Hawthorn (Crataegus pinnatifida Bunge) leave flavonoids attenuate atherosclerosis development in apoE knock-out mice

Author’s Accepted Manuscript Hawthorn (Crataegus pinnatifida Bunge) leave flavonoids attenuate atherosclerosis development in apoE knock-out mice Pengzhi Dong, Lanlan Pan, Xiting Zhang, Wenwen Zhang, Xue Wang, Meixiu Jiang, Yuanli Chen, Yajun Duan, Honghua Wu, Yantong Xu, Peng Zhang, Yan Zhu

PII: DOI: Reference:

www.elsevier.com/locate/jep

S0378-8741(17)30274-X http://dx.doi.org/10.1016/j.jep.2017.01.040 JEP10687

To appear in: Journal of Ethnopharmacology Received date: 15 August 2016 Revised date: 13 January 2017 Accepted date: 20 January 2017 Cite this article as: Pengzhi Dong, Lanlan Pan, Xiting Zhang, Wenwen Zhang, Xue Wang, Meixiu Jiang, Yuanli Chen, Yajun Duan, Honghua Wu, Yantong Xu, Peng Zhang and Yan Zhu, Hawthorn (Crataegus pinnatifida Bunge) leave flavonoids attenuate atherosclerosis development in apoE knock-out mice, Journal of Ethnopharmacology, http://dx.doi.org/10.1016/j.jep.2017.01.040 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Hawthorn (Crataegus pinnatifida Bunge) leave flavonoids attenuate atherosclerosis development in apoE knock-out mice Pengzhi Dong11, 3, Lanlan Pan§1, 3, Xiting Zhang§1, 3, Wenwen Zhang2, Xue Wang6, Meixiu Jiang5, Yuanli Chen4, Yajun Duan2, Honghua Wu1, 3, Yantong Xu1, 3, Peng Zhang1, 3, Yan Zhu1, 3* 1 Tianjin State Key Laboratory of Modern Chinese Medicine, Tianjin University of Traditional Chinese Medicine, Tianjin 300193, China 2 The College of Life Sciences, Nankai University, Tianjin, 300071, China 3 Research and Development Center of TCM, Tianjin International Joint Academy of Biotechnology & Medicine, Tianjin, China 4 School of Medicine, Nankai University, Tianjin, 300071, China 5 Institute of Translational Medicine, Nanchang University, Nanchang, 330031, China 6 The Academy of Fundamental and Interdisciplinary Science, Harbin Institute of Technology, Harbin, 150080, China Pengzhi Dong: [email protected] Lanlan Pan: [email protected] Xiting Zhang: [email protected] Wenwen Zhang: [email protected] Xue Wang: [email protected] Meixiu Jiang: [email protected] Yuanli Chen: [email protected] Yajun Duan: [email protected] Honghua Wu: [email protected] Yantong Xu: [email protected] Peng Zhang: [email protected] Yan Zhu: [email protected] * Correspondence should be addressed to Yan Zhu. ABSTRACT Ethnopharmacological relevance: Hawthorn (Crataegus pinnatifida Bunge) leave have been used to treat cardiovascular diseases in China and Europe. Hawthorn leave flavonoids (HLF) are the main part of extraction. Whether hawthorn leave flavonoids could attenuate the development of atherosclerosis and the possible mechanism remain unknown. Materials and methods: High-fat diet (HFD) mixed with HLF at concentrations of 5 mg/kg and 20 mg/kg were administered to apolipoprotein E (apoE) knock out mice. 16 weeks later, mouse serum was collected to determine the lipid profile while the mouse aorta dissected was prepared to measure the lesion area. Hepatic mRNA of genes involved in lipid metabolism were determined. Peritoneal macrophages were collected to study the impact of HLF on cholesterol efflux, formation of foam cell and the expression of ATP binding cassette transporter A1 (ABCA1). Besides, in vivo reverse cholesterol transport (RCT) was conducted. Results: HLF attenuated the development of atherosclerosis that the mean atherosclerotic lesion area in 1

These authors contribute equally to this work. 1

en face aortas was reduced by 23.1% (P<0.05). In mice fed with 20 mg/kg HLF, Total cholesterol (TC) level was decreased by 18.6% and very low density lipoprotein cholesterol plus low density lipoprotein cholesterol (VLDLc+LDLc) level were decreased by 23.1% whereas high density lipoprotein cholesterol (HDLc) and triglyceride (TG) levels were similar compared to that of the control group. Peroxisome proliferator activated receptor alpha (PPARα) mRNA was increased by 31.2% (P<0.05) and 60.9% (P<0.05) in mice fed with 5 mg/kg and 20 mg/kg HLF respectively. Sterol regulatory element binding protein-1c (SREBP-1c) was decreased by 59.3% in the group of 20 mg/kg. Carnitine palmitoyl transferase 1 (CPT-1) mRNA level of 20 mg/kg group was induced 66.7% (P<0.05). Superoxide dismutase 1 and 2 (SOD1 and SOD2) mRNA were induced 25.4% (P<0.05) and 71.4% (P<0.05) while induced by 36.3% (P<0.05) and 73.2 % (P<0.05) in group of 20 mg/kg. Glutathione peroxidase 3 (Gpx3) mRNA in the group of 20 mg/kg was induced by 96.7% (P<0.05). Hepatic hydroxymethylglutaryl CoA reductase (HMG-CoAR) expression was as same level as the control group while LDL receptor (LDLR) mRNA and protein were induced by 84.2% (P<0.05) and 98.8% (P<0.05) in group of 20 mg/kg. HLF inhibit the formation of foam cell by 27.9% (P<0.05) in the dosage of 25 μg/ml, and 33.3% (P<0.05) in the dosage of 50 μg/ml. HLF increased the reverse cholesterol transport (RCT) in vivo. Discussion and conclusion: Hawthorn leave flavonoids can slow down the development of atherosclerosis in apoE knockout mice via induced expression of genes involved in antioxidant activities, inhibition of the foam cell formation and promotion of RCT in vivo, which implies the potential use in the prevention of atherosclerosis.

Abbreviations: Hawthorn leave flavonoids, HLF; high-fat diet, HFD; apoE, apolipoprotein E; ATP binding cassette transporter A1, ABCA1; reverse cholesterol transport, RCT; total cholesterol, TC; very low density lipoprotein cholesterol, VLDLc; low density lipoprotein cholesterol, LDLc; high density lipoprotein cholesterol, HDLc; triglyceride, TG; peroxisome proliferator activated receptor alpha, PPARα; sterol regulatory element binding protein-1c, SREBP-1c; carnitine palmitoyl transferase 1, CPT-1; superoxide dismutase 1, SOD1 ; superoxide dismutase 2, SOD2 ; glutathione peroxidase 3, Gpx3; hydroxymethylglutaryl CoA reductase, HMG-CoAR; LDL receptor, LDLR; glyceraldehyde-3-phosphate dehydrogenase, GAPDH

Keywords: Hawthorn (Crataegus pinnatifida Bunge) leave flavonoids; Atherosclerosis; Reverse cholesterol transport; Foam cell

1. Introduction Hawthorn is classified as Rosaceae, Crataegus pinnatifida Bunge(Shi et al., 2013). It has been used as multi-effect traditional medicine for the prevention and treatment of heart disease in China and th

Europe(Chang et al., 2005; Tassell et al., 2010). Dating back to the early 20 century, hawthorn was used to improve circulation (Agelet and Vallès, 2003; Pieroni and Quave, 2005) and to treat insomnia (Vitalini 2

et al., 2009). In the UK, hawthorn was used for myocardial dysfunction, hypertension and atherosclerosis (British Herbal Pharmacopoeia, 1983). Its fruits were used for treating disorders of blood circulation in China (Chen et al., 2002). The extracts of hawthorn fruit, leave and flowers might prevent hypertension and heart failure (Li et al., 2009; Rothfuß et al., 2001). In clinical trials evaluating the efficacy of hawthorn, patients diagnosed with chronic heart failure (CHF) and categorised according to New York Heart Association (NYHA) classification (classes I to III), the leaf and flower extracts of hawthorn increased exercise tolerance and improved the symptoms of fatigue and shortness of breath(Pittler et al., 2008; Pittler et al., 2003). A standardized extract of WS 1442 and LI 132 were used as an adjunctive treatment and shown benefit in symptom control and physiologic outcomes (Bubik et al.; Rigelsky, J.M. and Sweet, B.V., 2002).

It was demonstrated that hawthorn fruits or their extracts were able to protect against development of atherosclerosis (Zhang et al., 2013; Zhang et al., 2014). However, whether extract from hawthorn leave were able to decrease the process of atherosclerosis has not been studied. The flavonoids are considered to be the key source of antioxidant effect (Wang et al., 2013). They could improve the situation of acute myocardial ischemia and inhibit the inflammation in anesthetized dogs (Fu et al., 2013), and may alleviate liver injury by means of the suppression of oxidative stress/lipid peroxidation reaction and the overexpression of uncoupling protein 2 (UCP2) in liver, which could prevent the further development of nonalcoholic steatohepatitis (NASH)

and protect cardiomyocytes from

ischemia-reperfusion injury(Li et al., 2009). It is known that inefficient reverse cholesterol transport can lead to accumulation of lipids in macrophages and their appearance in the aorta intima as foam cells, which is one of first crucial steps in development of atherosclerosis (Galkina and Ley, 2009; Johnson and Newby, 2009). Accumulation of cholesterol is toxic to the cells. They are effluxed by macrophages into serum, transported to the liver and metabolized into bile acid in the feces. This so called reverse cholesterol transport (RCT) is mediated by a series of receptors and transporters, such as cluster of differentiation 36 (CD36), scavenger receptor BI (SR-BI), LDL receptor (LDLR)(Bodzioch et al., 1999; Phillips, 2014; Rust et al., 1999). In particular, ATP binding cassette transporter A1 (ABCA1) is believed to be critical for cholesterol efflux (Oram, 2003). The objective of this work is to examine the impact of hawthorn leave flavonoids (HLF) on the -/-

development of atherosclerosis in apoE mice and to identify the possible mechanisms from the aspects of antioxidant and hypolipidemic activities.

2. Materials and methods 2.1 Reagent RPMI 1640(Cat.11875119) medium was obtained from Gibico (Life Technologies, Palo Alto, CA, USA). Acetylated low-density lipoprotein (acLDL), HDL and apolipoprotein A1 (apoAI) were prepared as described (Zhou et al., 2008). Antibody of ABCA1(Cat. NB400-105) purchased from Novus Biologicals, LLC (Littleton, CO, USA). Antibody of HMG-CoAR(Cat. ab174830) and LDLR (Cat. ab52818) purchased from Abcam (Cambridge, MA, USA). Pitavastatin (Cat. 147526-32-7) was purchased from Kowa (Tokyo, 3

Japan). Oil Red O solution (Cat. 1320-06-5) was obtained from Sigma-Aldrich (St Louis, MO, USA). H Cholesterol (1 mCi/ml, specific activity of 40–60 Ci/mmol) was purchased from New England Nuclear Life Science Products (Boston, MA, USA). All other chemicals were purchased from Sigma-Aldrich (St Louis, MO, USA).

2.2 Plant material 3

Hawthorn leave flavonoids (HLF) was a kind gift from Prof. Tao Wang from Tianjin University of Traditional Chinese Medicine (TCM). C. pinnatifida Bge. leave were collected from Qingshan Mountain, Ji County, Tianjin, China in September 25, 2014. Dr. Hong Liu identified all specimen. The voucher specimen (No.20071016-3) was deposited in Tianjin University of TCM. The hawthorn leave extract preparation and qualification followed the protocols published before (Tao et al., 2010). Wang and colleagues identified 11 major compounds in HLF are isovitexin-2"-O-rhamnoside, cyanidol, rutin-4'''-O-rhamnoside, eriodietyol-5, 3'-diglueoside, vitexin-4"-O-glucoside, vitexin-2"-O-rhamnoside, rutin, hyperoside, quercetin-4'-O-glucoside, vitexin-2"-O-glucoside (or vitexin-4"-O-glucoside) and quercetin. The structures were determined(Wang, Tao et al., 2011).

2.3 Animals −/−

ApoE-deficient mice (apoE ) (Cat. 002052) were obtained from the Jackson Laboratory (Bar Harbor, ME, USA). Wild type mice were bought from HFK BioSciences Co., Ltd (Beijing, China). Animal study -/-

protocols （No. EC20150023）were approved by the Ethics Committee of Nankai University. ApoE mice were fed with High-Fat diet (HFD) (Cat. MD12015) supplied by Jiangsu Medicine Co., Ltd (Nanjing, China). These mice were bred at the Animal Center of Nankai University. -/-

To study the effect of HLF on the HFD induced dyslipidemia, 40 apoE mice were randomly divided into 4 groups (10 mice/group). There were groups of control, 5 mg/kg HLF, 20 mg/kg HLF and 1 mg/kg Pitavastatin. These mice were fed with High-Fat diet (HFD) mixed with HLF (5 mg/kg or 20 mg/kg) or pitavastatin (1mg/kg) for 16 weeks. Control group received same volume of dimethyl sulphoxide (DMSO). Dosages of HLF applied in this study were calculated based on the Food and Drug Administration (FDA) Draft Guidelines (Reagan-Shaw et al., 2008). To study the effect of HLF on the reverse cholesterol transport (RCT) in vivo, C57BL/6N mice were fed with normal chow containing 20 mg/kg HLF or the same volume of DMSO. The feces of each group were collected at different time points. All mice used in this study were free to gain water and food and maintained at the Animal Center of Nankai University. At the end of experiments, the animals were anaesthetized and sacrificed via suffocation by carbon dioxide asphyxiation.

2.4 Cell culture -/-

Another group (10 mice/group) of apoE mice other than those received HLF or pitavastatin treatment were used for macrophages isolation. Peritoneal macrophages were collected as following steps: 8-week -/-

apoE mice were i.p. injected with 4 ml of 4% thioglycollate solution. Five days later, cold and sterilized phosphate buffer solution (PBS) was injected into the mouse abdomen and peritoneal macrophages were collected by centrifuge at 2,000 g for 10 minutes. The cells were cultivated in complete RPMI 1640 medium with 10% heat-inactivated fetal bovine serum (Invitrogen, Carlsbad, Calif. USA), penicillin (100 U/ml), and streptomycin (100 μg/ml) and cultured at 37°C in a humidified atmosphere with 5% CO 2 followed by the removal of all floating cells. Macrophages were continually cultivated in complete RPMI 1640 medium for 2 days before they received treatment.

2.5 Determination of serum triglyceride, total, HDL, VLDL and LDL cholesterol levels Blood sample was collected through retro-orbital veins under isoflurane anesthesia. The blood sample was transferred into a 1.5 ml tube and kept in room temperature for 2 hours, and then centrifuged for 5 minutes at 2,000 g. The upper layer serum (~150 µl/sample) was transferred into a new tube diluted with 4

PBS (1:1), and then loaded onto an automatic biochemical analyzer (Model 7020, Hitachi, Tokyo, Japan) to complete the assay. Total cholesterol (TC), triglyceride (TG), high density lipoprotein cholesterol (HDLc), and low density lipoprotein cholesterol (LDLc) levels were analyzed(Chen et al., 2015). To determine very low density lipoprotein cholesterol (VLDLc), the density of serum pooled from 3 mice was adjusted to 1.019 g/mL with NaBr solution and fractioned by ultracentrifugation at 105,000 g for 22 hours at 5 °C (ProteomeLab XL-I, Bechman Coulter, Fullerton, CA, USA). The fraction with the density less than 1.019 g/mL was collected, and the cholesterol content was determined(Lee and Alaupovic, 1970).

2.6 Dissecting mouse aortas and en face aortic lesion area analysis -/-

ApoE mouse aortas were dissected as following steps: cold PBS was used to perfuse the vasculature. Full length aorta, prolonged 5 to10 mm below bifurcation of the iliac arteries, including the subclavian right and left common carotid arteries, was removed and fixed in PBS containing 4% paraformaldehyde at room temperature. After removing the connecting tissue, the aorta was stained by Oil Red O solution (0.5% in isopropanol) following the protocol published before(Chen et al., 2014). The whole aorta was photographed and the lesion area was measured by ImagePro plus software (Media Cybernetics, Inc. Silver Spring, MD, USA).

Data was presented as mean percent of lesion area of the total aorta area±

SEM. Student’s t-test was employed for statistical analysis.

2.7 T-AOC and Antioxidant Enzymes Activities in the Serum The total antioxidant capacity (T-AOC) values in the serum were quantitatively measured using a kit (Cat. ab65329) supplied by Abcam (Cambridge, UK) according to the manufacturer’s instructions. Concentration of 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox, included in the kit) was used to create a calibration curve (R2 = 0.999) and the results of the assay was calculated as nanomoles per microliter Trolox equivalents and expressed as Unit per microliter serum. The activities of superoxide dismutase (SOD) and glutathione peroxidase (GSH-PX) were measured in serum samples using an SOD assay kit (Cat. 706002) and GSH-PX assay kit (Cat. 703102) supplied by Cayman Chemical Company (Ann Arbor, MI, USA) following the procedure offered by the manufacturers, the results of the assay were expressed as Unit per microliter serum. 2.8 Quantitative RT-PCR analysis Total RNA was extracted from liver using TRIzol reagent (Cat. 15596026) purchased from Invitrogen (Carlsbad, CA, USA) in accordance with the protocols supplied by the manufacturer and treated with DNase I (Cat. 2212) (Takara, Kyoto, Japan). One microgram total RNA was used to obtain the cDNA by a reverse transcription kit (Cat. 11483188001) purchased from Roche Applied Sciences (Basel, Switzerland) and real-time PCR was conducted using SYBR green PCR master mix (Cat. 1725272) purchased from Bio-Rad (Hercules, CA, USA), with primers listed in Table 1. The expression of genes was normalized by the corresponding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA.

Table 1. Primers list for real-time PCR analysis Gene

Primer

Oligonucleotide sequence (5＇~3＇)

Product length

SREBP-1c

F

TGACCCGGCTATTCCGTGA

61

5

LDLR

SOD1

SOD2

Gpx3

PPARα

CPT-1

HMG-CoAR

R

CTGGGCTGAGCAATACAGTTC

F

TCAGACGAACAAGGCTGTCC

R

CCATCTAGGCAATCTCGGTCTC

F

AACCAGTTGTGTTGTCAGGAC

R

CCACCATGTTTCTTAGAGTGAGG

F

CAGACCTGCCTTACGACTATGG

R

CTCGGTGGCGTTGAGATTGTT

F

CCTTTTAAGCAGTATGCAGGCA

R

CAAGCCAAATGGCCCAAGTT

F

AACATCGAGTGTCGAATATGTGG

R

CCGAATAGTTCGCCGAAAGAA

F

TGGCATCATCACTGGTGTGTT

R

GTCTAGGGTCCGATTGATCTTTG

F

TGTTCACCGGCAACAACAAGA

R

CCGCGTTATCGTCAGGATGA

116

139

113

120

99

133

101

F, forward (sense) primer. R, reverse (antisense) primer. 2.9 Measurement of foam cell formation -/-

There were six apoE mice were prepared for isolation. Peritoneal macrophages isolated from male −/−

apoE

mice were plated on coated 12-mm glass slides in 24-well plates. HLF was dissolved in DMSO.

Control group received the same volume of DMSO as HLF. 50,000 cells were counted for each well seeding. Macrophages were treated with 25 μg/ml or 50 μg/ml HLF for 12 hours and incubated with 50 μg/ml ox-LDL for 2 hours. Then, the cells were fixed in 4% paraformaldehyde for half an hour, washed with PBS three times, and then stained with Oil Red O solution for 1 hour at room temperature followed by three washes using double-distilled water. A haematoxylin solution was employed to conduct cell re-stain for 30 seconds. The cells were kept in water for 5 minutes and pictured. Cells that have 10 or more lipid droplets were considered as foam cells.

2.10 Measurement of free cholesterol efflux from macrophages Handle of radioactive elements followed the protocol of Biosafety Committee of Nankai University (No. 20140029). Peritoneal macrophages isolated from male apoE

-/-

mice and cultivated in 24-well plates

were switched to serum-free medium containing 50 μg/ml acLDL (carrier for free cholesterol labeling) and 3

150 nCi/ml [ H]-cholesterol for labeling assay. Twenty-four hours later, the peritoneal macrophages were washed twice with cold PBS and treated for 16 hours. Then, cells were switched to serum-free medium or medium containing purified apoAI (10 μg/ml). After incubation for 6 hours at 37 °C, medium from 24-well was collected, radioactivity in the supernatants was measured using Low Activity Liquid Scintillation Analyzer (Tri-Carb 2810TR, PerkinElmer, Boston, MA, USA). The remaining cells were lysed using 0.2 N NaOH and the content of the lysate was determined to normalize the cholesterol efflux.

2.11 Western Blotting 40 μg of protein for each sample was loaded on the gel and separated by SDS/PAGE (7.5% gel) and 6

transferred to a NC membrane. The membrane was blocked with 5% BSA in PBS for 1 hour at room temperature, incubated with a polyclonal antibody overnight at 4°C, washed in PBS-T solution for three times, exposed to HRP-conjugated rabbit antibody and incubated for 1 hour at room temperature. Later, the membrane was washed with PBS-T for three times and 10 minutes for each, incubated for 5 minutes with chemiluminescence immunoassay (Pierce, Rockford, IL) solution. Then, the film was developed.

2.12 Determination of reverse cholesterol transport (RCT) in vivo Handle of radioactive elements followed the protocol of Biosafety Committee of Nankai University (No. 20140031). The RCT in vivo was measured as follows (Naik et al., 2006; Zhang et al., 2005). Wild type (WT) C57Bl/6N mouse peritoneal macrophages were labeled in serum-free RPMI 1640 medium with 50 μg/ml acLDL and 2 μCi/ml [3H]-cholesterol for 24 hours. Then, cells were washed three times followed by 4 hours equilibration with medium containing 0.2% BSA, spun down and re-suspended in serum-free medium. Mice were fed with high-fat diet mixed with 20 mg/kg/day HLF for one week. The WT mice were then injected with the radiolabeled macrophages (~2x106 cells/mouse containing 1.2x106 cpm) and transferred into metabolic chambers. Feces from individual mouse were collected at 8, 16, 24, 32, 40 and 48 hours after the cell injection. At the end of the experiment, radioactivity in the feces was determined with a liquid scintillation counter (Tri-Carb 2810TR, PerkinElmer, Boston, MA, USA). 2.13 Statistics All experiments in this study were repeated for at least three times. Paired Student’s t test was used to analyze statistics. Data was subjected to a normal distribution analysis using SPSS software (1-sample K-S of non-parametic test). Statistically significant differences were defined as a two-tailed probability of less than 0.05. 3. Results 3.1 Hawthorn leave flavonoids attenuated the development of atherosclerosis in apoE-/- Mice In order to elucidate the effect of HLF on the development of atherosclerosis, male apoE-/mice were fed either with HLF (5 or 20 mg/kg/day) or normal chow for 16 weeks. Dose translation (Reagan-Shaw et al., 2008) into human equivalent dose (HED) resulted in 25 mg and 100 mg respectively. The dosage based on native water–ethanol extract of the leave and flowers ranges from 160 mg to 900 mg for clinic trials (Rigelsky, J. and Sweet, B., 2002). During the whole study, mice were free to water and food. There were no statistically significant body weight and food intake changes observed between the control and High-Fat-Diet (HFD) fed groups (Table 2). As shown in the images in Figure 1, lipids accumulated along the aorta (e.g. white arrows) and HLF reduced the lesion area compared to the control group. The mean atherosclerotic lesion area in en face aortas between the mice fed with HLF in dosage of 20 mg/kg was significantly decreased by 23.1% (p<0.05) compared to that observed in the control group. Table 2. Changes in body weight and food intake of apoE-/- mice

Initial body weight (g)

Control (n=10)

HLF (n=10) 5 mg/kg

HLF (n=10) 20 mg/kg

Pitavastatin (n=10) 1 mg/kg

19.34±2.31

19.56±1.99

19.75±2.46

19.49±2.44

7

Final body weight (g)

33.89±4.88

32.54±2.11

31.11±3.02

31.23±2.00

Food intake (g/day)

3.81±0.23

3.77±0.19

3.80±0.27

3.69±2.10

Values are represented as the mean±SD.

Figure 1. Hawthorn (Crataegus pinnatifida Bunge) leave flavonoids inhibited atherosclerosis development in male apoE-/- mice. Eight- week-old male apoE-/- mice were used in all groups. Control mice were fed with high-fat diet while other mice were fed with high-fat diet mixed HLF (5 or 20 mg/kg) or pitavastatin (1 mg/kg) for 16 weeks. At the end of experiments, mice were sacrificed, the lesion area of aorta was measured as described in the Methods. Representative images of aortas (A) and the quantitative results of lesions were presented (B). White arrows indicate the lipid accumulation. *P < 0.05 (n = 10) compared to the control group. 3.2 Hawthorn leave flavonoids decreased the level of total cholesterol in serum of apoE-/- mice To investigate the effects of HLF on the lipid profiles, serum samples were collected from mice 8

as mentioned, and total cholesterol (TC), low density lipoprotein cholesterol (LDLc), high density lipoprotein cholesterol (HDLc), triglyceride (TG) and very low density lipoprotein cholesterol (VLDLc) was determined. As shown in Figure 2 A and C, TC level was decreased by 18.6% and VLDLc+LDLc level was decreased by 23.1% (P<0.05) in the group fed with 20 mg/kg HLF while no significant change in either level was observed in the group fed with 5 mg/kg HLF. There was a similar amount of HDL-C and TG in HLF-fed mice compared to that of the control (Figure 2 C, D).

Figure 2. Effect of hawthorn (Crataegus pinnatifida Bunge) leave flavonoids on lipid concentration in serum of apoE-/- males. Eight- week-old male apoE-/- mice were used in all groups. Control mice were fed with high-fat diet while other mice were fed with high-fat diet mixed HLF (5 or 20 mg/kg) or pitavastatin (1 mg/kg) for 16 weeks. Mice were sacrificed, serum was collected and TC (A), TG (B), VLDLc+LDLc (C) and HDLc (D) content was determined. *P<0.05 (n=10) compared to the control group. 3.3 Hawthorn leave flavonoids increased the level of T-AOC and antioxidant enzyme activities in serum To further investigate whether the consumption of HLF increased the activities of antioxidant enzymes, the level of total antioxidant capacity (T-AOC), the activities of superoxide dismutase (SOD) and glutathione peroxidase (GSH-PX) was determined. As shown in Figure 3, serum value of T-AOC in the group fed with 20 mg/kg HLF that was significantly increased by 21.2%, and the SOD activity increased by 31.25% (P<0.05). The GSH-PX activity was also increased but did not reach statistical significance.

9

Figure 3. Hawthorn (Crataegus pinnatifida Bunge) leave flavonoids increased the level of T-AOC and antioxidant enzyme activities in serum. Eight- week-old male apoE-/- mice were used in all groups. Control mice were fed with high-fat diet while other mice were fed with high-fat diet mixed HLF (5 or 20 mg/kg) or pitavastatin (1 mg/kg) for 16 weeks. Total antioxidant capacity (A) and serum activities of SOD (B) and GSH-PX (C) were measured following the procedure supplied by the manufacturers. *P < 0.05 (n = 10) compared to the control group. 3.4 Expression of lipid metabolism-related genes was affected by hawthorn leave flavonoids consumption In an attempt to find out the mechanism that the HLF alters the lipid profile and activities of antioxidant enzymes, mRNA levels of the hepatic genes related to lipid metabolism were evaluated using real-time RT-PCR. As shown in Figure 4 A, the hepatic peroxisome proliferator activated receptor alpha (PPARα) mRNA was increased by 31.2% (P<0.05) and 60.9% (P<0.05) in 5 10

mg/kg and 20 mg/kg HLF-fed groups, respectively. The mRNA of sterol regulatory element binding protein-1c (SREBP-1c) was decreased by 59.3% in the 20 mg/kg HLF-fed group while not significantly decreased in 5 mg/kg HLF-fed group (Figure 4 B). The hepatic carnitine palmitoyl transferase 1 (CPT-1) mRNA level was induced by 66.7% in 20 mg/kg HLF-fed group (P<0.05) compared to that of the control (Figure 4 C). Superoxide dismutase 1 and 2 (SOD1 and SOD2) mRNA levels were increased. SOD1 and SOD2 mRNAs were induced by 25.4% (P<0.05) and 71.4% (P<0.05) in group fed with 5 mg/kg HLF, while they were induced by 36.3% (P<0.05) and 73.2 % (P<0.05) in group fed with 20 mg/kg HLF (Figure 4 D, E). The hepatic glutathione peroxidase 3 (Gpx3) mRNA was induced by 96.7% (P<0.05) in the group fed with 20 mg/kg HLF (Figure 4 F). As a positive control, pitavastatin (1 mg/kg) induced hepatic mRNA level of PPARα (106.7%, P<0.05), CPT-1 (114.1%, P<0.05), SOD1 (63.6%, P<0.05), SOD2 (199.2%, P<0.05), and Gpx3 (163.3%, P<0.05) while downregulated the expression of SREBP-1c by 197.6% (P<0.05).

11

Figure 4. Hepatic expression of genes related to lipid metabolism and antioxidant activities affected by consumption of hawthorn (Crataegus pinnatifida Bunge) leave flavonoids. Eightweek-old male apoE-/- mice were used in all groups. Control mice were fed with high-fat diet while other mice were fed with high-fat diet mixed HLF (5 or 20 mg/kg) or pitavastatin (1 mg/kg) for 16 weeks. Hepatic mRNA of PPARα (A), SREBP-1c (B), CPT-1 (C), SOD1 (D), SOD2 (E) and Gpx3 (F) were determined using real-time RT-PCR. *P < 0.05 (n = 10) compared to the control group. 3.5 Hawthorn leave flavonoids did not change the expression of HMG-CoAR but induced the expression of LDLR In order to clarify whether the decreased the level of TC was due to the decreased level of hepatic hydroxymethylglutaryl CoA reductase (HMG-CoAR), the expression of hepatic HMG-CoAR was determined. As shown in Figure 5, neither mRNA (Figure 5 A) nor protein (Figure 5 B) level of hepatic HMG-CoAR was changed. Given the result that consumption of HLF lowered the TC (Figure 2 A) and VLDLc+LDLc (Figure 2 C) level, the expression of hepatic low density lipoprotein receptor (LDLR) was measured. As shown in Figure 5 C, hepatic mRNA level LDLR was increased by 84.2% (P<0.05) in the group of 20 mg/kg and slightly but not significantly increased in the group of 5 mg/kg. The protein level of LDLR was increased by 98.8% (P<0.05) in the group of 20 mg/kg (Figure 5 D). We carefully speculated that the decreased TC and VLDLc+LDLc were not due to the inhibition of cholesterol synthesis but the increased metabolic processes.

Figure 5. Hawthorn (Crataegus pinnatifida Bunge) leave flavonoids do not alter the expression of HMG-CoAR but induce the expression of LDLR. Eight- week-old male apoE-/- mice were used in all groups. Control mice were fed with high-fat diet while other mice were fed with high-fat diet mixed HLF (5 or 20 mg/kg) or pitavastatin (1 mg/kg) for 16 weeks. Hepatic mRNA (A, C) and protein (B, D) of HMG-CoAR and LDLR were determined using real-time RT-PCR and Western blotting. *P < 0.05 (n = 10) compared to control group. 3.6 Hawthorn leave flavonoids inhibited foam cell formation Foam cell formation is one of the crucial steps in progression of atherosclerosis (Li and Glass, 2002). Promotion of reverse cholesterol transport (RCT) was thought to be an effective way to attenuate the development of atherosclerosis(Cuchel and Rader, 2006). In order to verify the 12

effect of HLF on foam cell formation, peritoneal macrophages were collected and treated with HLF at concentrations of 25 or 50 μg/ml. As shown in Figure 6 A, B, HLF inhibited the foam cell formation by 27.9% (P<0.05) in the dosage of 25 μg/ml, and 33.3% (P<0.05) in the dosage of 50 μg/ml. To determine the cholesterol efflux, peritoneal macrophages were labled with [3H]-cholesterol and treated with HLF at concentrations of 12.5, 25 and 50 μg/ml, respectively. Free cholesterol efflux from macrophages in response to HLF was measured 16 hours later. As shown in Figure 6 C, HLF induced the cholesterol efflux from macrophages by 24.1% (P<0.05) in dosage of 12.5 μg/ml, 49.1% (P<0.05) in dosage of 25 μg/ml and 76.2% (P<0.05) in dosage of 50 μg/ml, respectively. Since ATP binding cassette transporter A1 (ABCA1) protein is an important mediator in promoting macrophage free cholesterol efflux to apolipoprotein A1 (apoAI) receptor and thus inhibiting the foam cell formation (Aiello et al., 2002), the expression of ABCA1 protein were determined by Western blotting peritoneal macrophages isolated from wild type mice treated with HLF for 16 hours. As shown in Figure 6 D, HLF induced ABCA1 protein expression at concentrations of 12.5μg/ml (35.3%, P<0.05), 25μg/ml (91.5%, P<0.05) and 50μg/ml (30.6%, P<0.05) μg/ml.

Figure 6. Hawthorn (Crataegus pinnatifida Bunge) leave flavonoids inhibits macrophage/foam cell formation. Peritoneal macrophages from apoE-/-mice were seeded in 12-well plate, treated with 25 μg/ml or 50 μg/ml HLF for 12 hours, and stained with Oil Red O solution and haematoxylin (A) and foam cells were quantified (B) as describe in the Materials and methods.

13

Effects of HLF on cholesterol efflux (C) and ABCA1 protein level (D) in peritoneal macrophage were also derermined. *P<0.05 (n=3) compared to ox-LDL group. 3.7 Hawthorn leave flavonoids increased the RCT in vivo As mentioned above, ABCA1 protein level was upregulated by HLF (Figure 6 D). So, next we questioned what biological consequences could be by this elevation? Thus, wild type mice were used to feed with HLF (20 mg/kg) for 8 days. Eight days after the HLF treatment, radiolabeled macrophages were injected to the mice and the radioactivity at different time points was measured as mentioned in the Methods. As shown in Figure 7 A, [3H]-tracer accumulation over time was observed in both control mice and HLF fed mice. However, significantly increased [3H]-tracer in feces of HLF-fed mice was observed in time points of 32, 40 and 48 hours for 57.1% (P<0.05), 30.2% (P<0.05) and 22.7% (P<0.05), respectively. As shown in Figure 7 B, [3H]-tracer in serum and liver was also increased by 23.9% (P<0.05) and 57.1% (P<0.05) after consumption of HLF, demonstrating that HLF induced reverse cholesterol transport (RCT) in vivo.

Figure 7. Hawthorn (Crataegus pinnatifida Bunge) leave flavonoids induces reverse cholesterol transport in vivo. Eight-week-old WT C57/BL6 mice were fed with HLF (20 mg/kg) for 8 days. At the end of treatment, mice were i.p. injected with the radiolabeled macrophages, and feces at different time points were collected and the reverse cholesterol transport in vivo was determined. (A) Time course of CPM in feces of mice fed with HLF (20 mg/kg). (B) CPM in serum and liver of mice fed with HLF (20 mg/kg). * P<0.05 (n =10) compared to control group. 4. Discussion Our studies have shown that hawthorn leave flavonoids (HLF) was able to attenuate the development of atherosclerosis (Figure 1) and play a role in enhancing the antioxidant activity (Figure 3). As shown in Figure 2, HLF reduced the serum total cholesterol (TC) (by 18.6%) and very low density lipoprotein cholesterol plus low density lipoprotein cholesterol (VLDLc+LDLc) (by 23.1%), but have no significant effect on high density lipoprotein cholesterol (HDLc) level. In comparison, a previous report showed that hawthorn leave decreased the serum levels of TC and triglyceride (TG) in high-fat diet fed rabbits (Liu, 2008). In order to figure out the possible mechanism that HLF attenuated the development of atherosclerosis, liver tissue was collected to evaluate the expression of genes related to lipid metabolism. HLF enhanced the hepatic mRNA level of superoxide dismutase 1 and 2 (SOD1, SOD2) and glutathione peroxidase 3 (Gpx3) (Figure 4), which are a series of genes associated with 14

fatty acid oxidation (de Haan et al., 2006; Kim et al., 2005; Li et al., 1995; Sturtz et al., 2001). Their expression reduced oxidative stress. We also observed that the serum total antioxidant capacity (T-AOC) levels as well as activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-PX) were significantly induced by consumption of HLF (Figure 3), suggesting that HLF might promote the activities of antioxidant enzymes and decrease the modification of low density lipoprotein (LDL) that are accumulated in arteries after high-fat diet feeding, as the accumulation of oxidized low denstity lipoprotein (ox-LDL) is a critical step of atherosclerosis development (Steinberg and Witztum, 2010). Next, we evaluated the signaling pathways that might be involved. AMP-activated protein kinase (AMPK) maintain the cellular energy homeostasis (Kahn et al., 2005) and sterol regulatory element binding protein-1c (SREBP-1c) regulates genes involved in fatty acid and triglyceride synthesis (Amemiya-Kudo et al., 2002; Shimano et al., 1997) and accelerates atherosclerosis in low-density lipoprotein receptor-deficient (LDLR-/-)mice (Karasawa et al., 2011). Inhibition of SREBP-1c could be a novel strategy to treat atherosclerosis (Xiao and Song, 2013). As shown in Figure 4 B, SREBP-1c expression was indeed inhibited by HLF feeding. Moreover, a previously study showed that peroxisome proliferator activated receptor alpha (PPARα) plays a role in SREBP-mediated adiponectin/AMPK pathway(Li et al., 2015) and is involved in regulation of fatty acid oxidation, lipid and lipoprotein metabolism and inflammatory and vascular responses, all of which were documented to benefit the reduction of atherosclerotic risk. In our study, the mRNA of PPARα was upregulated. Carnitine palmitoyl transferase 1 (CPT-1), a downstream gene of PPARα that play an important role in oxygenolysis of fatty acids, was induced as well. These data suggested that HLF activates the PPARα signaling pathway that promotes lipid degradation in the liver. Nevertheless, both mRNA and protein levels of hydroxymethylglutaryl CoA reductase (HMG-CoAR), a rate-limit enzyme that play pivotal role in cholesterol biosynthesis (Lindgren et al., 1985), were the same as the control group (Figure 3 A, B). Besides, VLDLc+LDLc was significantly reduced (Figure 2 C) while LDLR expression was significantly upregulated (Figure 3 C, D). Based on these observation, we propose that HLF did not alter the biosynthesis of cholesterol but promote the activities of LDLR on the liver cell surface in addition to enhancing the activities of antioxidant enzymes, thus lowering the level of cholesterol in apoE-/- mice. Moreover, the increased expression of LDLR leads to much more cholesterol being transported to and metabolized in the liver. Thus, we examined whether HLF could improve the reverse cholesterol transport (RCT), a physiological process by macrophage to scavenge, esterify and efflux the cholesterol to liver. In view of these findings, foam cell formation and in vivo RCT were further evaluated. As shown in Figure 6 in peritoneal macrophages, HLF inhibited the foam cell formation (Figure 6 A, C), increased the cholesterol efflux (Figure 6 B) and induced the expression of ATP binding cassette transporter A1 (ABCA1) (Figure 6 D), a critical player involved in cholesterol efflux. To access the consequences of the increased ABCA1 in vivo, wild type (WT) mice were fed with HLF. We determined that HLF increased the [3H]-tracer in feces at 32, 40 and 48 hours time points in mice injected with radiolabeled macrophages (Figure 7 A), confirming that HLF significantly increased macrophage free cholesterol efflux in vivo. It is believed that flavonoids are the main component in leave of hawthorn plant. Wang and colleague have identified 11 most abundant compounds in hawthorn leave (Wang, T. et al., 2011). Studies for the biological impacts of flavonoids mainly focused on the antioxidant activity and the 15

pharmacology of some abundant compounds were investigated. Vitexin-2″-O-rhamnoside and vitexin-4″-O-glucoside decrease cell apoptosis (Wei et al., 2014). Hyperoside protects cells from oxidative damages (Piao et al., 2008; Wei et al., 2014). These compounds were beneficial for cells by avoiding the oxidative stress and reducing ox-LDL formation. Macrophages transformed into foam cell plays a critical role in the early stage development of atherogenesis (Randolph, 2014) and ox-LDL taken up by macrophages is thought to be the main cause of foam cell formation. Accumulation of the macrophages under the endothelial cells lead to secretion of proinflammatory mediators and thinning of fibrous cap (Chinetti-Gbaguidi et al., 2015; Yan and Hansson, 2007). In addition, kaempferol and quercetin identified in Hawthorn leave were able to induce the expression of LDLR (Ochiai et al., 2016) which confirmed our findings (Figure 5 C, D). Based on these facts, we hypothesize and confirmed that HLF could inhibit the foam cell formation, increased the expression of LDLR on the cell surface other than increased the activities of antioxidant enzymes in the liver, thus decreasing the development of atherosclerosis in a multi-targeting fashion. ABCA1 transporter belongs to the large family ATP-binding cassette genes (Jones and George, 2004). Together with ATP binding cassette transporter G1 (ABCG1), ABCA1 plays an important role in RCT. In this work, we just determined the expression level of ABCA1 in consideration of that it mediated a majority of cholesterol efflux while macrophages efflux less through ABCG1 and scavenger receptor class B member 1 (SR-BI) pathway (Adorni et al., 2007). For the further investigation, it is important to verify whether HLF regulate the expression of ABCG1 and SR-BI. Thus, we concluded from the animal experiment that HLF decreased the lipid deposition in the aorta wall via ABCA1-mediated pathway. Pitavastatin is a member of the blood cholesterol lowering medication called statins which reduces the cholesterol by inhibition of HMG-CoAR activity (Kajinami et al., 2003). We used it as a positive control based on the hypothesis that the mechanism of which HLF reduce the cholesterol might be the same as statin does. However, our data indicated that HLF induced the antioxidant activities of enzymes but had no significant impact on the expression of HMG-CoAR (Figure 5 A, C). Rather, it induced LDLR (Figure 5 B, D) and ABCA1 (Figure 6 D), supporting our hypothesis that HLF could promote the RCT in mice. In conclusion, our study indicates that HLF is not only able to increase the activities of antioxidant enzymes but also decrease level of cholesterol in the serum and induce RCT, thus protect against the development of atherosclerosis in mice. These results imply a potential of HLF in the development of new antiatherogenic drugs and their application in clinics. Conflict of Interest The authors declare no potential conflict of interests regarding the publication of this paper. Author contributions Pengzhi Dong designed the experiment. Yan Zhu contributed the reagents, materials and edited the manuscript. Pengzhi Dong, Wenwen Zhang and Xue Wang carried out the laboratory experiment, co-wrote and revised manuscript. Lanlan Pan and Xiting Zhang analyzed the data, interpreted the results, and prepared the figures. Meixiu Jiang, Yuanli Chen, Yajun Duan, Honghua Wu, Yantong Xu and Peng Zhang gave constructive suggestions.

16

Acknowledgments Supported by grants from National Natural Science Foundation of China(No.81403132), China Ministry of Science and Technology (No.2014CB542902) , Tianjin Municipal Education Commission (No.20140203) , the National Key Technology R&D Program in the 12th Five Year Plan of China (Grant Nos. 2013ZX09201020, 2014ZX09201-023) and Program for Changjiang Scholars and Innovative Research Team in University (PCSIRT”, IRT_14R41). References Adorni, M.P., Zimetti, F., Billheimer, J.T., Wang, N., Rader, D.J., Phillips, M.C., Rothblat, G.H., 2007. The roles of different pathways in the release of cholesterol from macrophages. J. Lipid Res. 48(11), 2453-2462. Agelet, A., Vallès, J., 2003. Studies on pharmaceutical ethnobotany in the region of Pallars (Pyrenees, Catalonia, Iberian Peninsula). Part II. New or very rare uses of previously known medicinal plants. J. Ethnopharmacol. 84(2–3), 211-227. Aiello, R.J., Brees, D., Bourassa, P. A., Royer, L., Lindsey, S., Coskran, T., Haghpassand, M., Francone, O.L., 2002. Increased atherosclerosis in hyperlipidemic mice with inactivation of ABCA1 in macrophages. Atertio. Thromb. Vasc. Biol. 22(4), 630-637. Alaupovic, D.M.L.a.P., 1974. Physicochemical properties of low-density lipoproteins of normal human plasma. Biochem. J. 137, 155-167. Amemiya-Kudo, M., Shimano, H., Hasty, A.H., Yahagi, N., Yoshikawa, T., Matsuzaka, T., Okazaki, H., Tamura, Y., Iizuka, Y., Ohashi, K., Osuga, J., Harada, K., Gotoda, T., Sato, R., Kimura, S., Ishibashi, S., Yamada, N., 2002. Transcriptional activities of nuclear SREBP-1a, -1c, and -2 to different target promoters of lipogenic and cholesterogenic genes. J. Lipid Res. 43(8), 1220-1235. British Herbal Pharmacopoeia, 1983. British Herbal Medical. Association, Scientific Committee, Bourneumouth (U.K.) Bodzioch, M., Orso, E., Klucken, J., Langmann, T., Bottcher, A., Diederich, W., Drobnik, W., Barlage, S., Buchler, C., Porsch-Ozcurumez, M., Kaminski, W.E., Hahmann, H.W., Oette, K., Rothe, G., Aslanidis, C., Lackner, K.J., Schmitz, G., 1999. The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease. Nat. Genet. 22(4), 347-351. Bubik, M.F., Willer, E.A., Bihari, P., Jürgenliemk, G., Ammer, H., Krombach, F., Zahler, S., Vollmar, 17

A.M., Fürst, R., A novel approach to prevent endothelial hyperpermeability: The Crataegus R 1442 targets the cAMP/Rap1 pathway. J. Mol. Cell. Cardiol. 52(1), 196-205. extract WS○

Chang, W.T., Dao, J., Shao, Z.H., 2005. Hawthorn: potential roles in cardiovascular disease. Am. J. Chin. Med. 33(01), 1-10. Chen, J., Xue, B., Li, K., Shi, J., Krempin, D., Zhu, M., Garland, C., 2002. The effects of an instant haw beverage on lipid levels, antioxidant enzyme and immune function in hyperlipidemia patients. Zhonghua Yu Fang Yi Xue Za Zhi 36(3), 172-175. Chen, Y., Duan, Y., Yang, X., Sun, L., Liu, M., Wang, Q., Ma, X., Zhang, W., Li, X., Hu, W., Miao, R.Q., Xiang, R., Hajjar, D.P., Han, J., 2015. Inhibition of ERK1/2 and activation of LXR synergistically reduce atherosclerotic lesions in apoE-deficient mice. Atertio. Thromb. Vasc. Biol. 35(4), 948-959. Chen, Z., Wen, X., Yan, M., He, B., 2009. Effect of total flavones of hawthorn leafon (TFHL) on expression of UCP2 in liver of NASH rats. Zhongguo Zhong Yao Za Zhi 34(24), 3272-3276. Chinetti-Gbaguidi, G., Colin, S., Staels, B., 2015. Macrophage subsets in atherosclerosis. Nat. Rev. Cardiol. 12(1), 10-17. Cuchel, M., Rader, D.J., 2006. Macrophage reverse cholesterol transport: key to the regression of atherosclerosis? Circulation 113(21), 2548-2555. de Haan, J.B., Witting, P.K., Stefanovic, N., Pete, J., Daskalakis, M., Kola, I., Stocker, R., Smolich, J.J., 2006. Lack of the antioxidant glutathione peroxidase-1 does not increase atherosclerosis in C57BL/J6 mice fed a high-fat diet. J. Lipid Res. 47(6), 1157-1167. Fruchart, J.C., 2009. Peroxisome proliferator-activated receptor-alpha (PPARα): At the crossroads of obesity, diabetes and cardiovascular disease. Atherosclerosis 205(1), 1-8. Fu, J.H., Zheng, Y.Q., Li, P., Li, X.Z., Shang, X.H., Liu, J.X., 2013. Hawthorn leaves flavonoids decreases inflammation related to acute myocardial ischemia/reperfusion in anesthetized dogs. Chin. J. Integr. Med. 19(8), 582-588. Galkina, E., Ley, K., 2009. Immune and inflammatory mechanisms of atherosclerosis. Annu. Rev. Immunol. 27, 165-197. Johnson, J.L., Newby, A.C., 2009. Macrophage heterogeneity in atherosclerotic plaques. Curr. Opin. Lipidol. 20(5), 370-378. Jones, P.M., George, A.M., 2004. The ABC transporter structure and mechanism: perspectives on recent research. Cell Mol. Life Sci. 61(6), 682-699. Kahn, B.B., Alquier, T., Carling, D., Hardie, D.G., 2005. AMP-activated protein kinase: ancient energy gauge provides clues to modern understanding of metabolism. Cell Metab. 1(1), 15-25. Kajinami, K., Takekoshi, N., Saito, Y., 2003. Pitavastatin: efficacy and safety profiles of a novel synthetic HMG-CoA reductase inhibitor. Cardiovasc. Drug Rev. 21(3), 199-215. Karasawa, T., Takahashi, A., Saito, R., Sekiya, M., Igarashi, M., Iwasaki, H., Miyahara, S., Koyasu, S., Nakagawa, Y., Ishii, K., Matsuzaka, T., Kobayashi, K., Yahagi, N., Takekoshi, K., Sone, H., Yatoh, S., Suzuki, H., Yamada, N., Shimano, H., 2011. Sterol regulatory element–binding protein-1 determines plasma remnant lipoproteins and accelerates atherosclerosis in low-density lipoprotein receptor–deficient mice. Atertio. Thromb. Vasc. Biol. 31(8), 1788-1795. Kim, Y.-J., Nakatomi, R., Akagi, T., Hashikawa, T., Takahashi, R., 2005. Unsaturated fatty acids induce cytotoxic aggregate formation of amyotrophic lateral sclerosis-linked superoxide dismutase 1 mutants. J. Biol. Chem. 280(22), 21515-21521. 18

Lee, D.M., Alaupovic, P., 1970. Composition and structure of plasma lipoproteins. Isolation, composition, and immunochemical characterization of low density lipoprotein subfractions of human plasma. Biochem. J 9(11), 2244-2252. Lee, D.M., Alaupovic, P., 1974. Physicochemical properties of low-density lipoproteins of normal human plasma. Evidence for the occurrence of lipoprotein B in associated and free forms. Biochem. J. 137(2), 155-167. Li, A.C., Glass, C.K., 2002. The macrophage foam cell as a target for therapeutic intervention. Nat. Med. 8(11), 1235-1242. Li, P., Wang, J., Lu, S., Fu, J., Liu, J., 2009. Protective effect of hawthorn leaf procyanidins on cardiomyocytes of neonatal rats subjected to simulated ischemia-reperfusion injury. Zhongguo Zhong Yao Za Zhi 34(1), 96-99. Li, Y., Huang, T.T., Carlson, E.J., Melov, S., Ursell, P.C., Olson, J.L., Noble, L.J., Yoshimura, M.P., Berger, C., Chan, P.H., Wallace, D.C., Epstein, C.J., 1995. Dilated cardiomyopathy and neonatal lethality in mutant mice lacking manganese superoxide dismutase. Nat. Genet. 11(4), 376-381. Li, Z., Xu, J., Zheng, P., Xing, L., Shen, H., Yang, L., Zhang, L., Ji, G., 2015. Hawthorn leaf flavonoids alleviate nonalcoholic fatty liver disease by enhancing the adiponectin/AMPK pathway. Int. J. Clin. Exp. Med. 8(10), 17295-17307. Lindgren, V., Luskey, K.L., Russell, D.W., Francke, U., 1985. Human genes involved in cholesterol metabolism: chromosomal mapping of the loci for the low density lipoprotein receptor and 3-hydroxy-3-methylglutaryl-coenzyme A reductase with cDNA probes. Proc. Natl. Acad. Sci. U. S. A. 82(24), 8567-8571. Liu, Q.L.Y., Z.L., 2008. Comparison of total flavonoids of different purities from Folium crataegi in effect of antihyperlipidemia. Strait Pharm. J. 20, 32-52. Naik, S.U., Wang, X., Da Silva, J.S., Jaye, M., Macphee, C.H., Reilly, M.P., Billheimer, J.T., Rothblat, G.H., Rader, D.J., 2006. Pharmacological activation of liver X receptors promotes reverse cholesterol transport in vivo. Circulation 113(1), 90-97. Ochiai, A., Miyata, S., Iwase, M., Shimizu, M., Inoue, J., Sato, R., 2016. Kaempferol stimulates gene expression of low-density lipoprotein receptor through activation of Sp1 in cultured hepatocytes. Sci. Rep. 6, 24940. Oram, J.F., 2003. HDL apolipoproteins and ABCA1: partners in the removal of excess cellular cholesterol. Atertio. Thromb. Vasc. Biol. 23(5), 720-727. Phillips, M.C., 2014. Molecular mechanisms of cellular cholesterol efflux. J. Biol. Chem. 289(35), 24020-24029. Piao, M.J., Kang, K.A., Zhang, R., Ko, D.O., Wang, Z.H., You, H.J., Kim, H.S., Kim, J.S., Kang, S.S., Hyun, J.W., 2008. Hyperoside prevents oxidative damage induced by hydrogen peroxide in lung fibroblast cells via an antioxidant effect. Biochim. Biophys. Acta 1780(12), 1448-1457. Pieroni, A., Quave, C.L., 2005. Traditional pharmacopoeias and medicines among Albanians and Italians in southern Italy: A comparison. J. Ethnopharmacol. 101(1–3), 258-270. Pittler, M.H., Guo, R., Ernst, E., 2008. Hawthorn extract for treating chronic heart failure. Cochrane Database Syst. Rev. (1), CD005312. Pittler, M.H., Schmidt, K., Ernst, E., 2003. Hawthorn extract for treating chronic heart failure: meta-analysis of randomized trials. Am. J. Med. 114(8), 665-674. Randolph, G.J., 2014. Mechanisms that regulate macrophage burden in atherosclerosis. Circul. Res. 19

114(11), 1757-1771. Reagan-Shaw, S., Nihal, M., Ahmad, N., 2008. Dose translation from animal to human studies revisited. FASEB J. 22(3), 659-661. Rigelsky, J.M., Sweet, B.V., 2002. Hawthorn: pharmacology and therapeutic uses. Am. J. Health Syst. Pharm. 59(5), 417-422. Rothfuss, M.A., Pascht, U., Kissling, G., 2001. Effect of long-term application of Crataegus oxyacantha on ischemia and reperfusion induced arrhythmias in rats. Arzneimittelforschung 51(01), 24-28. Rust, S., Rosier, M., Funke, H., Real, J., Amoura, Z., Piette, J.C., Deleuze, J.F., Brewer, H.B., Duverger, N., Denefle, P., Assmann, G., 1999. Tangier disease is caused by mutations in the gene encoding ATP-binding cassette transporter 1. Nat. Genet. 22(4), 352-355. Shi, S., Li, J., Sun, J., Yu, J., Zhou, S., 2013. Phylogeny and classification of Prunus sensu lato (Rosaceae). J. Integr. Plant Biol. 55(11), 1069-1079. Shimano, H., Horton, J.D., Shimomura, I., Hammer, R.E., Brown, M.S., Goldstein, J.L., 1997. Isoform 1c of sterol regulatory element binding protein is less active than isoform 1a in livers of transgenic mice and in cultured cells. J. Clin. Invest. 99(5), 846-854. Steinberg, D., Witztum, J.L., 2010. Oxidized low-density lipoprotein and atherosclerosis. Atertio. Thromb. Vasc. Biol. 30(12), 2311-2316. Sturtz, L.A., Diekert, K., Jensen, L.T., Lill, R., Culotta, V.C., 2001. A fraction of yeast Cu,Zn-superoxide dismutase and its metallochaperone, CCS, localize to the intermembrane space of mitochondria: A physiological role for SOD1 in guarding against mitochondrial oxidative damage. J. Biol. Chem. 276(41), 38084-38089. Tao, W., Deqin, Z., Yuhong, L., Hong, L., Zhanbiao, L., Chunfeng, Z., Limin, H., Xiumei, G., 2010. Regulation effects on abnormal glucose and lipid metabolism of TZQ-F, a new kind of Traditional Chinese Medicine. J. Ethnopharmacol. 128(3), 575-582. Tassell, M.C., Kingston, R., Gilroy, D., Lehane, M., Furey, A., 2010. Hawthorn (Crataegus spp.) in the treatment of cardiovascular disease. Pharmacogn Rev. 4(7), 32-41. Vitalini, S., Tomè, F., Fico, G., 2009. Traditional uses of medicinal plants in Valvestino (Italy). J. Ethnopharmacol. 121(1), 106-116. Wang, J., Xiong, X., Feng, B., 2013. Effect of Crataegus usage in cardiovascular disease prevention: an evidence-based approach. Evid. Based Complement. Alternat. Med. eCAM 2013, 149363.

20