- Email: [email protected]
Hemeoxygenase 1 partly mediates the anti-inflammatory effect of dieckol in lipopolysaccharide stimulated murine macrophages
International Immunopharmacology 22 (2014) 51–58
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Hemeoxygenase 1 partly mediates the anti-inflammatory effect of dieckol in lipopolysaccharide stimulated murine macrophages Taddesse Yayeh a,1, Eun Ju Im a, Tae-Hyung Kwon b,c, Seong-Soo Roh d, Suk Kim e, Ji Hye Kim f, Seung-Bok Hong g, Jae Youl Cho f, Nyun-Ho Park b,⁎, Man Hee Rhee a,⁎⁎ a
Laboratory of Veterinary Physiology and Cell Signaling, College of Veterinary Medicine, Kyungpook National University, Daegu 702-701, Republic of Korea Department of Research & Development, Gyeongbuk Institute for Marine Bio-Industry, Uljin 767-813, Republic of Korea Food Science and Biotechnology Major, Andong National University, Andong 760-749, Republic of Korea d Department of Herbology, College of Korean Medicine, Daegu Haany University, Gyeongsan 712-715, Republic of Korea e Department of Veterinary Medicine, College of Veterinary Medicine, Gyeongsang National University, Jinju 660-701, Republic of Korea f Department of Genetic Engineering, Sungkyunkwan University, Suwon 440-746, Republic of Korea g Department of Clinical Laboratory Science, Chungbuk Health and Science University, Chungbuk 363-794, Republic of Korea b c
a r t i c l e
i n f o
Article history: Received 18 February 2014 Received in revised form 12 May 2014 Accepted 6 June 2014 Available online 19 June 2014 Keywords: Dieckol HO-1 Inflammation Murine macrophages
a b s t r a c t Eisenia bicyclis is edible brown algae recognized as a rich source of bioactive derivatives mainly phlorotannins reported for their anti-oxidant properties. Of all phlorotannins identified so far, dieckol has shown the most potent effect in anti-inflammatory, radical scavenging and neuroprotective functions. However, whether dieckol up-regulates hemeoxygenase 1 (HO-1) and this mediates its anti-inflammatory effect in murine macrophages remains poorly understood. Dieckol (12.5–50 μM) inhibited nitric oxide production and attenuated inducible nitric oxide synthase, phospho (p)-PI-3 K, p-Akt, p-IKK-α/β, p-IκB-α and nuclear p-NF-κBp65 protein expressions, and NF-κB transcriptional activity in LPS (0.1 μg/ml) stimulated murine macrophages. On the other hand, dieckol up-regulated HO-1which partly mediated its anti-inflammatory effect in murine macrophages. Thus, dieckol appeared to be a potential therapeutic agent against inflammation through HO-1 up-regulation. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Macrophages are the sentinels of innate immune system for sensing, integrating, and appropriately responding to a wide array of stimuli [1]. Lipoplysacchride (LPS) activates macrophage toll like receptor 4 (TLR4) to transduce inflammatory signaling cascade in cells [2,3] that leads to the activation of mitogen activated protein kinase (MAPK), phosphoinositide 3 kinase (PI-3 K)/Akt and NF-κB signaling pathways [4,5]. PI-3 K/Akt signaling converges at inhibitory kappa B kinase, IKK, activation in the NF-κB pathway [6]. IKK then ubiqutinates and degrades inhibitory kappa B alpha (IκB-α) to unleash nuclear factor kappa B (NF-κB) for nuclear translocation and transcription of target genes
⁎ Corresponding author. Tel.: +82 54 780 3452; fax: +82 54 780 3455. ⁎⁎ Correspondence to: M.H. Rhee, Laboratory of Veterinary Physiology & Signaling, College of Veterinary Medicine, Kyungpook National University, Daegu 702-701, Republic of Korea. Tel.: +82 53 950 5967; fax: +82 53 950 5955. E-mail addresses: [email protected] (N.-H. Park), [email protected] (M.H. Rhee). 1 Present address: Debre Markos University, Debre Markos, Ethiopia.
http://dx.doi.org/10.1016/j.intimp.2014.06.009 1567-5769/© 2014 Elsevier B.V. All rights reserved.
[7,8] such as inducible nitric oxide synthase [9], cyclooxyginase 2 (COX-2), tumor necrotic factor (TNF)-α, interleukin (IL)-1β and IL-6 [10]. The inducible isoform of nitric oxide synthase produces huge nitric oxide (NO) that is cytotoxic [11]. Cells respond to such oxidative agents through various ways including the expression of phase II anti-oxidant enzymes. Hemeoxygenase 1 (HO-1) is a phase II anti-oxidant that converts the proxidant heme into valuable substances like bilirubin (anti-oxidant) and carbon monoxide (anti-inflammatory). HO-1 gene expression is highly inducible by various stimuli and it involves multiple signaling pathways. It has been suggested that pharmacologic induction of HO-1 protects cells against physical, chemical and biological stress [12,13]. In this regard, phytotherapeutic agents that upregulated HO-1 have also shown protection against oxidative stress [14]. Recently, efforts have been made to isolate and characterize biologically active components from seaweeds. In this regard, the marine brown algae Eisenia bicyclis, Eisenia arborea, Ecklonia stolinifera and Ecklonia cava have been reported for their diverse phlorotannins [15, 16] which are biologically active components [17]. E. bicyclis, edible seaweed, is recognized as a rich source of dieckol (phlorotannin) with anti-oxidant effects [18]. Dieckol has shown anti-inflammatory,
52
T. Yayeh et al. / International Immunopharmacology 22 (2014) 51–58
2. Material and methods 2.1. Materials Dulbecco's modified Eagle's medium (DMEM) [Daegu, Korea]; fetal bovine serum (FBS) (WelGene Co., Korea); streptomycin and penicillin (Lonza, MD, USA); TRI reagent® solution (AM9738, applied biosystems, Ambion); oligodT (Bioneer oligo synthesis); SYBER® green master mix (Warrington, UK); iNOS, COX-2, TNF-α and IL-1β primers were obtained from Bioneer; total protein lysis buffer (PRO-PREP) [iNtRON Biotechnology]; PROMEASURE assay kit (iNtRON Biotechnology); LPS (Escherichia coli 055:B5) and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) and tin protoporphyrin IX (SnPP), were purchased from Sigma. Specific antibodies used against phospho- and/or total form of ERK, JNK, p38, IKK α/β, IκB, NFκBp65, PI-3 K, Akt, PARP, iNOS, COX-2, HO-1, β-actin and rabbit HRP linked antibody were purchased from Cell Signaling Technology. All other reagents and chemicals were obtained from sigma Aldrich. 2.2. Extraction and isolation of dieckol
Fig. 1. The chemical structure of dieckol.
anti-adipogenic, anti-cancer, anti-diabetic, anti-myeloperoxidase, hepatoprotective, and free radical scavenging activities [15,19–22]. However, the anti-inflammatory mediator of dieckol in murine macrophages is poorly understood. Here, therefore, we reported that dieckol (12.5– 50 μM) inhibited NO production via PI-3 K/Akt and NF-κB signaling pathways in RAW264.7 cells and this effect was partly mediated by HO-1.
*
*
*
Dieckol (µM) basal
LPS
12.5
25
Cell viability in %
B
Nitrite production (µM)
A
Marine brown alga E. bicyclis collected from Ulleung Island, Korea was lyophilized (Ilshin, Gyeonggi, Korea) and pulverized to powder (hanil, FM-909 T©). The dried sample (1.3 kg) was then subjected for 80% methanolic (MeOH) extraction in an accelerated solvent extraction (ASE) method [Dionex model ASER 350 (Dionex Corporation, Sunnyvale, CA94085, made in USA)] with working conditions (temperature, 80 °C; purge time, 900 s; heating, 5 min; static time, 5 min). The extract was evaporated at 50 °C and then dried in a vacuum oven (40 °C) to obtain MeOH extract which was partitioned into ethyl acetate. The ethyl acetate fraction was mixed with celite, dried and packed into a glass column in order to elute with hexane, methylene chloride, diethyl ether, and methanol consecutively. The
50
basal
LPS
12.5
LPS (0.1µg/ml)
D
100
140
30
120
25 20 15
* *
10
Cell viability in %
Nitrite production (µM)
50
LPS (0.1µg/ml)
C
100 80 60 40 20
5
0
0 Dieckol (µM) basal
25
LPS
12.5
25
LPS (0.1µg/ml)
50
basal
LPS
12.5
25
50
100
LPS (0.1µg/ml)
Fig. 2. Dieckol inhibited NO production in murine macrophages. RAW264.7 cells and peritoneal macrophages were pre-treated with dieckol (12.5–100 μM) and incubated with or without LPS for 18 h to measure the amount of NO release and check cytotoxicity of the compound in RAW264.7 cells (A, B) and peritoneal macrophages (C, D), as described in the Materials and methods section. Values were the means ± SEM of triplicates from separate experiments. *P b 0.05 shows relative to the LPS treated group.
T. Yayeh et al. / International Immunopharmacology 22 (2014) 51–58
diethyl ether fraction was subjected to Sephadex LH-20 column chromatography using stepwise gradient chloroform/methanol solvent systems. After further purification using the HPLC system, dieckol (10 mg) was obtained and its structure was determined by NMR as shown in Fig. 1. 2.3. Cell culture RAW264.7 and BV-2 cells were cultured and maintained in Dulbecco's modified Eagle's medium enriched with 10% heatinactivated fetal bovine serum, 100 μg/ml streptomycin and 100 U/ml penicillin in 5% CO2 at 37 °C humidified atmosphere. Moreover, peritoneal macrophages were isolated from BALB/c as described by Zhang [23] and cultured using DMEM/F12-10 medium. 2.4. Nitric oxide and cell viability assay Cultured RAW264.7 cells (4 × 105) and peritoneal macrophages were pre-treated with or without dieckol (12.5–50 μM) for 30 min and then stimulated with LPS (0.1 μg/ml) for 18 h in a 96 well plate. NO and cell viability assays were performed as indicated previously [24]. Briefly, the culture supernatant (100 μl) was mixed with an equal volume of Griess reagent and incubated for 10 min at room temperature to determine nitrite accumulation. Cells left after NO assay were immediately incubated with MTT (0.5 mg/ml) reagent for 3 h and formazone precipitates were solubilized by DMSO (150 μl) for plate reading at 540 nm. 2.5. RNA isolation and real time polymerase chain reaction RNA isolation, cDNA preparation and real time PCR were performed as indicated earlier [25]. Briefly, total RNA was isolated using TRI reagent® solution and then reverse transcribed in a commercially available reverse transcriptase pre-mix at 42 °C for 90 min with final reverse
2.6. Western blotting RAW264.7 cells were treated or left untreated with dieckol (12.5– 50 μM) in the presence or absence of LPS (0.1 μg/ml). Cytosolic and nuclear proteins were extracted according to the instructions of NE-PER® Nuclear and cytosolic extraction reagents (Thermo scientific, #78833 & #78835). Total protein extraction, SDS-PAGE, immunoblotting and antibody binding were performed as described previously [25]. Bound antibodies were visualized using enhanced chemiluminescence (Supex) and images were analyzed using ImageJ software. 2.7. Transient transfection and luciferase assay BV-2 cells were cultured in 24 well plates for one day and then transfected in triplicate with TK-renilla (pRL-TK) and NF-κB firefly luciferase (pNFκB-Luc) constructs both obtained from Dr. Oh Byung Chul (Harvard University) using lipofectamine™ 2000 according to the manufacturer's instructions. Briefly, transfected cells were pretreated with dieckol (12.5–50 μM) for 30 min before LPS stimulation for 6 h. Next, cells were washed twice with ice cold PBS and 150 μl of 1x passive lysis buffer was added. After centrifugation at 12,000 ×g for 5 min at 4 °C, 10 μl aliquot of supernatant was analyzed using Glomax luminometer (promega). The NF-κB luciferase activity was measured using luciferase
B.
Normalized mRNA expression
iNOS
*
* *
Dieckol (µM)
transcripitase inactivation. Real time PCR was performed in CFX96TM Real-Time System using power SYBER® green master mix and primers of iNOS: Forward GGAGCCTTTAGACCTCAACAGA, Reverse TGAACGAG GAGGGTGGTG; COX-2: Forward GGGAGTCTGGAACATTGTGAA, Reverse GCACATTGTAAGTAGGTGGACTGT; TNF-α: Forward TGCCTATGTCTCAG CCTCTTC, Reverse GAGGCCATTTGGGAACTTCT; IL-1β: Forward CAAC CAACAAGTGATATTCTCCATG, Reverse GATCCACACTCTCCAGCTGCA; GAPDH: Forward CAATGAATACGGCTACAGCAAC, Reverse AGGGAGAT GCTCAGTGTTGG. Normalized fold expression (ΔΔCT) was calculated relative to the control.
-
LPS
12.5
25
COX-2
Normalized mRNA expression
A.
* * *
-
50
LPS
LPS (0.1µg/ml)
C.
53
12.5
25
50
LPS (0.1µg/ml)
D.
IL-1β
Dieckol (µM)
*
basal
LPS
12.5
*
*
25
50
LPS (0.1µg/ml)
Normalized mRNA expression
Normalized mRNA expression
TNF-α
basal
LPS
12.5
*
*
25
50
LPS (0.1µg/ml)
Fig. 3. Dieckol attenuated mRNA expressions of proinflammatory mediators. Cells were pre-treated with dieckol (12.5–50 μM) for 30 min and then stimulated with LPS for 18 h. RNA was isolated and reverse transcribed into cDNA for mRNA expression of iNOS (A) and COX-2 (B), IL-1β (C) and TNF-α (D). Values were mean ± SEM from triplicates of independent experiments. *P b 0.05 v LPS control group.
54
T. Yayeh et al. / International Immunopharmacology 22 (2014) 51–58
assay system according to the manufacturer's instructions. Luciferase activity was normalized to TK renilla. For HO-1 siRNA (sense CAC CAA GGA GGU ACA CAU C; anti-sense GAU GUG UAC CUC CUU GGU G) transfection, BV-2 cells were cultured in a 60 mm plate without penicillin/ streptomycin for 24 h and then transfected using lipofectamin 2000. Nitrite production was determined as described above.
2.9. Data analysis The results were presented as mean ± standard error of the mean. One way analysis of variance followed by Dunnett's test was used for statistical analysis. P values less than 0.05 were considered as statistically significant.
B.
A. iNOS
iNOS COX-2 β- actin
β- actin
14
iNOS/β-action ratio
iNOS/β-action ratio
12 10 8 6 4 2
* Dieckol (µM) LPS (0.1µg/ml)
-
-
-
12.5
+
25
+
+
C.
50
0 Dieckol (µM)
-
-
25
50
+
LPS (0.1µg/ml) -
+
+
+
D. HO-1
HO-1 β- actin *
HO-1/β- actin ratio
Dieckol (50 µM)
HO-1/β- actin ratio
β- actin
*
0
12
24
h
Dieckol (µM)
-
12.5
Hemin (µM)
-
-
25
50
-
-
-
25
E. HO-1 β- actin HO-1/β-action ratio
1.2 1.0 0.8 0.6
0.4 0.2 0
Dieckol (µM)
-
12.5
25
50
Fig. 4. The effect of dieckol on iNOS, COX-2 and HO-1 protein expressions. RAW264.7 cells and peritoneal macrophages were pretreated with dieckol (12.5–50 μM) and then stimulated with LPS (0.1 μg/ml) for 24 h to determine iNOS and COX-2 protein expression in RAW264.7 cells (A) and peritoneal macrophages (B). Cells were also pretreated with dieckol alone to determine HO-1 protein expression in RAW264.7 cells (C, D) and peritoneal macrophages (E). Images were representative of three independent experiments.
T. Yayeh et al. / International Immunopharmacology 22 (2014) 51–58
3. Results
55
considerable therapeutic merit. Hence, we determined if LPS induced NO release in RAW264.7 cells and peritoneal macrophages could be modulated by pretreatment of dieckol dissolved in DMSO (b 0.1%). We found that dieckol (12.5–50 μM) attenuated the release of excess NO without any detectable cytotoxicity in RAW264.7 cells (Fig. 2A, B) and peritoneal macrophages (Fig. 2C, D); however, cellular injury levels of 20% or more were noticed if the concentration of dieckol exceeded 50 μM.
3.1. Dieckol inhibited LPS induced overproduction of NO in RAW264.7 cells and peritoneal macrophages Because NO overproduction is linked to a number of pathologies [26,27]; agents that modulate the activity of this radical have
A.
B.
Nitrite production in µM
iNOS
iNOS/β- actin ratio
β-actin
*
LPS (0.1µg/ml)
-
+
+
+
+
Dieckol (50 µM)
-
-
+
+
-
-
-
-
+
+
SnPP (20 µM)
Nitrite production in µM
C.
LPS (0.1µg/ml) -
+
+
+
+
Dieckol (50 µM) -
-
+
+
-
SnPP (20 µM) -
-
-
+
+
60
* *
*
+ + 40
+ + 60
40 * 20
0 LPS (0.1μg/ml) Dieckol (50μM) SnPP (μM)
Nitrite production in µM
D.
-
+ -
+ + -
+ + 20
+ + 80
+ 20
+ 40
+ 60
+ 80
Untransfected Scrambled siRNA siRNA HO-1
40 30 20 10
0 LPS (0.1μg/ml)
-
+
+
+
Dieckol (μM)
-
-
12.5
25
Fig. 5. The effect of HO-1 siRNA transfection and SnPP inhibitor on NO release and iNOS expression. RAW264.7 cells were pretreated with HO-1 inhibitor (SnPP, 20–80 μM) for 1 h and dieckol (50 μM) for 30 min and then stimulated by LPS (0.1 μg/ml) for 18 h. NO production (A, C) and iNOS protein expression (B) were evaluated. BV-2 cells were also cultured and transfected with HO-1 siRNA using lipofectamin 2000 to determine NO production (D). *P b 0.05 shows statistical significance.
56
T. Yayeh et al. / International Immunopharmacology 22 (2014) 51–58
3.2. The effect of dieckol on iNOS and HO-1 protein expressions in LPS stimulated murine macrophages Under basal conditions, macrophages are unable to exhibit iNOS protein expression; however, its intracellular expression increases when cells are exposed to inflammatory agents such as LPS. To this end, we investigated if LPS induced iNOS mRNA and protein expressions were attenuated by pretreatment of dieckol. We found that dieckol (12.5– 50 μM) inhibited iNOS and COX-2 mRNA expression (Fig. 3A, B). While dieckol attenuated protein expression of iNOS which was markedly abrogated at 50 μM in both RAW264.7 cells (Fig. 4A) and peritoneal macrophages (Fig. 4B), COX-2 protein expression was unaffected. Dieckol also
A.
inhibited mRNA expression of IL-1β and TNF-α cytokines (Fig. 3C, D). On the other hand, dieckol up-regulated HO-1 protein expression (Fig. 4C) with a pronounced up-regulation at 12 h when 50 μM was used at two time points. Likewise, dieckol enhanced HO-1 protein expression dose dependently in RAW264.7 cells and peritoneal macrophages (Fig. 4D–E). 3.3. HO-1 partially mediated the inhibitory effect of dieckol on NO production in murine macrophages Given the anti-inflammatory nature of HO-1 catalytic products (bilirubin and CO), we determined whether HO-1, induced by dieckol,
B.
p- IKKα/β
p- NFκB p65
p-IκB-α
PARP
nuclear
P-NFκBp65/PARP ratio
Total-IκB-α
Density ratio
β- actin
* * *
Dieckol (µM) LPS (0.1µg/ml) *
Dieckol (µM)
-
-
12.5
25
50
-
+
+
+
+
0
30
60
12.5 +
25 +
50 +
*
LPS (0.1µg/ml)
C.
+
time (min)
D. p-P38
p-PI-3K
Total -P38
Total- PI-3K
p-Akt
p-ERK
Total-Akt Total -ERK
Density ratio
p-JNK
Total-JNK *
Dieckol (µM)
-
-
12.5
25
50
LPS (0.1µg/ml) -
+
+
+
+
* LPS (0.1µg/ml)
-
+
+
+
+
Dieckol (10 µM)
-
-
+
-
+
Fig. 6. The effect of dieckol on NF-κB, PI-3 K/Akt and MAPK proteins. Cells were pretreated with dieckol (12.5–50 μM) and then stimulated with LPS (0.1 μg/ml) for 30 min to determine p-IKK-α/β, and IκB-α (A); p-NF-κBp65, (C) PI-3 K/Akt (B); p38, ERK, JNK (D, E). Images represented independent experiments.
T. Yayeh et al. / International Immunopharmacology 22 (2014) 51–58
Relative NF-κB luciferase activity
E.
57
p- ERK
Total -ERK
p-p38 Total -p38
β- actin
Dieckol (µM)
* *
* basal
LPS
12.5
25
50
Density ratio relative to β - actin
LPS (0.1µg/ml)
Dieckol (50 µM)
Fig. 7. The effect of dieckol on NF-κB luci reporter expression in BV-2 cells. BV-2 cells were transfected with NF-κB luci reporter plasmid using lipofectamine 2000 according to manufacturer's instructions and then cells were pretreated with dieckol (12.5– 50 μM) for 30 min before LPS (0.1 μg/ml) stimulation for 6 h. Luciferase activity was performed using a luminometer. Results represent triplicate of independent experiments. *P b 0.05 v LPS control group.
ease of transfection over RAW264.7 cells. Transfected BV-2 cells were pretreated with dieckol (12.5–50 μM) for 30 min and then stimulated with LPS (0.1 μg/ml) for 6 h. Dieckol dose dependently inhibited LPS induced NF-κB transcriptional activity in BV-2 cells (Fig. 7). 0
5
15
30
60
120
min
Fig. 6 (continued).
impaired NO production and suppressed iNOS expression in LPS stimulated RAW264.7 cells. Dieckol at 50 μM strongly inhibited NO release and totally abrogated iNOS protein expression (Fig. 5A, B) both of which were partially reversed by HO-1 inhibitor (SnPP, 20 μM). We also used safe concentrations of SnPP (20–80 μM) and HO-1siRNA transfection to verify the anti-inflammatory effect of dieckol. Both SnPP pretreatment and HO-1siRNA transfection reversed NO production that was inhibited by dieckol pretreatment (Fig. 5C, D), indicating that the anti-inflammatory effect of dieckol could be partly mediated by HO-1. 3.4. Dieckol attenuated NF-κB and PI-3 K/Akt signaling pathways in LPS stimulated RAW264.7 cells NF-κB, MAPK and PI-3 K/Akt cellular signaling pathways have been frequently involved in LPS triggered inflammation [28,29]. Here therefore we examined if PI-3 K/Akt, NF-κB and/or MAPK signaling pathways were modulated by pretreatment of dieckol at the range of concentrations used (12.5–50 μM). Dieckol attenuated the expressions of phospho (p), p-IKK α/β and p- IκB-α (Fig. 6A) and impaired nuclear expression of p-NF-κBp65 (Fig. 6B) in LPS stimulated cells. Likewise, p-PI-3 K and p-Akt protein expressions were shown to be inhibited at 60 min of LPS stimulation (Fig. 6C); however, neither the expression of p-p38, p-JNK, nor p-ERK was inhibited (Fig. 6D). Instead, treatment with dieckol alone increased the expression level of p-ERK and p-p38 (Fig. 6E). 3.5. Dieckol downregulated NF-κB transcriptional activity in BV-2 cells Transcriptional activity of NF-κB is a prerequisite for the expression of various proinflammatory mediators including iNOS and COX-2. Here therefore we evaluated the effect of dieckol on LPS-stimulated NF-κBdependent reporter gene expression in BV-2 cells using their potential
4. Discussion Seaweeds have long history as traditional cosmetics and herbal medicine in the treatments of various ailments, yet little is known about their anti-inflammatory role under experimental conditions. In recent years, therefore, attempts have been made to explore the potential role of extracts from various seaweeds against cellular oxidation and inflammation [30,31]. For instance, phlorotannins extracted from brown algae showed potent anti-oxidant and anti-inflammatory properties in vitro cellular systems where dieckol accounted for the major part of cytoprotective action [32,33]. Jung et al. also portrayed the neuroprotective effect of dieckol and its molecular mechanism of actions in microglia at relatively higher concentrations [34]; however, whether this cytoprotective effect was mediated by HO-1 at relatively safer concentrations remained to be defined. In this study, therefore, we geared to investigate whether dieckol mediates anti-inflammatory effect through HO-1 expression in LPS stimulated murine macrophage RAW264.7 cells. Dieckol attenuated NO production without any visible cytotoxicity in the range of concentrations used (Fig. 2A–D) and this effect could be emanated from its inhibitory effect on iNOS (Fig. 4A, B) and/or its NO scavenging capabilities [15,31]. It is interesting that dieckol upregulated HO-1 protein expression (Fig. 4C–E) that could be signaled through p38MAPK and ERK pathways (Fig. 6E) as these pathways have been identified for HO-1 induction [35]. HO-1 partly contributed its suppressive action on iNOS protein expression thereby inhibited NO production which was demonstrated using HO-1 inhibitor, SnPP (Fig. 5A–C) and HO-1siRNA transfection (Fig. 5D). We speculated that the catalytic products of heme (CO and bilirubin) may explain HO-1 mediated NF-κB inhibition (Fig. 6), repression of iNOS, COX-2, IL-1β and TNF-α mRNA expressions (Fig. 3A) as well as reduced luciferase reporter activity (Fig. 7). While dieckol impaired the mRNA expression of COX-2, its protein expression was unaffected. This could be explained by post-translational modifications of proteins [36]. Dieckol also inhibited PI-3 K/Akt signaling which in turn attenuates the NF-κB pathway (Fig. 6A & B). This specific action of dieckol on NF-κB signaling in RAW264.7 cells could also be supported by similar observations made on fibrosarcoma cell line [37]. On the other hand, dieckol was reported for its anti-inflammatory action in BV-2 cells via p38 MAPK and NF-κB pathways [34], reflecting that the molecular action of dieckol may
58
T. Yayeh et al. / International Immunopharmacology 22 (2014) 51–58
vary depending on the concentration and cell type used. Despite this, the current cytoprotective effect of dieckol agrees with its neuroprotective function reported previously. In conclusion, dieckol at relatively lower and safer concentrations attenuated NO release and iNOS expression in murine macrophages. This suppressive effect of dieckol on NO and iNOS could be emanated from the diminished activity of PI-3 K/Akt and NF-κB signaling cascades modulated partly by HO-1. Thus, dieckol derived from brown algae appears to be a potentially indispensable natural compound to fight against the rampant cellular oxidation and inflammation through HO-1 up-regulation.
References [1] Odegaard JI, Chawla A. Alternative macrophage activation and metabolism. Annu Rev Pathol 2011;6:275–97. [2] Trent MS, Stead CM, Tran AX, Hankins JV. Diversity of endotoxin and its impact on pathogenesis. J Endotoxin Res 2006;12:205–23. [3] Wang X, Quinn PJ. Lipopolysaccharide: biosynthetic pathway and structure modification. Prog Lipid Res 2010;49:97–107. [4] West AP, Koblansky AA, Ghosh S. Recognition and signaling by toll-like receptors. Annu Rev Cell Dev Biol 2006;22:409–37. [5] Dunne A, O'Neill LA. The interleukin-1 receptor/Toll-like receptor superfamily: signal transduction during inflammation and host defense. Sci STKE 2003;2003:re3. [6] Vanhaesebroeck B, Guillermet-Guibert J, Graupera M, Bilanges B. The emerging mechanisms of isoform-specific PI3K signalling. Nat Rev Mol Cell Biol 2010;11:329–41. [7] Perkins ND. Integrating cell-signalling pathways with NF-kappaB and IKK function. Nat Rev Mol Cell Biol 2007;8:49–62. [8] Bode JG, Ehlting C, Haussinger D. The macrophage response towards LPS and its control through the p38(MAPK)-STAT3 axis. Cell Signal 2012;24:1185–94. [9] Ashenagar MS, Tabuchi M, Kinoshita K, Ooshima K, Niwa A, Watanabe Y, et al. Gene expression in the adrenal glands of three spontaneously hypertensive rat substrains. Mol Med Rep 2010;3:213–22. [10] Hacker H, Karin M. Regulation and function of IKK and IKK-related kinases. Sci STKE 2006;2006:re13. [11] Aktan F. iNOS-mediated nitric oxide production and its regulation. Life Sci 2004; 75:639–53. [12] Prawan A, Kundu JK, Surh YJ. Molecular basis of heme oxygenase-1 induction: implications for chemoprevention and chemoprotection. Antioxid Redox Signal 2005;7:1688–703. [13] Ryter SW, Alam J, Choi AM. Heme oxygenase-1/carbon monoxide: from basic science to therapeutic applications. Physiol Rev 2006;86:583–650. [14] Yang H, Lee SE, Jeong S, Park CS, Jin YH, Park YS. Up-regulation of heme oxygenase-1 by Korean red ginseng water extract as a cytoprotective effect in human endothelial cells. J Ginseng Res 2011;35:352–9. [15] Li Y, Qian ZJ, Ryu B, Lee SH, Kim MM, Kim SK. Chemical components and its antioxidant properties in vitro: an edible marine brown alga, Ecklonia cava. Bioorg Med Chem 2009;17:1963–73. [16] Li Y-X, Wijesekara I, Li Y, Kim S-K. Phlorotannins as bioactive agents from brown algae. Process Biochem 2011;46:2219–24. [17] Thomas NV, Kim SK. Potential pharmacological applications of polyphenolic derivatives from marine brown algae. Environ Toxicol Pharmacol 2011;32:325–35.
[18] Kwon TH, Kim TW, Kim CG, Park NH. Antioxidant activity of various solvent fractions from edible brown alga, Eisenia bicyclis and its active compounds. J Food Sci 2013;78:C679–84. [19] Choi HJ, Park JH, Lee BH, Chee HY, Lee KB, Oh SM. Suppression of NF-kappaB by dieckol extracted from ecklonia cava negatively regulates LPS induction of inducible nitric oxide synthase gene. Appl Biochem Biotechnol 2014;173:957–67. [20] Jung HA, Jung HJ, Jeong HY, Kwon HJ, Ali MY, Choi JS. Phlorotannins isolated from the edible brown alga Ecklonia stolonifera exert anti-adipogenic activity on 3 T3-L1 adipocytes by downregulating C/EBPalpha and PPARgamma. Fitoterapia 2014;92:260–9. [21] Kang MC, Kang SM, Ahn G, Kim KN, Kang N, Samarakoon KW, et al. Protective effect of a marine polyphenol, dieckol against carbon tetrachloride-induced acute liver damage in mouse. Environ Toxicol Pharmacol 2013;35:517–23. [22] Yoon JS, Kasin Yadunandam A, Kim SJ, Woo HC, Kim HR, Kim GD. Dieckol, isolated from Ecklonia stolonifera, induces apoptosis in human hepatocellular carcinoma Hep3B cells. J Nat Med 2013;67:519–27. [23] Zhang X, Goncalves R, Mosser DM. The isolation and characterization of murine macrophages. Curr Protoc Immunol 2008;83:14.1.1–14.1.14. [24] Yayeh T, Jung KH, Jeong HY, Park JH, Song YB, Kwak YS, Kang HS, Cho JY, Oh JW, Kim SK, Rhee MH. Korean red ginseng saponin fraction downregulates proinflammatory mediators in LPS stimulated RAW264.7 cells and protects mice against endotoxic shock. J Ginseng Res 2012;36:263–9. [25] Yayeh T, Hong M, Jia Q, Lee YC, Kim HJ, Hyun E, et al. Pistacia chinensis inhibits NO production and upregulates HO-1 induction via PI-3 K/Akt pathway in LPS stimulated macrophage cells. Am J Chin Med 2012;40:1085–97. [26] Knott AB, Bossy-Wetzel E. Nitric oxide in health and disease of the nervous system. Antioxid Redox Signal 2009;11:541–54. [27] Knott AB, Bossy-Wetzel E. Impact of nitric oxide on metabolism in health and agerelated disease. Diabetes Obes Metab 2010;12(suppl 2):126–33. [28] Kyriakis JM, Avruch J. Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol Rev 2001; 81:807–69. [29] Bakkar N, Guttridge DC. NF-kappaB signaling: a tale of two pathways in skeletal myogenesis. Physiol Rev 2010;90:495–511. [30] Yang EJ, Moon JY, Kim MJ, Kim DS, Kim CS, Lee WJ, et al. Inhibitory effect of Jeju endemic seaweeds on the production of pro-inflammatory mediators in mouse macrophage cell line RAW 264.7. J Zhejiang Univ Sci B 2010;11:315–22. [31] Lopes G, Sousa C, Silva LR, Pinto E, Andrade PB, Bernardo J, et al. Can phlorotannins purified extracts constitute a novel pharmacological alternative for microbial infections with associated inflammatory conditions? PLoS One 2012;7:e31145. [32] Yotsu-Yamahita M, Kondo S, Segawa S, Lin YC, Toyohara H, Ito H, et al. Isolation and structural determination of two novel phlorotannins from the brown alga Ecklonia kurome Okamura, and their radical scavenging activities. Mar Drugs 2013;11:165–83. [33] Kim AR, Shin T-S, Lee M-S, Park J-Y, Park K-E, Yoon N-Y, et al. Isolation and identification of phlorotannins from Ecklonia stolonifera with antioxidant and antiinflammatory properties. J Agric Food Chem 2009;57:3483–9. [34] Jung WK, Heo SJ, Jeon YJ, Lee CM, Park YM, Byun HG, et al. Inhibitory effects and molecular mechanism of dieckol isolated from marine brown alga on COX-2 and iNOS in microglial cells. J Agric Food Chem 2009;57:4439–46. [35] Ferrandiz ML, Devesa I. Inducers of heme oxygenase-1. Curr Pharm Des 2008; 14:473–86. [36] Espiritu MJ, Cabalteja CC, Sugai CK, Bingham JP. Incorporation of post-translational modified amino acids as an approach to increase both chemical and biological diversity of conotoxins and conopeptides. Amino Acids 2014;46:125–51. [37] Zhang C, Li Y, Qian ZJ, Lee SH, Li YX, Kim SK. Dieckol from Ecklonia cava regulates invasion of human fibrosarcoma cells and modulates MMP-2 and MMP-9 expression via NF-kappaB pathway. Evid Based Complement Altern Med 2011;2011:140462.
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Hemeoxygenase 1 partly mediates the anti-inflammatory effect of dieckol in lipopolysaccharide stimulated murine macrophages Taddesse Yayeh a,1, Eun Ju Im a, Tae-Hyung Kwon b,c, Seong-Soo Roh d, Suk Kim e, Ji Hye Kim f, Seung-Bok Hong g, Jae Youl Cho f, Nyun-Ho Park b,⁎, Man Hee Rhee a,⁎⁎ a
Laboratory of Veterinary Physiology and Cell Signaling, College of Veterinary Medicine, Kyungpook National University, Daegu 702-701, Republic of Korea Department of Research & Development, Gyeongbuk Institute for Marine Bio-Industry, Uljin 767-813, Republic of Korea Food Science and Biotechnology Major, Andong National University, Andong 760-749, Republic of Korea d Department of Herbology, College of Korean Medicine, Daegu Haany University, Gyeongsan 712-715, Republic of Korea e Department of Veterinary Medicine, College of Veterinary Medicine, Gyeongsang National University, Jinju 660-701, Republic of Korea f Department of Genetic Engineering, Sungkyunkwan University, Suwon 440-746, Republic of Korea g Department of Clinical Laboratory Science, Chungbuk Health and Science University, Chungbuk 363-794, Republic of Korea b c
a r t i c l e
i n f o
Article history: Received 18 February 2014 Received in revised form 12 May 2014 Accepted 6 June 2014 Available online 19 June 2014 Keywords: Dieckol HO-1 Inflammation Murine macrophages
a b s t r a c t Eisenia bicyclis is edible brown algae recognized as a rich source of bioactive derivatives mainly phlorotannins reported for their anti-oxidant properties. Of all phlorotannins identified so far, dieckol has shown the most potent effect in anti-inflammatory, radical scavenging and neuroprotective functions. However, whether dieckol up-regulates hemeoxygenase 1 (HO-1) and this mediates its anti-inflammatory effect in murine macrophages remains poorly understood. Dieckol (12.5–50 μM) inhibited nitric oxide production and attenuated inducible nitric oxide synthase, phospho (p)-PI-3 K, p-Akt, p-IKK-α/β, p-IκB-α and nuclear p-NF-κBp65 protein expressions, and NF-κB transcriptional activity in LPS (0.1 μg/ml) stimulated murine macrophages. On the other hand, dieckol up-regulated HO-1which partly mediated its anti-inflammatory effect in murine macrophages. Thus, dieckol appeared to be a potential therapeutic agent against inflammation through HO-1 up-regulation. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Macrophages are the sentinels of innate immune system for sensing, integrating, and appropriately responding to a wide array of stimuli [1]. Lipoplysacchride (LPS) activates macrophage toll like receptor 4 (TLR4) to transduce inflammatory signaling cascade in cells [2,3] that leads to the activation of mitogen activated protein kinase (MAPK), phosphoinositide 3 kinase (PI-3 K)/Akt and NF-κB signaling pathways [4,5]. PI-3 K/Akt signaling converges at inhibitory kappa B kinase, IKK, activation in the NF-κB pathway [6]. IKK then ubiqutinates and degrades inhibitory kappa B alpha (IκB-α) to unleash nuclear factor kappa B (NF-κB) for nuclear translocation and transcription of target genes
⁎ Corresponding author. Tel.: +82 54 780 3452; fax: +82 54 780 3455. ⁎⁎ Correspondence to: M.H. Rhee, Laboratory of Veterinary Physiology & Signaling, College of Veterinary Medicine, Kyungpook National University, Daegu 702-701, Republic of Korea. Tel.: +82 53 950 5967; fax: +82 53 950 5955. E-mail addresses: [email protected] (N.-H. Park), [email protected] (M.H. Rhee). 1 Present address: Debre Markos University, Debre Markos, Ethiopia.
http://dx.doi.org/10.1016/j.intimp.2014.06.009 1567-5769/© 2014 Elsevier B.V. All rights reserved.
[7,8] such as inducible nitric oxide synthase [9], cyclooxyginase 2 (COX-2), tumor necrotic factor (TNF)-α, interleukin (IL)-1β and IL-6 [10]. The inducible isoform of nitric oxide synthase produces huge nitric oxide (NO) that is cytotoxic [11]. Cells respond to such oxidative agents through various ways including the expression of phase II anti-oxidant enzymes. Hemeoxygenase 1 (HO-1) is a phase II anti-oxidant that converts the proxidant heme into valuable substances like bilirubin (anti-oxidant) and carbon monoxide (anti-inflammatory). HO-1 gene expression is highly inducible by various stimuli and it involves multiple signaling pathways. It has been suggested that pharmacologic induction of HO-1 protects cells against physical, chemical and biological stress [12,13]. In this regard, phytotherapeutic agents that upregulated HO-1 have also shown protection against oxidative stress [14]. Recently, efforts have been made to isolate and characterize biologically active components from seaweeds. In this regard, the marine brown algae Eisenia bicyclis, Eisenia arborea, Ecklonia stolinifera and Ecklonia cava have been reported for their diverse phlorotannins [15, 16] which are biologically active components [17]. E. bicyclis, edible seaweed, is recognized as a rich source of dieckol (phlorotannin) with anti-oxidant effects [18]. Dieckol has shown anti-inflammatory,
52
T. Yayeh et al. / International Immunopharmacology 22 (2014) 51–58
2. Material and methods 2.1. Materials Dulbecco's modified Eagle's medium (DMEM) [Daegu, Korea]; fetal bovine serum (FBS) (WelGene Co., Korea); streptomycin and penicillin (Lonza, MD, USA); TRI reagent® solution (AM9738, applied biosystems, Ambion); oligodT (Bioneer oligo synthesis); SYBER® green master mix (Warrington, UK); iNOS, COX-2, TNF-α and IL-1β primers were obtained from Bioneer; total protein lysis buffer (PRO-PREP) [iNtRON Biotechnology]; PROMEASURE assay kit (iNtRON Biotechnology); LPS (Escherichia coli 055:B5) and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) and tin protoporphyrin IX (SnPP), were purchased from Sigma. Specific antibodies used against phospho- and/or total form of ERK, JNK, p38, IKK α/β, IκB, NFκBp65, PI-3 K, Akt, PARP, iNOS, COX-2, HO-1, β-actin and rabbit HRP linked antibody were purchased from Cell Signaling Technology. All other reagents and chemicals were obtained from sigma Aldrich. 2.2. Extraction and isolation of dieckol
Fig. 1. The chemical structure of dieckol.
anti-adipogenic, anti-cancer, anti-diabetic, anti-myeloperoxidase, hepatoprotective, and free radical scavenging activities [15,19–22]. However, the anti-inflammatory mediator of dieckol in murine macrophages is poorly understood. Here, therefore, we reported that dieckol (12.5– 50 μM) inhibited NO production via PI-3 K/Akt and NF-κB signaling pathways in RAW264.7 cells and this effect was partly mediated by HO-1.
*
*
*
Dieckol (µM) basal
LPS
12.5
25
Cell viability in %
B
Nitrite production (µM)
A
Marine brown alga E. bicyclis collected from Ulleung Island, Korea was lyophilized (Ilshin, Gyeonggi, Korea) and pulverized to powder (hanil, FM-909 T©). The dried sample (1.3 kg) was then subjected for 80% methanolic (MeOH) extraction in an accelerated solvent extraction (ASE) method [Dionex model ASER 350 (Dionex Corporation, Sunnyvale, CA94085, made in USA)] with working conditions (temperature, 80 °C; purge time, 900 s; heating, 5 min; static time, 5 min). The extract was evaporated at 50 °C and then dried in a vacuum oven (40 °C) to obtain MeOH extract which was partitioned into ethyl acetate. The ethyl acetate fraction was mixed with celite, dried and packed into a glass column in order to elute with hexane, methylene chloride, diethyl ether, and methanol consecutively. The
50
basal
LPS
12.5
LPS (0.1µg/ml)
D
100
140
30
120
25 20 15
* *
10
Cell viability in %
Nitrite production (µM)
50
LPS (0.1µg/ml)
C
100 80 60 40 20
5
0
0 Dieckol (µM) basal
25
LPS
12.5
25
LPS (0.1µg/ml)
50
basal
LPS
12.5
25
50
100
LPS (0.1µg/ml)
Fig. 2. Dieckol inhibited NO production in murine macrophages. RAW264.7 cells and peritoneal macrophages were pre-treated with dieckol (12.5–100 μM) and incubated with or without LPS for 18 h to measure the amount of NO release and check cytotoxicity of the compound in RAW264.7 cells (A, B) and peritoneal macrophages (C, D), as described in the Materials and methods section. Values were the means ± SEM of triplicates from separate experiments. *P b 0.05 shows relative to the LPS treated group.
T. Yayeh et al. / International Immunopharmacology 22 (2014) 51–58
diethyl ether fraction was subjected to Sephadex LH-20 column chromatography using stepwise gradient chloroform/methanol solvent systems. After further purification using the HPLC system, dieckol (10 mg) was obtained and its structure was determined by NMR as shown in Fig. 1. 2.3. Cell culture RAW264.7 and BV-2 cells were cultured and maintained in Dulbecco's modified Eagle's medium enriched with 10% heatinactivated fetal bovine serum, 100 μg/ml streptomycin and 100 U/ml penicillin in 5% CO2 at 37 °C humidified atmosphere. Moreover, peritoneal macrophages were isolated from BALB/c as described by Zhang [23] and cultured using DMEM/F12-10 medium. 2.4. Nitric oxide and cell viability assay Cultured RAW264.7 cells (4 × 105) and peritoneal macrophages were pre-treated with or without dieckol (12.5–50 μM) for 30 min and then stimulated with LPS (0.1 μg/ml) for 18 h in a 96 well plate. NO and cell viability assays were performed as indicated previously [24]. Briefly, the culture supernatant (100 μl) was mixed with an equal volume of Griess reagent and incubated for 10 min at room temperature to determine nitrite accumulation. Cells left after NO assay were immediately incubated with MTT (0.5 mg/ml) reagent for 3 h and formazone precipitates were solubilized by DMSO (150 μl) for plate reading at 540 nm. 2.5. RNA isolation and real time polymerase chain reaction RNA isolation, cDNA preparation and real time PCR were performed as indicated earlier [25]. Briefly, total RNA was isolated using TRI reagent® solution and then reverse transcribed in a commercially available reverse transcriptase pre-mix at 42 °C for 90 min with final reverse
2.6. Western blotting RAW264.7 cells were treated or left untreated with dieckol (12.5– 50 μM) in the presence or absence of LPS (0.1 μg/ml). Cytosolic and nuclear proteins were extracted according to the instructions of NE-PER® Nuclear and cytosolic extraction reagents (Thermo scientific, #78833 & #78835). Total protein extraction, SDS-PAGE, immunoblotting and antibody binding were performed as described previously [25]. Bound antibodies were visualized using enhanced chemiluminescence (Supex) and images were analyzed using ImageJ software. 2.7. Transient transfection and luciferase assay BV-2 cells were cultured in 24 well plates for one day and then transfected in triplicate with TK-renilla (pRL-TK) and NF-κB firefly luciferase (pNFκB-Luc) constructs both obtained from Dr. Oh Byung Chul (Harvard University) using lipofectamine™ 2000 according to the manufacturer's instructions. Briefly, transfected cells were pretreated with dieckol (12.5–50 μM) for 30 min before LPS stimulation for 6 h. Next, cells were washed twice with ice cold PBS and 150 μl of 1x passive lysis buffer was added. After centrifugation at 12,000 ×g for 5 min at 4 °C, 10 μl aliquot of supernatant was analyzed using Glomax luminometer (promega). The NF-κB luciferase activity was measured using luciferase
B.
Normalized mRNA expression
iNOS
*
* *
Dieckol (µM)
transcripitase inactivation. Real time PCR was performed in CFX96TM Real-Time System using power SYBER® green master mix and primers of iNOS: Forward GGAGCCTTTAGACCTCAACAGA, Reverse TGAACGAG GAGGGTGGTG; COX-2: Forward GGGAGTCTGGAACATTGTGAA, Reverse GCACATTGTAAGTAGGTGGACTGT; TNF-α: Forward TGCCTATGTCTCAG CCTCTTC, Reverse GAGGCCATTTGGGAACTTCT; IL-1β: Forward CAAC CAACAAGTGATATTCTCCATG, Reverse GATCCACACTCTCCAGCTGCA; GAPDH: Forward CAATGAATACGGCTACAGCAAC, Reverse AGGGAGAT GCTCAGTGTTGG. Normalized fold expression (ΔΔCT) was calculated relative to the control.
-
LPS
12.5
25
COX-2
Normalized mRNA expression
A.
* * *
-
50
LPS
LPS (0.1µg/ml)
C.
53
12.5
25
50
LPS (0.1µg/ml)
D.
IL-1β
Dieckol (µM)
*
basal
LPS
12.5
*
*
25
50
LPS (0.1µg/ml)
Normalized mRNA expression
Normalized mRNA expression
TNF-α
basal
LPS
12.5
*
*
25
50
LPS (0.1µg/ml)
Fig. 3. Dieckol attenuated mRNA expressions of proinflammatory mediators. Cells were pre-treated with dieckol (12.5–50 μM) for 30 min and then stimulated with LPS for 18 h. RNA was isolated and reverse transcribed into cDNA for mRNA expression of iNOS (A) and COX-2 (B), IL-1β (C) and TNF-α (D). Values were mean ± SEM from triplicates of independent experiments. *P b 0.05 v LPS control group.
54
T. Yayeh et al. / International Immunopharmacology 22 (2014) 51–58
assay system according to the manufacturer's instructions. Luciferase activity was normalized to TK renilla. For HO-1 siRNA (sense CAC CAA GGA GGU ACA CAU C; anti-sense GAU GUG UAC CUC CUU GGU G) transfection, BV-2 cells were cultured in a 60 mm plate without penicillin/ streptomycin for 24 h and then transfected using lipofectamin 2000. Nitrite production was determined as described above.
2.9. Data analysis The results were presented as mean ± standard error of the mean. One way analysis of variance followed by Dunnett's test was used for statistical analysis. P values less than 0.05 were considered as statistically significant.
B.
A. iNOS
iNOS COX-2 β- actin
β- actin
14
iNOS/β-action ratio
iNOS/β-action ratio
12 10 8 6 4 2
* Dieckol (µM) LPS (0.1µg/ml)
-
-
-
12.5
+
25
+
+
C.
50
0 Dieckol (µM)
-
-
25
50
+
LPS (0.1µg/ml) -
+
+
+
D. HO-1
HO-1 β- actin *
HO-1/β- actin ratio
Dieckol (50 µM)
HO-1/β- actin ratio
β- actin
*
0
12
24
h
Dieckol (µM)
-
12.5
Hemin (µM)
-
-
25
50
-
-
-
25
E. HO-1 β- actin HO-1/β-action ratio
1.2 1.0 0.8 0.6
0.4 0.2 0
Dieckol (µM)
-
12.5
25
50
Fig. 4. The effect of dieckol on iNOS, COX-2 and HO-1 protein expressions. RAW264.7 cells and peritoneal macrophages were pretreated with dieckol (12.5–50 μM) and then stimulated with LPS (0.1 μg/ml) for 24 h to determine iNOS and COX-2 protein expression in RAW264.7 cells (A) and peritoneal macrophages (B). Cells were also pretreated with dieckol alone to determine HO-1 protein expression in RAW264.7 cells (C, D) and peritoneal macrophages (E). Images were representative of three independent experiments.
T. Yayeh et al. / International Immunopharmacology 22 (2014) 51–58
3. Results
55
considerable therapeutic merit. Hence, we determined if LPS induced NO release in RAW264.7 cells and peritoneal macrophages could be modulated by pretreatment of dieckol dissolved in DMSO (b 0.1%). We found that dieckol (12.5–50 μM) attenuated the release of excess NO without any detectable cytotoxicity in RAW264.7 cells (Fig. 2A, B) and peritoneal macrophages (Fig. 2C, D); however, cellular injury levels of 20% or more were noticed if the concentration of dieckol exceeded 50 μM.
3.1. Dieckol inhibited LPS induced overproduction of NO in RAW264.7 cells and peritoneal macrophages Because NO overproduction is linked to a number of pathologies [26,27]; agents that modulate the activity of this radical have
A.
B.
Nitrite production in µM
iNOS
iNOS/β- actin ratio
β-actin
*
LPS (0.1µg/ml)
-
+
+
+
+
Dieckol (50 µM)
-
-
+
+
-
-
-
-
+
+
SnPP (20 µM)
Nitrite production in µM
C.
LPS (0.1µg/ml) -
+
+
+
+
Dieckol (50 µM) -
-
+
+
-
SnPP (20 µM) -
-
-
+
+
60
* *
*
+ + 40
+ + 60
40 * 20
0 LPS (0.1μg/ml) Dieckol (50μM) SnPP (μM)
Nitrite production in µM
D.
-
+ -
+ + -
+ + 20
+ + 80
+ 20
+ 40
+ 60
+ 80
Untransfected Scrambled siRNA siRNA HO-1
40 30 20 10
0 LPS (0.1μg/ml)
-
+
+
+
Dieckol (μM)
-
-
12.5
25
Fig. 5. The effect of HO-1 siRNA transfection and SnPP inhibitor on NO release and iNOS expression. RAW264.7 cells were pretreated with HO-1 inhibitor (SnPP, 20–80 μM) for 1 h and dieckol (50 μM) for 30 min and then stimulated by LPS (0.1 μg/ml) for 18 h. NO production (A, C) and iNOS protein expression (B) were evaluated. BV-2 cells were also cultured and transfected with HO-1 siRNA using lipofectamin 2000 to determine NO production (D). *P b 0.05 shows statistical significance.
56
T. Yayeh et al. / International Immunopharmacology 22 (2014) 51–58
3.2. The effect of dieckol on iNOS and HO-1 protein expressions in LPS stimulated murine macrophages Under basal conditions, macrophages are unable to exhibit iNOS protein expression; however, its intracellular expression increases when cells are exposed to inflammatory agents such as LPS. To this end, we investigated if LPS induced iNOS mRNA and protein expressions were attenuated by pretreatment of dieckol. We found that dieckol (12.5– 50 μM) inhibited iNOS and COX-2 mRNA expression (Fig. 3A, B). While dieckol attenuated protein expression of iNOS which was markedly abrogated at 50 μM in both RAW264.7 cells (Fig. 4A) and peritoneal macrophages (Fig. 4B), COX-2 protein expression was unaffected. Dieckol also
A.
inhibited mRNA expression of IL-1β and TNF-α cytokines (Fig. 3C, D). On the other hand, dieckol up-regulated HO-1 protein expression (Fig. 4C) with a pronounced up-regulation at 12 h when 50 μM was used at two time points. Likewise, dieckol enhanced HO-1 protein expression dose dependently in RAW264.7 cells and peritoneal macrophages (Fig. 4D–E). 3.3. HO-1 partially mediated the inhibitory effect of dieckol on NO production in murine macrophages Given the anti-inflammatory nature of HO-1 catalytic products (bilirubin and CO), we determined whether HO-1, induced by dieckol,
B.
p- IKKα/β
p- NFκB p65
p-IκB-α
PARP
nuclear
P-NFκBp65/PARP ratio
Total-IκB-α
Density ratio
β- actin
* * *
Dieckol (µM) LPS (0.1µg/ml) *
Dieckol (µM)
-
-
12.5
25
50
-
+
+
+
+
0
30
60
12.5 +
25 +
50 +
*
LPS (0.1µg/ml)
C.
+
time (min)
D. p-P38
p-PI-3K
Total -P38
Total- PI-3K
p-Akt
p-ERK
Total-Akt Total -ERK
Density ratio
p-JNK
Total-JNK *
Dieckol (µM)
-
-
12.5
25
50
LPS (0.1µg/ml) -
+
+
+
+
* LPS (0.1µg/ml)
-
+
+
+
+
Dieckol (10 µM)
-
-
+
-
+
Fig. 6. The effect of dieckol on NF-κB, PI-3 K/Akt and MAPK proteins. Cells were pretreated with dieckol (12.5–50 μM) and then stimulated with LPS (0.1 μg/ml) for 30 min to determine p-IKK-α/β, and IκB-α (A); p-NF-κBp65, (C) PI-3 K/Akt (B); p38, ERK, JNK (D, E). Images represented independent experiments.
T. Yayeh et al. / International Immunopharmacology 22 (2014) 51–58
Relative NF-κB luciferase activity
E.
57
p- ERK
Total -ERK
p-p38 Total -p38
β- actin
Dieckol (µM)
* *
* basal
LPS
12.5
25
50
Density ratio relative to β - actin
LPS (0.1µg/ml)
Dieckol (50 µM)
Fig. 7. The effect of dieckol on NF-κB luci reporter expression in BV-2 cells. BV-2 cells were transfected with NF-κB luci reporter plasmid using lipofectamine 2000 according to manufacturer's instructions and then cells were pretreated with dieckol (12.5– 50 μM) for 30 min before LPS (0.1 μg/ml) stimulation for 6 h. Luciferase activity was performed using a luminometer. Results represent triplicate of independent experiments. *P b 0.05 v LPS control group.
ease of transfection over RAW264.7 cells. Transfected BV-2 cells were pretreated with dieckol (12.5–50 μM) for 30 min and then stimulated with LPS (0.1 μg/ml) for 6 h. Dieckol dose dependently inhibited LPS induced NF-κB transcriptional activity in BV-2 cells (Fig. 7). 0
5
15
30
60
120
min
Fig. 6 (continued).
impaired NO production and suppressed iNOS expression in LPS stimulated RAW264.7 cells. Dieckol at 50 μM strongly inhibited NO release and totally abrogated iNOS protein expression (Fig. 5A, B) both of which were partially reversed by HO-1 inhibitor (SnPP, 20 μM). We also used safe concentrations of SnPP (20–80 μM) and HO-1siRNA transfection to verify the anti-inflammatory effect of dieckol. Both SnPP pretreatment and HO-1siRNA transfection reversed NO production that was inhibited by dieckol pretreatment (Fig. 5C, D), indicating that the anti-inflammatory effect of dieckol could be partly mediated by HO-1. 3.4. Dieckol attenuated NF-κB and PI-3 K/Akt signaling pathways in LPS stimulated RAW264.7 cells NF-κB, MAPK and PI-3 K/Akt cellular signaling pathways have been frequently involved in LPS triggered inflammation [28,29]. Here therefore we examined if PI-3 K/Akt, NF-κB and/or MAPK signaling pathways were modulated by pretreatment of dieckol at the range of concentrations used (12.5–50 μM). Dieckol attenuated the expressions of phospho (p), p-IKK α/β and p- IκB-α (Fig. 6A) and impaired nuclear expression of p-NF-κBp65 (Fig. 6B) in LPS stimulated cells. Likewise, p-PI-3 K and p-Akt protein expressions were shown to be inhibited at 60 min of LPS stimulation (Fig. 6C); however, neither the expression of p-p38, p-JNK, nor p-ERK was inhibited (Fig. 6D). Instead, treatment with dieckol alone increased the expression level of p-ERK and p-p38 (Fig. 6E). 3.5. Dieckol downregulated NF-κB transcriptional activity in BV-2 cells Transcriptional activity of NF-κB is a prerequisite for the expression of various proinflammatory mediators including iNOS and COX-2. Here therefore we evaluated the effect of dieckol on LPS-stimulated NF-κBdependent reporter gene expression in BV-2 cells using their potential
4. Discussion Seaweeds have long history as traditional cosmetics and herbal medicine in the treatments of various ailments, yet little is known about their anti-inflammatory role under experimental conditions. In recent years, therefore, attempts have been made to explore the potential role of extracts from various seaweeds against cellular oxidation and inflammation [30,31]. For instance, phlorotannins extracted from brown algae showed potent anti-oxidant and anti-inflammatory properties in vitro cellular systems where dieckol accounted for the major part of cytoprotective action [32,33]. Jung et al. also portrayed the neuroprotective effect of dieckol and its molecular mechanism of actions in microglia at relatively higher concentrations [34]; however, whether this cytoprotective effect was mediated by HO-1 at relatively safer concentrations remained to be defined. In this study, therefore, we geared to investigate whether dieckol mediates anti-inflammatory effect through HO-1 expression in LPS stimulated murine macrophage RAW264.7 cells. Dieckol attenuated NO production without any visible cytotoxicity in the range of concentrations used (Fig. 2A–D) and this effect could be emanated from its inhibitory effect on iNOS (Fig. 4A, B) and/or its NO scavenging capabilities [15,31]. It is interesting that dieckol upregulated HO-1 protein expression (Fig. 4C–E) that could be signaled through p38MAPK and ERK pathways (Fig. 6E) as these pathways have been identified for HO-1 induction [35]. HO-1 partly contributed its suppressive action on iNOS protein expression thereby inhibited NO production which was demonstrated using HO-1 inhibitor, SnPP (Fig. 5A–C) and HO-1siRNA transfection (Fig. 5D). We speculated that the catalytic products of heme (CO and bilirubin) may explain HO-1 mediated NF-κB inhibition (Fig. 6), repression of iNOS, COX-2, IL-1β and TNF-α mRNA expressions (Fig. 3A) as well as reduced luciferase reporter activity (Fig. 7). While dieckol impaired the mRNA expression of COX-2, its protein expression was unaffected. This could be explained by post-translational modifications of proteins [36]. Dieckol also inhibited PI-3 K/Akt signaling which in turn attenuates the NF-κB pathway (Fig. 6A & B). This specific action of dieckol on NF-κB signaling in RAW264.7 cells could also be supported by similar observations made on fibrosarcoma cell line [37]. On the other hand, dieckol was reported for its anti-inflammatory action in BV-2 cells via p38 MAPK and NF-κB pathways [34], reflecting that the molecular action of dieckol may
58
T. Yayeh et al. / International Immunopharmacology 22 (2014) 51–58
vary depending on the concentration and cell type used. Despite this, the current cytoprotective effect of dieckol agrees with its neuroprotective function reported previously. In conclusion, dieckol at relatively lower and safer concentrations attenuated NO release and iNOS expression in murine macrophages. This suppressive effect of dieckol on NO and iNOS could be emanated from the diminished activity of PI-3 K/Akt and NF-κB signaling cascades modulated partly by HO-1. Thus, dieckol derived from brown algae appears to be a potentially indispensable natural compound to fight against the rampant cellular oxidation and inflammation through HO-1 up-regulation.
References [1] Odegaard JI, Chawla A. Alternative macrophage activation and metabolism. Annu Rev Pathol 2011;6:275–97. [2] Trent MS, Stead CM, Tran AX, Hankins JV. Diversity of endotoxin and its impact on pathogenesis. J Endotoxin Res 2006;12:205–23. [3] Wang X, Quinn PJ. Lipopolysaccharide: biosynthetic pathway and structure modification. Prog Lipid Res 2010;49:97–107. [4] West AP, Koblansky AA, Ghosh S. Recognition and signaling by toll-like receptors. Annu Rev Cell Dev Biol 2006;22:409–37. [5] Dunne A, O'Neill LA. The interleukin-1 receptor/Toll-like receptor superfamily: signal transduction during inflammation and host defense. Sci STKE 2003;2003:re3. [6] Vanhaesebroeck B, Guillermet-Guibert J, Graupera M, Bilanges B. The emerging mechanisms of isoform-specific PI3K signalling. Nat Rev Mol Cell Biol 2010;11:329–41. [7] Perkins ND. Integrating cell-signalling pathways with NF-kappaB and IKK function. Nat Rev Mol Cell Biol 2007;8:49–62. [8] Bode JG, Ehlting C, Haussinger D. The macrophage response towards LPS and its control through the p38(MAPK)-STAT3 axis. Cell Signal 2012;24:1185–94. [9] Ashenagar MS, Tabuchi M, Kinoshita K, Ooshima K, Niwa A, Watanabe Y, et al. Gene expression in the adrenal glands of three spontaneously hypertensive rat substrains. Mol Med Rep 2010;3:213–22. [10] Hacker H, Karin M. Regulation and function of IKK and IKK-related kinases. Sci STKE 2006;2006:re13. [11] Aktan F. iNOS-mediated nitric oxide production and its regulation. Life Sci 2004; 75:639–53. [12] Prawan A, Kundu JK, Surh YJ. Molecular basis of heme oxygenase-1 induction: implications for chemoprevention and chemoprotection. Antioxid Redox Signal 2005;7:1688–703. [13] Ryter SW, Alam J, Choi AM. Heme oxygenase-1/carbon monoxide: from basic science to therapeutic applications. Physiol Rev 2006;86:583–650. [14] Yang H, Lee SE, Jeong S, Park CS, Jin YH, Park YS. Up-regulation of heme oxygenase-1 by Korean red ginseng water extract as a cytoprotective effect in human endothelial cells. J Ginseng Res 2011;35:352–9. [15] Li Y, Qian ZJ, Ryu B, Lee SH, Kim MM, Kim SK. Chemical components and its antioxidant properties in vitro: an edible marine brown alga, Ecklonia cava. Bioorg Med Chem 2009;17:1963–73. [16] Li Y-X, Wijesekara I, Li Y, Kim S-K. Phlorotannins as bioactive agents from brown algae. Process Biochem 2011;46:2219–24. [17] Thomas NV, Kim SK. Potential pharmacological applications of polyphenolic derivatives from marine brown algae. Environ Toxicol Pharmacol 2011;32:325–35.
[18] Kwon TH, Kim TW, Kim CG, Park NH. Antioxidant activity of various solvent fractions from edible brown alga, Eisenia bicyclis and its active compounds. J Food Sci 2013;78:C679–84. [19] Choi HJ, Park JH, Lee BH, Chee HY, Lee KB, Oh SM. Suppression of NF-kappaB by dieckol extracted from ecklonia cava negatively regulates LPS induction of inducible nitric oxide synthase gene. Appl Biochem Biotechnol 2014;173:957–67. [20] Jung HA, Jung HJ, Jeong HY, Kwon HJ, Ali MY, Choi JS. Phlorotannins isolated from the edible brown alga Ecklonia stolonifera exert anti-adipogenic activity on 3 T3-L1 adipocytes by downregulating C/EBPalpha and PPARgamma. Fitoterapia 2014;92:260–9. [21] Kang MC, Kang SM, Ahn G, Kim KN, Kang N, Samarakoon KW, et al. Protective effect of a marine polyphenol, dieckol against carbon tetrachloride-induced acute liver damage in mouse. Environ Toxicol Pharmacol 2013;35:517–23. [22] Yoon JS, Kasin Yadunandam A, Kim SJ, Woo HC, Kim HR, Kim GD. Dieckol, isolated from Ecklonia stolonifera, induces apoptosis in human hepatocellular carcinoma Hep3B cells. J Nat Med 2013;67:519–27. [23] Zhang X, Goncalves R, Mosser DM. The isolation and characterization of murine macrophages. Curr Protoc Immunol 2008;83:14.1.1–14.1.14. [24] Yayeh T, Jung KH, Jeong HY, Park JH, Song YB, Kwak YS, Kang HS, Cho JY, Oh JW, Kim SK, Rhee MH. Korean red ginseng saponin fraction downregulates proinflammatory mediators in LPS stimulated RAW264.7 cells and protects mice against endotoxic shock. J Ginseng Res 2012;36:263–9. [25] Yayeh T, Hong M, Jia Q, Lee YC, Kim HJ, Hyun E, et al. Pistacia chinensis inhibits NO production and upregulates HO-1 induction via PI-3 K/Akt pathway in LPS stimulated macrophage cells. Am J Chin Med 2012;40:1085–97. [26] Knott AB, Bossy-Wetzel E. Nitric oxide in health and disease of the nervous system. Antioxid Redox Signal 2009;11:541–54. [27] Knott AB, Bossy-Wetzel E. Impact of nitric oxide on metabolism in health and agerelated disease. Diabetes Obes Metab 2010;12(suppl 2):126–33. [28] Kyriakis JM, Avruch J. Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol Rev 2001; 81:807–69. [29] Bakkar N, Guttridge DC. NF-kappaB signaling: a tale of two pathways in skeletal myogenesis. Physiol Rev 2010;90:495–511. [30] Yang EJ, Moon JY, Kim MJ, Kim DS, Kim CS, Lee WJ, et al. Inhibitory effect of Jeju endemic seaweeds on the production of pro-inflammatory mediators in mouse macrophage cell line RAW 264.7. J Zhejiang Univ Sci B 2010;11:315–22. [31] Lopes G, Sousa C, Silva LR, Pinto E, Andrade PB, Bernardo J, et al. Can phlorotannins purified extracts constitute a novel pharmacological alternative for microbial infections with associated inflammatory conditions? PLoS One 2012;7:e31145. [32] Yotsu-Yamahita M, Kondo S, Segawa S, Lin YC, Toyohara H, Ito H, et al. Isolation and structural determination of two novel phlorotannins from the brown alga Ecklonia kurome Okamura, and their radical scavenging activities. Mar Drugs 2013;11:165–83. [33] Kim AR, Shin T-S, Lee M-S, Park J-Y, Park K-E, Yoon N-Y, et al. Isolation and identification of phlorotannins from Ecklonia stolonifera with antioxidant and antiinflammatory properties. J Agric Food Chem 2009;57:3483–9. [34] Jung WK, Heo SJ, Jeon YJ, Lee CM, Park YM, Byun HG, et al. Inhibitory effects and molecular mechanism of dieckol isolated from marine brown alga on COX-2 and iNOS in microglial cells. J Agric Food Chem 2009;57:4439–46. [35] Ferrandiz ML, Devesa I. Inducers of heme oxygenase-1. Curr Pharm Des 2008; 14:473–86. [36] Espiritu MJ, Cabalteja CC, Sugai CK, Bingham JP. Incorporation of post-translational modified amino acids as an approach to increase both chemical and biological diversity of conotoxins and conopeptides. Amino Acids 2014;46:125–51. [37] Zhang C, Li Y, Qian ZJ, Lee SH, Li YX, Kim SK. Dieckol from Ecklonia cava regulates invasion of human fibrosarcoma cells and modulates MMP-2 and MMP-9 expression via NF-kappaB pathway. Evid Based Complement Altern Med 2011;2011:140462.