Harnessing the tumour-derived cytokine, CSF-1, to co-stimulate T-cell growth and activation

Available online at www.sciencedirect.com

Molecular Immunology 45 (2008) 1276–1287

Harnessing the tumour-derived cytokine, CSF-1, to co-stimulate T-cell growth and activation Agnes Shuk Yee Lo a , Jessica Rhiannon Taylor b , Farzin Farzaneh c , David Michael Kemeny d , Nicholas John Dibb e , John Maher f,∗ a

Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Harvard Medical School, 44 Binney Street, Boston, MA 02115, USA Cancer Genetics and Epigenetics, Breakthrough Breast Cancer Research Centre, Institute of Cancer Research, Mary-Jean Mitchell Green Building, Chester Beatty Laboratories, 237 Fulham Road, London SW3 6JB, United Kingdom c King’s College London, Department of Haematological Medicine, The Rayne Institute, 123 Coldharbour Lane, London SE5 9NU, United Kingdom d Immunology Programme and Department of Microbiology, National University of Singapore, Blk MD11, 10 Medical Drive, Singapore 117597, Singapore e IRDB, Imperial College London, Hammersmith Campus, Du Cane Road, London W12 0NN, United Kingdom f King’s College London, The Breast Cancer Biology Group, Division of Cancer Studies, Guy’s Hospital Campus, St Thomas Street, London SE1 9RT, United Kingdom b

Received 20 August 2007; accepted 13 September 2007 Available online 24 October 2007

Abstract Aberrant growth factor production is a prevalent mechanism in tumourigenesis. If T-cells responded positively to a cancer-derived cytokine, this might result in selective enhancement of function within the tumour microenvironment. Here, we have chosen colony-stimulating factor-1 (CSF-1) as a candidate to test this concept. CSF-1 is greatly overproduced in many cancers but has no direct effects upon T-lymphocytes, which do not express the c-fms-encoded CSF-1 receptor. To confer CSF-1-responsiveness, we have expressed the human c-fms gene in immortalized and primary T-cells. Addition of soluble CSF-1 resulted in synergistic enhancement of IL-2-driven T-cell proliferation. CSF-1 also co-stimulated the production of interferon (IFN)-␥ by activated T-cells. These effects required Y809 of the CSF-1R and activation of the Ras-MEK-MAP kinase cascade, but were independent of PI3K signalling. T-cells that express c-fms are also responsive to membrane-anchored CSF-1 (mCSF-1) which, unlike its soluble counterpart, could co-stimulate IL-2 production. CSF-1 promoted chemotaxis of c-fms-expressing primary human T-cells and greatly augmented proliferation mediated by a tumour-targeted chimeric antigen receptor, with preservation of tumour cytolytic activity. Taken together, these data establish that T-cells may be genetically modified to acquire responsiveness to CSF-1 and provide proof-of-principle for a novel strategy to enhance the effectiveness of adoptive T-cell immunotherapy. © 2007 Elsevier Ltd. All rights reserved. Keywords: CSF-1; c-fms; T-cell; Adoptive immunotherapy

1. Introduction Abbreviations: CAR, chimeric antigen receptor; CSF-1(R), colonystimulating factor-1 (receptor); CTL, cytotoxic T-lymphocyte; (e)GFP, (enhanced) Green fluorescent protein; EMCV, Encephalomyocarditis virus; Erk, extracellular-regulated kinase; FGF(1R), fibroblast growth factor (1 receptor); IFN, interferon; IL, interleukin; IRES, internal ribosome entry site; MAP(K), mitogen-activated protein (kinase); mCSF-1, membrane anchored CSF-1; MHC, Major Histocompatibility Complex; PI3K, phosphatidylinositol3 kinase; PSMA, prostate-specific membrane antigen; RTK, receptor tyrosine kinases; TCR, T-cell receptor; TGF, transforming growth factor. ∗ Corresponding author at: King’s College London, The Breast Cancer Biology Group, Third Floor Thomas Guy House, Guy’s Hospital, St Thomas Street, London SE1 9RT, United Kingdom. Tel.: +44 207 188 1468; fax: +44 207 188 0919. E-mail address: [email protected] (J. Maher). 0161-5890/$ – see front matter © 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.molimm.2007.09.010

Priming of effective anti-tumour immunity presents several challenges. Foremost amongst these is the poor immunogenicity of tumour antigens, many of which represent self or subtle modifications of self (Boon et al., 1997). In principle, this difficulty may be overcome by genetic re-targeting of T-cell specificity. This can be achieved by introduction of an ectopic Tcell receptor (TCR), a strategy that has achieved notable success in pre-clinical studies (Xue et al., 2005) and in a small number of patients (Morgan et al., 2006). However, this approach requires matching of Major Histocompatibility Complex (MHC) antigens and may fail since tumour cells frequently downregulate expression of cell surface MHC molecules (Bubenik,

A.S.Y. Lo et al. / Molecular Immunology 45 (2008) 1276–1287

2004). An alternative system involves the use of “chimeric antigen receptors” (CAR). These fusion receptors bypass the need for MHC or antigen processing since they engage native target molecules found on tumour cells (Sadelain et al., 2003). Recent designs incorporate modular endodomains which deliver integrated TCR-like (signal 1) and co-stimulatory signals (e.g. CD28/OX40/4-1BB – signal 2). As a consequence, CAR-grafted T-cells can kill antigen-expressing targets and then undergo tumour-dependent proliferation (Maher et al., 2002; Pule et al., 2005). A series of murine xenograft studies have provided considerable grounds for optimism using this approach (Haynes et al., 2002; Brentjens et al., 2003). Nonetheless, early clinical studies have proven disappointing (Kershaw et al., 2006). Why should cancer progress despite the provision of large numbers of tumour-specific effector T-cells? This is not a peculiarity associated with the use of gene-modified or ex vivo manipulated T-cells, since it has also been observed in active immunotherapy protocols for melanoma (Rosenberg et al., 2005). Increasing evidence implicates the tumour microenvironment as an important factor in explaining this dichotomy (Gajewski et al., 2006). Locally recruited leukocytes, together with stromal and endothelial cells conspire within tumours to promote local immunosuppression, angiogenesis, tumour cell invasion and metastasis (Lin et al., 2001; Goswami et al., 2005; Gajewski et al., 2006; Lin et al., 2006). These outcomes are promoted by the in situ generation of several cytokines, including transforming growth factor (TGF)-␤, interleukin (IL)-10, colony-stimulating factor (CSF)-1, vascular endothelial growth factor and IL-6 (Lin et al., 2001; Goswami et al., 2005; Gajewski et al., 2006; Lin et al., 2006). To address this difficulty, several approaches are under development including the delivery of activating stimuli to tumours (Yu et al., 2004) or the introduction of dominant negative TGF-␤ receptor subunits to gene-modified T-cells (Bollard et al., 2002). We reasoned that if T-cells were engineered to respond positively to a cancer-associated cytokine, this could also provide a useful way of amplifying an anti-tumour immune response in proximity to malignant deposits. As a model to test this, we selected CSF-1 (also known as macrophage colony-stimulating factor). Colony-stimulating factor-1 is a homodimeric glycoprotein that regulates growth and differentiation of cells of the monocytic lineage (Stanley et al., 1997). These actions are mediated by binding to the cfms-encoded CSF-1 receptor (CSF-1R), which is a member of subfamily III of the receptor tyrosine kinases (RTK; Fantyl et al., 1993). Upon binding of ligand, the CSF-1R undergoes tyrosine autophosphorylation, followed by activation of signalling intermediates that include phosphatidylinositol-3 kinase (PI3K), the mitogen-activated protein (MAP) kinase/extracellular-regulated kinase (Erk) pathway and phospholipase C-␥ (Hamilton, 1997). Over-production of CSF-1 has been identified in several tumour types, most notably gynaecological malignancies and cancer of the breast (Baiocchi et al., 1991; Kommoss et al., 1994; Suzuki et al., 1995; McDermott et al., 2002; Kirma et al., 2007). In epithelial ovarian carcinoma, serum CSF-1 levels provide a useful biomarker (Skates et al., 2004) and may exceed 100 ng/ml in advanced disease (Kacinski, 1997). In recent years, several studies have correlated high serum levels of CSF-1 with poor

1277

prognosis in a broad spectrum of tumour types (Kacinski, 1997; Sapi, 2004; Kaminska et al., 2006; Mroczko et al., 2007). At least three mechanisms may account for this: First, co–expression of CSF-1 and its receptor may be demonstrated in many cases, suggesting that autocrine stimulation promotes clonal tumour cell expansion (Kommoss et al., 1994; Kacinski, 1997; Sapi, 2004; Kirma et al., 2007). This concept is supported by functional studies of tumour cell lines (Takeda et al., 1996) and transgenic mice (Kirma et al., 2004) in which c-fms and/or its ligand are over-expressed. Second, CSF-1 may promote macrophage recruitment associated with increased production of angiogenic (Okazaki et al., 2005; Lin et al., 2006), mitogenic (Goswami et al., 2005) and pro-invasive factors (Lin et al., 2001). Finally, CSF-1 exerts an immunosuppressive action since it alters differentiation of myeloid dendritic cells, promoting emergence of a tolerogenic or macrophage-like phenotype (Menetrier-Caux et al., 1998; Li et al., 2005; Lo et al., in press). T-cells are not normally responsive to CSF-1 since they do not express the CSF-1R. The hypothesis underlying our study is that T-lymphocytes directed to CSF-1-producing tumours would prove more effective therapeutic agents if genetically modified such that their growth and activation was potentiated by exposure to this cytokine. In this study, we provide proof of principle for this assertion. We demonstrate that the human CSF-1R is functionally active when expressed in T-lymphocytes and can deliver a CSF-1-dependent signal that co-stimulates growth and activation. 2. Materials and methods 2.1. Recombinant DNA constructs To express the wild-type or mutated human CSF-1R in CTLL2 cells, the onco-retroviral expression vectors, vsn-2 (G418 resistance) or pBabe puro (puromycin resistance) were used. In each case, a 3.1 kb cDNA of c-fms was ligated into the EcoR I site of the vector. The mutants Y809F and K616A cfms cDNAs have been described previously (Baker et al., 1994; Uden et al., 1999). For expression in Jurkat and primary human T-cells, c-fms cDNAs were ligated into the Nco I site of the SFG onco-retroviral expression vector. To facilitate detection of transduced cells, some SFG-based constructs also contained an Encephalomyocarditis virus internal ribosome entry site/enhanced Green fluorescent protein cassette (EMCV IRES eGFP) ligated in the BamH I site of SFG. DNA encoding for the membrane-associated isoform of human CSF-1 was sub-cloned as a 1 kb SmaI/EcoR I fragment in pSL1180 and then ligated into pBabe puro following EcoR I/BamH I partial digestion. pBH H12 -ras contains a 903 bp human H-ras cDNA fragment with a transforming codon 12 (G → D) mutation (Baker et al., 1994), ligated into the EcoR I site of pBabe hygro (pBH – encodes resistance to hygromycin). To generate the F28 fusion receptor, the extracellular domain (bp 301–1838) of the CSF-1R was PCR amplified using primers 1 (5’ CCATGGGCCCAGGAGTTCTGCTGC 3 ) and 2 (5 ACCAACCACCACCAG CACCCAAAACTCATCCGGGGGATGCGTGTGGGC 3 ). The product (P1) incorporates the sequence encoding the entire extracellu-

1278

A.S.Y. Lo et al. / Molecular Immunology 45 (2008) 1276–1287

lar domain of the human CSF-1R, attached to a small portion of the transmembrane region of CD28. Bases 556762 of human CD28 were amplified using primers 3 (5 TTTTGGGTGCTGGTGGTGGTTGGT 3 ) and 4 (5 TCAGGAGCGATAG GCTGCGAAGTC 3 ). The product (P2) incorporates the transmembrane and intracellular domains of CD28 (amino acids 135–202). Since P1 and P2 are complementary (underlined sequences), they were PCR fused using primers 1 and 4 to generate F28. The final product was A-tailed with taq polymerase and cloned in the TA vector pCR2.1 (Invitrogen, Paisley, UK) before ligation into the Nco I site of SFG. To generate F28+, the extracellular domain of the human CSF1R was amplified using primers 5 (5 CCATGGGCCCAGGAGTTCTGC TGCTCCT 3 ) and 6 (5 TTCAATTGCGGCCGCTGAGGACTCATCCGGGGGATGCGTGT GGGCTCC 3 ). The product was A-tailed and cloned in pCR2.1 as above. Following Nco I/Not I digestion, it was ligated with cDNA encoding amino acids 96-202 of CD28 (Not I/Bam H I fragment) and SFG (Nco I/Bam HI digested). The P28z chimeric antigen receptor was expressed using SFG, as described (Maher et al., 2002). 2.2. Cell lines All cell lines were from ATCC unless otherwise stated. PG13 retroviral packaging cells were maintained in DMEM + 10% FCS. NIH3T3 cells were maintained in DMEM + 10% donor calf serum. NIH3T3 fibroblasts expressing human B7.1 were a generous gift of Dr Jean-Baptiste Latouche (Department of Human Genetics, Memorial Sloan Kettering Cancer Center, New York, NY). CTLL-2 is a murine IL-2-dependent CD8+ Tcell line and was maintained in RPMI + 10% foetal bovine serum (FBS) + 100 U/ml IL-2 (aldesleukin, Novartis, Frimley, UK). E6 Jurkat cells were kindly provided by Dr Clay Lyddane (Department of Human Genetics, Memorial Sloan Kettering Cancer Center, New York, NY) and were maintained in RPMI + 10% FBS. LNCaP prostate carcinoma cells were maintained in RPMI + 10% FBS. All tissue culture media was supplemented with l-glutamine, penicillin and streptomycin (all from Invitrogen, Paisley, UK). 2.3. Pharmacological inhibitors Pharmacological inhibitors were all purchased from Calbiochem (Nottingham, UK), dissolved in DMSO and used at the following concentrations: Wortmannin (PI3K inhibitor: up to 1000 nM), PD98059 (MEK inhibitor: up to 100 nM). In all cases, DMSO was used as a solvent control. 2.4. Retroviral transduction of immortalized T-cell lines and primary human T-cells For gene transfer into CTLL-2 or Jurkat cells respectively, target cells were co-cultivated for 3 days with GP + E86 or PG13 retroviral packaging cell lines respectively. Infected cells were selected using G418 (1 mg/ml), hygromycin (500 ␮g/ml) or puromycin (1–3 ␮g/ml) as appropriate. Where vectors did not possess a selectable marker, transduced cells were purified by

flow sorting (GFP) or immunomagnetic selection using the rat anti-CSF-1R antibody, 3-4A4 followed by incubation with goat anti-rat IgG coated Dynabeads (Invitrogen, Paisley, UK). Human peripheral blood mononuclear cells were obtained from screened anonymised blood packs (purchased from the UK National Blood Transfusion Service). Following ficoll separation, T-cells were transduced using the PG13 packaging cell line as described (Maher et al., 2002; Brentjens et al., 2003). T-cells were propagated in RMPI + 10% AB human serum (Sigma– Aldrich, Poole, UK) + IL-2 (20 U/ml, unless otherwise stated). 2.5. Flow cytometry To demonstrate surface CSF-1R, F28 or F28+ expression, cells were incubated for 30 min with 1 ␮g of 3-4A4 antibody followed by 10 ␮l of a 1/150 dilution of PE or FITC-conjugated goat anti-rat IgG (100 mg/ml – both from Santa Cruz (Santa Cruz, CA)). To demonstrate expression of mCSF-1 in transduced NIH3T3 cells, goat anti-human CSF-1 serum was used (2 ␮g/test – Sigma–Aldrich, Poole, UK) followed by 10 ␮l of 1/100 swine anti-goat IgG FITC conjugate (Caltag/Invitrogen, Paisley, UK). Expression of the prostate-specific membrane antigen (PSMA)specific P28z fusion receptor was directly demonstrated using PE-conjugated goat anti-mouse antiserum (Caltag/Invitrogen, Paisley, UK), which recognizes conserved murine sequences in the scFv fragment. Transduced cells were also visualized as a consequence of GFP expression. CD4-PE and CD8-PerCP antibodies (Becton Dickinson, San Jose, CA) were used to assess T-cell subset distribution of GFP-expressing cells and purity of cells derived by immunomagnetic separation. To determine absolute number of gene-modified T-cells in the CD4+ or CD8+ subset, dual platform analysis was used. First, the percentage of GFP+ CD4+ or GFP+ CD8+ T-cells in cultures was determined by flow cytometry. Absolute numbers were then calculated as %GFP+ × total cell count/100. Flow cytometry analysis was performed using a Becton Dickinson FACScan or FACScalibur cytometer using Cellquest software. Measurement of phosphorylation of Erk1 and 2 was measured by flow cytometry using a murine phosphoErk-specific antibody (Cell signaling technology, Danvers, MA) as described (Chow et al., 2001). 2.6. Cytotoxicity assays Assays of cytotoxic T-lymphocyte (CTL)-mediated killing were performed using a non-radioactive cytotoxicity detection kit (lactate dehydrogenase (LDH) – Boehringer Mannehim, Germany) as described (Maher et al., 2002). In brief, transduced T-cells and target-cells were established in RPMI + 2% AB human serum and co-cultured at the indicated ratios for 4 h in triplicate. Percent specific LDH release was calculated as (effector + target-cell mix − effector cell control) − low control/maximum LDH release − low control. 2.7. Generation of human T-cells that co-express CSF-1R and the P28z CAR T-cells were simultaneously transduced with SFG c-fms and SFG P28z IRES GFP by addition of equal volumes of

A.S.Y. Lo et al. / Molecular Immunology 45 (2008) 1276–1287

retrovirus-conditioned supernatant, as described (Maher et al., 2002). CSF-1R-expressing cells were positively selected by incubation with the 3-4A4 monoclonal antibody, followed by collection of cells using paramagnetic beads coated with goat anti-rat IgG. To enrich for P28z-expressing cells, CSF-1R+ T-lymphocytes were co-cultivated twice over a 10-day period with the PSMA-expressing LNCaP prostate carcinoma cell line (Maher et al., 2002).

2.8. Protein analysis The expression of CSF-1R protein was analysed by [␥-32 P] ATP labelling of immunoprecipitates as previously described (Dibb et al., 1990) using antiserum raised against the CSF-1R. Demonstration of MAP kinase and Akt phosphorylation was performed by Western blotting as described (Taylor et al., 2006).

1279

2.9. Activation of T-cells and measurement of cytokine production Murine cells: CTLL-2 cells (105 cells/ml) were activated with PMA and ionomycin (Sigma–Aldrich, Poole UK; at the indicated concentrations) ± CSF-1. Supernatants were harvested from cultures on day 3, and analysed in duplicate or triplicate for IFN-␥ production by in-house sandwich ELISA using R46A2 (1 ␮g/ml) as the capture antibody, biotinylated XMG1.2 (1.5 ␮g/ml) as the detection antibody and murine IFN-␥ as standard (all from BD Biosciences PharMingen, Oxford, UK). The coefficient of variation for all data presented was less than 10%. Human cells: Jurkat cells and primary human T-cells were activated in non-tissue culture treated plates coated with goat anti-mouse antiserum (1 ␮g/ml) followed by OKT3 (Memorial Sloan Kettering Cancer Center, NY) at the indicated concentrations. Plates were blocked with mouse serum prior to addition of soluble anti-CD28 antibody (CLB-CD28/1, 15E8;

Fig. 1. Signalling by the CSF-1R when expressed in CTLL-2 cells. (A) CTLL-2 cells were engineered to express the c-fms-encoded CSF-1R or indicated mutant receptor. Cell surface expression was demonstrated by flow cytometry (open histogram). Background staining of control CTLL-2 cells is shown by the filled histogram. (B) A kinase assay was performed following immunoprecipitation of wild-type or indicated mutant CSF-1R from CTLL-2 cells. The mature and immature glycoforms of the receptor are indicated by the upper and lower arrows, respectively. (C) CSF-1 (5000 U/ml) was added to CTLL-2 cells that express wild-type or Y809F mutant CSF-1R for the indicated times. Levels of Erk1/2, Akt and phosphorylated Erk/Akt were analysed by Western blotting. (D) CTLL-2 c-fms cells were analysed by intracellular staining and flow cytometry for phospho-Erk in the absence of stimulation (+Nil) or following addition of CSF-1 for 2 min (open histograms). The filled histogram indicates staining with secondary antibody alone. (E) A time course of phospho-Erk (P-ERK) positive cells was generated by intracellular staining and flow cytometry at the indicated time points in CTLL c-fms (filled symbols) or CTLL c-fms Y809F (open symbols), following stimulation with CSF-1 (5000 U/ml).

1280

A.S.Y. Lo et al. / Molecular Immunology 45 (2008) 1276–1287

Research Diagnostics, Franklin Lakes, NJ) where indicated. In some experiments, transduced Jurkat cells were co-cultivated overnight with NIH3T3 monolayers expressing human mCSF1, human B7.1 (or empty NIH3T3 cells as control). To provide TCR cross-linking in trans, soluble OKT3 (1 ␮g/ml) was added in the presence of goat anti-mouse IgG (1 ␮g/ml). Human IFN-␥ and IL-2 were measured in harvested supernatants using commercially available kits (R&D systems, Abingdon, UK). 2.10. Purification of human T-cell subsets T-cells were separated into CD4+ and CD8+ subsets by positive selection using the CD4 and CD8 Dynabead-Detachabead system (Invitrogen, Paisley, UK) as described by the manufacturers. Purity of subsets obtained was >99.5%. 2.11. Cell migration assay One million T-cells were placed in the upper chamber of a transwell insert (6.5 mm diameter, 5 ␮m pore size; Corning, NY) in RPMI + 10% AB serum. The lower chamber contained medium ± CSF-1 (5000 U/ml). After 4 h, cells that had migrated through the transwell into the lower chamber were counted in triplicate by trypan exclusion. 3. Results 3.1. The human CSF-1R is functionally active in the CD8+ T-cell line, CTLL-2

Fig. 2. Functional activity of the human CSF-1R when expressed in CTLL-2 cells. (A) 104 cells expressing wild-type or indicated c-fms mutant were washed free of IL-2 and plated ±5000 U/ml CSF-1. IL-2 was added on day 0 and day 3 at the indicated concentrations. Cell numbers were counted on day 6. Data presented are from a representative experiment. Similar findings were observed in six independent experiments. (B) 105 cells/ml expressing wild-type or mutant c-fms were washed free of IL-2 and then activated with ionomycin (400 ng/ml) + PMA (concentrations indicated) ±CSF-1 (5000 U/ml). Supernatants were harvested for measurement of IFN-␥ on day 3. Similar results were found in six independent experiments. (C) CTLL-2 c-fms cells were plated in CSF-1 (5000 U/ml) at 105 cells/ml or in IL-2 (100 U/ml – added on day 0 and day 3) at 3 × 104 cells/ml ± PD98059 (MEK inhibitor) or wortmannin (PI3K inhibitor) at the indicated concentrations. Cell numbers were evaluated on day

To examine whether the CSF-1R can signal in T-lymphocytes, CTLL-2 cells were separately infected with retroviral vectors encoding the normal human CSF-1R and two mutant CSF-1Rs: the kinase deficient c-fms K616A and the signalling defective c-fms Y809F mutants. All three receptors were expressed on the surface of CTLL-2 cells at similar levels (Fig. 1A). Kinase activity was detected in immunoprecipitates of wild type CSF1R and the Y809F mutant (at reduced levels), but not c-fms K616A (Fig. 1B), consistent with findings reported from other cell types (Downing et al., 1989; van der Geer and Hunter, 1991). The two protein bands in Fig. 1B represent the mature and immature glycoforms of the CSF-1R. Upon stimulation with CSF-1, CTLL-2 c-fms cells exhibit rapid and transient phosphorylation of Erk1, Erk2 (Fig. 1C and D) and Akt (Fig. 1C). This is followed by a second sustained peak of Erk kinase phosphorylation at later time points (Fig. 1E). Activation of the Erk and PI3K sig-

5. Similar results were obtained in three independent experiments. (D) CTLL-2 c-fms cells were plated in IL-2 (2 U/ml) ± CSF-1 (5000 U/ml) at 3 × 104 cells/ml supplemented with PD98059 or wortmannin at the indicated concentrations. IL2 was added again on day 3 and cell numbers evaluated on day 5. Similar results were obtained in three independent experiments. (E) Following infection with pBH H12 -ras or empty vector (pBH) as control, 104 CTLL-2 cells/ml were plated in IL-2 at the indicated amounts (added on days 0 and 3). Comparison was made with growth of CTLL-2 c-fms cells ± CSF-1 (2000 U/ml) as positive control. Cell numbers were counted after 6 days. Similar results were observed in three independent experiments.

A.S.Y. Lo et al. / Molecular Immunology 45 (2008) 1276–1287

1281

nalling pathways was markedly attenuated in cells that express the Y809F mutant (Fig. 1C and E). Together, these data demonstrate that the CSF-1R can engage diverse signalling pathways when expressed in CTLL-2 cells. Next, the functional activity of the CSF-1R was examined in CTLL-2 cells. In the absence of IL-2, CSF-1 promoted slow growth of CTLL-2 c-fms cells, which was highly density dependent (Fig. 2A and data not shown). However, the growthpromoting action of CSF-1 was much more readily apparent when assayed in synergy with IL-2 (Fig. 2A). Over the range of IL-2 concentrations from 2.0 to 20 U/ml, CTLL-2 c-fms cells exhibited a marked enhancement of growth in the presence of CSF-1, in contrast to cultures expressing either mutant CSF-1R (Fig. 2A). This synergistic action was observed in concentrations as low as 100 U/ml (1.2 ng/ml) of CSF-1 and was also evident using three separate CTLL-2 isolates (data not shown). In addition to providing an assay of T-cell growth, we found that CTLL-2 cells provide a convenient model of T-cell activation. Upon simulation with PMA + ionomycin, nanogram quantities of interferon-␥ (IFN-␥) are produced by these cells (Fig. 2B). Unlike control cultures, activation of CTLL-2 c-fms cells in the additional presence of CSF-1 results in substantial enhancement of IFN-␥ production (Fig. 2B). 3.2. CSF-1-dependent growth and synergy with IL-2 is dependent upon the Ras/MEK/Erk kinase pathway

Fig. 3. Co-stimulation of IL-2 production by Jurkat c-fms cells in response to membrane-anchored CSF-1. (A) Jurkat cells were engineered to express the CSF-1R (sequence shown in black) or CSF-1R/CD28 fusion receptors (CD28 sequence is shaded). In F28, the extracellular domain of the CSF-1R was joined to the transmembrane + intracellular domains of CD28. In F28+, amino acids 96–202 of CD28 have been incorporated (includes 39 amino acids from extracellular domain of CD28). Cell surface receptor expression was demonstrated by flow cytometry (open histograms). Staining of untransduced Jurkat cells is indicated by the filled histogram. (B) 5 × 105 Jurkat cells/ml bearing the indicated receptor (or untransduced control) were activated in triplicate wells using immobilized OKT3 (1 ␮g/ml) ± soluble anti-CD28 antibody (CLB-CD28; 1 ␮g/ml) or CSF-1 (5000 U/ml). Supernatants were harvested after 16 h and analysed for IL-2. (C) Expression of mCSF-1 was demonstrated in retrovirustransduced NIH3T3 fibroblasts by flow cytometry (filled histogram). Staining of untransduced NIH3T3 cells is shown by the open histogram. (D) Transduced

To identify the roles played by individual signalling pathways downstream of the CSF-1R, inhibitor studies were performed. These experiments revealed that growth of CTLL-2 c-fms cells in response to CSF-1, but not IL-2, was inhibited by PD98059 – a specific MEK antagonist (Fig. 2C, left panel). By contrast, addition of the PI3K inhibitor wortmannin had no effect on cell growth in response to either cytokine (Fig. 2C, right panel). Next, we examined the effect of MEK inhibition upon synergy between CSF-1 and a limiting concentration of IL-2 (2 U/ml – Fig. 2D). Titration of PD98059 into these cultures resulted in a dose-dependent inhibition of this synergy but had no effect upon growth of the same cells in response to IL-2 alone (Fig. 2D, left panel). Wortmannin did not influence the proliferation of CTLL2 c-fms cells in response to IL-2 or IL-2 plus CSF-1 (Fig. 2D, right panel). Next, we examined whether constitutive activation of the Ras-MEK-Erk kinase signalling pathway can mimic the synergistic action of CSF-1 in CTLL-2 cells. Compared to cells infected with an empty vector, CTLL-2 H12 -ras cells manifest increased growth in a range of sub-optimal concentrations of IL-2 (Fig. 2E). Together, these data implicate the Ras/MEK/Erk pathway in the mitogenic action of CSF-1 upon CTLL-2 cells. or untransduced (control) Jurkat cells were plated on a confluent monolayer of NIH3T3 fibroblasts that express B7.1, mCSF-1 or untransduced NIH3T3 (control). Cross-linking of CD3 was achieved by addition of OKT3 + goat antimouse IgG in solution. Supernatants were harvested after overnight activation and assayed for IL-2 by ELISA. The dotted horizontal lines in panels B and D indicate the sensitivity of the IL-2 ELISA.

1282

A.S.Y. Lo et al. / Molecular Immunology 45 (2008) 1276–1287

3.3. Co-stimulation of IL-2 production by c-fms-expressing Jurkat-cells in response to membrane-associated, but not soluble CSF-1 To compare co-stimulation by CSF-1R and CD28, a model was established using Jurkat cells. Two control CSF-1R/CD28 fusion receptors (F28 and F28+) were compared to the wild type CSF-1R and anti-CD28 antibody for their ability to enhance IL-2 production (Fig. 3A). Upon activation with immobilized anti-CD3 (OKT3), the addition of soluble anti-CD28 antibody results in a 4–6-fold increase in IL-2 content of harvested supernatants (Fig. 3B). By contrast, CSF-1 did not increase IL-2 production by OKT3-activated Jurkat cells that express CSF1R, F28 or F28+. Nonetheless, soluble CSF-1 was clearly active on CSF-1R+ Jurkat-cells as indicated by up-regulation of the early activation marker CD69 (data not shown). Next, we examined if the membrane-bound form of CSF-1 (mCSF-1) can co-stimulate IL-2 production by OKT3-activated Jurkat cells. When Jurkat c-fms cells were co-cultivated with an NIH3T3 monolayer that expresses mCSF-1 (Fig. 3C), greatly enhanced IL-2 production was observed in comparison to cells that were co-cultivated with control NIH3T3 cells (Fig. 3D). IL-2 production by Jurkat cells that express F28 or F28+ was also increased by mCSF-1, reaching levels at least as high as those elicited by B7.1 (Fig. 3D). Together, these data indicate that the CSF-1R is functionally active in Jurkat cells and can provide a CD28-like co-stimulatory signal upon engagement with membrane-anchored but not soluble CSF-1. 3.4. Testing of the functional activity of the CSF-1R in primary human T-lymphocytes To test the effect of CSF-1R expression upon primary human T-cells, c-fms was delivered using a GFP-containing retroviral vector (Fig. 4A). Gene transfer efficiency varied between 16 and 68% and similar proportions of CD4+ and CD8+ T-cells were transduced (Fig. 4A). To provide a gene transfer control, T-cells were separately transduced with P28z GFP (Maher et al., 2002), which encodes a PSMA-specific chimeric antigen receptor together with GFP. As expected, T-cells transduced with the control vector were unresponsive to CSF-1 but did exhibit a proliferative response to anti-CD28 in the presence of OKT3 (Fig. 4B). By contrast, in the same assay CSF-1 enhanced the proliferation of T-cells that expressed the CSF-1R (Fig. 4B). Co-stimulation by CSF-1 differed from that mediated by CD28 in that it was not accompanied by increased

Table 1 Production of interferon-␥ by CSF1-R+ T-cells Stimulus

CD3 CD3 + CD28 CD3 + CSF-1 CD3 + CSF-1 + CD28

CSF-1Ra

Controla

Day 1

Day 3

Day 1

Day 3

3.2 8.8 6.6 12.4

4.0 15.4 15.9 38.4

4.7 9.6 4.5 9.1

4.9 16.6 2.8 13.8

a Human T-cells were transduced with SFG c-fms IRES GFP (25% transduction efficiency) or control vector (SFG P28z IRES GFP – 37%). Cells were plated at 5 × 105 cells/ml in duplicate wells and activated with immobilised OKT3 (1 ␮g/ml); soluble CD28 antibody (100 ng/ml) ± CSF-1 (5000 U/ml) as indicated. Data show mean levels of IFN-␥ (ng/ml) present in supernatants harvested on days 1 and 3. %CV between duplicates was <10%.

IL-2 production (data not shown) and also exhibited slower kinetics. Next, we examined if soluble CSF-1 can enhance T-cell activation in response to a limiting signal 1 (via OKT3) + signal 2 (via CD28). As expected, c-fms-expressing human T-cells exhibited very poor expansion when plated at low density with sub-optimal amounts of OKT3 + anti-CD28 (Fig. 4C). However, when CSF-1 was added to these cultures, striking co-stimulation of T-cell expansion was observed. Cytokine production by CSF1-R+ primary human T-cells was examined following activation with OKT3 + anti-CD28 and/or CSF-1. Addition of CSF-1 increased IFN-␥ production by cfms-expressing cells (Table 1). This action of CSF-1 was evident when cells were activated with OKT3 alone or together with anti-CD28 antibody and was not apparent in control cultures. When added to monocytes, CSF-1 promotes chemotactic migration of these cells (Pierce et al., 1990). Using a transwell assay system, we observed that CSF-1 also stimulates chemotaxis of primary human T-cells that expressed c-fms, but not control T-cells (Fig. 4D). 3.5. Assessment of the functional activity of the human CSF-1R in CD4+ and CD8+ T-cell subsets Using unsorted T-cell cultures, we consistently found that expansion of CSF-1R+ T-cells was more apparent in the CD8+ than the CD4+ T-cell subset (exemplified in Fig. 4C and data not shown). By contrast, in experiments performed with purified T-cell subsets we found that the synergistic action of the CSF1R upon T cell proliferation was more evident for CD4+ than

Fig. 4. Functional activity of the CSF1-R when expressed in primary human T-cells. (A) Flow cytometric analysis of gene modified T-lymphocytes. Cells were transduced with a GFP-containing bi-cistronic retroviral vector that encodes for the human CSF-1R (FMS GFP – lower row) or a PSMA-specific CAR (P28z GFP – upper row, right). Untransduced T-cells are also shown as staining controls (upper row – left). (B) Transduced T-cells were activated in triplicate wells of a 96 well dish using indicated combinations of immobilized OKT3 + anti-CD28 (CLB-CD28 – 100 ng/ml) or CSF-1 (5000 U). The dotted horizontal line indicates starting cell number. Cell number was re-evaluated after 3 days (upper row) and 6 days (lower row). Similar results were obtained in three independent experiments. (C) Transduced T-cells were activated in triplicate wells using immobilized OKT3, anti-CD28 and CSF-1 (100 ng CSF-1 = 8333 U). Each well initially contained 5 × 104 T-cells (represented by the dotted horizontal line on each graph) with similar numbers of CD4+ and CD8+ T-cells. Total cell number was re-evaluated after 9 days (FMS GFP – vertical bars). Control (P28z GFP) cultures yielded no detectable cells in this assay. Where cell number permitted, absolute number of GFP+ CD4+ and CD8+ T-cells was measured in FMS GFP cultures on day 9 (indicated by the callout). Similar results were obtained in two independent experiments. (D) One million T-cells were placed in the upper chamber of a transwell insert (CSF1-R+ = 58%). The lower chamber contained medium ± CSF1 (5000 U/ml). After 4 h, cells that had migrated through the transwell into the lower chamber were counted in triplicate (*p < 0.05).

A.S.Y. Lo et al. / Molecular Immunology 45 (2008) 1276–1287

1283

1284

A.S.Y. Lo et al. / Molecular Immunology 45 (2008) 1276–1287

Fig. 5. Activity of the CSF-1R in purified CD4+ and CD8+ human T-cells. Human T-cells were transduced with FMS GFP and then separated into CD4+ and CD8+ subsets by positive selection. T-cells were 58% (CD4+ ) and 67% (CD8+ ) surface CSF-1R+ . Triplicate cultures (5 × 104 T-cells per well – indicated by the horizontal lines) were activated using immobilized OKT3, anti-CD28 ± CSF-1 (5000 U/ml). Cell numbers were re-evaluated after 8 days. Similar findings were obtained in two independent experiments.

for CD8+ T-cells (Fig. 5). These data indicate that the growthpromoting action of the CSF-1R upon CD8+ T-cells is dependent upon the simultaneous presence of CD4+ cells in the cultures. 3.6. Co-expression of the CSF-1R and a chimeric antigen receptor in primary human T-lymphocytes Chimeric antigen receptors (CAR) provide a promising approach to target T-lymphocytes to native tumour antigens (Sadelain et al., 2003). The PSMA-specific P28z CAR contains a fused CD28 + CD3␨ signalling domain that enables T-cells to lyse PSMA-expressing tumour cells. P28z+ T-cells then undergo a brief proliferative burst that is most apparent following primary and secondary encounter with antigen (Maher et al., 2002). To examine if activation of the CSF-1R could enhance the function of P28z, these molecules were co-expressed in human T-cells (Fig. 6A). As expected, T-cells that co-express P28z and CSF-1R can kill PSMA-expressing prostate cancer cells (Fig. 6B). Addition of CSF-1 did not affect this process. However, addition of CSF-1 significantly enhanced PMSAdependent expansion of T-cells that co-express both P28z and the CSF-1R (Fig. 6C). In agreement with the data obtained using CTLL-2 cells, T-cell proliferation remained dependent upon provision of low-dose exogenous IL-2 (Fig. 6C). 4. Discussion In this study, we report that the human CSF-1R can signal effectively when ectopically expressed in CD4+ or CD8+ T-lymphocytes, so establishing the principle that T-cells can be modified to respond to key tumour-derived cytokines. In agreement with previous studies, we found that CSF-1 in isolation was a relatively poor mitogen (Roussel et al., 1990; von R¨uden et al., 1991) and did not promote macrophage differentiation of immortalized or primary T-lymphocytes (Bourette et

al., 2007). However, since CSF-1 is a potent synergistic factor (Baker et al., 1994), we also examined the ability of this cytokine to enhance signalling in combination with sub-optimal growth stimuli. Using this approach, we found that CSF-1 synergistically enhanced T-cell proliferation in response to IL-2 and following activation with antibodies to CD3 ± CD28. We also found that CSF-1 increased the production of IFN-␥, promoted chemotaxis and could enhance T-cell proliferation in response to a tumour-specific chimeric antigen receptor. These diverse positive effects support the potential of CSF-1-responsive T-cells for cancer treatment. The RAS/MEK/Erk kinase pathway was found to be important for the synergistic action of CSF-1 upon CTLL-2 cells as evidenced by the effects of MEK inhibition and the fact that expression of oncogenic Ras mimicked the action of CSF-1. CSF-1-mediated activation of this pathway was also demonstrated in c-fms-expressing primary human T-cells (data not shown). By contrast, inhibition of PI3K did not affect proliferation in response to CSF-1, in agreement with previous studies (Roche et al., 1994). Furthermore, proliferation in response to IL-2 was not affected by MEK inhibition, as has been reported by others (Crawley et al., 1996). Co-stimulation mediated by the CSF-1R in response to soluble CSF-1 was distinct from that provided by CD28 since it was not accompanied by enhanced IL-2 production. By contrast, membrane-bound CSF-1 did co-stimulate IL-2 production by c-fms-expressing Jurkat cells. This finding is in keeping with other data indicating that membrane-anchored CSF-1 provides a more potent signal than its soluble counterpart (Friel et al., 2005). Why should T-cells possess the signalling machinery to respond so effectively to CSF-1 following ectopic CSF-1R expression? One possible explanation is that the CSF-1R can activate pathways normally recruited by a related receptor, which is naturally expressed in T-lymphocytes. At least three

A.S.Y. Lo et al. / Molecular Immunology 45 (2008) 1276–1287

1285

Fig. 6. CSF-1 enhances T-cell proliferation mediated by a chimeric antigen receptor. (A) Human T-cells were simultaneously transduced with P28z GFP and SFG c-fms (lacks GFP). Dual transduced cells accounted for 5% of the starting population and were enriched by immunoselection for CSF-1R and two cycles of stimulation on PSMA+ tumour cells. The flow cytometric profile of the resultant T-cell line is shown (GFP used to track P28z expression). (B) To examine the effect of CSF-1 on tumour cell killing, a 4-h CTL assay was performed using PSMA-expressing LNCaP cells (or control NIH3T3) as targets. No specific cytotoxicity directed against NIH3T3 cells was detected. (C) Proliferation assays were established by plating FMS+ P28z+ T-cells (or FMS+ or P28z+ as control) in triplicate on the PSMA-expressing tumour cell line, LNCaP or control NIH3T3 cells ± CSF-1 (5000 U/ml). Cultures were established in the presence or absence of IL-2 (20 U/ml on days 0 and 3). No T-cell proliferation occurred on NIH3T3 monolayers.

illustrative examples present themselves. The first is the stem cell factor (SCF) receptor, which is also a member of subfamily III of the RTK and is highly homologous to the CSF-1R (Fantyl et al., 1993). In myeloid cells, CSF-1 can mimic the broad synergistic action of SCF by activating a pathway requiring Y809 of the CSF-1R and involving the Ras-MAP kinase cascade (Baker et al., 1994). Here, we demonstrate that this pathway is conserved in CTLL-2 cells and plays a key role in the growth-promoting

action of CSF-1 in these cells. The demonstration that SCF can enhance the IL-2 responsiveness of activated T-cells (Bluman et al., 1996) may reflect a naturally occurring counterpart of the synergy reported here between CSF-1 and IL-2. A second example is the Eph family of receptor tyrosine kinases. A number of Eph kinases and their ligands (ephrins) are expressed by T-cells and can co-stimulate growth and production of IFN-␥ but not IL-2 in a MEK sensitive manner (Yu et al., 2003). Both ephrins

1286

A.S.Y. Lo et al. / Molecular Immunology 45 (2008) 1276–1287

(Aasheim et al., 2005) and stem cell factor (Taylor et al., 2001) can enhance chemotactic responses of T-lymphocytes. Furthermore, Eph-related chemotaxis has been ascribed to Erk kinase activation in some models (Vindis et al., 2003). These findings closely mimic those reported here for CSF-1R. A third RTK that is expressed by a subset of human T-cells is the fibroblast growth factor 1 receptor (FGF1R), a member of RTK sub-family IV. Similar to other RTK, FGF1R is known to signal through the Ras MAP kinase cascade in response to ligand (Kouhara et al., 1997). By contrast to the effect of soluble CSF-1, addition of FGF to Jurkat cells has been reported to co-stimulate IL-2 production in the presence of heparin (Byrd et al., 1999). It is noteworthy that heparin induces oligomerization of FGF molecules which would be expected to promote formation of an aggregated cluster of FGF receptor complexes. This may explain why soluble CSF1 fails to co-stimulate Jurkat activation while membrane-bound CSF-1 (or FGF + heparin) is active in this regard. The wild type CSF-1R was responsive to both soluble and mCSF-1, whereas the CSF-1R/CD28 fusions described here were only active when engaged by the membrane anchored form of this cytokine. In light of the copious amounts of circulating CSF-1 found in patients with a number of different tumour types, we therefore engineered primary human T-cells to express the wild type CSF-1R rather than pursuing the development of CSF1R/CD28 fusions. An important advantage of this approach is that the synergistic action of CSF-1 would be expected to lower the in vivo requirements of such T-cells for systemically administered IL-2, an approach presently limited by the toxicity of this agent. It remains to be seen if the chemotactic action of CSF-1 will facilitate intratumoral migration of gene-modified T-cells. Taken together, the data presented here establish the principle that T-cells can be modified to receive potent co-stimulation of growth and activation in response to a tumour-derived cytokine. In light of the prevalence of dysregulated growth factor production in human cancer, similar strategies can be envisaged to enhance T-cell function in a broad range of tumour types. Acknowledgements The authors would like to thank Dr Michel Sadelain (Department of Human Genetics, Memorial Sloan Kettering Cancer Center, New York, NY) for provision of the SFG onco-retroviral vector and for helpful discussions. We also thank Dr. Kirsten Koths (Chiron Corporation, Emeryville, CA) who generously provided cDNA encoding for mCSF-1. Antiserum raised against the CSF-1R was a kind gift of Dr L. Rohrschneider (Fred Hutchinson Cancer Research Center, Seattle, WA). We also thank Dr Scott Wilkie (Breast Cancer Biology Group, King’s College London) for helpful discussions and critical review of the manuscript. This study was supported by a Royal College of Pathologists/Health Foundation Senior Clinician Scientist Research Fellowship (JM), a Breast Cancer Campaign Project Grant (JM) and a Breast Cancer Concept Award from the US Department of Defense under contract DAMD17-01-1-0556 (JM). Agnes Shuk Yee Lo was supported by a JRC research fellowship from King’s College London.

References Aasheim, H.C., Delabie, J., Finne, E.F., 2005. Ephrin-A1 binding to CD4+ T lymphocytes stimulates migration and induces tyrosine phosphorylation of PYK2. Blood 105, 2869–2876. Baiocchi, G., Kavanagh, J.J., Talpaz, M., Wharton, J.T., Gutterman, J.U., Kurzrock, R., 1991. Expression of the macrophage colony-stimulating factor and its receptor in gynecologic malignancies. Cancer 67, 990–996. Baker, D.A., Maher, J., Roberts, I.A.G., Dibb, N.J., 1994. Evidence that Ras and Myc mediate the synergy between SCF or M-CSF and other haemopoietic growth factors. Leukemia 8, 1970–1981. Bluman, E.M., Schnier, G.S., Avalos, B.R., Strout, M.P., Sultan, H., Jacobson, F.W., Williams, D.E., Carson, W.E., Caligiuri, M.A., 1996. The c-kit ligand potentiates the allogeneic mixed lymphocyte reaction. Blood 88, 3887–3893. Bollard, C.M., Rossig, C., Calonge, M.J., Huls, M.H., Wagner, H.J., Massague, J., Brenner, M.K., Heslop, H.E., Rooney, C.M., 2002. Adapting a transforming growth factor beta-related tumor protection strategy to enhance antitumor immunity. Blood 99, 3179–3187. Boon, T., Coulie, P.G., Van den Eynde, B., 1997. Tumor antigens recognized by T cells. Immunol. Today 18, 267–268. Bourette, R.P., Grasset, M.F., Mouchiroud, G., 2007. E2a/Pbx1 oncogene inhibits terminal differentiation but not myeloid potential of pro-T cells. Oncogene 26, 234–247. Brentjens, R.J., Latouche, J.B., Santos, E., Marti, F., Gong, M.C., Lyddane, C., King, P.D., Larson, S., Weiss, M., Rivi`ere, I., Sadelain, M., 2003. Eradication of systemic B-cell tumors by genetically targeted human T lymphocytes co-stimulated by CD80 and interleukin-15. Nat. Med. 9, 279–286. Bubenik, J., 2004. MHC class I down-regulation: tumour escape from immune surveillance? (review). Int. J. Oncol. 25, 487–491. Byrd, V.M., Ballard, D.W., Miller, G.G., Thomas, J.W., 1999. Fibroblast growth factor-1 (FGF-1) enhances IL-2 production and nuclear translocation of NFkB in FGF receptor-bearing Jurkat T-cells. J. Immunol. 162, 5853–5859. Chow, S., Patel, H., Hedley, D.W., 2001. Measurement of MAP kinase activation by flow cytometry using phospho-specific antibodies to MEK and ERK: potential for pharmacodynamic monitoring of signal transduction inhibitors. Cytometry 46, 72–78. Crawley, J.B., Willcocks, J., Foxwell, B.M., 1996. Interleukin-7 induces T-cell proliferation in the absence of Erk/MAP kinase activity. Eur. J. Immunol. 26, 2717–2723. Dibb, N.J., Green, S.M., Ralph, P., 1990. Expression of v-fms and c-fms in the hemopoietic cell line FDC-P1. Growth Factors 2, 301–311. Downing, J.R., Roussel, M.F., Sherr, C.J., 1989. Ligand and protein kinase C downmodulate the colony-stimulating factor 1 receptor by independent mechanisms. Mol. Cell. Biol. 9, 2890–2896. Fantyl, W.J., Johnson, D.E., Williams, L.T., 1993. Signaling by receptor tyrosine kinases. Ann. Rev. Biochem. 62, 453–481. Friel, J., Heberlein, C., Geldmacher, M., Ostertag, W., 2005. Diverse isoforms of colony-stimulating factor-1 have different effects on the development of stroma-dependent hematopoietic cells. J. Cell. Physiol. 204, 247–259. Gajewski, T.F., Meng, Y., Blank, C., Brown, I., Kacha, A., Kline, J., Harlin, H., 2006. Immune resistance orchestrated by the tumor microenvironment. Immunol. Rev. 213, 131–145. Goswami, S., Sahai, E., Wyckoff, J.B., Cammer, M., Cox, D., Pixley, F.J., Stanley, E.R., Segall, J.E., Condeelis, J.S., 2005. Macrophages promote the invasion of breast carcinoma cells via a colony-stimulating factor1/epidermal growth factor paracrine loop. Cancer Res. 65, 5278–5283. Hamilton, J.A., 1997. CSF-1 signal transduction. J. Leukoc. Biol. 62, 145–155. Haynes, N.M., Trapani, J.A., Teng, M.W., Jackson, J.T., Cerruti, L., Jane, S.M., Kershaw, M.H., Smyth, M.J., Darcy, P.K., 2002. Single-chain antigen recognition receptors that costimulate potent rejection of established experimental tumors. Blood 100, 3155–3163. Kacinski, B.M., 1997. CSF-1 and its receptor in breast carcinomas and neoplasms of the female reproductive tract. Mol. Reprod. Dev. 46, 71–74. Kaminska, J., Kowalska, M., Kotowicz, B., Fuksiewicz, M., Glogowski, M., Wojcik, E., Chechlinska, M., Steffen, J., 2006. Pretreatment serum levels of cytokines and cytokine receptors in patients with non-small cell lung cancer, and correlations with clinicopathological features and prognosis. M-CSF—an independent prognostic factor. Oncology 70, 115–125.

A.S.Y. Lo et al. / Molecular Immunology 45 (2008) 1276–1287 Kershaw, M.H., Westwood, J.A., Parker, L.L., Wang, G., Eshhar, Z., Mavroukakis, S.A., White, D.E., Wunderlich, J.R., Canevari, S., RogersFreezer, L., Chen, C.C., Yang, J.C., Rosenberg, S.A., Hwu, P., 2006. A phase I study on adoptive immunotherapy using gene-modified T cells for ovarian cancer. Clin. Cancer Res. 12, 6106–6115. Kirma, N., Hammes, L.S., Liu, Y.G., Nair, H.B., Valente, P.T., Kumar, S., Flowers, L.C., Tekmal, R.R., 2007. Elevated expression of the oncogene c-fms and its ligand, the macrophage colony-stimulating factor-1, in cervical cancer and the role of transforming growth factor-beta1 in inducing c-fms expression. Cancer Res. 67, 1918–1926. Kirma, N., Luthra, R., Jones, J., Liu, Y.G., Nair, H.B., Mandava, U., Tekmal, R.R., 2004. Overexpression of the colony-stimulating factor (CSF-1) and/or its receptor c-fms in mammary glands of transgenic mice results in hyperplasia and tumor formation. Cancer Res. 64, 4162–4170. Kommoss, F., Wolfle, J., Bauknecht, T., Pfisterer, J., Kiechle-Schwarz, M., Pfleiderer, A., Sauerbrei, W., Kiehl, R., Kacinski, B.M., 1994. Co-expression of M-CSF transcripts and protein Fms (M-CSF receptor) transcripts and protein, and steroid receptor content in adenocarcinomas of the ovary. J. Pathol. 174, 111–119. Kouhara, H., Hadari, Y.R., Spivak-Kroizman, T., Schilling, J., Bar-Sagi, D., Lax, I., Schlessinger, J., 1997. A lipid-anchored Grb2-binding protein that links FGF-receptor activation to the Ras/MAPK signaling pathway. Cell 89, 693–702. Li, G., Kim, Y.J., Broxmeyer, H.E., 2005. Macrophage colony-stimulating factor drives cord blood monocyte differentiation into IL-10(high)IL-12absent dendritic cells with tolerogenic potential. J. Immunol. 174, 4706–4717. Lin, E.Y., Li, J.F., Gnatovskiy, L., Deng, Y., Zhu, L., Grzesik, D.A., Qian, H., Xue, X.N., Pollard, J.W., 2006. Macrophages regulate the angiogenic switch in a mouse model of breast cancer. Cancer Res. 66, 11238–11246. Lin, E.Y., Nguyen, A.V., Russell, R.G., Pollard, J.W., 2001. Colony-stimulating factor 1 promotes progression of mammary tumors to malignancy. J. Exp. Med. 193, 727–740. Lo, A.S.Y., Gorak-Stolinska, P., Bachy, V., Ibrahim, M.A., Kemeny, D.M., Maher, J. Modulation of dendritic cell differentiation by colony-stimulating factor-1: role of phosphatidylinositol 3 -kinase and delayed caspase activation. J. Leukoc. Biol., in press. Maher, J., Brentjens, R.J., Gunset, G., Rivi`ere, I., Sadelain, M., 2002. Human T-lymphocyte cytotoxicity and proliferation directed by a single chimeric TCRzeta/CD28 receptor. Nat. Biotechnol. 20, 70–75. McDermott, R.S., Deneux, L., Mosseri, V., Vedrenne, J., Clough, K., Fourquet, A., Rodriguez, J., Cosset, J.M., Sastre, X., Beuzeboc, P., Pouillart, P., Scholl, S.M., 2002. Circulating macrophage colony stimulating factor as a marker of tumour progression. Eur. Cytokine Netw. 13, 121–127. Menetrier-Caux, C., Montmain, G., Dieu, M.C., Bain, C., Favrot, M.C., Caux, C., Blay, J.Y., 1998. Inhibition of the differentiation of dendritic cells from CD34+ progenitors by tumor cells: role of interleukin-6 and macrophage colony-stimulating factor. Blood 92, 4778–4791. Morgan, R.A., Dudley, M.E., Wunderlich, J.R., Hughes, M.S., Yang, J.C., Sherry, R.M., Royal, R.E., Topalian, S.L., Kammula, U.S., Restifo, N.P., Zheng, Z., Nahvi, A., de Vries, C.R., Rogers-Freezer, L.J., Mavroukakis, S.A., Rosenberg, S.A., 2006. Cancer regression in patients after transfer of genetically engineered lymphocytes. Science 314, 126–129. Mroczko, B., Groblewska, M., Wereszczynska-Siemiatkowska, U., Okulczyk, B., Kedra, B., Laszewicz, W., Dabrowski, A., Szmitkowski, M., 2007. Serum macrophage-colony stimulating factor levels in colorectal cancer patients correlate with lymph node metastasis and poor prognosis. Clin. Chim. Acta 380, 208–212. Okazaki, T., Ebihara, S., Takahashi, H., Asada, M., Kanda, A., Sasaki, H., 2005. Macrophage colony-stimulating factor induces vascular endothelial growth factor production in skeletal muscle and promotes tumor angiogenesis. J. Immunol. 174, 7531–7538. Pierce, J.H., Di Marco, E., Cox, G.W., Lombardi, D., Ruggiero, M., Varesio, L., Wang, L.M., Choudhury, G.G., Sakaguchi, A.Y., Di Fiore, P.P., Aaronson, S.A., 1990. Macrophage-colony-stimulating factor (CSF-1) induces proliferation, chemotaxis, and reversible monocytic differentiation in myeloid progenitor cells transfected with the human c-fms/CSF-1 receptor cDNA. Proc. Natl. Acad. Sci. U.S.A. 87, 5613–5617.

1287

Pule, M.A., Straathof, K.C., Dotti, G., Heslop, H.E., Rooney, C.M., Brenner, M.K., 2005. A chimeric T cell antigen receptor that augments cytokine release and supports clonal expansion of primary human T cells. Mol. Ther. 12, 933–941. Roche, S., Koegl, M., Courtneidge, S.A., 1994. The phosphatidylinositol 3kinase alpha is required for DNA synthesis induced by some, but not all, growth factors. Proc. Natl. Acad. Sci. U.S.A. 91, 9185–9189. Rosenberg, S.A., Sherry, R.M., Morton, K.E., Scharfman, W.J., Yang, J.C., Topalian, S.L., Royal, R.E., Kammula, U., Restifo, N.P., Hughes, M.S., Schwartzentruber, D., Berman, D.M., Schwarz, S.L., Ngo, L.T., Mavroukakis, S.A., White, D.E., Steinberg, S.M., 2005. Tumor progression can occur despite the induction of very high levels of self/tumor antigen-specific CD8+ T cells in patients with melanoma. J. Immunol. 175, 6169–6176. Roussel, M.F., Transy, C., Kato, J.Y., Reinherz, E.L., Sherr, C.J., 1990. Antibodyinduced mitogenicity mediated by a chimeric CD2-c-fms receptor. Mol. Cell. Biol. 10, 2407–2412. Sadelain, M., Rivi`ere, I., Brentjens, R., 2003. Targeting tumours with genetically enhanced T lymphocytes. Nat. Rev. Cancer 3, 35–45. Sapi, E., 2004. The role of CSF-1 in normal physiology of mammary gland and breast cancer: an update. Exp. Biol. Med. (Maywood) 229, 1–11. Skates, S.J., Horick, N., Yu, Y., Xu, F.J., Berchuck, A., Havrilesky, L.J., de Bruijn, H.W., van der Zee, A.G., Woolas, R.P., Jacobs, I.J., Zhang, Z., Bast Jr., R.C., 2004. Preoperative sensitivity and specificity for early-stage ovarian cancer when combining cancer antigen CA-125II, CA 15-3, CA 72-4, and macrophage colony-stimulating factor using mixtures of multivariate normal distributions. J. Clin. Oncol. 22, 4059–4066. Stanley, E.R., Berg, K.L., Einstein, D.B., Lee, P.S., Pixley, F.J., Wang, Y., Yeung, Y.G., 1997. Biology and action of colony-stimulating factor-1. Mol. Reprod. Dev. 46, 4–10. Suzuki, M., Ohwada, M., Sato, I., Nagatomo, M., 1995. Serum levels of macrophage colony-stimulating factor as a marker for gynecologic malignancies. Oncology 52, 128–133. Takeda, S., Soutter, W.P., Dibb, N.J., White, J.O., 1996. Biological activity of the receptor for macrophage colony-stimulating factor in the human endometrial cancer cell line, Ishikawa. Br. J. Cancer 73, 615–619. Taylor, J.R., Brownlow, N., Domin, J., Dibb, N.J., 2006. FMS receptor for MCSF (CSF-1) is sensitive to the kinase inhibitor imatinib and mutation of Asp-802 to Val confers resistance. Oncogene 25, 147–151. Taylor, M.L., Dastych, J., Sehgal, D., Sundstrom, M., Nilsson, G., Akin, C., Mage, R.G., Metcalfe, D.D., 2001. The Kit-activating mutation D816V enhances stem cell factor-dependent chemotaxis. Blood 98, 1195– 1199. Uden, M., Morley, G.M., Dibb, N.J., 1999. Evidence that downregulation of the M-CSF receptor is not dependent upon receptor kinase activity. Oncogene 18, 3846–3851. van der Geer, P., Hunter, T., 1991. Tyrosine 706 and 807 phosphorylation site mutants in the murine colony-stimulating factor-1 receptor are unaffected in their ability to bind or phosphorylate phosphatidylinositol-3 kinase but show differential defects in their ability to induce early response gene transcription. Mol. Cell. Biol. 11, 4698–4709. Vindis, C., Cerretti, D.P., Daniel, T.O., Huynh-Do, U., 2003. EphB1 recruits c-Src and p52Shc to activate MAPK/ERK and promote chemotaxis. J. Cell. Biol. 162, 661–671. von R¨uden, T., Mouchiroud, G., Bourette, R.P., Ouazana, R., Blanchet, J.P., Wagner, E.F., 1991. Expression of human CSF-1 receptor induces CSF1-dependent proliferation in murine myeloid but not in T-lymphoid cells. Leukemia 5, 3–7. Xue, S.A., Gao, L., Hart, D., Gillmore, R., Qasim, W., Thrasher, A., Apperley, J., Engels, B., Uckert, W., Morris, E., Stauss, H., 2005. Elimination of human leukemia cells in NOD/SCID mice by WT1-TCR gene-transduced human T cells. Blood 106, 3062–3067. Yu, G., Luo, H., Wu, Y., Wu, J., 2003. Ephrin B2 induces T cell costimulation. J. Immunol. 171, 106–114. Yu, P., Lee, Y., Liu, W., Chin, R.K., Wang, J., Wang, Y., Schietinger, A., Philip, M., Schreiber, H., Fu, Y.-X., 2004. Priming of na¨ıve T cells inside tumors leads to eradication of established tumors. Nat. Immunol. 5, 141–149.