- Email: [email protected]
HemT-3, an alternative transcript of mouse gene HemT specific to male germ cells
Gene 240 (1999) 193–199 www.elsevier.com/locate/gene
HemT-3, an alternative transcript of mouse gene HemT specific to male germ cells Haifeng Xue a, David O’Neill a,b, Xiangyuan Wang a, Debra J. Wolgemuth a, Arthur Bank a,c, * a Department of Genetics and Development, Columbia University College of Physicians and Surgeons, New York, NY 10032, USA b Department of Pathology, Columbia University College of Physicians and Surgeons, New York, NY 10032, USA c Department of Medicine, Columbia University College of Physicians and Surgeons, New York, NY 10032, USA Received 14 June 1999; accepted 27 August 1999 Received by L. Luzzatto
Abstract A number of genes are known to be expressed primarily in hematopoietic cells and testis and are thought to function in the control of both blood cell and male germ cell differentiation. We have recently identified a mouse gene, HemT, that encodes two alternatively spliced transcripts specific to hematopoietic cells (HemT-1 and HemT-2) and kidney (HemT-2). We have now isolated a third HemT transcript, HemT-3, that is found only in testis by Northern blot analysis and RT-PCR. HemT-3 is alternatively spliced and may be initiated differently from HemT-1 and HemT-2. RNA in-situ hybridization of testis from wild-type and germcell-deficient adult mice, as well as from mice at different developmental stages, indicates that HemT-3 is expressed only in early spermatocytes. HemT-3 cDNA has a major open reading frame related to a human glycosylphosphatidylinositol (GPI )-anchored protein, GML. Using an antibody generated against a peptide derived from the HemT-3 open reading frame, we have detected a testis-specific 22 kDa protein by Western blot analysis. © 1999 Elsevier Science B.V. All rights reserved. Keywords: Alternative splicing; Hematopoiesis; HemT; HemT-3; Male germ cells; Spermatogenesis; Testis
1. Introduction Several genes have been described that are involved in hematopoisis and spermatogenesis, processes that involve the continuous production of large numbers of differentiated cells from relatively few stem cells. For example, naturally occurring mutations of the genes encoding stem cell factor (SCF ) and its receptor, c-kit, are associated with sterility and anemia, due to the failure of stem cells in the testes and bone marrow to migrate and proliferate effectively during development (Chabot et al., 1988; Geissler et al., 1988; Broudy, 1997). A variety of genes have also been identified that are Abbreviations: BCIP, 5-bromo-4-chloro-3-indolylphosphate; GPI, glycosylphosphatidylinositiol; MAP, multiple antigen peptide; MELC, murine erythroleukemia cells; NBT, Nitro-blue Tetrazolium; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; PIPLC, phosphatidylinositol-specific phospholipase C; RAC, rapid amplification of cDNA ends; RT, reverse transcriptase; TBS, tris-buffered saline. * Corresponding author. Tel.: +1-212-305-4186; fax: +1-212-923-2090. E-mail address: [email protected] (A. Bank)
expressed primarily in hematopoietic cells and testis, and these genes may similarly be involved in the control of both blood-cell- and male-germ-cell differentiation. The gene encoding GATA-1, an erythroid cell-specific transcription factor that is essential for erythroid differentiation (Pevny et al., 1991), also encodes a differently initiated transcript in testis (Ito et al., 1993). Ship, an SH2-containing inositol polyphosphate 5-phosphatase that is thought to function in signaling, is expressed both during hematopoiesis and spermatogenesis (Liu et al., 1998), and Enx-1, a mouse Polycomb group gene, is expressed primarily in spleen and testis in adult animals (Hobert et al., 1996). In a screen for hematopoietic cell-specific genes, we recently identified a mouse gene, Hem-T, that is preferentially expressed in mouse erythroleukemia cells (MELC ) before induction with known inducers of differentiation ( Xue et al., 1999). Hem-T was found to encode two RNA transcripts. HemT-1 is hematopoietic-cell-specific and may be erythroid-specific. The second transcript, HemT-2, is expressed in both hematopoietic tissues and
0378-1119/99/$ - see front matter © 1999 Elsevier Science B.V. All rights reserved. PII: S0 3 7 8 -1 1 1 9 ( 9 9 ) 0 0 40 1 - 1
194
H. Xue et al. / Gene 240 (1999) 193–199
kidney. The cDNAs of both transcripts have been cloned and found to be products of alternative splicing ( Xue et al., 1999). We have now isolated a third HemT transcript, HemT-3, that is found only in testis by Northern blot analysis and RT-PCR. HemT-3 is alternatively spliced and may be initiated differently from HemT-1 and HemT-2. By studying HemT-3 expression in sections of testis from wild-type and germ-cell-deficient adult mice, as well as from mice at different development stages, we show that HemT-3 is expressed only in early spermatocytes. HemT-3 cDNA has a major open reading frame related to a human glycosylphosphatidylinositol (GPI )anchored protein, GML (Furuhata et al., 1996; Kimura et al., 1997a,b). We show that a testis-specific 22 kDa protein is detected in Western blots using an antibody generated against a peptide derived from this open reading frame, and that this HemT-3 product is only expressed in testis.
2. Materials and methods 2.1. EMBL Accession Nos HemT genomic DNA sequence: Accession No. AJ242830; HemT-3 cDNA sequence: Accession No. AJ242831. 2.2. Obtaining the 5∞ and 3∞ ends of HemT-3 cDNA Rapid amplification of cDNA ends (RACE) was performed to obtain the 5∞ and 3∞ ends of the HemT-3 cDNA using a 5∞/3∞ RACE kit (Boehringer Mannheim) according to the manufacturer’s instructions. 2.3. RNA in-situ hybridization RNA in-situ hybridization was performed on histological sections of testes using a procedure modified from several described methods (Jaffe et al., 1990; Chapman and Wolgemuth, 1992). Rehydrated slides were fixed in 4% paraformaldehyde for 20 min, washed in PBS for 5 min twice, treated with 10 mg/ml of Proteinase K for 7 min, washed in PBS for 5 min twice, treated with 10 mg/ml of Proteinase K for 7 min, washed in PBS for 5 min twice, refixed for 5 min in 4% paraformaldehyde, and then incubated in 0.1 M triethanolamine (pH 8.0) with a 1/400 dilution of acetic anhydride for 10 min. The slides were then washed in PBS for 5 min twice, dehydrated, and then pre-hybridized at 50°C for 2 h in 50% formamide, 4× SSC, 1× Denhart’s solution (Sambrook et al., 1989) and 0.5 mg/ml of denatured salmon sperm DNA. Hybridization was then carried out at 50°C overnight in 50% formamide, 4× SSC, 1× Denhart’s solution, 0.5 mg/ml denatured salmon sperm DNA, 10% dextran sulfate, and 200–500 ng/ml of a
digoxygenin-labeled antisense or sense (as control ) RNA probe. The RNA probes were generated by in-vitro transcription of a pBluescript IISK(+) phagemid containing the HemT-3 cDNA insert. After hybridization, the slides were washed successively in excess amounts of formamide wash buffer (50% formamide, 1× SSC ) for 30 min at 50°C, 0.5× SSC for 30 min at room temperature, RNase solution (20 mg/ml RNase A in 3.5× SSC ) for 15 min at room temperature 3.5× SSC for 10 min at room temperature twice, and 0.1× SSC at 65°C for 1 h. The slides were then incubated successively in maleic buffer (100 mM maleic acid, 150 mM Tris, pH 7.5) for 5 min, blocking buffer (10% Boehringer Mannheim Blocking Reagent in maleic buffer) for 30 min, and then in a 1:200 dilution of alkaline phosphatase conjugated anti-digoxygenin antibody (Boehringer Mannheim) for 2 h. The slides were then washed four times for 5 min each in maleic buffer and then incubated in detection buffer (100 mM Tris, 100 mM NaCl, pH 9.5) for 10 min. Color development was carried out in the dark in color substrate solution [45 ml NBT and 35 ml BCIP (Boehringer Mannheim) freshly mixed with 10 ml of detection buffer]. After color development was complete, the slides were washed in PBS, fixed in 4% paraformaldehyde and mounted in Aqua Poly/Mount (Polysciences). 2.4. Generation of polyclonal antibodies Polyclonal antibodies were generated against synthetic peptides. The sequence of the peptide was selected primarily based on the Antigen Index (James–Wolf method ) (Jameson and Wolf, 1988), utilizing the Wisconsin sequence analysis package (GCG). Multiple antigen peptides (MAPs) were synthesized in the Protein Chemistry Core Facility of the Howard Hughes Medical Institute, Columbia University. Rabbit immunization with the MAPs was then performed by Cocalico Biologicals, Inc. Serum samples from several test bleeds were obtained and used to perform ELISAs against the MAP directly. When a strong interaction between the serum and the MAP was detected, rabbit serum was collected. 2.5. Immunoblotting Mouse tissues were homogenized in 50 mM Tris– HCl, pH 6.8, 2% SDS, and 1 mM PMSF at 4°C. Protein concentrations were determined using a spectrophotometer. Extracts were diluted in Laemmli sample buffer (Bio Rad ), boiled for 3 min, and run on 16.5% Tris– Tricine ready gels (Bio Rad) for 60 min at 200 V. Gels were electroblotted onto nitrocellulose or PVDF membranes (Bio Rad). Membranes were first incubated in blocking buffer (tris-buffered saline ( TBS ) with 5% nonfat dry milk and 0.1% Tween-20) overnight at 4°C, and then with antibody diluted in blocking buffer for 1 h at
H. Xue et al. / Gene 240 (1999) 193–199
195
room temperature. Pre-immune serum from the same rabbit was used as a negative control. In some control experiments, antibody was first incubated with an excess amount of the peptide used for immunization on ice for 30 min prior to incubation with the blot. Membranes were washed once in TBS with 0.1% Tween-20 ( TBST ) for 15 min and then twice more for 5 min, incubated with horse-radish peroxidase conjugated goat anti-rabbit IgG (Santa Cruz biotechnology) diluted in TBST for 30 min, then washed in TBST once for 15 min and then twice for 5 min. A Western blotting detection reagent kit ( ECL kit, Amersham/Pharmacia) was used for the detection step.
3. Results and discussion 3.1. Cloning of HemT-3 cDNA We have previously reported the identification of a mouse gene, HemT, using differential display, which produces two alternatively spliced transcripts (HemT-1 and HemT-2) in MELC ( Xue et al., 1999). The HemT-1 message is detected only in hematopoietic tissues, whereas HemT-2 is detected in both hematopoietic tissues and kidney. We also reported that a longer (1.1 kb) HemT transcript (HemT-3) is detected only in mouse testis by Northern blot analysis using a 412 bp cDNA
Fig. 2. HemT-3 cDNA sequence. The cDNA sequence was obtained by subcloning and sequencing several RT-PCR and RACE products of HemT-3 transcript. The deduced amino acid sequence of the open reading frame is shown under the cDNA sequence.
Fig. 1. Analysis of HemT-3 sequence using primers for HemT-1 and HemT-2. Transcript HemT-1, which is hematopoietic-cell-specific, consists of exon 1 and exon 2. Transcript HemT-2, which is expressed in hematopoietic cells and kidney, consists of exon 1 (minus 38 bp at 3∞end) and exon 2. RT-PCR primer set 1 (upstream primer: 5∞ATGGATGCCGTCTAGAAGGG, downstream primer: 5∞GGTGCAGTCCTTGAGAACCAT ) was used in the original RT-PCR experiment to study HemT expression ( Xue et al., 1999). RT-PCR primer set 2 used the same uptream primer (5∞-ATGGATGCCGTCTAGAAGGG) as RT-PCR primer set 1. The 3∞ primer of RT-PCR primer set 2 is 5∞-GGTGCTCTTGACACTGTCTCT. The arrows indicate the locations of the primers used in the RT-PCR experiments to amplify the testis-specific HemT-3 cDNA.
probe generated from the 3∞ end of HemT-1 ( Xue et al., 1999). In addition, a 635 bp RT-PCR product is amplified only from testis RNA using primers (RT-PCR primer set 1) ( Fig. 1) to generate 244 bp (HemT-1) and 206 bp (HemT 2) products from MELC RNA ( Xue et al., 1999). To characterize HemT-3, we subcloned and sequenced the 635 bp testis RT-PCR product. Surprisingly, we found that only 39 bp at the 3∞ end of the HemT-3 sequence matched the HemT-1/HemT-2 cDNA sequence. This match corresponds to the very 5∞ end of HemT/exon 2, and the sequences diverge exactly at the intron/exon 2 junction (Fig. 1). We repeated the
196
H. Xue et al. / Gene 240 (1999) 193–199
3.2. HemT-3 is related to human GML
Fig. 3. Comparison of the deduced amino acid sequence of mouse HemT-3 and human GML (GPI-anchored molecule like protein). Amino acid sequences are deduced from the cDNA sequence. An approximately 51% similarity and 44% identity are found between the two predicted proteins. The 10 conserved cysteines are indicated in bold.
amplification from testes RNA using a second 3∞ primer that anneals to HemT-1 and HemT-2 further downstream (RT-PCR primer set 2), ( Fig. 1). Sequencing of the resulting product again showed that the sequences of the MELC transcripts (HemT-1 and HemT-2) and the testis transcript (HemT-3) are identical within exon 2, and diverge upstream of the intron/exon 2 junction (Fig. 1). This suggested that HemT-3 is spliced alternatively from HemT-1 and HemT-2, with all three transcripts having exon 2 in common, and that the 5∞ primer used in the RT-PCR reactions annealed to the testes transcript non-specifically. We then used 5∞ and 3∞ RACE with testes RNA to obtain a full-length HemT-3 cDNA clone. The complete cDNA sequence of HemT-3 is shown in Fig. 2. The 951 bp cDNA includes a 531 bp open reading frame coding for a 177-amino-acid polypeptide (Fig. 2).
Using a BLAST search, we found that HemT-3 shares a significant homology to a cloned human cDNA, GML (GPI-anchored molecule like protein) ( Furuhata et al., 1996) both at the cDNA sequence level (data not shown) and at the deduced amino acid sequence level (Fig. 3). The level of similarity between the two deduced proteins is approximately 51%. There are 10 cysteine residues that are conserved between the two proteins within the core GPI anchor motif, which is found in a variety of cell-surface glycoproteins (Behrendt et al., 1991; Ploug et al., 1993). The amino acid sequence of HemT-3 has one mismatch with the consensus pattern of this motif (the GPI anchor consensus pattern is [EQR]-C[LIVMFYAH ]-x-C-x ( 5,8 )-C-x ( 3,8 )-[ EDNQSTV ]-C{C}x(5)-C-x(12,24)-C, and HemT-3 has a Y in the position for [EDNQSTV ]). The human GML gene, which is located on human chromosome 8q24.3 ( Kimura et al., 1997b), is expressed only in human testis at a level detectable by Northern blot, and is activated by p53 (Furuhata et al., 1996). GML expression seems to increase the susceptibility of cells to be killed by taxol ( Kimura et al., 1997a). The similarities in sequence and expression pattern strongly suggest that mouse HemT-3 is related to human GML. 3.3. HemT-3 is initiated and spliced differently from HemT-1 and HemT-2 By aligning the sequence of HemT-3 cDNA with that of a HemT genomic DNA clone previously described ( Xue et al., 1999), we established the intron/exon struc-
Fig. 4. HemT genomic DNA structure: 4.5 kb of cloned and sequenced HemT genomic DNA, which includes all the exons, is shown. Three types of HemT transcripts have been identified. Transcript HemT-1, which consists of exon 3 and 4 (exons 1 and 2 in Fig. 1), is only found in hematopoietic tissues (bone marrow, spleen, and day 14 fetal liver) and erythroid cell lines (MELC, BBB8), and thus is hematopoietic-cell-specific and may be erythroid-cell-specific. Transcript HemT-2, which consists of exon 3 (minus 38 bp at its 3∞ end ) and exon 4, is found in hematopoietic tissues and cell lines (EL4, MELC, BB8B) and kidney. Transcript HemT-3, which consists of exon 1, 2, and 4, is only found in testis. The 5∞ donor sequence of intron 1 (between exon 1 and 2) is GT…, and the 3∞ acceptor sequence is …AG. Similarly, the other exon–intron junctions have appropriate consensus donor and acceptor sequences ( EMBL Accession No. AJ242830).
H. Xue et al. / Gene 240 (1999) 193–199
197
ture for all three transcripts ( Fig. 4). HemT-1, which is hematopoietic cell-specific (and perhaps erythroid cellspecific), consists of exon 3 and exon 4 (initially named exons 1 and 2). HemT-2, which is expressed in hematopoietic tissues and kidney, also consists of exon 3 (but with an alternate splice donor site 38 bp upstream of that for HemT-1) and exon 4. HemT-3, the testis-specific transcript, consists of exon 1, exon 2, and exon 4. Consensus donor and acceptor splice sequences are present at all exon–intron junctions ( Fig. 4, EMBL Accession No. AJ242830). Because HemT-3 has a different first exon, HemT-3 transcription most probably initiates differently from HemT-1 and HemT-2. This notion is reinforced by the observation of minor bands seen on Northern blot that fit the size of unspliced HemT-3 pre-mRNA in testes and HemT-1/HemT-2 pre RNA in MELC ( Xue et al., 1999). The mechanisms involved in the regulation of the tissue-specific expression of HemT-1, HemT-2 and HemT-3 remain to be understood. We have no evidence that HemT-1 and HemT-2 are translated into proteins ( Xue et al., 1999). They may be active as RNA. It is also interesting to note that there is a binding site for GATA-1 ( Wall et al., 1988; Merika and Orkin, 1993), an erythroid-cell-specific transcription factor, immediately upstream of exon 3 (originally called exon 1), the presumed transcription initiation site for HemT-1 and HemT-2 (data not shown). 3.4. HemT-3 RNA is expressed only in early spermatocytes To determine which cells in testis express HemT-3, we performed RNA in-situ hybridization on histological sections of mouse testis. Spermatogenesis in adult mouse testis has been well characterized histologically, with spermatogonia, the stem cells, located at the periphery of the testicular tubules, and more differentiated cells located toward the lumen (Herrada and Wolgemuth, 1997). Antisense HemT-3 riboprobes yield positive signals in germ cells at peripheral regions of adult testicular tubules ( Fig. 5), indicating that HemT-3 is expressed in earlier, less differentiated male germ cells. Only a very weak HemT-3 signal, which appears to be located in a small number of remaining germ cells, is detected in testes of germ-cell-deficient WWv mice ( Fig. 5), confirming that HemT-3 is expression is germ-cell-specific. These results do not indicate, however, whether HemT-3 is expressed in spermatogonia, in more differentiated spermatocytes, or in both cell types. To determine more precisely which specific spermatogenic cell types express HemT-3, we performed RNA in-situ hybridization on testes from mice at three different developmental stages: 7 day old (d7), 17 day-old (d17), and adult mice (Fig. 6). Day 7 testes contain mitotic spermatogonia only, whereas d17 testes have entered
Fig. 5. RNA in-situ hybridization on wild-type and WWv germ-celldeficient adult mouse testis. (A) Hematoxylin and eosin (H and E ) staining of wild-type mouse testis (100×). (B) H and E staining of WWv mouse testis (200×). (C ) RNA in-situ hybridization on wildtype mouse testis (100×). (D) RNA in-situ hybridization on WWv mouse testis (200×). ( E) RNA in-situ hybridization on wild-type mouse testis (400×). (F ) RNA in-situ hybridization on WWv mouse testis (400×). Digoxygenin-labeled riboprobe is generated by in-vitro transcription from a pBluescript II phagemid containing the 3∞ end of the HemT-3 cDNA (corresponding to nucleotides 540–951). Positive signals are present in the peripheral regions of the wild-type testicular tubules and weakly present in a few remaining germ cells in WWv mouse testis.
meiosis and contain both spermatogonia and spermatocytes. Both d7 and d17 testes lack post-meiotic spermatids, while adult testes contain spermatogonia, spermatocytes and spermatids [reviewed in Wolgemuth and Watrin (1991)]. As shown in Fig. 6, no significant positive signals were present in d7 testis, but were present in the center of the d 17 testicular tubules and at the periphery of the adult testicular tubules. These results strongly suggest that HemT 3 RNA is expressed only in spermatocytes that are in meiotic prophase.
198
H. Xue et al. / Gene 240 (1999) 193–199
Fig. 6. RNA in-situ hybridization on day 7, day 17, and adult mouse testis. (A) H and E staining of day 7 mouse testis (200×). (B). H and E staining of day 17 mouse testis ( 100×). (C ) H and E staining of adult mouse testis (100×). (D) RNA in-situ hybridization on day 7 mouse testis (200×). (E ) RNA in-situ hybridization on day 17 mouse testis (100×). (F ) RNA in-situ hybridization on adult mouse testis (100×). (G) RNA in-situ hybridization on day 7 mouse testis (400×). (H ) RNA in-situ hybridization on day 17 mouse testis (400×). (I ) RNA in-situ hybridization on adult mouse testis (400×). Digoxygenin-labeled riboprobe is generated by in-vitro transcription from a pBluescript II phagemid containing the 3∞ end of the HemT-3 cDNA (corresponding to nucleotides 540–951). In day 7 testis, there are no significant specific positive signals. In day 17 testis, positive signals are present in the center of the testicular tubules. In adult testis, positive signals are present in the peripheral regions of the testicular tubules.
3.5. HemT-3 protein expression is restricted to expression in testis To characterize the tissue expression of HemT-3 protein, we generated an antibody against a 20-aminoacid synthetic peptide derived from the HemT-3 major open reading frame. Anti-HemT-3 antibody recognizes a protein of about 22 kDa in mouse testis by immunoblotting (Fig. 7), very close to the size of the predicted HemT-3 protein (about 20 kDa). This 22 kDa band is not present in other mouse tissues tested (Fig. 7B), similar to the pattern of HemT-3 RNA expression ( Xue et al., 1999). In addition, the 22 kDa protein is present in adult and d17 testes, but is essentially absent in d7 testes (Fig. 7C ), consistent with the pattern of HemT-3 expression observed in in-situ hybridization experiments (Fig. 6). As mentioned previously, the deduced HemT-3 protein shares about 50% homology with the deduced amino acid sequence of a human cDNA, GML (GPI-anchored molecule like protein), and is particularly homologous to GML within its GPI-anchor motif, suggesting that the HemT-3 product is a GPI-linked cell surface glycoprotein. Biochemical experiments using detergent fractionation (Hooper and Bashir, 1991) and PIPLC treatment
(Ikezawa, 1991) were performed and are consistent with HemT-3 being a GPI-anchored membrane protein, but do not prove that it is (data not shown). In summary, we report the identification and characterization of mouse HemT-3, a testes-specific transcript that most likely encodes a GPI-anchored membrane protein related to human GML. HemT-3 is alternatively spliced and initiated differently from the other HemT transcripts previously described that are expressed in hematopoietic cells (HemT-1 and HemT-2) and kidney (HemT-2). Expression of HemT-3 is restricted to male germ cells relatively early in differentiation (spermatocytes in meiotic prophase). It is interesting to note the parallels in the expression patterns of the HemT transcripts, that is, HemT-3 is shut off before the final stages of spermatogenesis, and HemT-1 and HemT-2 are shut off before the final stages of erythropoiesis. Although the biological functions of the three HemT transcripts and HemT-3 protein are unclear, the very restricted expression patterns of its various transcripts, as well as the observation that HemT-3 encodes a polypeptide while HemT-1 and HemT-2 lack obvious open reading frames, are of potential interest. Targeted mutagenesis of the HemT gene may reveal the function of the HemT gene and its various transcripts.
H. Xue et al. / Gene 240 (1999) 193–199
Fig. 7. Western Blotting analyses using anti-HemT-3 antibody. (A) Control experiment using adult mouse testis protein. Lane 1, antiHemT3 serum used. Lane 2, pre-immune serum. Lane 3, anti-HemT3 serum was first incubated with HemT-3 antigen (18-amino-acid synthetic peptide) and then reacted with testis protein. (B) A band of approximately 22 kDa is detected only in testis and not in liver, kidney, and spleen. (C ) A HemT-3 band is detected in adult and day 17 (d17) mouse testis, but not in day 7 (d7) mouse testis.
Acknowledgements We thank Shenwei Qin, Hariy Raftopoulos, Maureen Ward, Andrea Streit, Claudio Stern and Argiris Efstratiadis for helpful discussions and advice. This work was supported by Public Health Service grants DK25274, HL28381 and PHL059887 from the National Institutes of Health and a grant from the Ahepa Cooley’s anemia foundation. D.O. was supported by an NIH Clinical Investigator Award (DK02260).
References Behrendt, N., Ploug, M., Patthy, L., Houen, G., Blasi, F., Dano, K., 1991. The ligand binding domain of the cell surface receptor for urokinase-type plasminogen activator. J. Biol. Chem. 266, 7842–7847. Broudy, V.C., 1997. Stem cell factor and hematopoiesis. Blood 90, 1345–1364. Chabot, B., Stephenson, D.A., Chapman, V.M., Besmer, P., Bernstein, A., 1988. The proto-oncogene c-kit encoding a transmembrane tyrosine kinase receptor maps to the mouse W locus. Nature 335, 88–89. Chapman, D.L., Wolgemuth, D.J., 1992. Identification of a mouse B-type cyclin which exhibits developmentally regulated expression in the germ line. Mol. Reprod. Dev. 33, 259–269.
199
Furuhata, T., Tokino, T., Urano, T., Nakamura, Y., 1996. Isolation of a novel GPI anchored gene specifically regulated by p53 correlation between its expression and anti-cancer drug sensitivity. Oncogene 13, 1965–1970. Geissler, E.N., Ryan, M.A., Housman, D.E., 1988. The dominantwhite spotting ( W ) locus of the mouse encodes the c-kit protooncogene. Cell 55, 185–192. Herrada, G., Wolgemuth, D.J., 1997. The mouse transcription factor Stat4 is expressed in haploid male germ cells and is present in the perinuclear theca of spermatozoa. J. Cell Sci. 110, 1543–1553. Hobert, O., Sures, I., Ciossek, T., Fuchs, M., Ullrich, A., 1996. Isolation and developmental expression analysis of Enx-1, a novel mouse Polycomb group gene. Mech. Dev. 55, 171–184. Hooper, N.M., Bashir, A., 1991. Glycosyl-phosphatidylinositolanchored membrane proteins can be distinguished from transmembrane polypeptide-anchored proteins by differential solubilization and temperature-induced phase separation in Triton X-114. Biochem. J. 280, 745–751. Ikezawa, H., 1991. Bacterial PIPLCs-unique properties and usefulness in studies on GPI anchors. Cell Biol. Int. Rep. 15, 1115–1131. Ito, E., Toki, T., Ishihara, H., Ohtani, H., Gu, L., Yokoyama, M., Engel, J.D., Yamamoto, M., 1993. Erythroid transcription factor GATA-1 is abundantly transcribed in mouse testis. Nature 362, 466–468. Jaffe, L., Jeannotte, L., Bikoff, E.K., Robertson, E.J., 1990. Analysis of beta 2-microglobulin gene expression in the developing mouse embryo and placenta. J. Immunol. 145, 3474–3482. Jameson, B.A., Wolf, H., 1988. The antigenic index: a novel algorithm for predicting antigenic determinants. Comput. Appl. Biosci. 4, 181–186. Kimura, Y., Furuhata, T., Shiratsuchi, T., Nishimori, H., Hirata, K., Nakamura, Y., Tokino, T., 1997a. GML sensitizes cancer cells to Taxol by induction of apoptosis. Oncogene 15, 1369–1374. Kimura, Y., Furuhata, T., Urano, T., Hirata, K., Nakamura, Y., Tokino, T., 1997b. Genomic structure and chromosomal localization of GML (GPI-anchored molecule-like protein), a gene induced by p53. Genomics 41, 477–480. Liu, Q., Shalaby, F., Jones, J., Bouchard, D., Dumont, D.J., 1998. The SH2-containing inositol polyphosphate 5-phosphatase, ship, is expressed during hematopoiesis and spermatogenesis. Blood 91, 2753–2759. Merika, M., Orkin, S.H., 1993. DNA-binding specificity of GATA family transcription factors. Mol. Cell. Biol. 13, 3999–4010. Pevny, L., Simon, M.C., Robertson, E., Klein, W.H., Tsai, S.F., D’Agati, V., Orkin, S.H., Costantini, F., 1991. Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1. Nature 349, 257–260. Ploug, M., Kjalke, M., Ronne, E., Weidle, U., Hoyer-Hansen, G., Dano, K., 1993. Localization of the disulfide bonds in the NH2-terminal domain of the cellular receptor for human urokinase-type plasminogen activator. A domain structure belonging to a novel superfamily of glycolipid-anchored membrane proteins. J. Biol. Chem. 268, 17 539–17 546. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Plainview, NY. Wall, L., deBoer, E., Grosveld, F., 1988. The human beta-globin gene 3∞ enhancer contains multiple binding sites for an erythroid-specific protein. Genes Dev. 2, 1089–1100. Wolgemuth, D.J., Watrin, F., 1991. List of cloned mouse genes with unique expression patterns during spermatogenesis. Mamm. Genome 1, 283–288. Xue, H., O’Neil, D., Morrow, J., Bank, A., 1999. A novel mouse gene, HemT, encoding an hematopoietic cell-specific transcript. Gene 231, 49–58.
HemT-3, an alternative transcript of mouse gene HemT specific to male germ cells Haifeng Xue a, David O’Neill a,b, Xiangyuan Wang a, Debra J. Wolgemuth a, Arthur Bank a,c, * a Department of Genetics and Development, Columbia University College of Physicians and Surgeons, New York, NY 10032, USA b Department of Pathology, Columbia University College of Physicians and Surgeons, New York, NY 10032, USA c Department of Medicine, Columbia University College of Physicians and Surgeons, New York, NY 10032, USA Received 14 June 1999; accepted 27 August 1999 Received by L. Luzzatto
Abstract A number of genes are known to be expressed primarily in hematopoietic cells and testis and are thought to function in the control of both blood cell and male germ cell differentiation. We have recently identified a mouse gene, HemT, that encodes two alternatively spliced transcripts specific to hematopoietic cells (HemT-1 and HemT-2) and kidney (HemT-2). We have now isolated a third HemT transcript, HemT-3, that is found only in testis by Northern blot analysis and RT-PCR. HemT-3 is alternatively spliced and may be initiated differently from HemT-1 and HemT-2. RNA in-situ hybridization of testis from wild-type and germcell-deficient adult mice, as well as from mice at different developmental stages, indicates that HemT-3 is expressed only in early spermatocytes. HemT-3 cDNA has a major open reading frame related to a human glycosylphosphatidylinositol (GPI )-anchored protein, GML. Using an antibody generated against a peptide derived from the HemT-3 open reading frame, we have detected a testis-specific 22 kDa protein by Western blot analysis. © 1999 Elsevier Science B.V. All rights reserved. Keywords: Alternative splicing; Hematopoiesis; HemT; HemT-3; Male germ cells; Spermatogenesis; Testis
1. Introduction Several genes have been described that are involved in hematopoisis and spermatogenesis, processes that involve the continuous production of large numbers of differentiated cells from relatively few stem cells. For example, naturally occurring mutations of the genes encoding stem cell factor (SCF ) and its receptor, c-kit, are associated with sterility and anemia, due to the failure of stem cells in the testes and bone marrow to migrate and proliferate effectively during development (Chabot et al., 1988; Geissler et al., 1988; Broudy, 1997). A variety of genes have also been identified that are Abbreviations: BCIP, 5-bromo-4-chloro-3-indolylphosphate; GPI, glycosylphosphatidylinositiol; MAP, multiple antigen peptide; MELC, murine erythroleukemia cells; NBT, Nitro-blue Tetrazolium; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; PIPLC, phosphatidylinositol-specific phospholipase C; RAC, rapid amplification of cDNA ends; RT, reverse transcriptase; TBS, tris-buffered saline. * Corresponding author. Tel.: +1-212-305-4186; fax: +1-212-923-2090. E-mail address: [email protected] (A. Bank)
expressed primarily in hematopoietic cells and testis, and these genes may similarly be involved in the control of both blood-cell- and male-germ-cell differentiation. The gene encoding GATA-1, an erythroid cell-specific transcription factor that is essential for erythroid differentiation (Pevny et al., 1991), also encodes a differently initiated transcript in testis (Ito et al., 1993). Ship, an SH2-containing inositol polyphosphate 5-phosphatase that is thought to function in signaling, is expressed both during hematopoiesis and spermatogenesis (Liu et al., 1998), and Enx-1, a mouse Polycomb group gene, is expressed primarily in spleen and testis in adult animals (Hobert et al., 1996). In a screen for hematopoietic cell-specific genes, we recently identified a mouse gene, Hem-T, that is preferentially expressed in mouse erythroleukemia cells (MELC ) before induction with known inducers of differentiation ( Xue et al., 1999). Hem-T was found to encode two RNA transcripts. HemT-1 is hematopoietic-cell-specific and may be erythroid-specific. The second transcript, HemT-2, is expressed in both hematopoietic tissues and
0378-1119/99/$ - see front matter © 1999 Elsevier Science B.V. All rights reserved. PII: S0 3 7 8 -1 1 1 9 ( 9 9 ) 0 0 40 1 - 1
194
H. Xue et al. / Gene 240 (1999) 193–199
kidney. The cDNAs of both transcripts have been cloned and found to be products of alternative splicing ( Xue et al., 1999). We have now isolated a third HemT transcript, HemT-3, that is found only in testis by Northern blot analysis and RT-PCR. HemT-3 is alternatively spliced and may be initiated differently from HemT-1 and HemT-2. By studying HemT-3 expression in sections of testis from wild-type and germ-cell-deficient adult mice, as well as from mice at different development stages, we show that HemT-3 is expressed only in early spermatocytes. HemT-3 cDNA has a major open reading frame related to a human glycosylphosphatidylinositol (GPI )anchored protein, GML (Furuhata et al., 1996; Kimura et al., 1997a,b). We show that a testis-specific 22 kDa protein is detected in Western blots using an antibody generated against a peptide derived from this open reading frame, and that this HemT-3 product is only expressed in testis.
2. Materials and methods 2.1. EMBL Accession Nos HemT genomic DNA sequence: Accession No. AJ242830; HemT-3 cDNA sequence: Accession No. AJ242831. 2.2. Obtaining the 5∞ and 3∞ ends of HemT-3 cDNA Rapid amplification of cDNA ends (RACE) was performed to obtain the 5∞ and 3∞ ends of the HemT-3 cDNA using a 5∞/3∞ RACE kit (Boehringer Mannheim) according to the manufacturer’s instructions. 2.3. RNA in-situ hybridization RNA in-situ hybridization was performed on histological sections of testes using a procedure modified from several described methods (Jaffe et al., 1990; Chapman and Wolgemuth, 1992). Rehydrated slides were fixed in 4% paraformaldehyde for 20 min, washed in PBS for 5 min twice, treated with 10 mg/ml of Proteinase K for 7 min, washed in PBS for 5 min twice, treated with 10 mg/ml of Proteinase K for 7 min, washed in PBS for 5 min twice, refixed for 5 min in 4% paraformaldehyde, and then incubated in 0.1 M triethanolamine (pH 8.0) with a 1/400 dilution of acetic anhydride for 10 min. The slides were then washed in PBS for 5 min twice, dehydrated, and then pre-hybridized at 50°C for 2 h in 50% formamide, 4× SSC, 1× Denhart’s solution (Sambrook et al., 1989) and 0.5 mg/ml of denatured salmon sperm DNA. Hybridization was then carried out at 50°C overnight in 50% formamide, 4× SSC, 1× Denhart’s solution, 0.5 mg/ml denatured salmon sperm DNA, 10% dextran sulfate, and 200–500 ng/ml of a
digoxygenin-labeled antisense or sense (as control ) RNA probe. The RNA probes were generated by in-vitro transcription of a pBluescript IISK(+) phagemid containing the HemT-3 cDNA insert. After hybridization, the slides were washed successively in excess amounts of formamide wash buffer (50% formamide, 1× SSC ) for 30 min at 50°C, 0.5× SSC for 30 min at room temperature, RNase solution (20 mg/ml RNase A in 3.5× SSC ) for 15 min at room temperature 3.5× SSC for 10 min at room temperature twice, and 0.1× SSC at 65°C for 1 h. The slides were then incubated successively in maleic buffer (100 mM maleic acid, 150 mM Tris, pH 7.5) for 5 min, blocking buffer (10% Boehringer Mannheim Blocking Reagent in maleic buffer) for 30 min, and then in a 1:200 dilution of alkaline phosphatase conjugated anti-digoxygenin antibody (Boehringer Mannheim) for 2 h. The slides were then washed four times for 5 min each in maleic buffer and then incubated in detection buffer (100 mM Tris, 100 mM NaCl, pH 9.5) for 10 min. Color development was carried out in the dark in color substrate solution [45 ml NBT and 35 ml BCIP (Boehringer Mannheim) freshly mixed with 10 ml of detection buffer]. After color development was complete, the slides were washed in PBS, fixed in 4% paraformaldehyde and mounted in Aqua Poly/Mount (Polysciences). 2.4. Generation of polyclonal antibodies Polyclonal antibodies were generated against synthetic peptides. The sequence of the peptide was selected primarily based on the Antigen Index (James–Wolf method ) (Jameson and Wolf, 1988), utilizing the Wisconsin sequence analysis package (GCG). Multiple antigen peptides (MAPs) were synthesized in the Protein Chemistry Core Facility of the Howard Hughes Medical Institute, Columbia University. Rabbit immunization with the MAPs was then performed by Cocalico Biologicals, Inc. Serum samples from several test bleeds were obtained and used to perform ELISAs against the MAP directly. When a strong interaction between the serum and the MAP was detected, rabbit serum was collected. 2.5. Immunoblotting Mouse tissues were homogenized in 50 mM Tris– HCl, pH 6.8, 2% SDS, and 1 mM PMSF at 4°C. Protein concentrations were determined using a spectrophotometer. Extracts were diluted in Laemmli sample buffer (Bio Rad ), boiled for 3 min, and run on 16.5% Tris– Tricine ready gels (Bio Rad) for 60 min at 200 V. Gels were electroblotted onto nitrocellulose or PVDF membranes (Bio Rad). Membranes were first incubated in blocking buffer (tris-buffered saline ( TBS ) with 5% nonfat dry milk and 0.1% Tween-20) overnight at 4°C, and then with antibody diluted in blocking buffer for 1 h at
H. Xue et al. / Gene 240 (1999) 193–199
195
room temperature. Pre-immune serum from the same rabbit was used as a negative control. In some control experiments, antibody was first incubated with an excess amount of the peptide used for immunization on ice for 30 min prior to incubation with the blot. Membranes were washed once in TBS with 0.1% Tween-20 ( TBST ) for 15 min and then twice more for 5 min, incubated with horse-radish peroxidase conjugated goat anti-rabbit IgG (Santa Cruz biotechnology) diluted in TBST for 30 min, then washed in TBST once for 15 min and then twice for 5 min. A Western blotting detection reagent kit ( ECL kit, Amersham/Pharmacia) was used for the detection step.
3. Results and discussion 3.1. Cloning of HemT-3 cDNA We have previously reported the identification of a mouse gene, HemT, using differential display, which produces two alternatively spliced transcripts (HemT-1 and HemT-2) in MELC ( Xue et al., 1999). The HemT-1 message is detected only in hematopoietic tissues, whereas HemT-2 is detected in both hematopoietic tissues and kidney. We also reported that a longer (1.1 kb) HemT transcript (HemT-3) is detected only in mouse testis by Northern blot analysis using a 412 bp cDNA
Fig. 2. HemT-3 cDNA sequence. The cDNA sequence was obtained by subcloning and sequencing several RT-PCR and RACE products of HemT-3 transcript. The deduced amino acid sequence of the open reading frame is shown under the cDNA sequence.
Fig. 1. Analysis of HemT-3 sequence using primers for HemT-1 and HemT-2. Transcript HemT-1, which is hematopoietic-cell-specific, consists of exon 1 and exon 2. Transcript HemT-2, which is expressed in hematopoietic cells and kidney, consists of exon 1 (minus 38 bp at 3∞end) and exon 2. RT-PCR primer set 1 (upstream primer: 5∞ATGGATGCCGTCTAGAAGGG, downstream primer: 5∞GGTGCAGTCCTTGAGAACCAT ) was used in the original RT-PCR experiment to study HemT expression ( Xue et al., 1999). RT-PCR primer set 2 used the same uptream primer (5∞-ATGGATGCCGTCTAGAAGGG) as RT-PCR primer set 1. The 3∞ primer of RT-PCR primer set 2 is 5∞-GGTGCTCTTGACACTGTCTCT. The arrows indicate the locations of the primers used in the RT-PCR experiments to amplify the testis-specific HemT-3 cDNA.
probe generated from the 3∞ end of HemT-1 ( Xue et al., 1999). In addition, a 635 bp RT-PCR product is amplified only from testis RNA using primers (RT-PCR primer set 1) ( Fig. 1) to generate 244 bp (HemT-1) and 206 bp (HemT 2) products from MELC RNA ( Xue et al., 1999). To characterize HemT-3, we subcloned and sequenced the 635 bp testis RT-PCR product. Surprisingly, we found that only 39 bp at the 3∞ end of the HemT-3 sequence matched the HemT-1/HemT-2 cDNA sequence. This match corresponds to the very 5∞ end of HemT/exon 2, and the sequences diverge exactly at the intron/exon 2 junction (Fig. 1). We repeated the
196
H. Xue et al. / Gene 240 (1999) 193–199
3.2. HemT-3 is related to human GML
Fig. 3. Comparison of the deduced amino acid sequence of mouse HemT-3 and human GML (GPI-anchored molecule like protein). Amino acid sequences are deduced from the cDNA sequence. An approximately 51% similarity and 44% identity are found between the two predicted proteins. The 10 conserved cysteines are indicated in bold.
amplification from testes RNA using a second 3∞ primer that anneals to HemT-1 and HemT-2 further downstream (RT-PCR primer set 2), ( Fig. 1). Sequencing of the resulting product again showed that the sequences of the MELC transcripts (HemT-1 and HemT-2) and the testis transcript (HemT-3) are identical within exon 2, and diverge upstream of the intron/exon 2 junction (Fig. 1). This suggested that HemT-3 is spliced alternatively from HemT-1 and HemT-2, with all three transcripts having exon 2 in common, and that the 5∞ primer used in the RT-PCR reactions annealed to the testes transcript non-specifically. We then used 5∞ and 3∞ RACE with testes RNA to obtain a full-length HemT-3 cDNA clone. The complete cDNA sequence of HemT-3 is shown in Fig. 2. The 951 bp cDNA includes a 531 bp open reading frame coding for a 177-amino-acid polypeptide (Fig. 2).
Using a BLAST search, we found that HemT-3 shares a significant homology to a cloned human cDNA, GML (GPI-anchored molecule like protein) ( Furuhata et al., 1996) both at the cDNA sequence level (data not shown) and at the deduced amino acid sequence level (Fig. 3). The level of similarity between the two deduced proteins is approximately 51%. There are 10 cysteine residues that are conserved between the two proteins within the core GPI anchor motif, which is found in a variety of cell-surface glycoproteins (Behrendt et al., 1991; Ploug et al., 1993). The amino acid sequence of HemT-3 has one mismatch with the consensus pattern of this motif (the GPI anchor consensus pattern is [EQR]-C[LIVMFYAH ]-x-C-x ( 5,8 )-C-x ( 3,8 )-[ EDNQSTV ]-C{C}x(5)-C-x(12,24)-C, and HemT-3 has a Y in the position for [EDNQSTV ]). The human GML gene, which is located on human chromosome 8q24.3 ( Kimura et al., 1997b), is expressed only in human testis at a level detectable by Northern blot, and is activated by p53 (Furuhata et al., 1996). GML expression seems to increase the susceptibility of cells to be killed by taxol ( Kimura et al., 1997a). The similarities in sequence and expression pattern strongly suggest that mouse HemT-3 is related to human GML. 3.3. HemT-3 is initiated and spliced differently from HemT-1 and HemT-2 By aligning the sequence of HemT-3 cDNA with that of a HemT genomic DNA clone previously described ( Xue et al., 1999), we established the intron/exon struc-
Fig. 4. HemT genomic DNA structure: 4.5 kb of cloned and sequenced HemT genomic DNA, which includes all the exons, is shown. Three types of HemT transcripts have been identified. Transcript HemT-1, which consists of exon 3 and 4 (exons 1 and 2 in Fig. 1), is only found in hematopoietic tissues (bone marrow, spleen, and day 14 fetal liver) and erythroid cell lines (MELC, BBB8), and thus is hematopoietic-cell-specific and may be erythroid-cell-specific. Transcript HemT-2, which consists of exon 3 (minus 38 bp at its 3∞ end ) and exon 4, is found in hematopoietic tissues and cell lines (EL4, MELC, BB8B) and kidney. Transcript HemT-3, which consists of exon 1, 2, and 4, is only found in testis. The 5∞ donor sequence of intron 1 (between exon 1 and 2) is GT…, and the 3∞ acceptor sequence is …AG. Similarly, the other exon–intron junctions have appropriate consensus donor and acceptor sequences ( EMBL Accession No. AJ242830).
H. Xue et al. / Gene 240 (1999) 193–199
197
ture for all three transcripts ( Fig. 4). HemT-1, which is hematopoietic cell-specific (and perhaps erythroid cellspecific), consists of exon 3 and exon 4 (initially named exons 1 and 2). HemT-2, which is expressed in hematopoietic tissues and kidney, also consists of exon 3 (but with an alternate splice donor site 38 bp upstream of that for HemT-1) and exon 4. HemT-3, the testis-specific transcript, consists of exon 1, exon 2, and exon 4. Consensus donor and acceptor splice sequences are present at all exon–intron junctions ( Fig. 4, EMBL Accession No. AJ242830). Because HemT-3 has a different first exon, HemT-3 transcription most probably initiates differently from HemT-1 and HemT-2. This notion is reinforced by the observation of minor bands seen on Northern blot that fit the size of unspliced HemT-3 pre-mRNA in testes and HemT-1/HemT-2 pre RNA in MELC ( Xue et al., 1999). The mechanisms involved in the regulation of the tissue-specific expression of HemT-1, HemT-2 and HemT-3 remain to be understood. We have no evidence that HemT-1 and HemT-2 are translated into proteins ( Xue et al., 1999). They may be active as RNA. It is also interesting to note that there is a binding site for GATA-1 ( Wall et al., 1988; Merika and Orkin, 1993), an erythroid-cell-specific transcription factor, immediately upstream of exon 3 (originally called exon 1), the presumed transcription initiation site for HemT-1 and HemT-2 (data not shown). 3.4. HemT-3 RNA is expressed only in early spermatocytes To determine which cells in testis express HemT-3, we performed RNA in-situ hybridization on histological sections of mouse testis. Spermatogenesis in adult mouse testis has been well characterized histologically, with spermatogonia, the stem cells, located at the periphery of the testicular tubules, and more differentiated cells located toward the lumen (Herrada and Wolgemuth, 1997). Antisense HemT-3 riboprobes yield positive signals in germ cells at peripheral regions of adult testicular tubules ( Fig. 5), indicating that HemT-3 is expressed in earlier, less differentiated male germ cells. Only a very weak HemT-3 signal, which appears to be located in a small number of remaining germ cells, is detected in testes of germ-cell-deficient WWv mice ( Fig. 5), confirming that HemT-3 is expression is germ-cell-specific. These results do not indicate, however, whether HemT-3 is expressed in spermatogonia, in more differentiated spermatocytes, or in both cell types. To determine more precisely which specific spermatogenic cell types express HemT-3, we performed RNA in-situ hybridization on testes from mice at three different developmental stages: 7 day old (d7), 17 day-old (d17), and adult mice (Fig. 6). Day 7 testes contain mitotic spermatogonia only, whereas d17 testes have entered
Fig. 5. RNA in-situ hybridization on wild-type and WWv germ-celldeficient adult mouse testis. (A) Hematoxylin and eosin (H and E ) staining of wild-type mouse testis (100×). (B) H and E staining of WWv mouse testis (200×). (C ) RNA in-situ hybridization on wildtype mouse testis (100×). (D) RNA in-situ hybridization on WWv mouse testis (200×). ( E) RNA in-situ hybridization on wild-type mouse testis (400×). (F ) RNA in-situ hybridization on WWv mouse testis (400×). Digoxygenin-labeled riboprobe is generated by in-vitro transcription from a pBluescript II phagemid containing the 3∞ end of the HemT-3 cDNA (corresponding to nucleotides 540–951). Positive signals are present in the peripheral regions of the wild-type testicular tubules and weakly present in a few remaining germ cells in WWv mouse testis.
meiosis and contain both spermatogonia and spermatocytes. Both d7 and d17 testes lack post-meiotic spermatids, while adult testes contain spermatogonia, spermatocytes and spermatids [reviewed in Wolgemuth and Watrin (1991)]. As shown in Fig. 6, no significant positive signals were present in d7 testis, but were present in the center of the d 17 testicular tubules and at the periphery of the adult testicular tubules. These results strongly suggest that HemT 3 RNA is expressed only in spermatocytes that are in meiotic prophase.
198
H. Xue et al. / Gene 240 (1999) 193–199
Fig. 6. RNA in-situ hybridization on day 7, day 17, and adult mouse testis. (A) H and E staining of day 7 mouse testis (200×). (B). H and E staining of day 17 mouse testis ( 100×). (C ) H and E staining of adult mouse testis (100×). (D) RNA in-situ hybridization on day 7 mouse testis (200×). (E ) RNA in-situ hybridization on day 17 mouse testis (100×). (F ) RNA in-situ hybridization on adult mouse testis (100×). (G) RNA in-situ hybridization on day 7 mouse testis (400×). (H ) RNA in-situ hybridization on day 17 mouse testis (400×). (I ) RNA in-situ hybridization on adult mouse testis (400×). Digoxygenin-labeled riboprobe is generated by in-vitro transcription from a pBluescript II phagemid containing the 3∞ end of the HemT-3 cDNA (corresponding to nucleotides 540–951). In day 7 testis, there are no significant specific positive signals. In day 17 testis, positive signals are present in the center of the testicular tubules. In adult testis, positive signals are present in the peripheral regions of the testicular tubules.
3.5. HemT-3 protein expression is restricted to expression in testis To characterize the tissue expression of HemT-3 protein, we generated an antibody against a 20-aminoacid synthetic peptide derived from the HemT-3 major open reading frame. Anti-HemT-3 antibody recognizes a protein of about 22 kDa in mouse testis by immunoblotting (Fig. 7), very close to the size of the predicted HemT-3 protein (about 20 kDa). This 22 kDa band is not present in other mouse tissues tested (Fig. 7B), similar to the pattern of HemT-3 RNA expression ( Xue et al., 1999). In addition, the 22 kDa protein is present in adult and d17 testes, but is essentially absent in d7 testes (Fig. 7C ), consistent with the pattern of HemT-3 expression observed in in-situ hybridization experiments (Fig. 6). As mentioned previously, the deduced HemT-3 protein shares about 50% homology with the deduced amino acid sequence of a human cDNA, GML (GPI-anchored molecule like protein), and is particularly homologous to GML within its GPI-anchor motif, suggesting that the HemT-3 product is a GPI-linked cell surface glycoprotein. Biochemical experiments using detergent fractionation (Hooper and Bashir, 1991) and PIPLC treatment
(Ikezawa, 1991) were performed and are consistent with HemT-3 being a GPI-anchored membrane protein, but do not prove that it is (data not shown). In summary, we report the identification and characterization of mouse HemT-3, a testes-specific transcript that most likely encodes a GPI-anchored membrane protein related to human GML. HemT-3 is alternatively spliced and initiated differently from the other HemT transcripts previously described that are expressed in hematopoietic cells (HemT-1 and HemT-2) and kidney (HemT-2). Expression of HemT-3 is restricted to male germ cells relatively early in differentiation (spermatocytes in meiotic prophase). It is interesting to note the parallels in the expression patterns of the HemT transcripts, that is, HemT-3 is shut off before the final stages of spermatogenesis, and HemT-1 and HemT-2 are shut off before the final stages of erythropoiesis. Although the biological functions of the three HemT transcripts and HemT-3 protein are unclear, the very restricted expression patterns of its various transcripts, as well as the observation that HemT-3 encodes a polypeptide while HemT-1 and HemT-2 lack obvious open reading frames, are of potential interest. Targeted mutagenesis of the HemT gene may reveal the function of the HemT gene and its various transcripts.
H. Xue et al. / Gene 240 (1999) 193–199
Fig. 7. Western Blotting analyses using anti-HemT-3 antibody. (A) Control experiment using adult mouse testis protein. Lane 1, antiHemT3 serum used. Lane 2, pre-immune serum. Lane 3, anti-HemT3 serum was first incubated with HemT-3 antigen (18-amino-acid synthetic peptide) and then reacted with testis protein. (B) A band of approximately 22 kDa is detected only in testis and not in liver, kidney, and spleen. (C ) A HemT-3 band is detected in adult and day 17 (d17) mouse testis, but not in day 7 (d7) mouse testis.
Acknowledgements We thank Shenwei Qin, Hariy Raftopoulos, Maureen Ward, Andrea Streit, Claudio Stern and Argiris Efstratiadis for helpful discussions and advice. This work was supported by Public Health Service grants DK25274, HL28381 and PHL059887 from the National Institutes of Health and a grant from the Ahepa Cooley’s anemia foundation. D.O. was supported by an NIH Clinical Investigator Award (DK02260).
References Behrendt, N., Ploug, M., Patthy, L., Houen, G., Blasi, F., Dano, K., 1991. The ligand binding domain of the cell surface receptor for urokinase-type plasminogen activator. J. Biol. Chem. 266, 7842–7847. Broudy, V.C., 1997. Stem cell factor and hematopoiesis. Blood 90, 1345–1364. Chabot, B., Stephenson, D.A., Chapman, V.M., Besmer, P., Bernstein, A., 1988. The proto-oncogene c-kit encoding a transmembrane tyrosine kinase receptor maps to the mouse W locus. Nature 335, 88–89. Chapman, D.L., Wolgemuth, D.J., 1992. Identification of a mouse B-type cyclin which exhibits developmentally regulated expression in the germ line. Mol. Reprod. Dev. 33, 259–269.
199
Furuhata, T., Tokino, T., Urano, T., Nakamura, Y., 1996. Isolation of a novel GPI anchored gene specifically regulated by p53 correlation between its expression and anti-cancer drug sensitivity. Oncogene 13, 1965–1970. Geissler, E.N., Ryan, M.A., Housman, D.E., 1988. The dominantwhite spotting ( W ) locus of the mouse encodes the c-kit protooncogene. Cell 55, 185–192. Herrada, G., Wolgemuth, D.J., 1997. The mouse transcription factor Stat4 is expressed in haploid male germ cells and is present in the perinuclear theca of spermatozoa. J. Cell Sci. 110, 1543–1553. Hobert, O., Sures, I., Ciossek, T., Fuchs, M., Ullrich, A., 1996. Isolation and developmental expression analysis of Enx-1, a novel mouse Polycomb group gene. Mech. Dev. 55, 171–184. Hooper, N.M., Bashir, A., 1991. Glycosyl-phosphatidylinositolanchored membrane proteins can be distinguished from transmembrane polypeptide-anchored proteins by differential solubilization and temperature-induced phase separation in Triton X-114. Biochem. J. 280, 745–751. Ikezawa, H., 1991. Bacterial PIPLCs-unique properties and usefulness in studies on GPI anchors. Cell Biol. Int. Rep. 15, 1115–1131. Ito, E., Toki, T., Ishihara, H., Ohtani, H., Gu, L., Yokoyama, M., Engel, J.D., Yamamoto, M., 1993. Erythroid transcription factor GATA-1 is abundantly transcribed in mouse testis. Nature 362, 466–468. Jaffe, L., Jeannotte, L., Bikoff, E.K., Robertson, E.J., 1990. Analysis of beta 2-microglobulin gene expression in the developing mouse embryo and placenta. J. Immunol. 145, 3474–3482. Jameson, B.A., Wolf, H., 1988. The antigenic index: a novel algorithm for predicting antigenic determinants. Comput. Appl. Biosci. 4, 181–186. Kimura, Y., Furuhata, T., Shiratsuchi, T., Nishimori, H., Hirata, K., Nakamura, Y., Tokino, T., 1997a. GML sensitizes cancer cells to Taxol by induction of apoptosis. Oncogene 15, 1369–1374. Kimura, Y., Furuhata, T., Urano, T., Hirata, K., Nakamura, Y., Tokino, T., 1997b. Genomic structure and chromosomal localization of GML (GPI-anchored molecule-like protein), a gene induced by p53. Genomics 41, 477–480. Liu, Q., Shalaby, F., Jones, J., Bouchard, D., Dumont, D.J., 1998. The SH2-containing inositol polyphosphate 5-phosphatase, ship, is expressed during hematopoiesis and spermatogenesis. Blood 91, 2753–2759. Merika, M., Orkin, S.H., 1993. DNA-binding specificity of GATA family transcription factors. Mol. Cell. Biol. 13, 3999–4010. Pevny, L., Simon, M.C., Robertson, E., Klein, W.H., Tsai, S.F., D’Agati, V., Orkin, S.H., Costantini, F., 1991. Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1. Nature 349, 257–260. Ploug, M., Kjalke, M., Ronne, E., Weidle, U., Hoyer-Hansen, G., Dano, K., 1993. Localization of the disulfide bonds in the NH2-terminal domain of the cellular receptor for human urokinase-type plasminogen activator. A domain structure belonging to a novel superfamily of glycolipid-anchored membrane proteins. J. Biol. Chem. 268, 17 539–17 546. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Plainview, NY. Wall, L., deBoer, E., Grosveld, F., 1988. The human beta-globin gene 3∞ enhancer contains multiple binding sites for an erythroid-specific protein. Genes Dev. 2, 1089–1100. Wolgemuth, D.J., Watrin, F., 1991. List of cloned mouse genes with unique expression patterns during spermatogenesis. Mamm. Genome 1, 283–288. Xue, H., O’Neil, D., Morrow, J., Bank, A., 1999. A novel mouse gene, HemT, encoding an hematopoietic cell-specific transcript. Gene 231, 49–58.