbilou et al., 2008). Moreover, the ethanol extract of P. harmala seeds has caused larval mortality and inhibits the growth and development of Plutella xylostella, while larval pupation, adult emergence and egg hatching have also been affected (Abbasipour et al., 2010). Furthermore, apoptosis induction has been considered an effective mechanism against pests. Apoptosis, or type I programmed cell death, is an elimination mechanism in multicellular organisms that occurs in response to endogenous or exogenous apoptotic stimuli (Suganuma et al., 2011). Apoptosis has been characterized by morphological changes and biochemical events, including chromatin condensation, plasma membrane blebbing, cell shrinkage, apoptotic bodies and DNA fragmentation (Hengartner, 2000). Currently, research on apoptosis of lepidopteran

⁎

Corresponding author at: Key Laboratory of Natural Pesticide and Chemical Biology, Ministry of Education PR China, South China Agricultural University, Guangzhou 510642, China. E-mail address: [email protected] (G. Zhong). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.pestbp.2019.01.002 Received 12 August 2018; Received in revised form 3 January 2019; Accepted 7 January 2019 Available online 10 January 2019 0048-3575/ © 2019 Elsevier Inc. All rights reserved.

Pesticide Biochemistry and Physiology 155 (2019) 26–35

B. Shu et al.

2.2. Cell morphological observation

insects mainly focuses on the morphological changes of tissues or cells induced by a variety of apoptotic stimuli, which can be divided into two aspects: intrinsic factors (ecdysone) and extrinsic factors (such as pesticides, viruses, UV light and heavy metals) (Zhang et al., 2010). Meanwhile, increasing reports have shown that apoptosis induced by botanical pesticides is emerging. For example, azadirachtin induces apoptosis in Lepidoptera insect cell lines, including S. frugiperda Sf9 and Spodoptera litura Sl-1 cells (Shu et al., 2015; Huang et al., 2011). In addition, apoptosis is also triggered by camptothecin in S. frugiperda Sf21 cells, Spodoptera exigua IOZCAS-Spex-II cells, and Sf9 and the midgut of S. litura larvae (Zhang et al., 2012; Huang et al., 2013; Gong et al., 2014). Harmine, a tricyclic compound, is one of the major β-carboline alkaloids extracted from seeds of the medical plant Peganum harmala L., and it presents remarkable pharmacological properties (Li et al., 2017a). Previous research has shown that harmine has a wealth of medicinal activities, and the mechanisms of its disease therapies have been studied in depth. Dual-specificity tyrosine phosphorylation-regulated kinase 1A (DYRK1A) was considered to be the main target of harmine, and harmine exerts its antidiabetic activity by inhibiting DYRK1A (Wang et al., 2015a). In addition, some molecules, including AChE, BChE and GABA receptor, were also considered to be targets of harmine for other pharmacological effects (Moloudizargari et al., 2013). Simultaneously, harmine exhibits some biological functions, including antibacterial, antiviral and insecticidal activities (Li et al., 2017b). Harmine has antimicrobial activity against many bacterial species, and Proteus vulgaris, Bacillus subtilis, and Candida albicans are among the more sensitive species (Arshad et al., 2008; Shahverdi et al., 2005). Harmine also possesses potent botanical pesticide activity. For example, harmine displayed insecticidal activity via larval mortality in Lipaphis erysimi and 4th instar mosquitos (Zeng et al., 2010). Additionally, harmine is toxic to Plodia interpunctella through triggering larval death, developmental disruption and reduction of α-amylase activity (Bouayad et al., 2012). Furthermore, Tribolium castaneum and Rhyzopertha dominica are also sensitive to harmine (Nenaah, 2011). Although the insecticidal activities of harmine have been investigated, its mechanisms remain inconclusive. To explore harmine's insecticidal mechanisms, the toxicity of harmine against the Sf9 cell line was comprehensively investigated. In the present study, harmine induced apoptosis in Sf9 cells was confirmed by morphological, physiological and biochemical criteria. Additionally, the activation of mitochondrial and lysosomal pathways by harmine were verified by fluorescent probe detection, RT-qPCR and western blotting. Furthermore, inhibition of topoisomerase I activity was also detected. Our results provide a comprehensive study of apoptosis induction by harmine and enrich our understanding of the insecticidal mechanism of harmine.

Sf9 cells were seeded into 6-well plates with a density of 0.5 × 105–1 × 105 cells/mL and incubated overnight. Then, the cells were treated with concentration series of harmine, and the morphological changes were observed. In addition, the cells treated with 0.35 mM harmine were incubated for 0, 12, 18, 24, 36 and 48 h. The morphological changes of Sf9 cells were also recorded with an inverted phase contrast microscope (Olympus, Japan). 2.3. Hoechst 33258 staining Sf9 cells were seeded in 12-well plates on glass coverslips. After an overnight incubation, the cells were treated with 0.35 mM harmine for 0, 12, 18, 24, 36 or 48 h. The supernatant was discarded, and cells were fixed with the 4% paraformaldehyde solution at room temperature for 10 min before washing twice with phosphate-buffered saline (PBS). The cells were stained with Hoechst 33258 (#C1018, Beyotime, China) in the dark for 10 min and washed twice with PBS. The nuclear morphological changes of cells were observed by fluorescence microscopy with 352 and 461 nm excitation and emission wavelengths, respectively (Nikon Eclipse 80 i, Japan). 2.4. DNA fragmentation assay Sf9 cells were incubated in 6-well plates and treated with 0.35 mM harmine for different durations. The cells with different treatments were collected, and the genomic DNA was extracted with the TIANamp Genomic DNA Kit (#DP304, TIANGEN, China) according to the manufacturer's instructions. DNA laddering was detected by 1% agarose gel electrophoresis at 60 V for 1 h and was photographed under the GelDoc XR+ (Bio-Rad, USA) gel imaging system. 2.5. Caspase-3-like activity assay Caspase-3-like activity was detected by the Caspase-3 Colorimetric assay kit (#KGA203, KeyGEN, China) according to the manufacturer's protocol. After treatment with 0.35 mM harmine for different durations, the cells were collected and lysed in ice-cold lysis buffer for 30 min. After centrifugation at 12,000 rpm at 4 °C for 10 min, the supernatants were transferred, and protein concentrations were determined by the Bradford method. The quantified protein samples were added to a 96well plate and then mixed with 50 μL of reaction buffer containing DTT and 5 μL of caspase-3 substrate. The mixture containing PBS and reaction buffer was used as the blank control. The plate was incubated in the dark at 37 °C for 4 h, and the absorbance was detected under the Multiskan FC microplate reader at the 405 nm wavelength (ThermoFisher Scientific, USA).

2. Materials and methods

2.6. ROS analysis

2.1. Cell culture and reagents

Sf9 cells were seeded in 6-well plates on glass coverslips. After an overnight incubation, the cells were treated with 0.35 mM harmine for 0, 12, 24 and 36 h. Then, the levels of intracellular ROS were detected by dihydroethidium (DHE) solution (#KGAF019, KeyGEN, China). The cells with different treatments were incubated with 20 μM DHE solution in fresh medium in the dark at 28 °C for 30 min. Then, the cells were washed with PBS three times, and the fluorescence intensity of cells was detected by fluorescence microscopy with 300 and 610 nm excitation and emission wavelengths, respectively.

Sf9 cells were cultured in Grace's insect medium (Gibco, USA) containing 10% fetal bovine serum (FBS) (Gibco, Australia) at 28 °C. The cell medium was changed every two days, and cells were subcultured up to 80%–90% confluency. Harmine (98%) was purchased from Aladdin and dissolved in dimethyl sulfoxide (DMSO) (Aladdin, China). The structure of harmine is shown in Fig. S1. The antibody against Cytochrome C was purchased from Beyotime Biotechnology (#AC909, Shanghai, China). The GAPDH and Cathepsin L antibodies were purchased from BOSTER Biological Technology Co. (Wuhan, China), and the Cleaved-Caspase-3 (Asp 175) antibody was obtained from Cell Signaling Technology (#9961, USA).

2.7. Rhodamine 123 staining A total of 1 × 105 cells per condition treated with 0.35 mM harmine for 0, 12, 24, 36 and 48 h were collected, washed with PBS twice and resuspended. Then, the cells were stained with 1 μL of Rhodamine 123 27

Pesticide Biochemistry and Physiology 155 (2019) 26–35

B. Shu et al.

China) according to the manufacturer's instructions. The proteins were quantified by the Bradford method. Equal amount of protein samples fixed with SDS-PAGE protein loading buffer (5×) (P0015, Beyotime, China) were separated by 12% SDS-PAGE gels and transferred to polyvinylidene fluoride (PVDF) (#IPVH00010, Millipore, USA) membranes. The membranes were blocked in Tris-HCl-buffered saline solution (TBS) with 5% fat-free milk at room temperature for 2 h. Then, the PVDF membranes were incubated with Cleaved-Caspase-3 (Asp 175) antibody (#9661, Cell Signaling Technology, USA), mouse polyclonal Cytochrome c antibody (#AC909, Beyotime Biotechnology, Shanghai, China) or mouse polyclonal cathepsin L antibody (# 193702, Roche, USA) (diluted 1:3000 in TBS) at 4 °C overnight. The membranes were washed with TBST (TBS containing 0.1% Tween-20) three times for 5 min each. Then, membranes were incubated in TBS solution containing the appropriately diluted secondary antibody conjugated to horseradish peroxidase (#A0216 or #A0208, Beyotime Biotechnology, Shanghai, China) (diluted 1:3000 in TBS) at room temperature for another 2 h. The protein bands were visualized with the ECL method using the Clarity Max™ Western ECL Substrate (#1705062S, BIO-RAD, USA) in a ChemiDoc™ MP imaging system (Bio-Rad, USA). GAPDH protein was used as internal normalization control.

(#R8004, Sigma, USA), incubated in the dark at room temperature for 15 min, and washed three times with PBS. The fluorescence intensity of cells was detected by fluorescence microscopy with the 507 and 529 nm excitation and emission wavelengths, respectively (Nikon ECLIPES 80 i, Japan). 2.8. Intracellular Ca2+ detection Sf9 cells were incubated in 6-well plates with 2 mL of medium overnight and treated with 0.35 mM harmine for different durations. The change in intracellular Ca2+ after harmine treatment was detected by the Fluo-3 probe (#KGAF023, KeyGEN BioTECH, China). First, Fluo3 was mixed with Pluronic F-127 in equal volumes. Then, 1 μL of mixture was added to each well, and the plates were incubated in the dark at 28 °C for 1 h. Then, the cells were washed with fresh medium three times and incubated with fresh medium for another 30 min. Finally, the fluorescence intensity of cells was detected by a flow cytometer (BD FACSCanto, USA). 2.9. Lysosome red probe staining analysis Lysosomes were detected using LysoTracker® Red DND-99 (#L7528, Thermo Fisher, USA). Sf9 cells growing on coverslips were treated with harmine for different durations. After the treatment incubations, the medium was removed, and the fresh serum-free medium containing red probe (50 nM) was added. The cells were incubated at 28 °C for 30 min, and then the loading solution was replaced with fresh medium. The changes in lysosomes were observed by fluorescence microscopy with 490 and 516 nm excitation and emission wavelengths, respectively (Nikon ECLIPES 80 i, Japan).

2.13. Topoisomerase I assay The enzyme extract containing topoisomerase I (Top I) was extracted from normal cells with the following method. Sf9 cells in 25cm2 cell culture flasks were collected, washed with cold PBS twice, lysed in 1 mL of ice-cold lysis buffer (20 mM Tris, 1 mM EGTA, 25 mM KCl, 5 mM MgCl2, 250 mM sucrose, 5% NP40) for 10 min, and centrifuged at 6000 ×g for 2 min. Next, the precipitate was resuspended in ice-cold extract buffer (20 mM Tris, 1 mM EGTA, 2 mM EDTA, 2 mM DTT, 400 mM NaCl) for 30 min and centrifuged at 14,000 rpm at 4 °C for 15 min. The supernatant containing topoisomerase I was used for the relaxation assay. The volume of supernatant which resulted in complete relaxation of 0.2 μg of supercoiled plasmid pBR322 DNA was used for the topoisomerase I assay, and different concentrations of harmine were used as the test samples. The 10 μL mixtures contained 1 μL of 10 × reaction buffer (100 mM Tris-HCl, 10 mM EDTA, 1.5 M NaCl, 1.0% BSA, 1 mM spermidine, and 50% glycerol), enzyme extract, 1 μL of test samples, 0.2 μg pBR322 DNA and distilled water. The mixtures were incubated at 37 °C for 30 min, and then 2.0 μL of cold-stop buffer (50 mM EDTA, 0.25 mg/mL bromophenol blue: 50% glycerol) was added to stop the reaction. The reaction mixtures processed with 1% agarose gel electrophoresis at 60 V for 50 min and photographed under the GelDoc XR + (Bio-Rad, USA) imaging system.

2.10. Acridine orange staining Sf9 cells were cultured in 35-mm culture dishes (Corning, USA) and incubated overnight. Then, cells were treated with 0.35 mM harmine for 24, 36 and 48 h. After treatment, cells were collected by centrifugation and washed with PBS. Next, 5 μg/mL of acridine orange (#KGA213, KeyGEN BioTECH, China) was used for staining, and a fluorescence microscope with 460 and 650 nm excitation and emission wavelengths, respectively (Olympus, Japan), was used for observation. 2.11. Quantitative real-time PCR Cells with different harmine treatments in 6-well plates were collected by centrifugation at 8000 rpm for 5 min. Next, total RNA of the samples was extracted using RNAiso Plus (#9109, Takara, Japan) following the manufacturer's instructions. The concentration and purity of total RNA were examined with a Nanodrop 2000 spectrophotometer (Thermo Fisher, USA). The first-stand cDNA was generated using the PrimeScript™ RT reagent Kit with gDNA Eraser (#RR047A, Takara, Japan) according to the manufacturer's protocol. The primers for apoptosis-related genes were designed by the Primer 5.0 software and are listed in Table 1. The cDNAs were amplified by RT-qPCR with SsoAdvanced™ SYBR® Green Supermix (#1725271, Bio-Rad, USA) on a CFX Connect™ Real-Time System (Bio-Rad, USA). Glyceraldehyde-3phosphate dehydrogenase (GAPDH) was used as the internal normalization control.

2.14. Homology model The X-ray crystal structure (PDB code: 1K4T, www.rcsb.org/) of human DNA topoisomerase I covalently bound to double-stranded DNA was used as the template for modeling Sf-Top I, and Discovery Studio 2017 (DS 2017) software was employed. In summary, the alignment of Sf-Top I and Hs-Top I sequences was conducted with the structure alignment method of the MODELER program, and the MODELER automodel tools were used for homology model building according to the alignment sequences and template structure. In addition, the number of models with a high optimization level was set to 20, and other parameters were set to the default values. Furthermore, the structure with the lowest probability density function (PDF) energy and DOPE score was selected as the candidate model and optimized with 2000 steps of conjugate gradient to remove steric overlap. The final model was further assessed by Verify Protein (Profiles-3D) and Ramanchandran Plot protocols (Jiang et al., 2018).

2.12. Western blot analysis Harmine-treated cells were collected and lysed in CytoBuster™ protein extraction reagent (#71009, Novagen, China) at 25 °C for 15 min. After centrifugation at 12,000 rpm at 4 °C for 10 min, the supernatants were used as total protein samples for western blots. The mitochondrial and cytosolic proteins were isolated from the Mitochondrial Protein Extraction Kit (#KGP850, KeyGEN BioTECH, 28

Pesticide Biochemistry and Physiology 155 (2019) 26–35

B. Shu et al.

Table 1 Primers used for RT-qPCR in the paper. Name

Primers sequences (5′-3′)

Name

Primers sequences (5′-3′)

Sf-AIF1-RT-F Sf-AIF1-RT-R Sf-Apaf1-RT-F Sf-Apaf1-RT-R Sf-Buffy-RT-F Sf-Buffy-RT-R Sf-Caspase-1-RT-F Sf- Caspase-1-RT-R Sf-Caspase-5-RT-F Sf-Caspase-5-RT-R Sf-cytochrome c-RT-F Sf-cytochrome c-RT-R Sf-Endo G-RT-F Sf-Endo G-RT-R

CAAGCACTACACGCACCAGAG CTGCCGAGAAGACACCCACT ACCGAACGAGATTATGGAGCAT AACGACCCGACTATCATCCGT TGGCGAAGAAGATGACGAGTTT CGCTGCTTGAGACCATAGTGC AGAACTATCAAAATGCTGGACGG ACACGGTTGGGTTGCGAAG GATACTGGGACTTGGTGCGTGAT TGCGTGTTGTTTCTGTTGGGTT GCTTCTCATACTCAGATGCCAACA CTTCTTTTAGGTAGGCGATGAGGT CAAGACTCGGACTGCTTCGC ACTCCATAATCGCACCCACA

Sf-p53-RT-F Sf-p53-RT-R Sf-IBM1-RT-F Sf-IBM1-RT-R Sf-Cathepsin B-RT-F Sf-Cathepsin B-RT-R Sf-Cathepsin D-RT-F Sf-Cathepsin D-RT-R Sf-Cathepsin L-RT-F Sf-Cathepsin L-RT-R Sf-Cathepsin O-RT-F Sf-Cathepsin O-RT-R Sf-GAPDH-RT-F Sf-GAPDH-RT-R

CCCACCGTCTCAACCGTATC TGCGGGGCAATAATGTAGTC TCCAGGAGAATAGGCGAGGTG CGAGGGAGACCTTTATGATGGC CATTTCGGTCTCGTCTCAGGA TGGCACTTTGGTGTTTTGGA GCAAGTGCTGAGGATCAAGTATG CAGGCAGGCGATGTTGGTAA TCGGTGGACGAGCAGTT CAGGGTGATGAGGAGAAGC TGAAGCCACCTAAGTCATACGG GCAGGGTTTGTCATCGTCCT TTGACGGACCCTCTGGAAAA ACGTTAGCAACGGGAACACG

observed after treatment with 0.35 mM harmine for 24 h to 48 h. The phenomenon of DNA fragmentation in the 36 h treatment condition was clearer than in the other treatments, and the DNA of normal Sf9 cells had a single band without DNA breakage (Fig. 2C). The caspase-3-like activity of cells treated with 0.35 mM harmine for different times was detected, and harmine treatment significantly increased the caspase-3-like activity. As shown in Fig. 2D, the caspase3-like activity of cells with harmine treatment for 12, 24, 36 and 48 h increased 2.82-, 6.85-, 12.00- and 13.53-fold compared to control cells, respectively.

2.15. Molecular docking simulations The structural model of Sf-Top I-DNA was input into the Prepare Protein protocol, and tasks including inserting missing atoms in incomplete residues, modeling missing loop regions, standardizing atom names, and protonating titratable residues using predicted pKs were performed. The binding site was defined from the current ligand with a radius of 11.5 to accommodate potential compounds. The target compound was minimized using the CHARMm forcefield with 2000 steps of the steepest descent algorithm at an RMS gradient of 0.1 kcal/ (mol × Å), followed with 2000 steps of conjugate gradient at an RMS gradient of 0.01 kcal/mol. Harmine was docked into the binding site of the Sf-Top I-DNA complex with the CHARMm-based CDOCKER protocol of DS 2017. In this process, 30 random conformations were generated in high temperature (1000 K) with 1000 dynamics steps and were translated into the binding site. Several candidate poses were then created using random rigid-body rotations followed by simulated annealing. A final minimization with a “Full Potential” parameter was used to refine the ligand poses. The docking result displayed the nonbond interactions between receptor and ligand. The top ranking pose with the lowest CDOCKER ENERGY was selected for further analysis. The binding free energy was estimated between each ligand and receptor using CHARMm based on the implicit solvation models. The charging rule was used in the MMFF94 forcefield for assigning atom partial charges, and other parameters were set to default values.

3.2. Harmine activated the mitochondrial apoptotic pathway To confirm whether the cytotoxicity of harmine against Sf9 cells was related to the generation of ROS, the DHE probe was used. Normal cells had little red fluorescence. After treatment with harmine for 12 h, the red fluorescence of cells increased. In addition, the intracellular ROS increased rapidly after the 24 h treatment. However, the ROS level of cells decreased with the 36 h treatment, but the level was still higher than control cells (Fig. 3A). These results indicate that harmine induces the generation of ROS in Sf9 cells. Rh123 permeates the membrane of normal cells and transports to the mitochondrial matrix by mitochondrial membrane potential (MMP), and the intensity of its green fluorescence is an index for MMP detection. Normal cells displayed a bright green color. However, the fluorescence of cells gradually weakened after harmine treatment (Fig. 3B). These results indicate that harmine induces the depolarization of mitochondria in Sf9 cells, and the loss of mitochondrial membrane potential is time dependent. In addition, the levels of intracellular Ca2+ in Sf9 cells with different treatments were also analyzed. The normal cells showed low fluorescence intensity, while the fluorescence intensity of cells with harmine treatments increased in a time-dependent manner (Fig. 3C). These results reveal that harmine increases the intracellular Ca2+ levels of Sf9 cells. Previous research has indicated that the mitochondrial apoptotic pathway is regulated by a series of apoptosis-related genes, including Cytochrome c, p53, and caspases. As shown in Fig. 3D, the mRNA expression levels of nine apoptosis-related genes involved in the mitochondrial pathway were determined by qRT-PCR. We found that the mRNA expression level of Sf-Apaf-1, Sf-Buffy, Sf-Caspase-1, Sf-Caspase5, Sf-Cytochrome c, Sf-p53 and Sf-IBM1 were increased. After exposure to 0.35 mM harmine for 24 h, the mRNA expression levels of Sf-Apaf-1 and Sf-Cytochrome c increased 381% and 592%, respectively. In addition, the mRNA expression levels of Sf-Buffy, Sf-Caspase-1, Sf-Caspase-5 and Sf-p53 increased to 836%, 946%, 1834% and 513% after 36 h treatment, respectively. Furthermore, an 11.07-fold increase in Sf-IBM1 mRNA was observed after harmine treatment for 48 h. The mRNA

3. Results 3.1. Harmine induced apoptosis in Sf9 cells Sf9 cells treated with harmine at 4.5 μM, 22.5 μM, 45 μM, 0.125 mM and 0.25 mM for 24 h showed no significant difference in morphology compared to normal cells. However, obvious apoptosis occurred at the 0.35 and 0.45 mM treatments (Fig. 1). As shown in Fig. 2A, typical characteristics of apoptosis induced by 0.35 mM harmine were observed. After treatment for 24 h, Sf9 cells displayed the following morphological changes: cell shrinkage, gap generation, membrane blebbing and emergence of apoptotic bodies. After treatment for 36 and 48 h, most cells disintegrated, and apoptotic bodies increased and were widely distributed. In addition, the nuclei of normal cells stained with Hoechst 33258 exhibited uniform size and blue color. However, apoptotic nuclei exhibited nuclear condensation and fragmentation in cells with 24 h treatment of 0.35 mM harmine (Fig. 2B). Simultaneously, the apoptotic nuclear morphology was gradually more obvious as the treatment time was extended. Furthermore, the DNA of cells with different treatments was analyzed by agarose gel electrophoresis. DNA laddering was clearly 29

Pesticide Biochemistry and Physiology 155 (2019) 26–35

B. Shu et al.

Fig. 1. Morphological changes of Sf9 cells induced by different concentrations of harmine treatments for 24, 36 and 48 h. CK was represented as the cells with 0.5% DMSO treatments.

et al., 2014). The protein levels of Cytochrome c in the mitochondria and cytoplasm of cells were also confirmed by western blotting, and the total protein levels of Cytochrome c increased after harmine treatment (Fig. 3E). Furthermore, the protein levels of cytoplasmic Cytochrome c also increased; however, mitochondrial Cytochrome c decreased after treatment with harmine (Fig. 3F). These results indicate that harmine induces the release of Cytochrome c from the mitochondria to cytoplasm in Sf9 cells. Finally, the above results reveal that harmine induces

expression levels of Sf-AIF1 and Sf-EndoG were also confirmed and increased with harmine treatment. The mRNA expression level of Sf-AIF increased to 313% (of the control value) after 24 h treatment, and SfEndoG increased 172% after 48 h treatment. These results indicate that harmine activates both caspase-dependent and caspase-independent apoptotic pathways at the transcriptional level. The release of Cytochrome c from mitochondria into the cytoplasm marks the irreversible activation of apoptosis in Lepidoptera insects (Gu 30

Pesticide Biochemistry and Physiology 155 (2019) 26–35

B. Shu et al.

Fig. 2. Apoptosis induction of harmine on Sf9 cells. A: The morphologic changes of Sf9 cells treated with 0.35 mM harmine for 12, 18, 24, 36 and 48 h, respectively. B: Nuclear morphologic changes of Sf9 cells with 0.35 mM harmine treatment for 12, 18, 24, 36 and 48 h, respectively. Cells were stained with Hoechst 33258 and observed by fluorescence microscope. C: The DNA ladder analysis of genomic DNA in Sf9 cells after treated with 0.35 mM harmine for different time. D: The caspase3 like activities analysis of Sf9 cells with 0.35 mM harmine treatment for 12, 24, 36 and 48 h, respectively. All data were collected from three independent experiments and performed as mean ± SEM. Different letter above the bar indicated significant differences analyzed by DMRT test (P < .05).

the mRNA expression level of Sf-Cathepsin-B decreased, while SfCathepsin-L and Sf-Cathepsin-O increased (Fig. 4C). After exposure to 0.35 mM harmine for 48 h, the mRNA expression level of Sf-Cathepsin-B decreased 82.72% and Sf-Cathepsin-O increased to 729%. In addition, the mRNA expression level of Sf-Cathepsin-L increased to 401% after treatment with harmine for 36 h. the mRNA expression level of Sf-Cathepsin-D showed no significantly changes after harmine treatment except for slight decreases in the 24 and 36 h treatments. These data indicate that harmine regulates the expression of cathepsins at the transcriptional level in Sf9 cells. Previous research has shown that Cathepsin-L activates Caspase-3, which plays an important role in apoptosis in Lepidoptera insect. Therefore, the protein levels of Cathepsin-L and cleaved-caspase-3 in cells with harmine treatments were confirmed by western blot analysis. Compared to control cells, the protein level of Cathepsin-L in total and cytosolic protein extracts increased after harmine treatments (Fig. 4D). Furthermore, the levels of cleaved-caspase-3 also increased (Fig. 4E). These results indicate that harmine induces increased expression of Cathepsin-L and activation of caspase-3 cleavage. The above results suggest that harmine activates the lysosomal pathway of apoptosis in Sf9 cells.

apoptosis via activating the mitochondrial apoptotic pathway in Sf9 cells. 3.3. Harmine activates the lysosomal pathway To investigate the changes of lysosomes induced by harmine, the specific red fluorescent dye Lyso-Tracker Red was used to label the acidic lysosomes in living cells. As shown in Fig. 4A, some normal cells showed red fluorescence at low levels, but the fluorescence intensity of harmine-treated cells increased significantly. This indicates that harmine increases the number and activities of lysosomes. In addition, the changes of lysosomal membrane permeabilization (LMP) were detected with AO dye, which freely passes through the biofilm, accumulates as the protonated form in acidic lysosomal environments, and exhibits bright red fluorescence. When membrane permeability changes, the release of protons results in a decrease in red fluorescence (Wang et al., 2015b). In this study, control cells had normal lysosomal membranes and exhibited bright red fluorescence and weaker green fluorescence. However, the red fluorescence of cells decreased after treatment with harmine (Fig. 4B). These results indicate that harmine treatment induces the appearance of LMP in Sf9 cells. To investigate the effect of harmine on the lysosomal protease cathepsins, four cathepsins were selected, and their mRNA expression level changes were verified by RT-qPCR. The mRNA expression levels of three cathepsins changed after treatment with harmine; among them,

3.4. Harmine inhibits the activity of topoisomerase I The effect of harmine on the catalytic activity of topoisomerase I 31

Pesticide Biochemistry and Physiology 155 (2019) 26–35

B. Shu et al.

Fig. 3. Harmine activated mitochondrial apoptotic pathway in Sf9 cells. A: The detection of reactive oxygen species (ROS) in Sf9 cells after treated with harmine for 12, 24 and 36 h. The red fluorescence was represented as the intracellular ROS. B: The mitochondrial membrane potential changes of Sf9 cells after treated with 0.35 mM harmine for different time detected by Rhodamine 123. The mitochondrial membrane potential of cells detected by fluorescence microscope. C: The changes of cytoplasmic Ca2+ in Sf9 cells after harmine treatment for different times and the average fluorescence intensity was detected by flow cytometry. D: The mRNA expression level changes of nine genes involved in mitochondrial apoptotic pathway in Sf9 cells after treatment with harmine for different times. E: The protein expression level changes of Cytochrome c in total proteins of cells with harmine treatment for 0, 12, 18, 24, 36 and 48 h, respectively. F: The protein expression level changes of Cytochrome c in cytoplasm and mitochondria of cells after treatment with harmine for 24, 36 and 48 h, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

observed when 0.35 mM harmine was present in the enzymatic reaction, and the inhibitory effect was more obvious with increasing concentrations (Fig. 5A). To explore the DNA topoisomerase I inhibitory mechanism of harmine, a docking study was performed. The binding

was analyzed with plasmid DNA relaxation experiments. Agarose gel electrophoresis results demonstrated that DMSO did not inhibit the activity of topoisomerase I, and the supercoiled pBR322 plasmid was completely relaxed. An inhibition of topoisomerase I activity was 32

Pesticide Biochemistry and Physiology 155 (2019) 26–35

B. Shu et al.

Fig. 4. Harmine activated lysosomal apoptotic pathway in Sf9 cells. A: The lysosome changes of cells with 0.35 mM harmine treatment for 0, 12, 18, 24, 36 and 48 h were stained with Lyso-Tracker Red and detected by fluorescence microscope. B: The lysosomal membrane permeabilization (LMP) of cells after harmine treatment for 12, 24 and 36 h were stained with AO and detected by fluorescence microscope. C: The mRNA expression level changes of four Cathepsin family genes in Sf9 cells after treatment with harmine for different times by RT-qPCR. All data were collected from three independent experiments and performed as mean ± SEM. Different letter above the bar indicated significant differences analyzed by DMRT test (P < .05). D: The protein expression level changes of Cathepsin L in total proteins and cytoplasm of cells after treatment with harmine for different time detected by western blot. E: The activation of caspase-3 cleavage in cells after treated with harmine for 0, 12, 24, 36 and 48 h, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

even mortality (Shu et al., 2018). In addition, the endogenous mitochondrial and lysosomal apoptotic pathways are activated by different insecticides in Sf9 cells (Wang et al., 2015b; Yang et al., 2017a). The natural alkaloid harmine presents significant therapeutic effects on various diseases. Numerous studies have demonstrated that apoptosis induction could be a major source of the anti-proliferative activity of harmine, and it has been observed in many human cells, while the mitochondrial, endoplasmic reticulum, AMPK, PI3K/Akt and ERK signaling pathways are activated (Li et al., 2017a; Hamsa and Kuttan, 2011; Elmore, 2007). To explore the insecticidal mechanisms, the type of cell death after harmine treatment was analyzed. Our results demonstrate that harmine induces a remarkable apoptosis with time- and dose-dependent manners in Sf9 cells, indicating that harmine inhibits the proliferation of insect cells by inducing apoptosis. Additionally, our preliminarily apoptosis mechanism is that harmine induces apoptosis via the mitochondrial and lysosomal apoptotic pathways, which is consistent with the apoptotic process induced by other insecticides. Mitochondria are key organelles that provide cellular energy. These organelles also play important roles in the apoptotic process, and the

mode of harmine is shown in Fig. 5B. The rigid rings of harmine insert into four bases (T940, G941, C964 and A965) of DNA in parallel and forms the strong π–π stacked interactions with the bases. The inserted structure can be defined as a base that localizes in the DNA gap and stabilizes the complex. These above results reveal that harmine inhibits the activity of topoisomerase I. 4. Discussion Recently, an increasing number of studies have demonstrated that apoptosis in different tissues of insects, including midguts, salivary glands, brain and ovaries, after insecticide exposure (Gregorc and Ellis, 2011; Wu et al., 2015; Martínez et al., 2019). Therefore, it is speculated that apoptosis may be a potential mechanism of insecticidal function. As a method of cell death, apoptosis in tissues promotes destruction of tissue structure which, in turn, affects the normal function of tissues, including nutrient absorption and nerve transmission (Gregorc and Ellis, 2011; Wu et al., 2015; Martínez et al., 2019). These adverse results ultimately affect insect behavior, growth and development, and 33

Pesticide Biochemistry and Physiology 155 (2019) 26–35

B. Shu et al.

decreased. The results are likely related to the transmission of apoptotic signals. Harmine first induces a variety of key events in the mitochondria, including increasing ROS, then apoptotic signals are transferred. So when ROS generation in cells decreases, the apoptotic signal may be still transmitted to caspases; the caspase cascade can amplify apoptotic signals and increase caspase activity, finally resulting in DNA laddering. These results indicate that harmine induces apoptosis via activating both the caspase-dependent and caspase-independent mitochondrial apoptotic pathways in Sf9 cells. Lysosomes, which are membrane-enclosed vesicles, are the main digestive organelles in eukaryotic cells that degrade a variety of exogenous and endogenous macromolecules and are involved in various physiological activities (Mrschtik and Ryan, 2015). Lysosomal membrane permeabilization (LMP) and release of cathepsins from lysosomes to the cytoplasm are considered preconditions for apoptotic regulation by the lysosomal pathway (Chwieralski et al., 2006; Serrano-Puebla and Boya, 2016). The lysosomal protease family cathepsins are the effectors of lysosomal cell death for tissue remodeling in numerous insects (Saikhedkar et al., 2015). For example, cathepsin D is involved in DNA fragmentation of the larval midgut and fat body degradation in Bombyx mori (Gui et al., 2006). Cathepsin B and L degrade cytoskeletal proteins in the labial glands of Maduca sexta (Facey and Lockshin, 2010). Further reports have shown that cathepsin L participates in fat body degradation and midgut remodeling in Helicoverpa armigera by regulating tissue apoptosis and activating caspase-1 (Zhai and Zhao, 2012; Yang et al., 2017b). Our previous study indicated that the lysosomal pathway exists in Sf9 cells and that azadirachtin induces apoptosis by activating LMP and the release of cathepsin L (Wang et al., 2015b). Our results demonstrated that harmine treatment increases the number of lysosomes and induces permeabilization of the lysosomal membrane and release of cathepsin L from the lysosomes to the cytoplasm in Sf9 cells. We found that the lysosome level greatly decreased after harmine treatment for 36 h, which could be explained by the small number of cells maintaining an intact morphology, while most cells were cracked. Similarly, we found that cells with intact morphology after harmine treatment also had a higher lysosome number than control cells. These data revealed that harmine activates the lysosomal pathway, in which cathepsin L could play an important role for apoptosis regulation in Sf9 cells. DNA topoisomerase I is a ubiquitous enzyme that functions to relax DNA supercoiling generated by DNA replication and transcription. Some compounds, such as camptothecin, combined with topoisomerase–DNA complexes form a more stable complex. After camptothecin treatment, DNA cleavage and genome damage are caused by functional topoisomerase I, and stress-associated signaling pathways are activated, eventually leading to apoptosis (Sen et al., 2004; Xin et al., 2017). It was reported that P. harmala seed extract and β-carbolines inhibit the activity of human DNA topoisomerase I, and harmine was speculated to have the strongest inhibition potency (Sobhani et al., 2002). Further research showed that two novel β-carbolines exhibit strong inhibition of topoisomerase I (Figueiredo et al., 2014). Our results showed that harmine strongly inhibits the activity of DNA topoisomerase I, and molecular modeling further confirmed that there was a correlation between harmine and topoisomerase I. This finding suggests that the DNA topoisomerase I inhibitory activity could be one mechanism of harmine-induced apoptosis in Sf9 cells. In summary, we demonstrated that harmine induces apoptosis in Sf9 cells, in which the intrinsic mitochondrial and lysosomal apoptotic pathways are activated. Furthermore, the DNA topoisomeraseI inhibitory activity was confirmed by enzymatic reactions in vivo and molecular modeling. Our data provided sufficient evidence to confirm the effect of apoptosis induction by harmine in Sf9 cells, and showed a theoretical reference for further study of the apoptotic mechanism in Lepidoptera induced by natural compounds and of the application of harmine as an insecticide for pest control. More biological activity experiments are required to understand the broader insecticidal spectrum

Fig. 5. Harmine inhibited the activity of DNA topoisomerase I. A: Agarose gel electrophoresis analysis of Top I activity inhibited by harmine with different concentrations. 1, 2, 3, 4, 5 and 6 represented the harmine concentration of 0.035, 0.07, 0.14, 0.23, 0.35 and 0.45 mM, respectively. DMSO: DMSO was used as the test sample. CK: Sterile water was used as the test sample. P: pBR322 plasmid. B: The binding mode analysis of topoisomerase I in complex with DNA and harmine. Four bases of DNA in parallel interacted with harmine were T940, G941, C964 and A965, respectively.

intrinsic apoptotic pathways are mitochondrial-initiated events (Liu et al., 2016). Stimuli induce a variety of key events in mitochondria, including generation of ROS and increasing cytosolic Ca2+. Oxidative stress and Ca2+ absorption and accumulation in mitochondria lead to mitochondrial permeability transitions (Baumgartner et al., 2009; Orrenius et al., 2015). The loss of Δψm and the opening of mitochondrial permeability transition pores (MPTPs) promote the release of many pro-apoptotic proteins including Cytochrome c, AIF, and endonuclease G into the cytoplasm; the activation of the caspase cascade or the cleavage of chromosomal DNA; and eventually leads to apoptosis (Ren et al., 2017; Saelens et al., 2004). The release of Cytochrome c is also regulated through alteration of the mitochondrial membrane by the oligomerization of Bcl-2 family proteins (Pan et al., 2016). The activation of the mitochondrial pathway and apoptosis induction by harmine in HepG2 cells was demonstrated with the following evidence: decrease in Δψm, activation of caspase-3 and caspase-9, and downregulation of Bcl-2, Mcl-1, and Bcl-xl (Cao et al., 2011). Further reports demonstrated that the collapse of Δψm, down-regulation of Bcl-2, and the up-regulation of cleaved-caspase-3, cleaved-caspase-9, Bax and cleaved-PARP were induced by harmine in human gastric cancer cells, and these results indicated the occurrence of apoptosis (Li et al., 2017a). The mitochondrial apoptotic pathway in Sf9 cells was confirmed and highly conserved, and it is also activated by many plantderived compounds, including azadirachtin, camptothecin, and cantharidin (Huang et al., 2013; Shu et al., 2017; Cui et al., 2017). In the present study, ROS generation, loss of Δψm, increase in cytosolic Ca2+, mRNA level changes of core genes in the mitochondrial apoptotic pathway and release of Cytochrome c from the mitochondria into the cytoplasm were induced with harmine treatment in Sf9 cells. However, our results showed that caspase activity and DNA laddering increased even after harmine treatment for 36 h, while ROS levels greatly

34

Pesticide Biochemistry and Physiology 155 (2019) 26–35

B. Shu et al.

and mechanism of harmine. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.pestbp.2019.01.002.

Liu, J.M., Li, Q., Liu, Z.L., Lin, L.M., Zhang, X.Q., Cao, M.R., Jiang, J.W., 2016. Harmine induces cell cycle arrest and mitochondrial pathway-mediated cellular apoptosis in SW620 cells via inhibition of the Akt and ERK signaling pathways. Oncol. Rep. 35, 3363–3370. Ma, J., Tong, S., Wang, P., Liao, W., Liu, H., Zhang, L., 2010. Insecticidal activity of camptothecin against Nilaparvata lugens, Brevicoryne brassicae, and Chilo suppressalis. J. Econ. Entomol. 103 (2), 492–496. Martínez, L.C., Plata-Rueda, A., Gonçalves, W.G., Freire, A.F.P.A., Zanuncio, J.C., Bozdoğan, H., Serrão, J.E., 2019. Toxicity and cytotoxicity of the insecticide imidacloprid in the midgut of the predatory bug, Podisus nigrispinus. Ecotoxicol. Environ. Saf. 167, 69–75. Moloudizargari, M., Mikaili, P., Aghajanshakeri, S., Asghari, M.H., Shayegh, J., 2013. Pharmacological and therapeutic effects of Peganum harmala and its main alkaloids. Pharmacogn. Rev. 7, 199–212. Mrschtik, M., Ryan, K.M., 2015. Lysosomal proteins in cell death and autophagy. FEBS J. 282 (10), 1858–1870. Nenaah, G., 2011. Toxicity and growth inhibitory activities of methanol extract and the bcarboline alkaloids of Peganum harmala L. against two coleopteran stored-grain pests. J. Stored Prod. Res. 47, 255–261. Orrenius, S., Gogvadze, V., Zhivotovsky, B., 2015. Calcium and mitochondria in the regulation of cell death. Biochem. Biophys. Res. Commun. 460, 72–81. Pan, C., Hu, Y.F., Song, J., Yi, H.S., Wang, L., Yang, Y.Y., Wang, Y.P., Zhang, M., Pan, M.H., Lu, C., 2016. Effects of 10-hydroxycamptothecin on intrinsic mitochondrial pathway in silkworm BmN-SWU1 cells. Pestic. Biochem. Phy. 127, 15–20. Ren, X., Zhang, L., Zhang, Y., Mao, L., Jiang, H., 2017. Mitochondria response to camptothecin and hydroxycamptothecine-induced apoptosis in Spodoptera exigua cells. Pestic. Biochem. Phy. 140, 97–104. Saelens, X., Festjens, N., Vande Walle, L., van Gurp, M., van Loo, G., Vandenabeele, P., 2004. Toxic proteins released from mitochondria in cell death. Oncogene 23, 2861–2874. Saikhedkar, N., Summanwar, A., Joshi, R., Giri, A., 2015. Cathepsins of lepidopteran insects: aspects and prospects. Insect Biochem. Mol. Biol. 64, 51–59. Sen, N., Das, B.B., Ganguly, A., Mukherjee, T., Tripathi, G., Bandyopadhyay, S., Rakshit, S., Sen, T., Majumder, H.K., 2004. Camptothecin induced mitochondrial dysfunction leading to programmed cell death in unicellular hemoflagellate Leishmania donovani. Cell Death Differ. 11 (8), 924–936. Serrano-Puebla, A., Boya, P., 2016. Lysosomal membrane permeabilization in cell death: new evidence and implications for health and disease. Ann. N. Y. Acad. Sci. 1371 (1), 30–44. Sethuraman, V., Shu, B., Cui, G., Fu, S., Zhong, G., 2017. Curcumin induces autophagic cell death in Spodoptera frugiperda cells. Pestic. Biochem. Phys. 139, 79–86. Shahverdi, A.R., Monsef-Esfahani, H.R., Nickavar, B., Bitarafan, L., Khodaee, S., Khoshakhlagh, N., 2005. Antimicrobial activity and main chemical composition of two smoke condensates from Peganum harmala seeds. Z. Naturforsch. C 60, 707–710. Shu, B., Wang, W., Hu, Q., Huang, J., Hu, M., Zhong, G., 2015. A comprehensive study on apoptosis induction by azadirachtin in Spodoptera frugiperda cultured cell line Sf9. Arch. Insect Biochem. 89 (3), 153–168. Shu, B.S., Zhang, J.J., Sethuraman, V., Cui, G.F., Yi, X., Zhong, G.H., 2017. Transcriptome analysis of Spodoptera frugiperda Sf9 cells reveals putative apoptosis-related genes and a preliminary apoptosis mechanism induced by azadirachtin. Sci. Rep. 7, 13231. Shu, B., Zhang, J., Cui, G., Sun, R., Yi, X., Zhong, G., 2018. Azadirachtin affects the growth of Spodoptera litura Fabricius by inducing apoptosis in larval midgut. Front. Physiol. 9, 137. Sobhani, A.M., Ebrahimi, S.A., Mahmoudian, M., 2002. An in vitro evaluation of human DNA topoisomerase I inhibition by Peganum harmala L. seeds extract and its betacarboline alkaloids. J Pharm. Pharm. Sci. 5 (1), 19–23. Suganuma, I., Ushiyama, T., Yamada, H., Iwamoto, A., Kobayashi, M., Ikeda, M., 2011. Cloning and characterization of a dronc homologue in the silkworm, Bombyx mori. Insect Biochem. Mol. 41, 909–921. Wang, P., Alvarez-Perez, J.C., Felsenfeld, D.P., Liu, H.T., Sivendran, S., Bender, A., Kumar, A., Sanchez, R., Scott, D.K., Garcia-Ocana, A.A., 2015a. High-throughput chemical screen reveals that harmine-mediated inhibition of DYRK1A increases human pancreatic beta cell replication. Nat. Med. 21, 383–388. Wang, Z., Cheng, X., Meng, Q., Wang, P., Shu, B., Hu, Q., Zhong, G., 2015b. Azadirachtininduced apoptosis involves lysosomal membrane permeabilization and cathepsin L release in Spodoptera frugiperda Sf9 cells. Int. J. Biochem. Cell Biol. 64, 126–135. Wu, Y.Y., Zhou, T., Wang, Q., Dai, P.L., Xu, S.F., Jia, H.R., Wang, X., 2015. Programmed cell death in the Honey Bee (Apis mellifera) (Hymenoptera: Apidae) worker brain induced by Imidacloprid. J. Econ. Entomol. 108, 1486–1494. Xin, L.T., Liu, L., Shao, C.L., Yu, R.L., Chen, F.L., Yue, S.J., Wang, M., Guo, Z.L., Fan, Y.C., Guan, H.S., Wang, C.Y., 2017. Discovery of DNA topoisomerase i inhibitors with lowcytotoxicity based on virtual screening from natural products. Mar. Drugs 15 (7), E217. Yang, M., Wang, B., Gao, J., Zhang, Y., Xu, W., Tao, T., 2017a. Spinosad induces programmed cell death involves mitochondrial dysfunction and cytochrome C release in Spodoptera frugiperda Sf9 cells. Chemosphere 169, 155–161. Yang, C., Lin, X.W., Xu, W.H., 2017b. Cathepsin L participates in the remodeling of the midgut through dissociation of midgut cells and activation of apoptosis via caspase-1. Insect Biochem. Mol. 82, 21–30. Zeng, Y., Zhang, Y., Weng, Q., Hu, M., Zhong, G., 2010. Cytotoxic and insecticidal activities of derivatives of harmine, a natural insecticidal component isolated from Peganum harmala. Molecules 15, 7775–7791. Zhai, X., Zhao, X.F., 2012. Participation of haemocytes in fat body degradation via cathepsin L expression. Insect Mol. Biol. 21 (5), 521–534. Zhang, J.Y., Pan, M.H., Sun, Z.Y., Huang, S.J., Yu, Z.S., Liu, D., Zhao, D.H., Lu, C., 2010. The genomic underpinnings of apoptosis in the silkworm, Bombyx mori. BMC Genomics 11, 611. Zhang, L., Zhang, Y., He, W., Ma, D., Jiang, H., 2012. Effects of camptothecin and hydroxycamptothecin on insect cell lines Sf21 and IOZCAS-Spex-II. Pest Manag. Sci. 68 (4), 652–657.

Competing financial interests The authors declare that there are no conflicts of interest. Acknowledgements This work was financially supported by the National Natural Science Foundation of China (Grants No. 31572335 and No. 31071713) and the Natural Science Foundation of Guangdong Province, China (Grant No. 2014A030313461). References Abbasipour, H., Mahmoudvand, M., Rastegar, F., Basij, M., 2010. Insecticidal activity of Peganum harmala seed extract against the diamondback moth, Plutella xylostella. Bull. Insectol. 63, 259–263. Arshad, N., Zitterl-Eglseer, K., Hasnain, S., Hess, M., 2008. Effect of Peganum harmala or its beta-carboline alkaloids on certain antibiotic resistant strains of bacteria and protozoa from poultry. Phytother. Res. 22, 1533–1538. Baumgartner, H.K., Gerasimenko, J.V., Thorne, C., Ferdek, P., Pozzan, T., Tepikin, A.V., Petersen, O.H., Sutton, R., Watson, A.J., Gerasimenko, O.V., 2009. Calcium elevation in mitochondria is the main Ca2+ requirement for mitochondrial permeability transition pore (mPTP) opening. J. Biol. Chem. 284, 20796–20803. Bouayad, N., Rharrabe, K., Lamhamdi, M., Nourouti, N.G., Sayah, F., 2012. Dietary effects of harmine, a b-carboline alkaloid, on development, energy reserves and a-amylase activity of Plodia interpunctella Hubner (Lepidoptera: Pyralidae). Saudi J. Biol. Sci. 19, 73–80. Cao, M.R., Li, Q., Liu, Z.L., Liu, H.H., Wang, W., Liao, X.L., Pan, Y.L., Jiang, J.W., 2011. Harmine induces apoptosis in HepG2 cells via mitochondrial signaling pathway. Hepd. Int. 10 (6), 599–604. Chwieralski, C.E., Welte, T., Bühling, F., 2006. Cathepsin-regulated apoptosis. Apoptosis 11 (2), 143–149. Cui, G.F., Li, Y.S., Ding, K., Hao, S.D., Wang, J.Z., Zhang, Z.Y., 2017. Attribution of Bax and mitochondrial permeability transition pore on cantharidin-induced apoptosis of Sf9 cells. Pestic. Biochem. Phy. 142, 91–101. Elmore, S., 2007. Apoptosis: a review of programmed cell death. Toxicol. Pathol. 35 (4), 495–516. Facey, C.O.B., Lockshin, R.A., 2010. The execution phase of autophagy associated PCD during insect metamorphosis. Apoptosis 15 (6), 639–652. Figueiredo, P.D., Perdomo, R.T., Garcez, F.R., Matos, M.D.C., de Carvalho, J.E., Garcez, W.S., 2014. Further constituents of Galianthe thalictroides (Rubiaceae) and inhibition of DNA topoisomerases I and II alpha by its cytotoxic beta-carbolinealkaloids. Bioorg. Med. Chem. Lett. 24, 1358–1361. Gong, L., Wang, H., Huang, J., Hu, M., Hu, Z., Zhong, G., 2014. Camptothecin-induced expression of programmed cell death gene 11 in Spodoptera litura. Pest Manag. Sci. 70 (4), 603–609. Gregorc, A., Ellis, J.D., 2011. Cell death localization in situ in laboratory reared honey bee (Apis mellifera L.) larvae treated with pesticides. Pestic. Biochem. Phys. 99, 200–207. Gu, Z., Zhou, Y., Xie, Y., Li, F., Ma, L., Sun, S., Wu, Y., Wang, B., Wang, J., Hong, F., Shen, W., Li, B., 2014. The adverse effects of phoxim exposure in the midgut of silkworm, Bombyx mori. Chemosphere 96, 33–38. Gui, Z.Z., Lee, K.S., Kim, B.Y., Choi, Y.S., Wei, Y.D., Choo, Y.M., Kang, P.D., Yoon, H.J., Kim, I., Je, Y.H., 2006. Functional role of aspartic proteinase cathepsin D in insect metamorphosis. BMC Dev. Biol. 6, 49. Hamsa, T.P., Kuttan, G., 2011. Harmine activates intrinsic and extrinsic pathways of apoptosis in B16F-10 melanoma. Chin. Med. 6 (1), 11. Hengartner, M.O., 2000. The biochemistry of apoptosis. Nature 407, 770–776. Huang, J.F., Shui, K.J., Li, H.Y., Hu, M.Y., Zhong, G.H., 2011. Antiproliferative effect of azadirachtin A on Spodoptera litura Sl-1 cell line through cell cycle arrest and apoptosis induced by up-regulation of p53. Pestic. Biochem. Phys. 99 (1), 16–24. Huang, J.F., Lv, C.J., Hu, M.Y., Zhong, G.H., 2013. The mitochondria-mediate apoptosis of lepidopteran cells induced by azadirachtin. PLoS One 8 (3), e58499. Jbilou, R., Amri, H., Bouayad, N., Ghailani, N., Ennabili, A., Sayah, F., 2008. Insecticidal effects of extracts of seven plant species on larval development, alpha-amylase activity and offspring production of Tribolium castaneum (Herbst) (Insecta: Coleoptera: Tenebrionidae). Bioresour. Technol. 99, 959–964. Jiang, Z., Zhang, Z., Cui, G., Sun, Z., Song, G., Liu, Y., Zhong, G., 2018. DNA Topoisomerase 1 structure-BASED design, synthesis, activity evaluation and molecular simulations study of new 7-amide camptothecin derivatives against Spodoptera frugiperda. Front. Chem. 6, 456. Khosravi, R., Sendi, J.J., 2013. Effect of neem pesticide (achook) on midgut enzymatic activities and selected biochemical compounds in the hemolymph of lesser mulberry pyralid, glyphodes pyloalis walker (lepidoptera: pyralidae). J. Plant Protect. Res. 53 (3), 238–247. Li, C., Wang, Y., Wang, C., Yi, X., Li, M., He, X., 2017a. Anticancer activities of harmine by inducing a pro-death autophagy and apoptosis in human gastric cancer cells. Phytomedicine 28, 10–18. Li, S., Cheng, X., Wang, C., 2017b. A review on traditional uses, phytochemistry, pharmacology, pharmacokinetics and toxicology of the genus Peganum. J. Ethnopharmacol. 203, 127–162.

35