- Email: [email protected]
HCV core antigen as an alternate test to HCV RNA for assessment of virologic responses to all-oral, interferon-free treatment in HCV genotype 1 infected patients
Journal of Virological Methods 245 (2017) 14–18
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
HCV core antigen as an alternate test to HCV RNA for assessment of virologic responses to all-oral, interferon-free treatment in HCV genotype 1 infected patients Jürgen Kurt Rockstroh a , Jordan J. Feld b , Stéphane Chevaliez c , Kevin Cheng d , Heiner Wedemeyer e , Christoph Sarrazin f , Benjamin Maasoumy f , Christine Herman d , John Hackett Jr. d , Daniel E. Cohen g , George J. Dawson d , Gavin Cloherty d,∗ , Jean-Michel Pawlotsky c a
University Hospital Bonn, Bonn, Germany Toronto Centre for Liver Disease McLaughlin-Rotman Centre for Global Health University of Toronto, Toronto, ON, Canada National Reference Center for Viral Hepatitis B C and D Department of Virology Hôpital Henri Mondor Université Paris-Est and INSERM U955, Créteil, France d Abbott Laboratories, Abbott Park, IL, USA e Klinik für Gastroenterologie Hepatologie und Endokrinologie Medizinische Hochschule Hannover, Hannover, Germany f Medizinische Klinik 1 Universitätsklinikum Frankfurt, Frankfurt am Main, Germany g Abbvie, North Chicago, IL, USA b c
a b s t r a c t Article history: Received 3 February 2017 Received in revised form 3 March 2017 Accepted 4 March 2017
In light of the advances in HCV therapy, simplification of diagnosis confirmation, pre- treatment diagnostic workup and treatment monitoring is required to ensure broad access to interferon-free therapies. HCV core antigen (HCV cAg) testing is rapid, giving results in approximately 60 min, and less expensive than HCV RNA methods. While extensive data on the analytical performance of HCV cAg relative to RNA or comparisons in longitudinal studies of patients on interferon based (response guided) therapy there is very limited data on the relative performance of HCV cAg in diagnosis and monitoring patients receiving all-oral interferon free regimens. Furthermore, there is no data in the literature that describes the specificity of HCV cAg in patients with resolved HCV infection i.e. anti-HCV positive/HCV RNA negative. In this study a total of 1201 plasma samples from the 411 HCV genotype 1 subjects with a HCV RNA viral load >50,000 IU/ml who enrolled in a clinical trial with ombitasvir, ritonavir-boosted paritaprevir and dasabuvir, with or without ribavirin were retrospectively tested in a blinded fashion with HCV cAg test and results were compared to HCV RNA levels. The specificity of the HCV cAg test was also evaluated in anti-HCV positive but HCV RNA negative samples. Overall concordance between HCV cAg and HCV RNA was 98.6% while concordance in pre-treatment samples was 99.5% (409/411; n = 2 HCV RNA pos. with viral loads > 3 Mill IU/ml but HCV cAg neg.) and 99.24% in post treatment week 12 samples (391/394; n = 2 HCV RNA pos. < 25 IU/ml and n = 1 HCV RNA pos. 2180 IU/ml). Specificity in anti-HCV positive HCV RNA negative samples tested was 100%. © 2017 Published by Elsevier B.V.
HCV cAg testing can be used to accurately identify active viremia in HCV genotype 1-infected patients with a viral load >50,000 IU/ml and discriminate those who achieve sustained virological response from those who fail therapy. Worldwide it is estimated that 185 million people are chronically infected with the HCV, with 3–4 million new infections per
∗ Corresponding author at: 100 Abbott Park Road, Abbott Park, IL 60064, USA. E-mail address: [email protected] (G. Cloherty). http://dx.doi.org/10.1016/j.jviromet.2017.03.002 0166-0934/© 2017 Published by Elsevier B.V.
year and over 350,000 deaths due to HCV-related liver disease each year (Gower et al., 2014). Among those who acquire a primary infection, 15–50% will spontaneously clear the virus within the first 2–6 months and remain positive for anti-HCV antibodies, although they are not actively infected and do not require treatment (Freiman et al., 2016). Those individuals who do not spontaneously clear the virus develop chronic infection characterized by the continuous detection of HCV RNA in the presence of antibodies to HCV (Maasoumy and Wedemeyer, 2012).
J.K. Rockstroh et al. / Journal of Virological Methods 245 (2017) 14–18
The long term impact of HCV infection is highly variable, ranging from minimal effects to chronic hepatitis, advanced fibrosis, cirrhosis, decompensated cirrhosis and hepatocellular carcinoma (Maasoumy and Wedemeyer, 2012). Chronic HCV infection may also induce severe extra-hepatic complications. The goal of therapy is to eradicate HCV in order to prevent hepatic and extra-hepatic complications and to improve overall survival (The Global Burden of Hepatitis, 2004). Advances in the treatment of HCV infection have demonstrated over 90% cure rates, as defined by the sustained virologic response (SVR), i.e. undetectable HCV RNA 12 weeks after the end of treatment, after 8–24 weeks of treatment with interferon (IFN)-free combinations of direct-acting antiviral (DAA) drugs. With these therapies, high SVR rates can be obtained regardless of viral genotype, degree of liver fibrosis or previous treatment history in the majority of patient groups. In order for infected individuals to benefit from these advances in treatment they need to pass through a cascade of care which includes screening, confirmation of diagnosis and linkage to care (Ward and Mermin, 2015; Linas et al., 2014). In light of the advances in HCV therapy, simplification of diagnosis confirmation, pre- treatment diagnostic workup and treatment monitoring is required to ensure broad access to these new therapies. Introduction of these highly potent therapies has obviated the need for response-guided therapy and reduced the role of treatment monitoring with highly sensitive quantitative HCV RNA tests (Chevaliez et al., 2016). However, HCV RNA testing remains required to confirm HCV infection and assess virological responses, in particular the SVR. During viral assembly, nucleocapsid is released into the plasma and can be detected earlier than antibodies and throughout the course of infection (Freiman et al., 2016). The amount of HCV core antigen in the blood correlates with the HCV RNA level. Thus, HCV core antigen can identify individuals actively infected with HCV and is a surrogate marker of HCV replication (Morota et al., 2009; Mederacke et al., 2009; Ross et al., 2010; Medici et al., 2011; Heidrich, 2014; Ottiger et al., 2013; Bouvier-Alias et al., 2002; Chevaliez et al., 2014). The Abbott ARCHITECT HCV core antigen assay (HCV cAg) detection is based on a two-step immunoassay (Abbott Diagnostics, Abbott Park, IL, USA), using Chemiluminescent Microparticle Immunoassay (CMIA) technology for the quantitative determination of HCV core antigen. This test is rapid, giving results in approximately 60 min, and less expensive than HCV RNA methods, and has a proposed limit of detection between 1000 IU/ml and 3000 IU/ml according to the HCV genotype. The goal of this study was to evaluate the ability of HCV cAg testing with the ARCHITECT assay to identify active chronic HCV infection and distinguish it from spontaneously resolved HCV infection, to monitor patients receiving all-oral, IFN-free, DAA-based treatment, and to identify patients who fail therapy in a randomized clinical trial with a new DAA-based regimen. The AVIATOR trial (Garbuglia et al., 2014) was an openlabel study with 14 treatment subgroups designed to evaluate the safety and efficacy of various combinations of ritonavirboosted paritaprevir (NS3-4A protease inhibitor) and ombitasvir (NS5A inhibitor) with dasabuvir (non-nucleoside inhibitor of the HCV RNA-dependent RNA polymerase) co-administered with or without ribavirin (RBV) for 8, 12 or 24 weeks in HCV genotype 1infected non-cirrhotic, treatment-naïve and null-responder adults [NCT01464827]. In this analysis, a total of 1201 plasma samples from 411/571 subjects who enrolled in the Aviator trial for which HCV RNA levels were known and sample volume available were tested retrospectively in a blinded fashion with the HCV cAg assay. The time points included baseline (N = 411), week 4 (N = 396), and post-treatment week 12 (N = 394). Results from HCV cAg were analyzed to determine levels of concordance with HCV RNA lev® ® els measured with the Roche High-Pure-System/COBAS TaqMan
15
Fig. 1. Least squares regression plot for all samples with valid results from both Roche HPS/TaqMan RNA vs ARCITECT HCV core antigen assays.
v2.0 assay (HPS; Roche Diagnostics, Indianapolis, IN, USA) which was the test of record method in this trial. Where sample volume was available, discordant results between the HPS and HCV cAg were investigated by retesting with HCV cAg for core antigen and with an alternate HCV RNA method, Abbott RealTime HCV (ART; Abbott Molecular Inc, Des Plaines, IL, USA). Discordance analysis between HPS and HCV cAg was conducted using <25 IU/ml which was the viral load used as the primary clinical end-point in the AVIATOR trial. Sequence analysis of the portion of the HCV genome coding for the virus core antigen was performed using 5 l of RNA extracted on the Abbott m2000sp and One-Step RT-PCR reagents (QIAGEN, Hilden, GmbH) according to the manufacturer suggested cycling conditions. PCR fragment of 597 bp was amplified using forward primer HCV-78Fb (5 GCCTTGTGGTACTGCCTGATA3 ) and mixture of two reverse primers HCV-852Rb (5 GG AAG ATA GAG AAA GAG CAA CC3 ) and HCV-852Rc (5 AGG AAG ATA GAA AAG GAG CAA CC3 ), and was sequenced directly using ABI Prism Big Dye Terminator v3.1 Cycle Sequencing Reactions Kit (Applied Biosystems, Austin, TX, USA) and the ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, Austin, TX). Sequence data were assembled and edited using Sequencher software Version 5.4 (Gene Code Corporation, Ann Arbor, MI, USA). Amino acid sequence was analyzed for mutations in the core Ag region using Lasergene v11.2.1 software (DNASTAR, Madison, WI, USA). HPS, HCV cAg and ART measurements were performed according to the manufacturers’ instruction. In addition, to assess the specificity of the HCV cAg test, 289 blood donor samples from the American Red Cross and 37 patient samples from University of Bonn which were anti-HCV positive/HCV RNA negative were tested with HCV cAg. All patients from the Bonn site had repeatedly tested positive for anti-HCV antibodies but were HCV RNA negative for at least 6 months, indicative of spontaneous clearance of previous HCV infection. None of the patients had ever been exposed to HCV therapy. All data were analyzed with PC SAS 9.3 (SAS Institute Cary, North Carolina, USA). A least squares linear regression was performed to examine the association between the HPS assay result (IU/ml) and the HCV cAg (fmol/l). The data were plotted and the Pearson correlation coefficient, the coefficient of determination, the point estimates for the slope and intercept of the regression line were calculated. All of the patients provided written informed consent. The study was performed in accordance with good clinical practice guidelines and the principles of the Declaration of Helsinki, and the study protocol was approved by the relevant institutional review boards and regulatory agencies. This study is retrospective and was performed using de-identified residual samples collected as part of the AVIATOR trial [NCT01464827]. There was a positive correlation between HCV cAg and HPS (r2 = 0.7520, Fig. 1). Using 25 IU/ml as a cutoff for HPS, ART and HCV cAg tests had overall concordant results in 1184 of 1201 samples
16
J.K. Rockstroh et al. / Journal of Virological Methods 245 (2017) 14–18
Table 1 Concordance table Roche HPS vs ARCHITECT HCV cAg using 25 IU/ml as the cut-off. Det = detected and ND = not detected. Visit
Baseline
Obs.
HPS IU/ml
Abbott RealTime HCV
HCV Ag
1 2
Result 3,850,000 6,090,000
Result 5.94 No sample
Initial test fmol/l 1.2 −1.2
tested (98.6%), including 409 in pre-treatment samples (99.5%), 382 in week 4 samples (96.46%) and 393 in post treatment week 12 samples (99.75%) (Table 1). Of the 17 discordant samples, 4 were HCV cAg negative/HPS positive. Two baseline samples, with viral loads of 3,580,000 and 6,090,000 IU/ml with HPS, gave negative results when tested with HCV cAg. Sequence analysis of the portion of the HCV genome coding for the virus core antigen was amplified from one sample (6,090,000 IU/ml) and compared to the sequence of the monoclonal antibodies used in the HCV cAg test but revealed no molecular basis for the discordant result. Sufficient sample volume for sequencing was not available for the second sample (3,580,000 IU/ml). The majority of discordant samples (n = 66) were from the week 4 time points with 53 HCV cAg negative/HPS positive and 13 HCV cAg positive/HPS negative. Only one of the HCV cAg negative/HPS positive samples gave a quantifiable viral load (75 IU/ml). All of the HCV cAg positive/HPS negative samples were also positive with ART (range < 1.08 log IU/ml—1.97 log IU/ml—see Table 2). All subjects with week four discordant results (n = 66) were undetectable by both methods at post treatment week 12. There were, however, three discordant results, all HCV cAg negative/HPS positive at the post-treatment week 12 time points. Two of the three had a viral load of <25 IU/ml, and were therefore considered SVR in this study, and the third sample had a viral load of 2180 IU/ml and was therefore a relapse. A post treatment week 24 sample or clinical follow up was not available for this discordance relapse patient. One of the <25 IU/ml samples was HCV RNA negative by ART but the other two results were confirmed positive by this method (Table 2). The HCV cAg test accurately identified active infections in 99.51% of subjects enrolled in this study and discriminated SVR from treatment failure in 99.75%. If a clinical cut-off of 10 fmol/l was adopted for HCV cAg at the week 4 time points, the number of discordant results would be further reduced, as 12 of 13 HCV cAg positives/RNA negative would then be considered negative. All 326 anti-HCV positive/confirmed HCV RNA negative samples tested with HCV cAg yielded negative results, demonstrating 100% concordance with RNA and 100% specificity of the test in this population. In this study the Abbott ARCHITECT HCV cAg accurately identified subjects with active viremia at screening in 99.51% (409/411) of cases, confirming that HCV core antigen detection can accurately diagnose active infection in samples with HCV RNA >50,000 IU/ml. In this study the vast majority of the discordant results between HCV cAg and HPS were from week 4 samples with very low levels of viremia, and would have had no clinical impact. The HCV cAg test discriminated SVR from non-SVR at 12 weeks post therapy in 99.75% (393/394) of subjects tested. In the one individual from whom relapse was missed by HCV cAg follow up was not available to determine whether repeat testing at a later time point would have identified this individual. Although this particular individual was identified by HCV RNA testing, other studies have shown that some patients relapse beyond SVR 12 even with the most sensitive HCV RNA PCR test (Yoshida et al., 2015). Although additional testing beyond SVR 12 might be necessary to ensure 100% accurate determination of SVR, whether it would be useful to add follow-up SVR 24 testing on all patients is debatable. These results suggest that HCV cAg testing can be used for accurate confirmation of SVR 12 in almost all patients.
Result Retest 1 fmol/l . .
Retest 2 fmol/l . .
Negative Negative
This study shows that HCV cAg testing can be safely used instead of HCV RNA monitoring to manage HCV-infected patients receiving IFN-free, DAA-based therapy (Chevaliez et al., 2016; Kowdley et al., 2014; Adhemo et al., 2016). While the results of this study focus on HCV genotype 1 infection they agree with the findings of other studies which have investigated the ability of the ARCHITECT HCV Ag assay to detect HCV cAg in HCV RNA positive samples. Data on 4534 samples from 19 studies with a 3 fmol/l cAg cut-off with a retest range of 3–10 fmol/l, demonstrated an overall sensitivity of the cAg assay relative to RNA of 92.9%. (Chevaliez et al., 2016; Morota et al., 2009; Mederacke et al., 2009; Ross et al., 2010; Medici et al., 2011; Heidrich, 2014; Ottiger et al., 2013; Bouvier-Alias et al., 2002; Chevaliez et al., 2014; Garbuglia et al., 2014; Kowdley et al., 2014; Adhemo et al., 2016; Medici et al., 2016; Kesli et al., 2011; Mederacke et al., 2012; Ergünay et al., 2011; Buket et al., 2014; Vermehren et al., 2012; Hadziyannis et al., 2013; Kadkhoda and Smart, 2014; Park et al., 2010; Tedder et al., 2013; Freiman et al., 2016). Of note, in samples with viral load >10,000 IU/ml the sensitivity rose to 99.5%, which correlates well with our findings from AVIATOR trial which had an inclusion criterion requiring subjects to have a viral load of at least 50,000 IU/ml. Although two samples with viral loads of 3,580,000 and 6,090,000 IU/ml when tested with HPS were negative with HCV cAg, this appears to be a very rare event, and in the sample which had sufficient volume to test, the absence of any viral sequence mutation which might indicate a molecular mechanism for the negative HCV cAg result might imply that this could be the result of a clerical or processing error. Some of the studies investigating the utility of HCV cAg also pointed out limitations of the assay. When compared to HCV RNA assays, it was apparent that some samples with low viral load were not detectable by the HCV cAg assay, as expected given its analytical sensitivity. Thus, in order to achieve 100% detection of active viremia in an anti-HCV positive sample with negative HCV cAg results, confirmation by an HCV RNA assay could be considered. As the number of HCV cAg false-negative results would be expected to be very low in the general population the number of RNA tests required to confirm HCV cAg negative results could be reduced while maintaining the 100% detection goal by pooling samples prior to HCV RNA testing (Freiman et al., 2016). For this study all 326 HCV antibody positive RNA negative samples were HCV cAg negative and the specificity of the HCV cAg test was calculated to be 100%. The findings of this study and others (Chevaliez et al., 2014; Kowdley et al., 2014; Freiman et al., 2016) have shown that low levels of quantifiable HCV RNA on therapy and even at the end of treatment should not be considered indicative of non-adherence and do not preclude achieving an SVR. These findings have not been replicated in special patients such as DAA experienced patients. In this context, an accurate but less sensitive method, such as measurement of HCV core antigen levels, may be a valuable alternative to highly sensitive HCV RNA testing as an adherence measure (Freiman et al., 2016). Based on the results of this study a clinical cutoff of 1000–5000 IU/ml HCV RNA or 5 –10 fmol/l HCV cAg following 4 weeks of therapy might be a more appropriate indicator of treatment adherence.
J.K. Rockstroh et al. / Journal of Virological Methods 245 (2017) 14–18
17
Table 2 Discordant table Roche HPS vs ARCHITECT HCV cAg with Abbott RealTime HCV assay as referee method. Det = detected; ND = not detected; PTW 12 = post-treatment week 12. Visit
Baseline Week 4
PTW 12
Obs.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71
HPS IU/ml
Abbott RealTime HCV
HCV Ag
Result
Result
3,850,000 6,090,000 <25 IU/ml HCV RNA detected <25 IU/Ml HCV RNA Detected HCV RNA not detected <25 IU/ml HCV RNA Detected <25 IU/ml HCV RNA Detected <25 IU/ml HCV RNA Detected <25 IU/ml HCV RNA detected <25 IU/ML HCV RNA Detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ML HCV RNA DETECTED <25 IU/ml HCV RNA Detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected HCV RNA not detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected 75 <25 IU/ml HCV RNA detected HCV RNA not detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected HCV RNA not detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected HCV RNA not detected HCV RNA not detected <25 IU/ml HCV RNA detected HCV RNA not detected HCV RNA not detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected HCV RNA not detected <25 IU/ML HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected HCV RNA not detected <25 IU/ml HCV RNA detected <25 IU/ML HCV RNA detected <25 IU/ML HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected HCV RNA not detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected HCV RNA not detected HCV RNA not detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected 2180 <25 IU/ML HCV RNA detected
5.94 No sample Detected < 1.48 Detected < 1.48 1.28 <1.08 Detected < 1.48 <1.08 <1.08 Detected < 1.08 1.43 <1.08 1.15
Initial test fmol/l 1.2 −1.2 −1.1 2 3.3 0.3 0.7 −0.1 0.4 0.5 2.4 0.7 0.1
Retest 1 fmol/l . . . . 3 . . . . . . . .
Retest 2 fmol/l . . . . 1.8 . . . . . . . .
Negative Negative Negative Negative Positive Negative Negative Negative Negative Negative Negative Negative Negative
Qns 1.59 1.52 Detected < 1.08 1.27 1.76 1.46 1.82 Detected < 1.48 Detected < 1.48 1.91 1.19 1.7 1.34 1.93 <1.08 Detected < 1.08 Detected < 1.08 1.18 1.97 1.73 <1.08 1.71 Detected < 1.48 Detected < 1.08 1.4 Detected < 1.48 1.24 1.55 Detected < 1.48 Detected < 1.48 Detected < 1.48 1.88 1.91 1.44 1.88 Detected < 1.48 Detected < 1.48 Detected < 1.48 Detected < 1.08 2.21 1.68 Detected < 1.48 Detected < 1.48 Target not detected Detected < 1.48 Detected < 1.48 1.86 2.13 1.57 Detected < 1.48 Target not detected Detected < 1.48 Detected < 1.48 Detected < 1.48 Target not detected 3.01 Detected < 1.48
1.5 2.5 1.2 3.4 0 0.4 1.4 2.2 4.1 13 2.2 0.7 2.4 3.1 2.1 4.7 0.4 0.4 1.4 4.5 5.4 2.1 4.3 3.8 0.8 1.8 0.1 1 1.3 8.4 1.8 1.9 1.9 4.6 0.2 2.4 0.8 0.6 0.9 1.3 1.9 0.3 4.9 0.6 1.5 4.3 1.9 2.8 2.1 2.3 1 −0.1 4.3 3.2 0.9 0.3 3.2 0.3
. . . 4.4 . . . . 2.8 . . . . 1.2 . 3.8 . . . 4 5.6 . 3.4 3.8 . . . . . 9.7 0.9 . . 4.1 . . . . . . . . 1.1 . . 5.6 . . . . . . 4.2 3 . . 2.5 0
. . . 3.4 . . . . 2.8 . . . . 1.1 . 5.5 . . . 1.9 3.9 . 2.7 . . . . . . 10.7 . . . 3.7 . . . . . . . . 0.9 . . . . . . . . . 5.1 2.6 . . 2.3 .
Negative Negative Negative Positive Negative Negative Negative Negative Negative Positive Negative Negative Negative Negative Negative Positive Negative Negative Negative Positive Positive Negative Positive Positive Negative Negative Negative Negative Negative Positive Negative Negative Negative Positive Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Positive Negative Negative Negative Negative Negative Negative Positive Positive Negative Negative Negative Negative
Result
18
J.K. Rockstroh et al. / Journal of Virological Methods 245 (2017) 14–18
The results from this and other studies indicate that HCV cAg testing can be used to accurately identify patients with chronic HCV infection and discriminate those who achieve SVR from those who fail therapy, and should be considered for inclusion in routine laboratory testing. Importantly, the specificity of HCV cAg in a very challenging patient population (anti-HCV positive/HCV RNA negative) described in results provide confidence that the use of this test will not result in falsely identifying patients as chronic/viremic with all the associated clinical, psychological and financial implication. The use of HCV Ag testing in diagnosis and treatment monitoring should improve access to care in areas where HCV RNA testing is not or hardly available. Author contributions G.C., K.C., S.C., C.H., B.M., V.H., G.D., J.R., H.W., J.M.P., C.S., J.F. contributed equally to the study design. G.C., K.C. and V.H. performed the laboratory testing described in this manuscript. C.H. conducted all statistical analysis and generated the figures and tables. G.C. took the lead in writing the manuscript. G.C., K.C., C.H., B.M., V.H., G.D., J.R., H.W., J.M.P., C.S., J.F. reviewed and provided feedback/edits on the manuscript. Acknowledgment We would like to thank the patients and investigators involved in AVIATOR study (NCT01464827) for their participation in the trial. References Gower, E., et al., 2014. Global epidemiology and genotype distribution of the hepatitis C virus infection. Hepatology 61 (1 Suppl), S45–S57. Freiman, M., et al., 2016. Hepatitis C core antigen testing for diagnosis of hepatitis C virus infection A systematic review and meta-analysis. Ann. Intern. Med. 165 (5), 345–355. Maasoumy, B., Wedemeyer, H., 2012. Natural history of acute and chronic hepatitis C. Gastroenterology 26 (4), 401–412. The Global Burden of Hepatitis C Working Group, 2004. The global burden of hepatitis C. J. Clin. Pharmacol. 44, 20–29. Ward, J.W., Mermin, J.H., 2015. Simple, effective, but out of reach? Public health implications of HCV drugs. N. Engl. J. Med. 373, 2678–2680. Linas, B.P., et al., 2014. The hepatitis C cascade of care: identifying priorities to improve clinical outcomes. PLoS One 9 (5), e97317. Chevaliez, et al., 2016. Clinical utility of hepatitis C virus core antigen detection and quantification in the diagnosis and management of patients with chronic hepatitis C receiving an all-oral, interferon-free regimen. Antiviral Ther., E-pub ahead of print.
Morota, K., et al., 2009. A new sensitive and automated chemiluminescent microparticle immunoassay for quantitative determination of hepatitis C virus core antigen. J. Virol. Methods 157, 8–14. Mederacke, I., et al., 2009. Performance and clinical utility of a novel fully automated quantitative HCV-core antigen assay. J. Clin. Virolol. 46, 210–215. Ross, R.S., et al., 2010. Analytical performance characteristics and clinical utility of a novel assay for total hepatitis C virus core antigen quantification. J. Clin. Microbiol. 48, 1161–1168. Medici, M.C., et al., 2011. Hepatitis C virus core antigen: analytical performances, correlation with viremia and potential applications of a quantitative, automated immunoassay. J. Clin. Virol. 51, 260–265. Heidrich, B., et al., 2014. Hepatitis C virus core antigen testing in liver and kidney transplant recipients. J. Viral Hepatitis 21, 769–779. Ottiger, C., et al., 2013. Detection limit of architect hepatitis C core antigen assay in correlation with HCV RNA, and renewed confirmation algorithm for reactive anti-HCV samples. J. Clin. Virol. 58, 535–540. Bouvier-Alias, M., et al., 2002. Clinical utility of total HCV core antigen quantification: a new indirect marker of HCV replication. Hepatology 36 (1), 211–218. Chevaliez, S., et al., 2014. J. Clin. Virol. 61 (1), 145–148. Garbuglia, et al., 2014. Clinical utility of hepatitis C virus core antigen quantification in patients with chronic hepatitis C. BMC Infect. Dis. 14, 222. Kowdley, K., et al., 2014. Phase 2b trial of interferon-free therapy for hepatitis C virus genotype 1. N. Engl. J. Med. 370, 222–232. Adhemo, A., et al., 2016. Quantification of core antigen monitors efficacy of direct acting antiviral agents in patients with chronic HCV. Clin. Gastroenterol. Hepatol. Medici, M., et al., 2016. Evolving strategy for HCV testing in an Italian tertiary care hospital. J. Clin. Virol. Kesli, R., et al., 2011. Comparison of a newly developed automated and quantitative hepatitis C virus (HCV) core antigen test with the HCV RNA assay for clinical usefulness in confirming anti-HCV results. J. Clin. Microbiol. 49, 4089–4093. Mederacke, I., et al., 2012. HCV core antigen testing in HIV- and HBV-coinfected patients, and in HCV-infected patients on hemodialysis. J. Clin. Virol. 53, 110–115. Ergünay, K., et al., 2011. Utility of commercial quantitative hepatitis C core antigen assay in a diagnostic laboratory setting. Diag. Microbiol. Infect. Dis. 70 (4), 486–901. Buket, C., et al., 2014. Comparison of HCV core antigen and anti-HCV with HCV RNA results. Afr. Health Sci. 14, 816–820. Vermehren, J., et al., 2012. Clinical utility of the ARCHITECT HCV Ag assay for early treatment monitoring in patients with chronic hepatitis C genotype 1 infection. J. Clin. Virol. 55 (1), 17–22. Hadziyannis, E., et al., 2013. Is HCV core antigen a reliable marker of viral load? An evaluation of HCV core antigen automated assays. Ann. Gastroenterol. 26 (2), 146–149. Kadkhoda, K., Smart, G., 2014. HCV antigen testing for the diagnosis of hepatitis C infection: a cost-efficient algorithm. Clin. Lab. 60, 677–680. Park, Y., et al., 2010. New automated hepatitis C virus (HCV) core antigen assay as an alternative to real-time PCR for HCV RNA quantification. J. Clin. Microbiol. 48 (6), 2253–2256. Tedder, R., et al., 2013. Therapy-induced clearance of HCV core antigen from plasma predicts an end of treatment viral response. J. Viral Hepatitis 20, 65–71. Yoshida, E., et al., 2015. Concordance of sustained virological response 4, 12, and 24 weeks post-treatment with sofosbuvir-containing regimens for hepatitis C virus. Hepatology 61 (1), 41–45.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
HCV core antigen as an alternate test to HCV RNA for assessment of virologic responses to all-oral, interferon-free treatment in HCV genotype 1 infected patients Jürgen Kurt Rockstroh a , Jordan J. Feld b , Stéphane Chevaliez c , Kevin Cheng d , Heiner Wedemeyer e , Christoph Sarrazin f , Benjamin Maasoumy f , Christine Herman d , John Hackett Jr. d , Daniel E. Cohen g , George J. Dawson d , Gavin Cloherty d,∗ , Jean-Michel Pawlotsky c a
University Hospital Bonn, Bonn, Germany Toronto Centre for Liver Disease McLaughlin-Rotman Centre for Global Health University of Toronto, Toronto, ON, Canada National Reference Center for Viral Hepatitis B C and D Department of Virology Hôpital Henri Mondor Université Paris-Est and INSERM U955, Créteil, France d Abbott Laboratories, Abbott Park, IL, USA e Klinik für Gastroenterologie Hepatologie und Endokrinologie Medizinische Hochschule Hannover, Hannover, Germany f Medizinische Klinik 1 Universitätsklinikum Frankfurt, Frankfurt am Main, Germany g Abbvie, North Chicago, IL, USA b c
a b s t r a c t Article history: Received 3 February 2017 Received in revised form 3 March 2017 Accepted 4 March 2017
In light of the advances in HCV therapy, simplification of diagnosis confirmation, pre- treatment diagnostic workup and treatment monitoring is required to ensure broad access to interferon-free therapies. HCV core antigen (HCV cAg) testing is rapid, giving results in approximately 60 min, and less expensive than HCV RNA methods. While extensive data on the analytical performance of HCV cAg relative to RNA or comparisons in longitudinal studies of patients on interferon based (response guided) therapy there is very limited data on the relative performance of HCV cAg in diagnosis and monitoring patients receiving all-oral interferon free regimens. Furthermore, there is no data in the literature that describes the specificity of HCV cAg in patients with resolved HCV infection i.e. anti-HCV positive/HCV RNA negative. In this study a total of 1201 plasma samples from the 411 HCV genotype 1 subjects with a HCV RNA viral load >50,000 IU/ml who enrolled in a clinical trial with ombitasvir, ritonavir-boosted paritaprevir and dasabuvir, with or without ribavirin were retrospectively tested in a blinded fashion with HCV cAg test and results were compared to HCV RNA levels. The specificity of the HCV cAg test was also evaluated in anti-HCV positive but HCV RNA negative samples. Overall concordance between HCV cAg and HCV RNA was 98.6% while concordance in pre-treatment samples was 99.5% (409/411; n = 2 HCV RNA pos. with viral loads > 3 Mill IU/ml but HCV cAg neg.) and 99.24% in post treatment week 12 samples (391/394; n = 2 HCV RNA pos. < 25 IU/ml and n = 1 HCV RNA pos. 2180 IU/ml). Specificity in anti-HCV positive HCV RNA negative samples tested was 100%. © 2017 Published by Elsevier B.V.
HCV cAg testing can be used to accurately identify active viremia in HCV genotype 1-infected patients with a viral load >50,000 IU/ml and discriminate those who achieve sustained virological response from those who fail therapy. Worldwide it is estimated that 185 million people are chronically infected with the HCV, with 3–4 million new infections per
∗ Corresponding author at: 100 Abbott Park Road, Abbott Park, IL 60064, USA. E-mail address: [email protected] (G. Cloherty). http://dx.doi.org/10.1016/j.jviromet.2017.03.002 0166-0934/© 2017 Published by Elsevier B.V.
year and over 350,000 deaths due to HCV-related liver disease each year (Gower et al., 2014). Among those who acquire a primary infection, 15–50% will spontaneously clear the virus within the first 2–6 months and remain positive for anti-HCV antibodies, although they are not actively infected and do not require treatment (Freiman et al., 2016). Those individuals who do not spontaneously clear the virus develop chronic infection characterized by the continuous detection of HCV RNA in the presence of antibodies to HCV (Maasoumy and Wedemeyer, 2012).
J.K. Rockstroh et al. / Journal of Virological Methods 245 (2017) 14–18
The long term impact of HCV infection is highly variable, ranging from minimal effects to chronic hepatitis, advanced fibrosis, cirrhosis, decompensated cirrhosis and hepatocellular carcinoma (Maasoumy and Wedemeyer, 2012). Chronic HCV infection may also induce severe extra-hepatic complications. The goal of therapy is to eradicate HCV in order to prevent hepatic and extra-hepatic complications and to improve overall survival (The Global Burden of Hepatitis, 2004). Advances in the treatment of HCV infection have demonstrated over 90% cure rates, as defined by the sustained virologic response (SVR), i.e. undetectable HCV RNA 12 weeks after the end of treatment, after 8–24 weeks of treatment with interferon (IFN)-free combinations of direct-acting antiviral (DAA) drugs. With these therapies, high SVR rates can be obtained regardless of viral genotype, degree of liver fibrosis or previous treatment history in the majority of patient groups. In order for infected individuals to benefit from these advances in treatment they need to pass through a cascade of care which includes screening, confirmation of diagnosis and linkage to care (Ward and Mermin, 2015; Linas et al., 2014). In light of the advances in HCV therapy, simplification of diagnosis confirmation, pre- treatment diagnostic workup and treatment monitoring is required to ensure broad access to these new therapies. Introduction of these highly potent therapies has obviated the need for response-guided therapy and reduced the role of treatment monitoring with highly sensitive quantitative HCV RNA tests (Chevaliez et al., 2016). However, HCV RNA testing remains required to confirm HCV infection and assess virological responses, in particular the SVR. During viral assembly, nucleocapsid is released into the plasma and can be detected earlier than antibodies and throughout the course of infection (Freiman et al., 2016). The amount of HCV core antigen in the blood correlates with the HCV RNA level. Thus, HCV core antigen can identify individuals actively infected with HCV and is a surrogate marker of HCV replication (Morota et al., 2009; Mederacke et al., 2009; Ross et al., 2010; Medici et al., 2011; Heidrich, 2014; Ottiger et al., 2013; Bouvier-Alias et al., 2002; Chevaliez et al., 2014). The Abbott ARCHITECT HCV core antigen assay (HCV cAg) detection is based on a two-step immunoassay (Abbott Diagnostics, Abbott Park, IL, USA), using Chemiluminescent Microparticle Immunoassay (CMIA) technology for the quantitative determination of HCV core antigen. This test is rapid, giving results in approximately 60 min, and less expensive than HCV RNA methods, and has a proposed limit of detection between 1000 IU/ml and 3000 IU/ml according to the HCV genotype. The goal of this study was to evaluate the ability of HCV cAg testing with the ARCHITECT assay to identify active chronic HCV infection and distinguish it from spontaneously resolved HCV infection, to monitor patients receiving all-oral, IFN-free, DAA-based treatment, and to identify patients who fail therapy in a randomized clinical trial with a new DAA-based regimen. The AVIATOR trial (Garbuglia et al., 2014) was an openlabel study with 14 treatment subgroups designed to evaluate the safety and efficacy of various combinations of ritonavirboosted paritaprevir (NS3-4A protease inhibitor) and ombitasvir (NS5A inhibitor) with dasabuvir (non-nucleoside inhibitor of the HCV RNA-dependent RNA polymerase) co-administered with or without ribavirin (RBV) for 8, 12 or 24 weeks in HCV genotype 1infected non-cirrhotic, treatment-naïve and null-responder adults [NCT01464827]. In this analysis, a total of 1201 plasma samples from 411/571 subjects who enrolled in the Aviator trial for which HCV RNA levels were known and sample volume available were tested retrospectively in a blinded fashion with the HCV cAg assay. The time points included baseline (N = 411), week 4 (N = 396), and post-treatment week 12 (N = 394). Results from HCV cAg were analyzed to determine levels of concordance with HCV RNA lev® ® els measured with the Roche High-Pure-System/COBAS TaqMan
15
Fig. 1. Least squares regression plot for all samples with valid results from both Roche HPS/TaqMan RNA vs ARCITECT HCV core antigen assays.
v2.0 assay (HPS; Roche Diagnostics, Indianapolis, IN, USA) which was the test of record method in this trial. Where sample volume was available, discordant results between the HPS and HCV cAg were investigated by retesting with HCV cAg for core antigen and with an alternate HCV RNA method, Abbott RealTime HCV (ART; Abbott Molecular Inc, Des Plaines, IL, USA). Discordance analysis between HPS and HCV cAg was conducted using <25 IU/ml which was the viral load used as the primary clinical end-point in the AVIATOR trial. Sequence analysis of the portion of the HCV genome coding for the virus core antigen was performed using 5 l of RNA extracted on the Abbott m2000sp and One-Step RT-PCR reagents (QIAGEN, Hilden, GmbH) according to the manufacturer suggested cycling conditions. PCR fragment of 597 bp was amplified using forward primer HCV-78Fb (5 GCCTTGTGGTACTGCCTGATA3 ) and mixture of two reverse primers HCV-852Rb (5 GG AAG ATA GAG AAA GAG CAA CC3 ) and HCV-852Rc (5 AGG AAG ATA GAA AAG GAG CAA CC3 ), and was sequenced directly using ABI Prism Big Dye Terminator v3.1 Cycle Sequencing Reactions Kit (Applied Biosystems, Austin, TX, USA) and the ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, Austin, TX). Sequence data were assembled and edited using Sequencher software Version 5.4 (Gene Code Corporation, Ann Arbor, MI, USA). Amino acid sequence was analyzed for mutations in the core Ag region using Lasergene v11.2.1 software (DNASTAR, Madison, WI, USA). HPS, HCV cAg and ART measurements were performed according to the manufacturers’ instruction. In addition, to assess the specificity of the HCV cAg test, 289 blood donor samples from the American Red Cross and 37 patient samples from University of Bonn which were anti-HCV positive/HCV RNA negative were tested with HCV cAg. All patients from the Bonn site had repeatedly tested positive for anti-HCV antibodies but were HCV RNA negative for at least 6 months, indicative of spontaneous clearance of previous HCV infection. None of the patients had ever been exposed to HCV therapy. All data were analyzed with PC SAS 9.3 (SAS Institute Cary, North Carolina, USA). A least squares linear regression was performed to examine the association between the HPS assay result (IU/ml) and the HCV cAg (fmol/l). The data were plotted and the Pearson correlation coefficient, the coefficient of determination, the point estimates for the slope and intercept of the regression line were calculated. All of the patients provided written informed consent. The study was performed in accordance with good clinical practice guidelines and the principles of the Declaration of Helsinki, and the study protocol was approved by the relevant institutional review boards and regulatory agencies. This study is retrospective and was performed using de-identified residual samples collected as part of the AVIATOR trial [NCT01464827]. There was a positive correlation between HCV cAg and HPS (r2 = 0.7520, Fig. 1). Using 25 IU/ml as a cutoff for HPS, ART and HCV cAg tests had overall concordant results in 1184 of 1201 samples
16
J.K. Rockstroh et al. / Journal of Virological Methods 245 (2017) 14–18
Table 1 Concordance table Roche HPS vs ARCHITECT HCV cAg using 25 IU/ml as the cut-off. Det = detected and ND = not detected. Visit
Baseline
Obs.
HPS IU/ml
Abbott RealTime HCV
HCV Ag
1 2
Result 3,850,000 6,090,000
Result 5.94 No sample
Initial test fmol/l 1.2 −1.2
tested (98.6%), including 409 in pre-treatment samples (99.5%), 382 in week 4 samples (96.46%) and 393 in post treatment week 12 samples (99.75%) (Table 1). Of the 17 discordant samples, 4 were HCV cAg negative/HPS positive. Two baseline samples, with viral loads of 3,580,000 and 6,090,000 IU/ml with HPS, gave negative results when tested with HCV cAg. Sequence analysis of the portion of the HCV genome coding for the virus core antigen was amplified from one sample (6,090,000 IU/ml) and compared to the sequence of the monoclonal antibodies used in the HCV cAg test but revealed no molecular basis for the discordant result. Sufficient sample volume for sequencing was not available for the second sample (3,580,000 IU/ml). The majority of discordant samples (n = 66) were from the week 4 time points with 53 HCV cAg negative/HPS positive and 13 HCV cAg positive/HPS negative. Only one of the HCV cAg negative/HPS positive samples gave a quantifiable viral load (75 IU/ml). All of the HCV cAg positive/HPS negative samples were also positive with ART (range < 1.08 log IU/ml—1.97 log IU/ml—see Table 2). All subjects with week four discordant results (n = 66) were undetectable by both methods at post treatment week 12. There were, however, three discordant results, all HCV cAg negative/HPS positive at the post-treatment week 12 time points. Two of the three had a viral load of <25 IU/ml, and were therefore considered SVR in this study, and the third sample had a viral load of 2180 IU/ml and was therefore a relapse. A post treatment week 24 sample or clinical follow up was not available for this discordance relapse patient. One of the <25 IU/ml samples was HCV RNA negative by ART but the other two results were confirmed positive by this method (Table 2). The HCV cAg test accurately identified active infections in 99.51% of subjects enrolled in this study and discriminated SVR from treatment failure in 99.75%. If a clinical cut-off of 10 fmol/l was adopted for HCV cAg at the week 4 time points, the number of discordant results would be further reduced, as 12 of 13 HCV cAg positives/RNA negative would then be considered negative. All 326 anti-HCV positive/confirmed HCV RNA negative samples tested with HCV cAg yielded negative results, demonstrating 100% concordance with RNA and 100% specificity of the test in this population. In this study the Abbott ARCHITECT HCV cAg accurately identified subjects with active viremia at screening in 99.51% (409/411) of cases, confirming that HCV core antigen detection can accurately diagnose active infection in samples with HCV RNA >50,000 IU/ml. In this study the vast majority of the discordant results between HCV cAg and HPS were from week 4 samples with very low levels of viremia, and would have had no clinical impact. The HCV cAg test discriminated SVR from non-SVR at 12 weeks post therapy in 99.75% (393/394) of subjects tested. In the one individual from whom relapse was missed by HCV cAg follow up was not available to determine whether repeat testing at a later time point would have identified this individual. Although this particular individual was identified by HCV RNA testing, other studies have shown that some patients relapse beyond SVR 12 even with the most sensitive HCV RNA PCR test (Yoshida et al., 2015). Although additional testing beyond SVR 12 might be necessary to ensure 100% accurate determination of SVR, whether it would be useful to add follow-up SVR 24 testing on all patients is debatable. These results suggest that HCV cAg testing can be used for accurate confirmation of SVR 12 in almost all patients.
Result Retest 1 fmol/l . .
Retest 2 fmol/l . .
Negative Negative
This study shows that HCV cAg testing can be safely used instead of HCV RNA monitoring to manage HCV-infected patients receiving IFN-free, DAA-based therapy (Chevaliez et al., 2016; Kowdley et al., 2014; Adhemo et al., 2016). While the results of this study focus on HCV genotype 1 infection they agree with the findings of other studies which have investigated the ability of the ARCHITECT HCV Ag assay to detect HCV cAg in HCV RNA positive samples. Data on 4534 samples from 19 studies with a 3 fmol/l cAg cut-off with a retest range of 3–10 fmol/l, demonstrated an overall sensitivity of the cAg assay relative to RNA of 92.9%. (Chevaliez et al., 2016; Morota et al., 2009; Mederacke et al., 2009; Ross et al., 2010; Medici et al., 2011; Heidrich, 2014; Ottiger et al., 2013; Bouvier-Alias et al., 2002; Chevaliez et al., 2014; Garbuglia et al., 2014; Kowdley et al., 2014; Adhemo et al., 2016; Medici et al., 2016; Kesli et al., 2011; Mederacke et al., 2012; Ergünay et al., 2011; Buket et al., 2014; Vermehren et al., 2012; Hadziyannis et al., 2013; Kadkhoda and Smart, 2014; Park et al., 2010; Tedder et al., 2013; Freiman et al., 2016). Of note, in samples with viral load >10,000 IU/ml the sensitivity rose to 99.5%, which correlates well with our findings from AVIATOR trial which had an inclusion criterion requiring subjects to have a viral load of at least 50,000 IU/ml. Although two samples with viral loads of 3,580,000 and 6,090,000 IU/ml when tested with HPS were negative with HCV cAg, this appears to be a very rare event, and in the sample which had sufficient volume to test, the absence of any viral sequence mutation which might indicate a molecular mechanism for the negative HCV cAg result might imply that this could be the result of a clerical or processing error. Some of the studies investigating the utility of HCV cAg also pointed out limitations of the assay. When compared to HCV RNA assays, it was apparent that some samples with low viral load were not detectable by the HCV cAg assay, as expected given its analytical sensitivity. Thus, in order to achieve 100% detection of active viremia in an anti-HCV positive sample with negative HCV cAg results, confirmation by an HCV RNA assay could be considered. As the number of HCV cAg false-negative results would be expected to be very low in the general population the number of RNA tests required to confirm HCV cAg negative results could be reduced while maintaining the 100% detection goal by pooling samples prior to HCV RNA testing (Freiman et al., 2016). For this study all 326 HCV antibody positive RNA negative samples were HCV cAg negative and the specificity of the HCV cAg test was calculated to be 100%. The findings of this study and others (Chevaliez et al., 2014; Kowdley et al., 2014; Freiman et al., 2016) have shown that low levels of quantifiable HCV RNA on therapy and even at the end of treatment should not be considered indicative of non-adherence and do not preclude achieving an SVR. These findings have not been replicated in special patients such as DAA experienced patients. In this context, an accurate but less sensitive method, such as measurement of HCV core antigen levels, may be a valuable alternative to highly sensitive HCV RNA testing as an adherence measure (Freiman et al., 2016). Based on the results of this study a clinical cutoff of 1000–5000 IU/ml HCV RNA or 5 –10 fmol/l HCV cAg following 4 weeks of therapy might be a more appropriate indicator of treatment adherence.
J.K. Rockstroh et al. / Journal of Virological Methods 245 (2017) 14–18
17
Table 2 Discordant table Roche HPS vs ARCHITECT HCV cAg with Abbott RealTime HCV assay as referee method. Det = detected; ND = not detected; PTW 12 = post-treatment week 12. Visit
Baseline Week 4
PTW 12
Obs.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71
HPS IU/ml
Abbott RealTime HCV
HCV Ag
Result
Result
3,850,000 6,090,000 <25 IU/ml HCV RNA detected <25 IU/Ml HCV RNA Detected HCV RNA not detected <25 IU/ml HCV RNA Detected <25 IU/ml HCV RNA Detected <25 IU/ml HCV RNA Detected <25 IU/ml HCV RNA detected <25 IU/ML HCV RNA Detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ML HCV RNA DETECTED <25 IU/ml HCV RNA Detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected HCV RNA not detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected 75 <25 IU/ml HCV RNA detected HCV RNA not detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected HCV RNA not detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected HCV RNA not detected HCV RNA not detected <25 IU/ml HCV RNA detected HCV RNA not detected HCV RNA not detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected HCV RNA not detected <25 IU/ML HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected HCV RNA not detected <25 IU/ml HCV RNA detected <25 IU/ML HCV RNA detected <25 IU/ML HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected HCV RNA not detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected HCV RNA not detected HCV RNA not detected <25 IU/ml HCV RNA detected <25 IU/ml HCV RNA detected 2180 <25 IU/ML HCV RNA detected
5.94 No sample Detected < 1.48 Detected < 1.48 1.28 <1.08 Detected < 1.48 <1.08 <1.08 Detected < 1.08 1.43 <1.08 1.15
Initial test fmol/l 1.2 −1.2 −1.1 2 3.3 0.3 0.7 −0.1 0.4 0.5 2.4 0.7 0.1
Retest 1 fmol/l . . . . 3 . . . . . . . .
Retest 2 fmol/l . . . . 1.8 . . . . . . . .
Negative Negative Negative Negative Positive Negative Negative Negative Negative Negative Negative Negative Negative
Qns 1.59 1.52 Detected < 1.08 1.27 1.76 1.46 1.82 Detected < 1.48 Detected < 1.48 1.91 1.19 1.7 1.34 1.93 <1.08 Detected < 1.08 Detected < 1.08 1.18 1.97 1.73 <1.08 1.71 Detected < 1.48 Detected < 1.08 1.4 Detected < 1.48 1.24 1.55 Detected < 1.48 Detected < 1.48 Detected < 1.48 1.88 1.91 1.44 1.88 Detected < 1.48 Detected < 1.48 Detected < 1.48 Detected < 1.08 2.21 1.68 Detected < 1.48 Detected < 1.48 Target not detected Detected < 1.48 Detected < 1.48 1.86 2.13 1.57 Detected < 1.48 Target not detected Detected < 1.48 Detected < 1.48 Detected < 1.48 Target not detected 3.01 Detected < 1.48
1.5 2.5 1.2 3.4 0 0.4 1.4 2.2 4.1 13 2.2 0.7 2.4 3.1 2.1 4.7 0.4 0.4 1.4 4.5 5.4 2.1 4.3 3.8 0.8 1.8 0.1 1 1.3 8.4 1.8 1.9 1.9 4.6 0.2 2.4 0.8 0.6 0.9 1.3 1.9 0.3 4.9 0.6 1.5 4.3 1.9 2.8 2.1 2.3 1 −0.1 4.3 3.2 0.9 0.3 3.2 0.3
. . . 4.4 . . . . 2.8 . . . . 1.2 . 3.8 . . . 4 5.6 . 3.4 3.8 . . . . . 9.7 0.9 . . 4.1 . . . . . . . . 1.1 . . 5.6 . . . . . . 4.2 3 . . 2.5 0
. . . 3.4 . . . . 2.8 . . . . 1.1 . 5.5 . . . 1.9 3.9 . 2.7 . . . . . . 10.7 . . . 3.7 . . . . . . . . 0.9 . . . . . . . . . 5.1 2.6 . . 2.3 .
Negative Negative Negative Positive Negative Negative Negative Negative Negative Positive Negative Negative Negative Negative Negative Positive Negative Negative Negative Positive Positive Negative Positive Positive Negative Negative Negative Negative Negative Positive Negative Negative Negative Positive Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Positive Negative Negative Negative Negative Negative Negative Positive Positive Negative Negative Negative Negative
Result
18
J.K. Rockstroh et al. / Journal of Virological Methods 245 (2017) 14–18
The results from this and other studies indicate that HCV cAg testing can be used to accurately identify patients with chronic HCV infection and discriminate those who achieve SVR from those who fail therapy, and should be considered for inclusion in routine laboratory testing. Importantly, the specificity of HCV cAg in a very challenging patient population (anti-HCV positive/HCV RNA negative) described in results provide confidence that the use of this test will not result in falsely identifying patients as chronic/viremic with all the associated clinical, psychological and financial implication. The use of HCV Ag testing in diagnosis and treatment monitoring should improve access to care in areas where HCV RNA testing is not or hardly available. Author contributions G.C., K.C., S.C., C.H., B.M., V.H., G.D., J.R., H.W., J.M.P., C.S., J.F. contributed equally to the study design. G.C., K.C. and V.H. performed the laboratory testing described in this manuscript. C.H. conducted all statistical analysis and generated the figures and tables. G.C. took the lead in writing the manuscript. G.C., K.C., C.H., B.M., V.H., G.D., J.R., H.W., J.M.P., C.S., J.F. reviewed and provided feedback/edits on the manuscript. Acknowledgment We would like to thank the patients and investigators involved in AVIATOR study (NCT01464827) for their participation in the trial. References Gower, E., et al., 2014. Global epidemiology and genotype distribution of the hepatitis C virus infection. Hepatology 61 (1 Suppl), S45–S57. Freiman, M., et al., 2016. Hepatitis C core antigen testing for diagnosis of hepatitis C virus infection A systematic review and meta-analysis. Ann. Intern. Med. 165 (5), 345–355. Maasoumy, B., Wedemeyer, H., 2012. Natural history of acute and chronic hepatitis C. Gastroenterology 26 (4), 401–412. The Global Burden of Hepatitis C Working Group, 2004. The global burden of hepatitis C. J. Clin. Pharmacol. 44, 20–29. Ward, J.W., Mermin, J.H., 2015. Simple, effective, but out of reach? Public health implications of HCV drugs. N. Engl. J. Med. 373, 2678–2680. Linas, B.P., et al., 2014. The hepatitis C cascade of care: identifying priorities to improve clinical outcomes. PLoS One 9 (5), e97317. Chevaliez, et al., 2016. Clinical utility of hepatitis C virus core antigen detection and quantification in the diagnosis and management of patients with chronic hepatitis C receiving an all-oral, interferon-free regimen. Antiviral Ther., E-pub ahead of print.
Morota, K., et al., 2009. A new sensitive and automated chemiluminescent microparticle immunoassay for quantitative determination of hepatitis C virus core antigen. J. Virol. Methods 157, 8–14. Mederacke, I., et al., 2009. Performance and clinical utility of a novel fully automated quantitative HCV-core antigen assay. J. Clin. Virolol. 46, 210–215. Ross, R.S., et al., 2010. Analytical performance characteristics and clinical utility of a novel assay for total hepatitis C virus core antigen quantification. J. Clin. Microbiol. 48, 1161–1168. Medici, M.C., et al., 2011. Hepatitis C virus core antigen: analytical performances, correlation with viremia and potential applications of a quantitative, automated immunoassay. J. Clin. Virol. 51, 260–265. Heidrich, B., et al., 2014. Hepatitis C virus core antigen testing in liver and kidney transplant recipients. J. Viral Hepatitis 21, 769–779. Ottiger, C., et al., 2013. Detection limit of architect hepatitis C core antigen assay in correlation with HCV RNA, and renewed confirmation algorithm for reactive anti-HCV samples. J. Clin. Virol. 58, 535–540. Bouvier-Alias, M., et al., 2002. Clinical utility of total HCV core antigen quantification: a new indirect marker of HCV replication. Hepatology 36 (1), 211–218. Chevaliez, S., et al., 2014. J. Clin. Virol. 61 (1), 145–148. Garbuglia, et al., 2014. Clinical utility of hepatitis C virus core antigen quantification in patients with chronic hepatitis C. BMC Infect. Dis. 14, 222. Kowdley, K., et al., 2014. Phase 2b trial of interferon-free therapy for hepatitis C virus genotype 1. N. Engl. J. Med. 370, 222–232. Adhemo, A., et al., 2016. Quantification of core antigen monitors efficacy of direct acting antiviral agents in patients with chronic HCV. Clin. Gastroenterol. Hepatol. Medici, M., et al., 2016. Evolving strategy for HCV testing in an Italian tertiary care hospital. J. Clin. Virol. Kesli, R., et al., 2011. Comparison of a newly developed automated and quantitative hepatitis C virus (HCV) core antigen test with the HCV RNA assay for clinical usefulness in confirming anti-HCV results. J. Clin. Microbiol. 49, 4089–4093. Mederacke, I., et al., 2012. HCV core antigen testing in HIV- and HBV-coinfected patients, and in HCV-infected patients on hemodialysis. J. Clin. Virol. 53, 110–115. Ergünay, K., et al., 2011. Utility of commercial quantitative hepatitis C core antigen assay in a diagnostic laboratory setting. Diag. Microbiol. Infect. Dis. 70 (4), 486–901. Buket, C., et al., 2014. Comparison of HCV core antigen and anti-HCV with HCV RNA results. Afr. Health Sci. 14, 816–820. Vermehren, J., et al., 2012. Clinical utility of the ARCHITECT HCV Ag assay for early treatment monitoring in patients with chronic hepatitis C genotype 1 infection. J. Clin. Virol. 55 (1), 17–22. Hadziyannis, E., et al., 2013. Is HCV core antigen a reliable marker of viral load? An evaluation of HCV core antigen automated assays. Ann. Gastroenterol. 26 (2), 146–149. Kadkhoda, K., Smart, G., 2014. HCV antigen testing for the diagnosis of hepatitis C infection: a cost-efficient algorithm. Clin. Lab. 60, 677–680. Park, Y., et al., 2010. New automated hepatitis C virus (HCV) core antigen assay as an alternative to real-time PCR for HCV RNA quantification. J. Clin. Microbiol. 48 (6), 2253–2256. Tedder, R., et al., 2013. Therapy-induced clearance of HCV core antigen from plasma predicts an end of treatment viral response. J. Viral Hepatitis 20, 65–71. Yoshida, E., et al., 2015. Concordance of sustained virological response 4, 12, and 24 weeks post-treatment with sofosbuvir-containing regimens for hepatitis C virus. Hepatology 61 (1), 41–45.