Helenalin from Centipeda minima ameliorates acute hepatic injury by protecting mitochondria function, activating Nrf2 pathway and inhibiting NF-κB activation

Biomedicine & Pharmacotherapy 119 (2019) 109435

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

Helenalin from Centipeda minima ameliorates acute hepatic injury by protecting mitochondria function, activating Nrf2 pathway and inhibiting NF-κB activation

T

Yan Lia,1, Yongmei Zengb,1, Quanfang Huangc,1, Shujuan Wena, Yuanyuan Weia, Ya Chena, ⁎ Xiaolin Zhanga, Facheng Baia, Zhongpeng Luc,d, Jinbin Weia, Xing Lina, a

Guangxi Medical University, Nanning, 530021, China Department of Pediatrics, Shenzhen Maternity and Child Healthcare Hospital, Shenzhen, 518028, China The First Affiliated Hospital of Guangxi University of Chinese Medicine, Nanning, 530023, China d Department of Biochemistry and Molecular Biology, University of Oklahoma Health Science Center, Oklahoma City, OK, 73126-0901, USA b c

A R T I C LE I N FO

A B S T R A C T

Keywords: Helenalin Acute hepatic injury Mitochondria function Nrf2 pathway NF-κB

Acute liver injury is a life-threatening syndrome that often caused by hepatocyte damage and is characterized by inflammatory and oxidative responses. Helenalin isolated from Centipeda minima (HCM) has been found to have anti-inflammatory and anti-oxidative effects. Here, this study aimed to investigate the effects and underlying mechanisms of HCM on Lipopolysaccharide/D-Galactosamine (LPS/D-GalN)-induced acute liver injury. Mice were intragastrically administered with various dose of HCM for 10 days; 2 h after the final treatment, the mice were injected with 50 μg/kg LPS and 800 mg/kg D-GalN. The histopathological changes, hepatocyte apoptosis, serum cytokines, oxidative stress and inflammatory cytokines were assessed. The results showed that HCM significantly ameliorated the hepatic injury, as evidenced by the attenuation of histopathological changes and the decrease in serum aminotransferase and total bilirubin activities. HCM markedly decreased hepatocyte apoptosis by modulating the mitochondria-dependent pathway, including the increase in the Bcl-2/Bax ratio, the inhibition of caspase-3, -8 and -9, and the inhibition of cytochrome C release. Moreover, HCM strongly alleviated oxidative stress, lipid peroxidation and reactive oxygen species (ROS) generation by activating the Nrf2 signaling pathway. In addition, HCM significantly attenuated inflammatory cytokines including TNF-α, IL6 and IL-1β as well as NO production by inhibiting TLR4 signaling transduction and NF-κB activation. In conclusion, HCM protects hepatocytes from damage induced by LPS/D-GalN, which may contribute to its ability to alleviate hepatocyte apoptosis by protecting the mitochondrial function, inhibit oxidative stress by activating the Nrf2 pathway, and attenuate inflammation by inhibiting NF-κB activation. This study demonstrates that HCM may be developed as a potential agent for the treatment of acute liver failure.

1. Introduction Acute liver injury is a dramatic clinical syndrome, which can be caused by a variety of factors such as viral hepatitis, toxic chemicals and hepatotoxic drugs. It can easily further develop to liver failure, leading to high mortality in clinic [1]. Lipopolysaccharide (LPS), a typical endotoxic element from the outer leaflet of Gram-negative bacteria, can strongly induce inflammatory response. D-Galactosamine (DGalN), a hexosamine derived from galactose, can promote the hepatotoxicity of LPS [2]. LPS/D-GalN-induced hepatic injury in mice closely resembles fulminant hepatic failure in clinic, which has been widely

used to investigate the new liver-protective medicines [3]. It has been confirmed that oxidant stress resulting from over reactive oxygen species (ROS) and mitochondrial dysfunction plays a crucial role in LPS/DGalN-induced acute liver injury. Many oxidative stress-related genes are regulated by the nuclear factor erythroid-2-related factor (Nrf2) [4]. After activation, Nrf2 can bind to the promoters of the certain antioxidant genes and promote their expression, enhancing the anti-oxidative defense system. Besides oxidant stress, inflammatory response has been considered as another important pathogenic factor that contributes to LPS/D-GalN-induced liver injury [5]. Under stimulation of LPS/D-GalN, the nuclear factor κB (NF-κB) is activated and sequentially

⁎

Corresponding author. E-mail address: [email protected] (X. Lin). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.biopha.2019.109435 Received 30 July 2019; Received in revised form 5 September 2019; Accepted 5 September 2019 0753-3322/ © 2019 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Biomedicine & Pharmacotherapy 119 (2019) 109435

Y. Li, et al.

2.3. Analysis of liver enzymes and serum cytokines levels

promotes the release of pro-inflammatory cytokines, such as tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and interleukin-1β (IL1β), then causing hepatic cell death [6]. Therefore, it may be a potential strategy for the treatment of acute liver injury by activating the Nrf2 signaling pathway and inhibiting NF-κB activation. Centipeda minima (L.)was found to have significant activities against bacteria, allergy, oxidant and inflammatory [7,8]. In our previous study, an ingredient was isolated from C. minima and identified as helenalin. The experiments showed that it could attenuate ethanol-induced liver fibrosis by promoting ethanol metabolism, reducing inflammatory response and inhibiting HSC activation [9]. But so far, the potentially protective effect of helenalin on acute hepatic injury remains unclear. Thus, in this study, the acute hepatic injury was induced by LPS/D-GalN in mice and the anti-hepatic failure effect of HCM was observed.

Serum aspartate aminotransferase (AST), alanine aminotransferase (ALT) and total bilirubin (TBIL) were determined using the commercially-available kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Serum tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and interleukin-1β (IL-1β) were detected using enzyme-linked immunosorbent assay (ELISA) kits (Amersham Pharmacia Biotec, NJ, USA) according to the manufacturer’s protocols. 2.4. Determination of hepatic lipid peroxidation and antioxidant enzymes Liver tissue was homogenized in cold 50 mM Tris HCl (pH 7.5, 4 ml per g of tissue) with a glass-Teflon tissue homogenizer, and centrifuged at 1000 g for 15 min at 4 °C. Lipid peroxidation was assessed by detecting malondialdehyde (MDA), an end product of lipid peroxidation. Hepatic MDA was measured using a thiobarbituric acid method as previously described [13]. Moreover, superoxide dismutase (SOD), glutathione-Px (GSH-Px), glutathione-Rd (GSH-Rd) and catalase in the supernatants were immediately detected using the commerciallyavailable kits (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China).

2. Materials and methods 2.1. Animals and experimental design Male C57BL/6 mice (22 ± 2 g) were obtained from the Laboratory Animal Center Guangxi Medical University (Guangxi, China). The animal experiment was approved by the Institutional Ethical Committee of Guangxi Medical University, according to the National Health Guidelines for the Care and Use of Laboratory Animals. The acute liver injury was induced in mice as previously described [10,11]. In brief, the mice were randomly divided into 6 groups (10 mice per group) including the normal control group (normal saline), HCM control group (3 mg/kg HCM), model group (50 μg/kg LPS and 800 mg/kg D-GalN), and HCM-treated groups (0.75, 1.5 and 3 mg/kg HCM). The doses of HCM were selected according to our previous study [9], and HCM was dissolved in normal saline. The experiment schedule was shown in Fig. 1. After 5 days acclimation, the mice in the HCM control group and HCM treated-groups were administered intragastrically with HCM once daily for 10 days; and the animals in the normal and model control groups were administered with the normal saline. Two hours after the final administration of drugs, the mice in the model group and HCM-treated groups were administrated intraperitoneally with 50 μg/kg LPS and 800 mg/kg D-GalN; and the mice in the normal control and HCM control groups were given the normal saline. Around 8 h after LPS/D-GalN injection [12], mice were anesthetized by intraperitoneally injecting sodium pentobarbital (50 mg/kg) and sacrificed, and the samples of serum and liver tissue were collected immediately.

2.5. Determination of reactive oxygen species (ROS) The content of ROS was determined as previously described [14]. Briefly, the freshly frozen liver tissues were cut into around 8-μm thick sections and paved on the glass slides. A fluorescent probe named Dihydroethidine hydrochloride (DHE; Sigma-Aldrich, St. Louis, USA) was used to detect ROS generation. Each tissue section was incubated with 5 μM DHE in a light-protected humidified chamber at 37 °C for 30 min. The fluorescence intensity was detected using a fluorescence microscope (BX-51W1; Olympus, Japan). 2.6. Estimating the NADP+/NADPH ratio Nicotinamide adenine dinucleotide phosphate (NADPH) plays a key role in the cellular anti-oxidation system, and its oxidized form is NADP+. The ratio of NADP+/NADPH is an indicator of cellular reducing potential. In this study, NADPH and NADP+ were detected using commercially-available kits (Sigma Aldrich, St. Louis, MO, USA) according to the manufacturer’s protocols [14]. 2.7. Determination of serum nitric oxide (NO) and hepatic heme oxygenase 1 (HO-1) Serum NO production was estimated using a commercially-available kit (BIOMOL, Plymouth Meeting, PA, USA). Hepatic HO-1 activity was assessed by measuring the bilirubin generation as previously described [15,16].

2.2. Histopathological analysis and assessment of apoptosis Liver tissues were successively fixed in 4% paraformaldehyde, dehydrated, and embedded in molten paraffin. Paraffin-embedded tissue samples were cut into 5-μm-thick sections and then stained with hematoxylin and eosin (H&E) according to the routine procedures. The pathologic changes were observed under a light microscope (IX-73, Olympus, Tokyo, Japan). Hepatocyte apoptosis in liver tissue was observed by the terminal deoxynucleotidyl transferase dUTP-mediated nick-end labeling (TUNEL) assay using a commercially-available kit (Takara Bio, Otsu, Japan).

2.8. Estimation of caspase-3, -8 and -9 activities The liver tissue was homogenized with lysis buffer and centrifuged at 20, 000 g for 15 min; the supernatant was harvested and incubated with the substrate peptide as following: DEVD-AFC, IETD-AFC and LEHD-AFC for caspase-3, -8 and -9, respectively [17]. After 2 h incubation, the intensity of fluorescence was detected using a Fig. 1. The experiment schedule.

2

Biomedicine & Pharmacotherapy 119 (2019) 109435

Y. Li, et al.

fluorescence microscope (IX-70, Olympus, Tokyo, Japan) as previously described [17].

Protein was extracted from liver tissue using the protein extraction kit (Thermo, USA); moreover, the nuclear protein and cytoplasmic protein were isolated using the Nuclear and Cytoplasmic Protein Extraction Kits (Beyotime Biotechnology, China), respectively. The concentration of the extraction protein was detected using the BCA protein analysis kit (Beyotime Biotechnology, China). Around 20 μg protein was separated by 12% SDS-PAGE and transferred onto PVDF membrane (Millipore Corp., Billerica, MA, USA). The membranes were blocked with 5% BSA in TBST at room temperature for 1 h and then incubated with a 1: 1000 dilution of various primary antibodies in 5% BSA with TBST at 4 °C overnight. The primary antibodies included Bcl-2, Bax, Cytochrome C (Cyt C), NF-κB-p65 (p65), p-NF-κB-p65 (p-p65), IκBα, p-IκBα, TLR4, MyD88 and GAPDH (Cell Signaling Technology, Beverly, MA, USA), as well as Nrf2, NQO1, HO-1, Keap-1, β-actin and Lamin B (Abcam, Cambridge, UK). Then, the membrane was washed with TBST for three times and incubated with HRP-conjugated secondary antibody (1:3000) for 1 h at room temperature. Total homogenate and cytosolic protein bands were normalized to GAPDH; Cytochrome C bands were normalized to β-actin, and nuclear fractions bands were normalized to Lamin B.

2.9. Assessment of mitochondrial membrane potential (MMP) Mitochondria were isolated from liver tissue as previously described [18]. In brief, the liver tissue was homogenized with lysis buffer and centrifuged at 1, 000 g for 10 min at 4 °C, and then the supernatant was removed. The medium was centrifuged at 8000 g for 10 min at 4 °C for two times, and the supernatant was discarded. The concentration of protein was detected using bicinchoninic acid (BCA) assay [19]. In this study, MMP was evaluated using rhodamine 123 staining (a fluorescent probe) as previously described [20,21]. The mitochondria were homogenized with a mixed buffer (10 mM HEPES, 50 μM EGTA, 220 mM sucrose, 68 mM D-mannitol, 2 μM rotenone, 5 mM sodium succinate, 2 mM MgCl2, 5 mM KH2PO4 and 10 mM KCl), and was stained with 10 μM rhodamine 123 for 30 min at 37 °C. The intensity of fluorescence was detected using a flow cytometer (Becton Dickinson, USA) [20]. 2.10. Cytochrome C release assay

2.13. Statistical analysis Cytochrome C (Cyt C) release from mitochondria was detected using an ELISA kit (Shanghai Enzyme-linked Biotechnology, Shanghai, China). Mitochondria samples were isolated from liver tissue as above described. First, each well of the 96-well microplate was precoated with 75 μl Horseradish peroxidase (HRP) conjugated Cyt C monoclonal antibody, and 50 μl of the control solution, standard solution or mitochondria sample were added and incubated for 2 h. Next, each well of the 96-well microplate was aspirated once and washed four times to remove the residual liquid, and then 100 μl of the substrate solution (Hydrogen peroxidase plus Tetramethyl benzidine) was added and mixed gently for 30 min. Finally, 100 μl of the stop solution was added, and the absorbance was detected using a microplate reader (BioTek, Winooski, VT, USA) at 450 nm.

The data were shown as the means ± SD, which was analyzed using the statistical software of SPSS 22.0 (Chicago, IL, USA). One-way analysis of variance (ANOVA) followed by Bonferroni's post hoc test was applied for comparisons between experimental groups. A value of P < 0.05 was considered statistically significant. 3. Results 3.1. HCM ameliorated LPS/D-GalN-induced acute liver injury The protective effect of HCM on LPS/D-GalN-induced acute liver damage in mice was assessed by H&E staining. The liver samples of the normal group and HCM control group revealed normal lobular and cellular structure (Fig. 2A1 and A2). LPS/D-GalN administration caused serious injury, such as hepatocyte degeneration, neutrophil infiltration, and necrosis (Fig. 2A3); however, these pathological alterations were significantly ameliorated by HCM pretreatment, as evidenced by the decreased inflammatory cell infiltration and the improvement of the hepatic lobular architecture (Fig. 2A4–A6). Moreover, LPS/D-GalN administration markedly increased the activity of AST and ALT as well as the content of TBIL. However, HCM pretreatment significantly reversed these abnormal changes induced by LPS/D-GalN (Fig. 2B and C). Altogether, these results suggest that HCM can significantly ameliorate LPS/D-GalN-induced acute liver injury in mice.

2.11. Real-time reverse transcription polymerase chain reaction (RT-PCR) RT-PCR assay was carried out as previously described [22]. Total RNA was extracted from liver tissue with TRIzol reagent (Life Technologies, Inc.). The total RNA (1.0 μg) was reversely transcribed by using one-step RT Kit (Takara Biotechnology, Dalian, China). RT-PCR analysis was performed using SYBRGreen Quantitative PCR kit (Takara Biotechnology). The primers, including TNF-α, IL-6, IL-1β, inducible nitric oxide synthase (iNOS), nuclear erythroid 2-related factor 2 (Nrf2), NAD(P)H-quinone oxidoreductase (NQO1) and glutamylcysteine synthetase (GCS), were listed in Table 1. In this study, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control.

3.2. HCM alleviated hepatocyte apoptosis

2.12. Western blot analysis

Hepatocyte apoptosis was assessed using TUNEL staining in the present study. The results showed that there were little TUNEL-positive hepatocytes in the normal group and HCM control group (Fig. 3A1 and

Western blot assay was performed as previously described [20]. Table 1 The sequences of primers used for real-time quantitative PCR. Genes

Sense primer (5'-3')

Anti-sense primer (5'-3')

TNF-α IL-6 IL-1β iNOS Nrf2 NQO1 GCS GAPDH

CTGCCTGCTGCACTTTGGAG AAGCCAGAGCTGTGCAGATGAGTA TCCAGGATGAGGACATGAGCAC GTGAGGATCAAAAACTGG GG CTCAGCATGATGGACTTGGA AGGATGGGAGGTACTC AGGAGCTTCGGGACTGTATCC GCACCGTCAAGGCTGAGAAC

ACATGGGCTACAGGCTTGTCACT TGTCCTGCAGCCACTGGTTC GAACGTCACACACCAGCAGGTTA ACCTGCAGGTTGGACCAC TCTATGTCTTGCCTCCAAAGG AGGCGTCCTTCCTTATATGCTA GGGACATGGTGCATTCCAAAA TGGTGAAGACGCCAGTGGA

3

Biomedicine & Pharmacotherapy 119 (2019) 109435

Y. Li, et al.

Fig. 2. Pretreatment with HCM ameliorated LPS/D-GalN-induced acute liver injury. (A) H&E staining was used to observe the histological changes (400×); A1: the normal group, A2: HCM control group, A3: LPS/D-GalN model group, A4-A6: HCM-treated groups (0.75, 1.50 and 3.00 mg/kg). The arrow indicates necrosis. (B and C) Serum ALT, AST and TBIL were determined using commercially-available kits. #P < 0.05 VS. the normal group and *P < 0.05 VS. the LPS/D-GalN model group.

cascade [23]. In the present study, mitochondrial function was assessed by detecting the mitochondrial membrane potential (MMP) and the release of Cyt C. As shown in Fig. 4A, LPS/D-GalN administration led to a significant increase in the MMP, suggesting the mitochondrial dysfunction; however, pretreatment with HCM significantly reduced MMP, indicating that HCM can protect mitochondria from dysfunction induced by LPS/D-GalN. In the cytochrome C release assay, the content of Cyt C was calculated according to the standard curve. The results showed that LPS/D-GalN administration significantly promoted Cyt C release from the mitochondria, but HCM pretreatment decreased Cyt C release (Fig. 4B). Furthermore, the Western blotting showed that LPS/ D-GalN administration promoted Cyt C release from mitochondria into cytosol, as evidenced by the decreased Cyt C level in the mitochondria with a corresponding increase of Cyt C level in cytosol; however, HCM pretreatment reversed these abnormal changes (Fig. 4C and D). Taken together, these findings suggest that HCM alleviates hepatocyte apoptosis more or less by improving mitochondrial function.

A2). However, numerous TUNEL-positive cells could be found in the model group (Fig. 3A3). Interestingly, HCM pretreatment significantly alleviated hepatocyte apoptosis compared with the model group (Fig. 3A4–A6). In addition, the apoptosis-related factors including Bcl2, Bax, caspase-3, caspase-8 and caspase-9 were also detected in the present study. As shown in Fig. 3B and C, administration with LPS/DGalN significantly enhanced Bax expression, whereas reduced Bcl-2 expression; moreover, LPS/D-GalN administration significantly activated caspase-3, -8 and -9. Interestingly, pretreatment with HCM significantly reversed these abnormal changes caused by LPS/D-GalN stimulation, suggesting that HCM decreases hepatocyte apoptosis by modulating the expression of the Bcl-2 family proteins and caspases’ activity.

3.3. HCM restored mitochondrial function Mitochondria function as the “central executioner”, playing a critical role in cellular apoptosis. The Bcl-2 family proteins, at least in part, bind to and interact with mitochondrial membranes, regulating cell apoptosis; and the release of cytochrome C (Cyt C) from mitochondria into cytosol activates downstream caspases and induces the apoptosis

3.4. HCM inhibited hepatic inflammatory cytokines LPS/D-GalN 4

administration

can

lead

to

accumulation

of

Biomedicine & Pharmacotherapy 119 (2019) 109435

Y. Li, et al.

Fig. 3. Pretreatment with HCM alleviated LPS/D-GalN-induced hepatocyte apoptosis. (A) Hepatocyte apoptosis was assessed by TUNEL staining (400×); A1: the normal group, A2: HCM control group, A3: LPS/D-GalN model group, A4-A6: HCM-treated groups (0.75, 1.50 and 3.00 mg/kg). The arrow indicates the TUNELpositive hepatocytes. (B) The expressions of Bcl-2 and Bax were determined by Western blotting; bands 1–6 represent the normal group, HCM control group, LPS/DGalN model group, and HCM-treated groups (0.75, 1.50 and 3.00 mg/kg), respectively. (C) Caspase-3, -8 and -9 activities were measured with the commerciallyavailable kits. #P < 0.05 VS. the normal group and *P < 0.05 VS. the LPS/D-GalN model group.

malondialdehyde (MDA) using the commercially-available kit. As shown in Fig. 5C, MDA content in the LPS/D-GalN model group was significantly increased; however, its content was effectively decreased by HCM pretreatment. In addition, the antioxidant enzymes, such as SOD, GSH-Px, GSH-Rd and catalase, were significantly reduced by LPS/ D-GalN administration, while pretreatment with HCM significantly increased their activities (Fig. 5D), suggesting that HCM restoring the anti-oxidative defense system.

inflammatory cytokines, aggravating hepatic damage. As shown in Fig. 5A, the contents of serum TNF-α, IL6 and IL-1β in the model group were significantly increased compared with those in the normal group; however, pretreatment with HCM markedly decreased these inflammatory cytokines’ contents. Similarly, the RT-PCR analysis showed that HCM significantly suppressed the mRNA transcription of these inflammatory cytokines (Fig. 5B). These data indicate that HCM inhibits inflammatory response, contributing to the treatment of LPS/DGalN-induced liver injury.

3.6. HCM reduced ROS generation 3.5. HCM alleviated lipid peroxidation and increased antioxidant enzyme activity

ROS generation was detected using Dihydroethidine hydrochloride (DHE) as a fluorescent probe. As shown in Fig. 6A, LPS/D-GalN administration significantly increased the fluorescence intensity;

In this study, lipid peroxidation was assessed by detecting hepatic 5

Biomedicine & Pharmacotherapy 119 (2019) 109435

Y. Li, et al.

Fig. 4. Pretreatment with HCM restored mitochondrial function. (A) Mitochondrial function was assessed by detecting mitochondrial membrane potential (MMP). A1: the normal group, A2: HCM control group, A3: LPS/D-GalN model group, A4-A6: HCM-treated groups (0.75, 1.50 and 3.00 mg/kg). (B) Cytochrome c (Cyt C) release from mitochondria was detected using the commercially available kit. (C and D) Cyt C expression in mitochondria and cytoplasm was detected by Western blotting; bands 1 to 6 represent the normal group, HCM control group, LPS/D-GalN model group, and HCM-treated groups (0.75, 1.50 and 3.00 mg/kg), respectively. # P < 0.05 VS. the normal group and *P < 0.05 VS. the LPS/D-GalN model group. Fig. 5. HCM pretreatment reduced inflammatory response. (A) The contents of serum TNF-α, IL6 and IL-1β were determined with the commercially-available kits. (B) RTPCR assay was used to analyze the mRNA levels of TNF-α, IL6 and IL-1β in liver tissues. (C) Lipid peroxidation was assessed by detecting hepatic malondialdehyde (MDA) content. (D)The activities of antioxidant enzymes were determined using the commercially-available kits. #P < 0.05 VS. the normal group and *P < 0.05 VS. the LPS/D-GalN model group.

6

Biomedicine & Pharmacotherapy 119 (2019) 109435

Y. Li, et al.

Fig. 6. Pretreatment with HCM reduced ROS generation. (A) ROS generation was assessed by detecting fluorescence intensity using the DHE staining. A1: the normal group, A2: HCM control group, A3: LPS/D-GalN model group, A4-A6: HCM-treated groups (0.75, 1.50 and 3.00 mg/kg). IOD: integrated optical density. (B to D) The content of NADPH and NADP+ was detected by commercially-available kits. #P < 0.05 VS. the normal group and *P < 0.05 VS. the LPS/D-GalN model group.

with high iNOS mRNA level was observed after LPS/D-GalN administration; whereas these abnormal changes were reversed by HCM pretreatment, suggesting that the hepatoprotective effect of HCM is also attributed to the inhibition of NO generation, to some extent.

however, pretreatment with HCM decreased the abnormal change of the fluorescence intensity, suggesting that ROS generation was decreased by HCM. NADP+ and NADPH play a critical role in oxidative stress. As shown in Fig. 6B–D, LPS/D-GalN administration caused higher NADP+/ NADPH ratio than that of the normal control; however, pretreatment with HCM markedly decreased the ratio with the recovery of NADPH compared with LPS/D-GalN treatment group. These data suggest that HCM alleviates ROS generation maybe by regulating the NADP+/ NADPH ratio.

3.8. HCM increased HO-1 activity Heme oxygenase 1 (HO-1), an inducible heat shock protein, can catalyze the breakdown of heme into antioxidant and anti-inflammatory agents such as biliverdin, carbon monoxide and iron, which is considered as a very important rate-limiting enzyme [25]. The expression of HO-1 is protective against inflammatory injury and subsequent organ dysfunction in LPS/D-GalN-induced acute hepatic injury in rats. Our study found that LPS/D-GalN administration led to a significant increase in the HO-1activity, which was consistent with the previous study [25]. Interestingly, the alteration of HO-1 was augmented by HCM treatment (Fig. 8A).

3.7. HCM inhibited nitric oxide (NO) generation NO is considered as a highly reactive oxidant, which is formed by catalysis of inducible nitric oxide synthase (iNOS) in the parenchymal and nonparenchymal liver cells. It has been reported that NO plays an important role in the pathological processes of liver damage such as inhibition of mitochondrial respiration, DNA synthesis and peroxynitrite formation [24]. As shown in Fig. 7A and B, increased NO content

Fig. 7. Pretreatment with HCM reduced NO generation. (A) NO generation was detected using a commercial kit. (B) The mRNA level of iNOS was detected by the RTPCR assay. #P < 0.05 VS. the normal group and *P < 0.05 VS. the LPS/D-GalN model group. 7

Biomedicine & Pharmacotherapy 119 (2019) 109435

Y. Li, et al.

Fig. 8. Pretreatment with HCM activated the Nrf2/HO-1 signaling pathway. (A) Hepatic heme oxygenase 1 (HO-1) activity was assessed using an ELISA kit. (B) The mRNA levels of Nfr2, NQO1 and GCS were detected by RT-PCR. (C and D) The protein expression of Nrf2, NQO1, HO-1 and Keap-1 was detected by Western blotting; bands 1–6 represent the normal group, HCM control group, LPS/D-GalN model group, and HCM-treated groups (0.75, 1.50 and 3.00 mg/kg), respectively. #P < 0.05 VS. the normal group and *P < 0.05 VS. the LPS/D-GalN model group.

3.9. HCM activated the Nrf2 signaling pathway

signaling pathway.

To further investigate the hepatoprotective mechanisms of HCM against LPS/D-GalN-induced acute liver injury, the Nrf2-mediated signaling pathway was evaluated. Nrf2 is a transcription factor to regulate antioxidative response, and the Nrf2-mediated pathway plays an important role in protecting the liver from various insults [26]. As shown in Fig. 8B, the transcription level of Nrf2 mRNA was elevated by LPS/DGalN administration; and this upregulation was further increased by pretreatment with HCM. Moreover, the same trend was also found in the expression of the downstream genes of NQO1 and GCS, in which NQO1 and GCS were strikingly upregulated by HCM pretreatment. Similarly, the Western blotting showed that pretreatment with HCM significantly increased the levels of Nrf2 (nucleus), NQO1 and HO-1, while markedly decreased the levels of Keap-1 and Nrf2 (cytosol) (Fig. 8C and D). Taken together, these data suggest that HCM reduces LPS/D-GalN-induced oxidative response by activating the Nrf2/HO-1

3.10. HCM inhibited NF-κB activation To investigate the anti-inflammatory mechanism of HCM, the NF-κB signaling pathway was assessed in the present study. As shown in Fig. 9, LPS/D-GalN administration markedly enhanced the NF-κB-p65 (p65) and IκBα phosphorylation; however, these abnormal changes were significantly reversed by HCM treatment (Fig. 9A). Furthermore, LPS/ D-GalN administration promoted p65 translocation from the cytosol into the nucleus, while HCM pretreatment inhibited its translocation (Fig. 9B). Additionally, LPS/D-GalN administration significantly enhanced the expressions of the upstream signaling molecules like TLR4 and MyD88; however, pretreatment with HCM significantly reversed these abnormal changes induced by LPS/D-GalN (Fig. 9C and D). Taken together, these findings suggest that HCM alleviates inflammatory response via suppression of the NF-κB signaling pathway. 8

Biomedicine & Pharmacotherapy 119 (2019) 109435

Y. Li, et al.

Fig. 9. Pretreatment with HCM inhibited the NF-κB signaling pathway. (A) HCM inhibited the phosphorylation of NF-κB (p65) and IκBα. (B) HCM decreased the cytosol p65 expression, whereas it increased the nucleus p65 expression. (C and D) HCM inhibited the expressions of the upstream signaling molecules TLR4 and MyD88. Bands 1–6 represent the normal group, HCM control group, LPS/D-GalN model group, and HCM-treated groups (0.75, 1.50 and 3.00 mg/kg), respectively. # P < 0.05 VS. the normal group and *P < 0.05 VS. the LPS/D-GalN model group.

4. Discussion

degeneration, necrosis, and neutrophil infiltration in mice; however, these abnormal changes were significantly attenuated by HCM pretreatment. Additionally, the serum aminotransferase measurement revealed a significant increase in the activities of serum AST, ALT and TBIL when exposed to LPS/D-GalN, further suggesting the serious hepatocellular injury; however, HCM pretreatment significantly decreased these enzymes’ activities. These results demonstrate that HCM can alleviate LPS/D-GalN-induced acute liver injury. Hepatocyte apoptosis is one of the crucial pathological mechanisms of LPS/D-GalN-induced acute liver injury. The content of apoptotic hepatocyte is correlated with the severity of liver injury induced by

Acute liver injury is well known as a syndrome with high morbidity and mortality. LPS/D-GalN-induced acute liver injury in mice is often used to study liver injury, which closely imitates the occurrence of liver injury in clinic [3]. D-GalN stimulation can decrease the synthesis of hepatocyte RNA and protein, leading to severe hepatotoxicity. Moreover, LPS, a primary component of Gram-negative bacteria, can aggravate the hepatotoxicity of D-GalN by generating a mass of inflammatory cytokines. In the present study, the pathological examination showed that LPS/D-GalN administration led to hepatocyte 9

Biomedicine & Pharmacotherapy 119 (2019) 109435

Y. Li, et al.

Fig. 10. HCM ameliorates LPS/D-GalN-induced acute liver injury by protecting mitochondria function, activating Nrf2 pathway and inhibiting NF-κB activation. (1) HCM protected mitochondria from damage induced by LPS/D-GalN, reducing hepatocyte apoptosis; (2) HCM promoted transferation of Nrf2 from cytosol to nucleus and then enhanced the anti-oxidative defense system, which was helpful to alleviate oxidative stress; (3) HCM inhibited the TLR4/NF-κB pathway and consequently reduced inflammatory responses.

alleviates hepatocyte apoptosis maybe by restoring the mitochondrial function and inhibiting caspases activity. It is well known that oxidative stress is involved in LPS/D-GalNinduced liver injury, which is characterized by elevated ROS production and excessive lipid peroxidation in liver tissues [34]. In this study, the results showed that HCM significantly reduced LPS/D-GalN-induced ROS generation by restoring the NADP+/NADPH ratio; and it markedly inhibited MDA production in liver tissues. Moreover, HCM also significantly reduced NO production that is a highly reactive oxidant. These results indicate that HCM can alleviate LPS/D-GalN-induced oxidative stress. In addition, antioxidant enzymes including SOD, GSHPx, GSH-Rd and catalase are involved in the antioxidant system, which can scavenge oxygen radical species and promote the degradation of hydrogen peroxide, protecting cell from oxidative damage [35]. In the present study, the significant reductions of SOD, GSH-Px, GSH-Rd and catalase were observed in the group of LPS/D-GalN administration, but these antioxidant enzymes were enhanced by HCM pretreatment. These results indicate that pretreatment with HCM alleviates LPS/D-GalNinduced liver injury more or less by suppressing oxidative stress and restoring the anti-oxidative defense system. Nrf2 is a transcription factor that plays an important role in oxidative stress. Activated Nrf2 can up-regulates the expression of cytoprotective genes and exert anti-oxidant stress, which has been considered as a critical therapeutic target for reducing oxidative stress [36]. Keap-1 can interact with Nrf2 and is a key regulator of the antioxidant response. Under the normal physiological condition, Keap-1 stably combines with Nrf2. However, under the oxidative stress condition, Nrf2 dissociates from Keap-1, and then translocates from cytoplasm into nucleus. where Nrf2 promotes antioxidant genes expression and subsequently enhances the activities of peroxiredoxins and phase II detoxification enzymes such as HO-1, NQO-1 and GCS, protecting cells from oxidative damage [37]. In this study, the transcription level of Nrf2 mRNA was elevated by HCM pretreatment, and the same trend was found in the expression of the downstream genes of NQO1 and GCS. Moreover, the Western blotting showed that HCM pretreatment significantly increased the expressions of Nrf2 (in nucleus), NQO1 and HO-1, while markedly decreased the levels of Keap-1 and Nrf2 (in cytosol). These data suggest that HCM alleviates oxidative stress by activating the Nrf2 signaling pathway. Inflammation is another essential pathogenic mechanism propagating LPS/D-GalN-induced liver injury. Previous study has illustrated

LPS/D-GalN [27]. In this study, the result of TUNEL staining showed that LPS/D-GalN administration led to excessive hepatocyte apoptosis, which was consistent with the previous study [27]. In contrast, HCM pretreatment significantly decreased the number of hepatocyte apoptosis in a dose-dependent manner, suggesting that pretreatment with HCM can ameliorate LPS/D-GalN-induced acute liver injury by reducing hepatocyte apoptosis. To investigate the underlying mechanisms of HCM on hepatocyte apoptosis, we further assessed the mitochondrial pathway, apoptosisrelated proteins and caspases activity. When mitochondria are destroyed, mitochondria membrane potential (MMP) is collapsed and mitochondrial permeability transition pore (MPTP) is opened, which cause the release of cytochrome C from mitochondria into cytosol, resulting in cell apoptosis [20]. The mitochondria-dependent apoptotic pathway can be regulated by Bcl-2 family [28]. Bax is a pro-apoptotic protein of the Bcl-2 family, which can induce MPTP opening and therefore promote cytochrome C release. On the other hand, Bcl-2, an anti-apoptotic protein of the Bcl-2 family, can reduce MPTP formation, inhibiting cytochrome C release [29]. Thus, the ratio between Bcl-2 and Bax is crucial for the regulation of mitochondrial pathway-mediated apoptosis. In addition, caspase family proteins are also involved in apoptosis, which are the principal mediators of apoptotic cell death [30]. The caspase cascade is the ultimate signaling pathway for the activation of apoptosis [30]. Among the caspase family members, caspase-3, -8 and -9 are the key nodes of the regulatory networks controlling cell apoptosis and death. Caspase-8 acts as a critical executor of apoptosis in the intracellular pathway. It can cause cytochrome C release into cytosol and trigger apoptosis [31]. Caspase-3 is a key death protease, catalyzing the specific cleavage of many key cellular proteins. Caspase-3 is indispensable for apoptotic chromatin condensation and DNA fragmentation. It has been reported that caspase-3 activation significantly induced hepatocyte apoptosis, resulting in liver injury [32]. Caspase-9 is an essential initiator caspase. Activated Caspase-9 cleaves downstream caspases such as Caspase-3, -6 and -7, initiating the caspase cascade [33]. In the present study, HCM pretreatment could protect mitochondria from dysfunction induced by LPS/D-GalN, as evidenced by the decreased level of MMP and the reduced release of cytochrome C from mitochondria into cytosol. Also, HCM pretreatment led to an increase in the expression of Bcl-2, while a remarkable decrease in Bax level. Moreover, HCM pretreatment significantly reduced the activities of caspase-3, -8, and -9. These data suggest that HCM 10

Biomedicine & Pharmacotherapy 119 (2019) 109435

Y. Li, et al.

that LPS stimulation results in massive inflammatory cytokines such as TNF-α, IL-1β and IL-6. Afterwards, these inflammatory cytokines induce inflammatory response, aggravating liver injury [38]. In this study, we found that HCM significantly inhibited LPS/D-GalN-induced TNF-α, IL-1β and IL-6 production, suggesting that HCM can alleviate inflammatory responses. It is well known that the production of inflammatory cytokines was mainly caused by the activation of NF-κB signaling pathway. Normally, NF-κB is restrained by the inhibitory IκB protein and is located in the cytoplasm. LPS/D-GalN stimulation can lead to TLR4-MyD88 activation followed by IκBα degradation, which promotes the translocation of NF- κB-p65 from cytoplasm to nucleus, leading to the over-expression of inflammatory cytokines [39]. The results of the present study showed that HCM decreased the phosphorylation of NF-κB (p65) and IκBα and inhibited NF-κB-p65 (p65) translocation from the cytosol into the nucleus. Moreover, HCM significantly inhibited the expressions of the upstream signaling molecules TLR4 and MyD88. The results suggest that HCM decreases LPS/D-GalNinduced inflammatory cytokines by inhibiting the NF-κB pathway. In conclusion, the present study demonstrates that HCM has a significant protective effect against LPS/D-GalN-induced acute liver injury in mice, which may mainly contribute to its ability to alleviate hepatocyte apoptosis by restoring the mitochondrial function, inhibit oxidative stress by activating the Nrf2 signaling pathway, and reduce inflammation via inhibiting the NF-κB pathway (Fig. 10).

[12] M. Li, S. Wang, X. Li, L. Jiang, X. Wang, R. Kou, Q. Wang, L. Xu, N. Zhao, K. Xie, Diallyl sulfide protects against lipopolysaccharide/d-galactosamine-induced acute liver injury by inhibiting oxidative stress, inflammation and apoptosis in mice, Food Chem. Toxicol. 120 (2018) 500–509. [13] Q. Huang, R. Huang, S. Zhang, J. Lin, L. Wei, M. He, L. Zhuo, X. Lin, Protective effect of genistein isolated from Hydrocotyle sibthorpioides on hepatic injury and fibrosis induced by chronic alcohol in rats, Toxicol. Lett. 217 (2) (2013) 102–110. [14] H. Misawa, W. Ohashi, K. Tomita, K. Hattori, Y. Shimada, Y. Hattori, Prostacyclin mimetics afford protection against lipopolysaccharide/d-galactosamine-induced acute liver injury in mice, Toxicol. Appl. Pharmacol. 334 (2017) 55–65. [15] J. Wan, X. Gong, L. Zhang, H. Li, Y. Zhou, Q. Zhou, Protective effect of baicalin against lipopolysaccharide/D-galactosamine-induced liver injury in mice by upregulation of heme oxygenase-1, Eur. J. Pharmacol. 587 (1) (2008) 302–308. [16] W.W. Wang, D.L. Smith, S.D. Zucker, Bilirubin inhibits iNOS expression and NO production in response to endotoxin in rats, Hepatology 40 (2) (2004) 424–433. [17] S. Kim, J. Kim, D. Lee, J. Kwak, S. Lee, Genipin protects lipopolysaccharide-induced apoptotic liver damage in D-galactosamine-sensitized mice, Eur. J. Pharmacol. 635 (1) (2010) 188–193. [18] C. Frezza, S. Cipolat, L. Scorrano, Organelle isolation: functional mitochondria from mouse liver, muscle and cultured filroblasts, Nat. Protoc. 2 (2) (2007) 287–295. [19] R.E. Brown, K.L. Jarvis, K.J. Hyland, Protein measurement using bicinchoninic acid: elimination of interfering substances, Anal. Biochem. 180 (1) (1989) 136–139. [20] X. Lin, J. Wei, Y. Chen, P. He, J. Lin, S. Tan, J. Nie, S. Lu, M. He, Z. Lu, Isoorientin from Gypsophila elegans induces apoptosis in liver cancer cells via mitochondrialmediated pathway, J. Ethnopharmacol. 187 (2016) 187–194. [21] M.R. Sepand, M.H. Ghahremani, K. Razavi‐Azarkhiavi, M. Aghsami, J. Rajabi, H. Keshavarz‐Bahaghighat, M. Soodi, Ellagic acid confers protection against gentamicin‐induced oxidative damage, mitochondrial dysfunction and apoptosis‐related nephrotoxicity, J. Pharm. Pharmacol. 68 (9) (2016) 1222–1232. [22] H. Misawa, W. Ohashi, K. Tomita, K. Hattori, Y. Shimada, Y. Hattori, Prostacyclin mimetics afford protection against lipopolysaccharide/d-galactosamine-induced acute liver injury in mice, Toxicol. Appl. Pharmacol. 334 (2017) 55–65. [23] S.A. Susin, H.K. Lorenzo, N. Zamzami, I. Marzo, B.E. Snow, G.M. Brothers, J. Mangion, E. Jacotot, P. Costantini, M. Loeffler, Molecular characterization of mitochondrial apoptosis-inducing factor, Nature 397 (6718) (1999) 441. [24] J.K. Sarady, B.S. Zuckerbraun, M. Bilban, O. Wagner, A. Usheva, F. Liu, E. Ifedigbo, R. Zamora, A.M. Choi, L.E. Otterbein, Carbon monoxide protection against endotoxic shock involves reciprocal effects on iNOS in the lung and liver, FASEB J. 18 (7) (2004) 854–856. [25] T. Wen, Z. Wu, Y. Liu, Y. Tan, F. Ren, H. Wu, Upregulation of heme oxygenase-1 with hemin prevents D-galactosamine and lipopolysaccharide-induced acute hepatic injury in rats, Toxicology 237 (1-3) (2007) 184–193. [26] A. Bataille, J. Manautou, Nrf2: a potential target for new therapeutics in liver disease, Clin. Pharmacol. Ther. 92 (3) (2012) 340–348. [27] Y. Deng, C. Chen, H. Yu, H. Diao, C. Shi, Y. Wang, G. Li, M. Shi, Oridonin ameliorates lipopolysaccharide/D-galactosamine-induced acute liver injury in mice via inhibition of apoptosis, Am. J. Transl. Res. 9 (9) (2017) 4271. [28] D. Kong, T. Zheng, M. Zhang, D. Wang, S. Du, X. Li, J. Fang, X. Cao, Static mechanical stress induces apoptosis in rat endplate chondrocytes through MAPK and mitochondria-dependent caspase activation signaling pathways, PLoS One 8 (7) (2013) e69403. [29] Y. Wang, X. Li, X. Wang, W. Lau, Y. Wang, Y. Xing, X. Zhang, X. Ma, F. Gao, Ginsenoside Rd attenuates myocardial ischemia/reperfusion injury via Akt/GSK-3β signaling and inhibition of the mitochondria-dependent apoptotic pathway, PLoS One 8 (8) (2013) e70956. [30] T. Fan, L. Han, R. Cong, J. Liang, Caspase family proteases and apoptosis, Acta Biochim. Biophys. Sin. 37 (11) (2005) 719–727. [31] G.S. Salvesen, Caspase 8: igniting the death machine, Structure 7 (10) (1999) R225–R229. [32] H. Ko, S. Joo, J. Jo, W. Park, W. Jung, J. Shin, H. Ahn, Liver-wrapping, nitric oxidereleasing nanofiber downregulates cleaved caspase-3 and bax expression on rat hepatic ischemia-reperfusion injury, Transplantation Proceedings, Elsevier, 2017, pp. 1170–1174. [33] M.L. Würstle, M.A. Laussmann, M. Rehm, The central role of initiator caspase-9 in apoptosis signal transduction and the regulation of its activation and activity on the apoptosome, Exp. Cell Res. 318 (11) (2012) 1213–1220. [34] S. Sheik Abdulazeez, D. Thiruvengadam, Effect of lycopene on oxidative stress induced during D-galactosamine/lipopolysaccharide-sensitized liver injury in rats, Pharm. Biol. 51 (12) (2013) 1592–1599. [35] T. Zeng, C.-L. Zhang, Z.-P. Zhu, L.-H. Yu, X.-L. Zhao, K.-Q. Xie, Diallyl trisulfide (DATS) effectively attenuated oxidative stress-mediated liver injury and hepatic mitochondrial dysfunction in acute ethanol-exposed mice, Toxicology 252 (1-3) (2008) 86–91. [36] J.-M. Lee, J.A. Johnson, An important role of Nrf2-ARE pathway in the cellular defense mechanism, BMB Rep. 37 (2) (2004) 139–143. [37] T. Deramaudt, C. Dill, M. Bonay, Regulation of oxidative stress by Nrf2 in the pathophysiology of infectious diseases, Médecine Mal. Infect. 43 (3) (2013) 100–107. [38] M. Ghabril, H.L. Bonkovsky, C. Kum, T. Davern, P.H. Hayashi, D.E. Kleiner, J. Serrano, J. Rochon, R.J. Fontana, M. Bonacini, Liver injury from tumor necrosis factor-α antagonists: analysis of thirty-four cases, Clin. Gastroenterol. Hepatol. 11 (5) (2013) 558–564 e3. [39] H. Pan, L.-H. Xu, D.-Y. Ouyang, Y. Wang, Q.-B. Zha, X.-F. Hou, X.-H. He, The second-generation mTOR kinase inhibitor INK128 exhibits anti-inflammatory activity in lipopolysaccharide-activated RAW 264.7 cells, Inflammation 37 (3) (2014) 756–765.

Declaration of Competing Interest The authors declare that there is no conflict of interest. Acknowledgments This study was supported by the National Natural Science Foundation of China (Nos. 81660693; 81660686; and 81873087), the Natural Science Foundation of Guangxi (2016GXNSFDA380025; 2018GXNSFDA281048; and 2018GXNSFAA281092), and the Innovation Project of Guangxi Graduate Education (YCBZ2019038). References [1] G. Xu, T. Zan, H. Li, J. Han, Z. Liu, J. Huang, L. Dong, H. Zhang, Betulin inhibits lipopolysaccharide/D-galactosamine-induced acute liver injury in mice through activating PPAR-γ, Biomed. Pharmacother. 106 (2018) 941–945. [2] M. Nowak, G.C. Gaines, J. Rosenberg, R. Minter, F. Bahjat, J. Rectenwald, S.L. MacKay, C.K. Edwards III, L.L. Moldawer, LPS-induced liver injury ind-galactosamine-sensitized mice requires secreted TNF-α and the TNF-p55 receptor, Am. J. Physiol.-Regul. Integr. Compar. Physiol. 278 (5) (2000) R1202–R1209. [3] Z. Wu, M. Han, T. Chen, W. Yan, Q. Ning, Acute liver failure: mechanisms of immune‐mediated liver injury, Liver Int. 30 (6) (2010) 782–794. [4] Q. Ma, Role of nrf2 in oxidative stress and toxicity, Annu. Rev. Pharmacol. Toxicol. 53 (2013) 401–426. [5] M. Leist, F. Gantner, I. Bohlinger, G. Tiegs, P.-G. Germann, A. Wendel, Tumor necrosis factor-induced hepatocyte apoptosis precedes liver failure in experimental murine shock models, Am. J. Pathol. 146 (5) (1995) 1220. [6] L. Li, C. Duan, Y. Zhao, X. Zhang, H. Yin, T. Wang, C. Huang, S. Liu, S. Yang, X. Li, Preventive effects of interleukin-6 in lipopolysaccharide/d-galactosamine induced acute liver injury via regulating inflammatory response in hepatic macrophages, Int. Immunopharmacol. 51 (2017) 99–106. [7] R.S. Taylor, G.N. Towers, Antibacterial constituents of the Nepalese medicinal herb, Centipeda minima, Phytochemistry 47 (4) (1998) 631–634. [8] S. Huang, C. Chiu, T. Lin, M. Lee, C. Lee, S. Chang, W. Hou, G. Huang, J. Deng, Antioxidant and anti-inflammatory activities of aqueous extract of Centipeda minima, J. Ethnopharmacol. 147 (2) (2013) 395–405. [9] X. Lin, S. Zhang, R. Huang, L. Wei, S. Tan, S. Liang, Y. Tian, X. Wu, Z. Lu, Q. Huang, Helenalin attenuates alcohol-induced hepatic fibrosis by enhancing ethanol metabolism, inhibiting oxidative stress and suppressing HSC activation, Fitoterapia 95 (2014) 203–213. [10] X. Lin, S. Zhang, R. Huang, S. Tan, S. Liang, X. Wu, L. Zhuo, Q. Huang, Protective effect of tormentic acid from Potentilla chinensis against lipopolysaccharide/Dgalactosamine induced fulminant hepatic failure in mice, Int. Immunopharmacol. 19 (2) (2014) 365–372. [11] X. Lin, S. Zhang, R. Huang, L. Wei, C. Liang, Y. Chen, Y. Tian, X. Wu, S. LV, S. Liang, X. Wu, Q. Huang, Protective effect of Genistein on lipopolysaccharide/d-galactosamine- induced hepatic failure in mice, Biol. Pharm. Bull. 37 (4) (2014) 625–632.

11