- Email: [email protected]
Hepatitis C virus core protein expression leads to biphasic regulation of the p21 cdk inhibitor and modulation of hepatocyte cell cycle
Available online at www.sciencedirect.com R
Virology 312 (2003) 245–253
www.elsevier.com/locate/yviro
Hepatitis C virus core protein expression leads to biphasic regulation of the p21 cdk inhibitor and modulation of hepatocyte cell cycle Hau Nguyen,a,1 Maria Mudryj,a,b,1 Moraima Guadalupe,a and Satya Dandekara,* a
Department of Medical Microbiology and Immunology, School of Medicine, University of California, Davis, CA 95616, USA b VA NCHS, Mather, CA 95655, USA Received 6 December 2002; accepted 18 February 2003
Abstract Hepatitis C virus (HCV) Core protein is implicated in viral pathogenesis by the modulation of hepatocyte gene expression and function. To determine the effect of Core protein on the cell-cycle control of hepatocytes, a HepG2 cell line containing a Flag-tagged Core under the control of an inducible promoter was generated. Initial Core protein expression included the presence of unprocessed (191 aa) and processed (173 aa) forms of the Core proteins with the processed form becoming dominant later. Expression of the 191 aa form of Core protein corresponded to an increase in the expression of the p21, a decrease in cdk2-dependent kinase activity, and a decrease in the percentage of cells in S-phase along with an accumulation of cells in the G0/G1 phase of the cell cycle. As the processed form accumulated, the p21 levels started to decline, suggesting that Core protein regulates p21 expression in a biphasic manner. These findings implicate Core protein in potentially modulating hepatocyte cell cycle differentially in the early stages of infection through biphasic regulation of p21 cdk kinase inhibitor. © 2003 Elsevier Science (USA). All rights reserved. Keywords: HCV; Core protein; p21; Cell cycle; cdk2; Biphasic
Introduction The hepatitis C virus (HCV) is the etiologic agent of acute and chronic hepatitis affecting more than 100 million people worldwide (Uchida, 1994). Chronic hepatitis is one of the leading causes of liver cirrhosis and hepatocellular carcinoma (Saito et al., 1990), but the precise role of HCV in the development of this cancer has not been elucidated. HCV, a member of the flavivirus family, has a 9.5-kb positive single-stranded RNA genome, which encodes a polyprotein that is processed into at least 10 different structural and nonstructural proteins (Choo et al., 1989; Ray and Ray, 2001). The HCV core protein is derived from the N-terminus of the polypeptide and has a highly basic Nterminal region and a highly hydrophobic C-terminus (Kunkel and Watowich, 2002). In addition to being the
* Corresponding author. E-mail address: [email protected] (S. Dandekar). 1 Nguyen and Mudryj contributed equally to the manuscript.
major component of the viral nucleocapsid, this multifunctional protein has also been implicated in hepatocyte proliferation and transformation. However, its role in hepatocyte proliferation and tumorogenesis has not been well elucidated. HCV Core protein is proteolytically processed and several molecular weight variants of Core protein have been identified. The 191 amino acid (aa) form encodes a 21-kDa protein. This 21-kDa form can be further proteolytically processed to a p19-kDa form that consists of 173 aa or to a minor 16-kDa form (Lo et al., 1995). Lo et al. (1995) reported that the p21 and p19 forms localized to the cytoplasm. Furthermore, Yamanaka et al. (2002) reported that 191 aa form of Core localized to the cytoplasm, while the 173 aa form could localize to the nucleus. Yasui et al. (1998) report that the processed form of Core protein resides in both the cytoplasm and the nucleus, but that the nuclear form has higher order structure that differs from the structure of the cytoplasmic form. In addition, Core protein can be degraded by ubiquitin-mediated proteolysis and that
0042-6822/03/$ – see front matter © 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S0042-6822(03)00209-5
246
H. Nguyen et al. / Virology 312 (2003) 245–253
processing of the C-terminal domain may affect the ubiquitination process (Suzuki et al., 2001). The distinct subcellular localization and differing stability of the various forms of Core protein raises the possibility that they may have distinct biological functions and may impact viral pathogenesis. However, our knowledge of the functions of these different core proteins remains limited. It is also not known how the combination of both immature and mature forms of Core protein will impact hepatocyte proliferation and function. Effects of the Core protein on various cellular processes have been studied in human and nonhuman cells. Expression of the Core protein in the liver of transgenic mice induces hepatic steatosis (Moriya et al., 1997) and promotes the development of hepatocellular carcinomas (Moriya et al., 1998). The ability of Core protein to mimic the HCV disease process argues that the expression of this protein is integral to HCV pathogenesis. Cells that stably express Core protein exhibit an accumulation of lipid droplets and the Core protein colocalizes with apolipoprotein AII (Barba et al., 1997; Sabile et al., 1999). Some studies indicate that HCV Core protein cooperates with the ras oncogene to transform primary rat embryo fibroblasts (REF) (Ray et al., 1996), while others argue that while Core has oncogenic potential, it is not sufficient to cooperate, with ras to transform primary REF (Chang et al., 1998). In addition, Core protein can activate the c-myc promoter but suppresses the fos promoter (Ray et al., 1995). Some studies have reported that cyclin E, a protein instrumental in the transversal of the G1/S checkpoint, is elevated in cells expressing Core protein (Cho et al., 2001a). Lu et al. (1999) reported that the p53 tumor suppressor is activated by expression of Core protein. A number of studies found that Core protein modulates the expression of the p21 cell-cycle-dependent kinase (cdk) inhibitor, a target of the p53 tumor suppressor. However, the results of these studies are conflicting. While some studies indicate that Core protein represses expression of the p21 promoter (Ray et al., 1998; Jung et al., 2001; Yoshida et al., 2001), others report that Core protein enhances p21 expression (Lu et al., 1999; Otsuka et al., 2000). A recent study indicated that the 191 aa form of Core localizes to the cytoplasm and enhances the expression of the p21 (cdk kinase inhibitor), while the processed 173 form represses p21 expression (Yamanaka et al., 2002). These studies suggest that Core protein plays a pivotal role in HCV pathogenesis and modulation of distinct cell-cycle regulatory molecules is a component of this process. However, the kinetics of the expression of Core protein forms in context of hepatocyte cell-cycle modulation are not known. The p21 protein belongs to a family of cdk inhibitors and modulates various biological processes such as cell growth, differentiation, and apoptosis (Dotto, 2000; Harper and Elledge, 1996). In mammalian cells, p21 is found in complexes that consist of cyclins (D and E), cdks, and proliferating cell nuclear antigen (PCNA), a subunit of DNA polymerase (Zhang et al., 1993; Chuang et al., 1997). By
interacting directly with PCNA, p21 prevents DNA synthesis and regulates DNA methylation (Li et al., 1994). It is thus possible that Core protein-dependent modulation of p21 may modify multiple cellular processes and affect cell transformation. However, the effect of immature and mature forms of Core protein on hepatocyte cell-cycle progression has not been fully examined. To determine the role of Core protein in p21 regulation and hepatocyte cell-cycle modulation, we generated a HepG2-derived cell line in which the expression of core protein is under the control of an inducible promoter. We enhanced the detection of Core protein by tagging the amino-terminus of the protein with the Flag epitope. Two isoforms of Core protein were present at early time points following the induction, which corresponded to the immature 191 aa form and the mature 173 aa form that have been previously reported (Yamanaka et al., 2002). At early time points postinduction (4 and 8 h), we observed that the two molecular weight forms were equally abundant in coreexpressing cells, while at later times (16 – 48 h), the mature form accumulated to become the dominant species. Western blot analysis revealed elevation of the p21 inhibitor expression early following induction and was coincident with the appearance of the immature form of Core protein. As the mature form of Core protein accumulated at 16 h, the level of p21 started to decline. The elevation of p21 corresponded with a decrease in cdk2-dependent kinase activity and was accompanied by a decrease in the percentage of cells in S-phase along with an accumulation of cells in the G0/G1 phase of the cell cycle. This study suggests that the immature form of Core protein enhances the expression of the p21 cdk inhibitor, which in turn represses cellular proliferation.
Results Construction of an inducible system for the expression of HCV Core protein in HepG2 cells To study the effect of HCV Core on hepatocytes in a consistent manner, we generated a HepG2 cell line that can be conditionally induced to express Core protein(s). An inducible system reduces variables associated with transient transfection systems and also minimizes the permanent and or injurious effects of constitutive and viral transduction systems. Due to the lack of availability of a sensitive Core protein antibody, we subcloned the full-length coding sequence of HCV-1b Core protein (191 aa) to include a 3XFLAG epitope (Sigma-Aldrich) upstream of the Core start codon. The amino-terminally FLAG-tagged Core sequence was further subcloned into the ecdysone-inducible pIND vector (Invitrogen, Carlsbad, CA) to make pIND-3XCore plasmid (Fig. 1A). The predicted size of the full-length FLAG-tagged Core protein is approximately 27 kDa. Addition of Ponasterone-A resulted in the induction of receptor
H. Nguyen et al. / Virology 312 (2003) 245–253
247
cells using Flag antibodies as shown in Fig. 1B. A very small amount of Core protein was detected in uninduced cells, suggesting low basal levels of expression inherent in this system. In contrast, commercially available antibodies to Core could only detect the protein when it was highly expressed (48 h postinduction). Expression and processing kinetics of Core protein in HepG2 cells
Fig. 1. Inducible expression of Core protein in HepG2 hepatocytes. (A) Schematic diagram of the ecdysone inducible system and the pIND3XFLAG-Core construct. The recombinant RxR and Ecdysone receptors are constitutively expressed under RSV and CMV promoters. Upon the addition of Ponasterone-A, the RxR and Ecdysone receptors bind to the hybrid ecdysone/glucocorticoid response element and induce the expression of FLAG-Core protein. (B) Western blot analysis of HCV Core proteins using anti-Core antibodies (top) and anti-Flag antibodies (bottom) at 4 and 48 h postinduction with 10 M of Ponasterone A. The bottom panel is a stripped blot of the top panel and it demonstrates the superior sensitivity of the anti-FLAG antibodies. NT ⫽ nontransfected cells, UI ⫽ uninduced cells.
dimerization, which in turn stimulated the expression of the FLAG-tagged Core protein. The immediate expression of a viral protein of interest upon induction by this system had been previously demonstrated in our laboratory (Ndolo et al., 2002). Using this inducible system, we generated a tool to monitor the early effects of HCV Core expression on hepatocytes and cell-cycle-related changes. To study the effect of Core expression on hepatocytes, the pIND-Core and pVgRxR plasmids were introduced into the HepG2 hepatocyte cell line. This cell line was chosen because of its hepatic origin. More importantly, HepG2 cells express both p21 cdk kinase inhibitor and wild-type p53. Individual clones were isolated and tested by Western blot analysis for Core protein expression prior to and following the induction by treatment with Ponasterone-A. Core protein was readily detectable in induced hepatocyte
To optimize the expression of Core protein, cells were induced with Ponasterone-A (10 M), harvested at 1, 2, 4, 8, 16, 24, and 48 h following induction, and subjected to Western blot analysis using an anti-Flag antibody. Expression of Core protein was detected within 4 h of induction and continued to increase for 48 h (Fig. 2). We did not observed any obvious indications of apoptosis or cytopathic effects in cells expressing Core protein. Two molecular weight species of Core protein were detected 4 h after induction, but at later time points (16 h) the smaller form dominated. The larger species (27 kDa) corresponds to the full-length native unprocessed FLAG-tagged 191 aa form. The smaller species (approximately 25 kDa) corresponds to the predicted size of a FLAG-tagged processed 173 aa form. During the initial 8 h of induction, the ratios of unprocessed (immature)-to-processed (mature) species of Core were higher than at 16 h or later. The levels of the unprocessed and processed forms were quantitated by densitometric analysis. At 2, 4, and 8 h postinduction the ratio of unprocessed-to-processed forms of Core were 1:2, 1:3, and 1:10, respectively. By 16 h the ratio of unprocessed-to-processed Core was greater than 1:1000. By 48 h of induction the mature form of the protein was so abundant that it obscured detection of the immature form. The heightened sensitivity of the Flag antibody enabled us to detect very early expression of the Core protein, identify two distinct molecular weight species, and follow the kinetics of Core protein processing. The accumulation of the mature form of Core protein at later time points suggests that it may be the dominant species present during the natural course of HCV infection. Previous studies reported that the immature 191 aa form of Core protein localized to the cytoplasm, while the mature, processed 173 aa form localized to the nucleus
Fig. 2. Kinetics of Core expression. Western blot analysis of cells induced to express Core protein at 1, 2, 4, 8, 16, 24, and 48 h. At 4 h postinduction, both forms of Core are abundant and with a ratio of immature to mature of 1:3. The mature form of Core protein is shown to be the predominant species at 16 h postinduction (ratio of immature to mature of 1:⬎1000) and beyond. This panel demonstrates the detection of both the mature and the immature forms of Core protein (marked with arrows). Western blots with Anti-FLAG antibodies were used to detect Core. NT ⫽ nontransfected cells, UI ⫽ uninduced cells.
248
H. Nguyen et al. / Virology 312 (2003) 245–253
Fig. 3. The p21 expression corresponds to the appearance of the immature Core protein. Western blot was used to detect expression of Core and p21 proteins. The top panel shows the levels of endogenous p21 expression corresponding to Core protein expression. The expression of p21 peaked at 4 and 8 h post-Core induction and declined after 8 h post-Core induction. NT ⫽ nontransfected cells, UI ⫽ uninduced cells.
(Yamanaka et al., 2002). The different cellular localization of the two forms of Core protein could have significantly different effects on cellular processes during early and later stages of viral infection. An increase of p21 cdk inhibitor is concurrent with the appearance of the immature Core protein. We utilized our inducible Core expression system to determine whether Core protein expression kinetics affected the cell-cycle regulators in hepatocytes. Cells were induced with Ponasterone-A and harvested 4 and 48 h later. At 4 h postinduction, both immature and mature forms of Core were present, while at 48 h postinduction the mature form predominated. The increased expression of p21 was concurrent with a high ratio of immature-to-mature form of Core protein (Fig. 3). Thus, the data suggested a biphasic regulation of p21 expression, where p21 levels increased early after induction of unprocessed core protein, but started to decline at later time points as the mature form accumulated. These results suggest that elevation of p21 seen in core-expressing cells is associated with the immature form of Core protein. These results also suggest that the immature form of Core protein is a more effective regulatory molecule since enhanced expression of p21 is apparent when very low levels of the immature form of Core protein are present. Previous studies reported that the mature form of Core protein repressed p21 expression. In our system, the accumulation of the mature form of Core was unable to efficiently repress p21 expression. This may be due to the constant presence of the immature form. The modulation of p21 levels is dependent on the ratios of the two Core protein forms that have counteracting effects.
form to mature form is greatest, and at the 48-h time point when most of the Core protein is in the mature form. Cellular extracts prepared from nontransfected (NT), uninduced (UI), and induced cells (IN) were used for Western blot analysis or cdk2-dependent kinase assays (Fig. 4A). The levels of p21 were elevated at the 4-h time point and decreased slightly at the 48 h time point (Fig. 4A). Cdk2 was immunoprecipitated and subjected to a histone kinase assay. The cdk2-dependent kinase activity at 4 and 48 h after Core induction was reduced to 55 and 44%, respectively (Fig. 4B). The reduction in cdk2 activity at 48 h time point reflects the maintenance of p21 up-regulation at 48-h post-Core induction. Cyclin D/cdk4/6-dependent kinase activity was unchanged following the induction of Core protein (data not shown).
Elevation of p21 leads to a repression of cdk2 kinase activity The p21 protein is the universal cyclin kinase inhibitor that acts to repress cyclin-dependent kinase activity. Therefore, we investigated whether the activity of cdk2, the catalytic partner of cyclins A and E, is altered following induction of Core protein expression in HepG2 cells. To investigate the effects of Core on cdk2 activity, we chose the 4-h induction time point when the ratio of the immature
Fig. 4. HCV Core protein enhances p21 expression leading to the repression of Cdk2 kinase activity. (A) Western blot analysis of p21, Cdk2, phospho-p53 shows that the increase of p21 expression was not due to activation of p53 or an increase in expression of Cdk2. (B) Cdk2-dependent histone kinase assays. The kinase activity of Cdk2 was repressed as the result of enhanced p21 expression. Histone H1 was used as a substrate. Cdk2 kinase activities were repressed to the average of 55% at 4 h and 44% at 8 h post-Core induction, as compared to nontransfected HepG2 cells.
H. Nguyen et al. / Virology 312 (2003) 245–253
249
p130, as well as E2F-1 and E2F-4 —were unchanged. These results suggest that only p21 is subject to regulation by Core protein in our system. HCV Core protein reduces the percentage of cells in S-phase
Fig. 5. HCV Core protein(s) does not alter the expression of other key cell-cycle regulators. Western blot analysis shows that the expression of HCV Core does not affect the expression of key cell-cycle regulators of the Rb family, cyclins E, A, and D, the Cdk inhibitors p27 and p16, and the E2F1 and E2F4. Actin serves as a protein loading control.
Previous investigations of Core protein and p21 did not demonstrate the phenotypic effects resulting from the modulation of p21 by Core protein. In this study, we sought to investigate whether the effect of Core protein on p21 expression and cdk2 activity would result in modification of hepatocyte proliferation. Using the BrdU incorporation assay, we examined the effect of Core protein on the cellcycle profile. We demonstrate that Core protein expression corresponded to a lower percentage of cells in the S-phase of the cell cycle at 6 h postinduction (Fig. 6). After 24 and 48 h of Core protein expression, the reduction in the population of cells entering S-phase was accompanied by a reciprocal increase in the number of cells at the G0/G1 phase of the cell cycle. Statistical analysis indicated that the decrease in S-phase cells and an increase in G0/G1 cells were significant (P ⬍ 0.05). The retardation of cells in G0/G1 phase of cell cycle is consistent with an increase of p21, arguing that the elevation of this kinase inhibitor has functional significance.
Expression of HCV Core does not alter the expression of other key cell-cycle regulators The p21 cdk inhibitor is regulated at transcriptional and posttranscriptional levels and is a major transcriptional target of the p53 tumor suppressor (el-Deiry et al., 1993). The p53 protein is phosphorylated and stabilized following DNA damage or genotoxic shock (Appella and Anderson, 2001). An increase in p53 expression induces the transcription of p21, thus initiating a growth arrest cascade. We investigated whether the increase in p21 expression following Core induction was mediated by p53. Western blot analysis of cellular extracts from uninduced cells and cells induced for 4 and 48 h showed that the levels of the phosphorylated p53 remained unchanged following Core protein expression (Fig. 4A). Therefore, we conclude that the increase in p21 levels is mediated by p53 independent mechanisms. The levels of the cdk2 protein were also unchanged (Fig. 4A); thus, the decrease of cdk2 kinase activity is most probably due to the inhibition of the cyclin/cdk2 complex. The effect of core protein on the expression of regulators of the cell cycle was examined by the Western blot analysis. Protein extracts were prepared from hepatocytes induced for 8, 16 and 24 h. The levels of cyclins E, A, and D were unchanged (Fig. 5). The protein levels of the cdk inhibitors p27 and p16 were also unchanged. We also determined that the levels of the RB family of proteins—Rb, p107, and
Fig. 6. Cell-cycle analysis of cells expressing Core protein. Flow cytometric analysis of nontransfected (NT), uninduced (UI), and induced (IN) Core protein expressing HepG2 hepatocyte cells shows a decline in the population of S-phase cells and an increase in the population of cells in G0/G1. The decrease in percentage of cells in S phase and an increase in the percentage of cells in the G0/G1 phase following induction of Core protein is statistically significant (P ⬍ 0.05).
250
H. Nguyen et al. / Virology 312 (2003) 245–253
Discussion The goal of this study was to investigate the effect of HCV core protein on the expression of cell-cycle regulators in hepatocytes. We successfully constructed an inducible system to analyze the kinetics of Core protein expression and processing in hepatocytes. The salient feature of our system is that Core protein can be detected within 4 h postinduction, thus providing us with a convenient tool to study the short-term versus long-term exposure of cells to Core protein(s). This allowed us to demonstrated a biphasic effect of Core protein on endogenous p21 expression after various times of exposure to Core. In previously described inducible systems, Core protein was not detected early following induction; therefore, the detection of early expression of the immature form of the Core protein may have been missed. We have shown that HCV Core protein upregulated p21 levels and repressed cdk2-dependent phosphorylation. In agreement with previously published results (Yamanaka et al., 2002), our data suggest that the immature form of Core up-regulates p21. Importantly, our data also show that p21 expression was enhanced 4 h post-Core protein induction, yet the amount of immature form present in cells at this time was undetectable by commercially available Core protein antibodies. Therefore, we conclude that at 4 h postinduction, Core protein was not overexpressed and that the expression level may closely resemble the expression level of Core protein in natural HCV infections. This analysis provides a plausible explanation for the widely discrepant results obtained from different studies on the regulation of p21 by Core protein. Previous studies by various groups utilized different expression systems that did not address the unique properties of different Core isoforms (Ray et al., 1998; Jung et al., 2001; Yoshida et al., 2001; Lu et al., 1999; Otsuka et al., 2000). Since the immature form is detected predominantly at very early times after Core protein expression, many of the studies analyzed the effect of the mature form of the protein. If the immature form of Core enhances, while the mature form represses expression of p21, then the results obtained are dependent on the form that predominates in the specific experiment. Should the processing kinetics differ in the individual studies, then the effect of Core protein on p21 expression would differ as well. Since we did not detect an increase of p53 activation by Core protein, p53 does not appear to be instrumental in p21 induction. Additional Western blot analysis showed that Core protein had no effect on other key cell-cycle regulators in our system. In contrast to previously published studies (Cho et al., 2001a,b), we did not detect a decrease in the levels of RB or an increase in E2F1 nor an increase of cyclin E expression. It is noteworthy that in the previously published studies, the increase in E2F1 was detected only 72 h after induction of Core protein. However, these studies analyzed the effect of Core protein on cyclin E expression in Rat1 cells; therefore, our studies may not be directly com-
parable (Cho et al., 2001a,b). It is not clear why the immature form of Core up-regulates p21 leading to the repression of cdk2 activity. Previous reports indicate that the immature form of Core localizes to the cytoplasm, while the mature form localizes to the nucleus. Different subcellular localizations may determine the protein–protein interactions of Core protein with the cellular component that results in modulation of p21 expression. An increase in the levels of p21 results in retardation of cell-cycle progression, which is contradictory to the proposed role of Core protein in cellular transformation. Changes in p21 stoichiometry, relative to the other components of these complexes, result in suppression of cdk activity, allowing the accumulation of hypophosphorylated Rb, inhibition of E2F-dependent transcriptional processes, and cell-cycle arrest in G1 (Harper et al., 1995). As predicted, we observed a decrease of cdk2 activity and an accumulation of cells in the G0/G1 phase of cell cycle that was coincident with elevated expression of p21. It is possible that the biphasic effect on important growth control proteins is a component of the viral life cycle. Biphasic effects on key cell-cycle regulators have been demonstrated for human cytomegalovirus (HCMV). Early after HCMV infection, cyclin A expression is repressed, while at later times in the viral infection, cyclin A expression is induced (Salvant et al., 1998). Early in the HCV life cycle, it may be advantageous for the virus to arrest or slow cell proliferation. The cell-cycle arrest may serve to protect cells from apoptosis during the initial stage of infection. An alternative explanation is that during the early stage of infection, the immature Core modulates the expression of proteins that are required for repression of the immune response and facilitates the escape from immunosurveillance. The up-regulation of p21 could also be a result of an increase in TGF-1, a protein that has been shown to activate expression of p21 in a p53-independent manner (Datto et al., 1995). Studies have shown that Core protein modulates p21 expression through the TGF- pathway (Lee et al., 2002). TGF-1 has been shown to have a repressive effect on T cells (Cook et al., 1999). By suppressing the immune system during the early stages of infection, HCV can enhance its ability to establish chronic infection. The evidence of increased TGF- expression in liver samples of HCV-infected patients has been well documented (Nelson et al., 1997). p21 can also stimulate NF-B-dependent gene expression through an interaction with cyclin-dependent kinases, NFB, and the coactivators p300 and CAAT-binding protein (Perkins et al., 1997). The multiple activities of p21 provide a mechanism for the coordination of transcriptional activation with cell-cycle progression. In summary, our results demonstrate that early after induction of Core protein expression, two distinct isoforms corresponding to an immature and mature form of Core protein are detected. During the initial 8 h of induction, the ratios of the immature-to-mature form are higher than at later times, where the mature form accumulates. Core pro-
H. Nguyen et al. / Virology 312 (2003) 245–253
tein modulates the expression of p21 in a biphasic manner and the immature form of the protein is associated with increased expression of this cdk inhibitor. The elevation of p21 coincides with a decrease in cdk2-dependent kinase activity. These changes in p21 and cdk2 activity lead to a decrease in cellular proliferation. Since there was no increase in the level of activated p53, the increase of p21 occurs in a p53-independent manner. We did not detect changes in the levels of 11 other cell-cycle regulatory proteins, suggesting the HCV Core protein primarily targets the p21 to modify cell-cycle controls. These studies provide better insights into the effect of HCV core protein on the cell-cycle regulation of hepatocytes.
Materials and methods Cell culture HepG2 cells were obtained from ATCC (Manassas, VA). Cells were maintained in DMEM supplemented with 10% fetal bovine serum, 2 mM L-glutamine, and 100 U of penicillin-streptomycin/ml (GIBCO-BRL, Rockville, MD). Plasmids The inducible plasmid pIND-3XFLAG-Core was generated by cloning the N-terminus FLAG-tagged Core coding sequence into the inducible expression vector pIND with a neomycin selection marker (Invitrogen). The generation of the 3XFLAG-Core coding sequence involved multiple subcloning steps. Briefly, the HCV-1b coding sequence from plasmid pBR394J1 was obtained from Dr. Miyamura (Aizaki et al., 1998). The Core-E1-E2 coding sequence was excised from the pBR394J1 plasmid with XbaI and NheI restriction enzymes and subcloned into the XbaI site of pUC-18 plasmid to make pUC-18-Core-Env plasmid. The HindIII/EcoRI fragment from pUC-18-Core-Env was further subcloned into the HindIII/EcoRI restriction sites of the p3XFLAG-CMV-10 plasmid (Sigma, St. Louis, MO) to generate p3X-Core-Env plasmid that contains the FLAG tag coding sequence upstream and in-frame of the Core coding sequence. Using 3XFLAG forward primer (ATAACCCCGCCCCGTTGA) and Core-stop reverse primer (AGGAATTCCACTTCCCTAAGCGGA), we amplified the sequence containing the FLAG-Core sequence with a stop codon after Core’s 191st codon (bold) by the polymerase chain reaction (PCR). The FLAG-Core PCR product was digested with SacI and EcoRI restriction enzymes and inserted into the SacI and EcoRI sites of the pIND plasmid to generate the pIND-3XFLAG-Core plasmid. The plasmid pVgRxR (Invitrogen) encodes the RxR and VgEcR ecdysone receptor subunits and contains a Zeocin selection marker.
251
Transfection and establishment of a Core-inducible stable cell line HepG2 cells were cotransfected with linearized pIND3XFLAG-Core and pVgRxR plasmids by electroporation of 5 ⫻ 106 cells in 0.5 ml of growth media without serum at 250 V and 950 F using a Gene Pulser (Bio-Rad, Hercules, CA) and grown on a 60-mm dish overnight. The transfected cells were grown in selection media containing 1000 g/ml of G418 and 200 g/ml of Zeocin for 2 weeks. The surviving cell colonies were isolated and transferred into 24-well plates and maintained in selection media for two to three more weeks. Cell clones that survived the second round of selection were plated in 25-mm flasks and expanded for further evaluation. Immunoblot analysis Cells were lysed in RIPA buffer and 30 g of total protein was separated on SDS–PAGE gels. Each gel was transferred to BA-85 membrane (Schleicher and Schuell, Keene, NH). The membrane was stained with Ponceau S to ensure equal loading of protein and blocked with 5% nonfat dry milk in phosphate-buffered saline (PBS) and 0.1% Tween for 1 h before the addition of specific antibodies. The following antibodies were used: cyclin E antibody (generous gift from Dr. G. Lozano), p21, cdk2, p27, p16, cyclin A, cyclin D, p130, p107, pRB, E2F1, E2F4, and Actin (Santa Cruz Biotechnologies, Santa Cruz, CA), Flag antibodies (Stratagene, La Jolla, CA), and the Core antibody (Maine Biotechnology Services, Inc., Portland, ME). After washing and incubation with secondary mouse monoclonal or rabbit polyclonal horseradish peroxidase linked antibodies (Amersham Pharmacia, Piscataway, NJ), proteins were detected using ECL (Amersham Pharmacia) following manufacturer’s recommendations. In vitro kinase assays In vitro kinase assays were performed as previously described (Chuang et al., 1997). Briefly, cells were lysed in NP-40 lysis buffer, the extracts were precleared and incubated with cdk2 antibodies (Santa Cruz). The antibody/ protein complexes were isolated on Protein A/Protein G agarose beads (Oncogene Science, Cambridge, MA), washed, and resuspended in kinase buffer (1 mg/ml Histone H1, 1 mM ATP, 1 Ci/l [␥32P] ATP, 20 mM HEPES pH 7.0, 80 mM -glycerolphosphate, 20 mM EGTA, 50 mM MgCl2, 5 mM MnCl2, 1 mM DTT, 2.5 mM PMSF, 10 M camp protein kinase inhibitor). The kinase reaction was terminated by addition of gel loading buffer and the protein was separated on 12% SDS–PAGE. The gel was fixed, dried, and autoradiographed. The radioactive bands were excised from the gel and the radioactivity was quantitated using a scintillation counter.
252
H. Nguyen et al. / Virology 312 (2003) 245–253
Measurement of BrdU incorporation and DNA content Cells were seeded at 3 ⫻ 105 cells/well in six-well plates and cultured overnight to allow attachment and growth. Cells were induced for 6, 24, and 48 h with 10 M of Ponasterone A. Cells were labeled with bromodeoxyuridine (BrdU) and 7-aminoactinomycin-D (7-AAD) according to the manufacturer’s recommendations (BD PharMingen, CA). Briefly, cells were incubated with 10 M of BrdU for 45 min and then trypsinized to make single cell suspension. Cells were washed, fixed, and permeabilized with appropriate solutions. Cells were treated with DNAse I for 1 h at 37°C to expose incorporated BrdU. Anti-BrdU antibody and 7-AAD stain were added to cells and cell samples were analyzed by flow cytometry.
Acknowledgments We thank Dr. Miyamura for providing the HCV plasmid and Dr. Michael George for review of the manuscript. This work was supported by a grant from the National Institutes of Health (DK61297) and Veterans Affairs Merit Award.
References Aizaki, H., Aoki, Y., Harada, T., Ishii, K., Suzuki, T., Nagamori, S., Toda, G., Matsuura, Y., Miyamura, T., 1998. Full-length complementary DNA of hepatitis C virus genome from an infectious blood sample. Hepatology 27, 621– 627. Appella, E., Anderson, C.W., 2001. Post-translational modifications and activation of p53 by genotoxic stresses. Eur. J. Biochem. 268, 2764 – 2772. Barba, G., Harper, F., Harada, T., Kohara, M., Goulinet, S., Matsuura, Y., Eder, G., Schaff, Z., Chapman, M.J., Miyamura, T., Brechot, C., 1997. Hepatitis C virus core protein shows a cytoplasmic localization and associates to cellular lipid storage droplets. Proc. Natl. Acad. Sci. USA 94, 1200 –1205. Chang, J., Yang, S.H., Cho, Y.G., Hwang, S.B., Hahn, Y.S., Sung, Y.C., 1998. Hepatitis C virus core from two different genotypes has an oncogenic potential but is not sufficient for transforming primary rat embryo fibroblasts in cooperation with the H-ras oncogene. J. Virol. 72, 3060 –3065. Cho, J., Baek, W., Yang, S., Chang, J., Sung, Y.C., Suh, M., 2001b. HCV core protein modulates Rb pathway through pRb down-regulation and E2F-1 up-regulation. Biochim. Biophys. Acta 1538, 59 – 66. Cho, J.W., Baek, W.K., Suh, S.I., Yang, S.H., Chang, J., Sung, Y.C., Suh, M.H., 2001a. Hepatitis C virus core protein promotes cell proliferation through the upregulation of cyclin E expression levels. Liver 21, 137–142. Choo, Q.L., Kuo, G., Weiner, A.J., Overby, L.R., Bradley, D.W., Houghton, M., 1989. Isolation of a cDNA clone derived from blood-borne non-A, non-B viral hepatitis genome. Science 244, 359 –362. Chuang, L.S., Ian, H.I., Koh, T.W., Ng, H.H., Xu, G., Li, B.F., 1997. Human DNA-(cytosine-5) methyltransferase-PCNA complex as a target for p21WAF1. Science 277, 1996 –2000. Cook, G., Campbell, J.D., Carr, C.E., Boyd, K.S., Franklin, I.M., 1999. Transforming growth factor beta from multiple myeloma cells inhibits proliferation and IL-2 responsiveness in T lymphocytes. J. Leukoc. Biol. 66, 981–988.
Datto, M.B., Li, Y., Panus, J.F., Howe, D.J., Xiong, Y., Wang, X.F., 1995. Transforming growth factor beta induces the cyclin-dependent kinase inhibitor p21 through a p53-independent mechanism. Proc. Natl. Acad. Sci. USA 92, 5545–5549. Dotto, G.P., 2000. p21(WAF1/Cip1): more than a break to the cell cycle? Biochim. Biophys. Acta 1471, M43–M56. el-Deiry, W.S., Tokino, T., Velculescu, V.E., Levy, D.B., Parsons, R., Trent, J.M., Lin, D., Mercer, W.E., Kinzler, K.W., Vogelstein, B., 1993. WAF1, a potential mediator of p53 tumor suppression. Cell 75, 817– 825. Harper, J.W., Elledge, S.J., 1996. Cdk inhibitors in development and cancer. Curr. Opin. Genet. Dev. 6, 56 – 64. Harper, J.W., Elledge, S.J., Keyomarsi, K., Dynlacht, B., Tsai, L.H., Zhang, P., Dobrowolski, S., Bai, C., Connell-Crowley, L., Swindell, E., et al., 1995. Inhibition of cyclin-dependent kinases by p21. Mol. Biol. Cell. 6, 387– 400. Jung, E.Y., Lee, M.N., Yang, H.Y., Yu, D., Jang, K.L., 2001. The repressive activity of hepatitis C virus core protein on the transcription of p21 (waf1) is regulated by protein kinase A-mediated phosphorylation. Virus Res. 79, 109 –115. Kunkel, M., Watowich, S.J., 2002. Conformational changes accompanying self-assembly of the hepatitis C virus core protein. Virology 294, 239 –245. Lee, M.N., Jung, E.Y., Kwun, H.J., Jun, H.K., Yu, D.Y., Choi, Y.H., Jang, K.L., 2002. Hepatitis C virus core protein represses the p21 promoter through inhibition of a TGF-beta pathway. J. Gen. Virol. 83 (Pt 9), 2145–2151. Li, R., Waga, S., Hannon, G.J., Beach, D., Stillman, B., 1994. Differential effects by the p21 CDK inhibitor on PCNA-dependent DNA replication and repair. Nature 371, 534 –537. Lo, S.Y., Masiarz, F., Hwang, S.B., Lai, M.M., Ou, J.H., 1995. Differential subcellular localization of hepatitis C virus core gene products. Virology 213, 455– 461. Lu, W., Lo, S.Y., Chen, M., Wu, K., Fung, Y.K., Ou, J.H., 1999. Activation of p53 tumor suppressor by hepatitis C virus core protein. Virology 264, 134 –141. Moriya, K., Fujie, H., Shintani, Y., Yotsuyanagi, H., Tsutsumi, T., Ishibashi, K., Matsuura, Y., Kimura, S., Miyamura, T., Koike, K., 1998. The core protein of hepatitis C virus induces hepatocellular carcinoma in transgenic mice. Nat. Med. 4, 1065–1067. Moriya, K., Yotsuyanagi, H., Shintani, Y., Fujie, H., Ishibashi, K., Matsuura, Y., Miyamura, T., Koike, K., 1997. Hepatitis C virus core protein induces hepatic steatosis in transgenic mice. J. Gen. Virol. 78 (Pt. 7), 1527–1531. Ndolo, T., Dhillon, N.K., Nguyen, H., Guadalupe, M., Mudryj, M., Dandekar, S., 2002. Simian immunodeficiency virus Nef protein delays the progression of CD4⫹ T cells through G1/S phase of the cell cycle. J. Virol. 76, 3587–3595. Nelson, D.R., Gonzalez-Peralta, R.P., Qian, K., Xu, Y., Marousis, C.G., Davis, G.L., Lau, J.Y., 1997. Transforming growth factor-beta 1 in chronic hepatitis C. J. Viral Hepat. 4, 29 –35. Otsuka, M., Kato, N., Lan, K., Yoshida, H., Kato, J., Goto, T., Shiratori, Y., Omata, M., 2000. Hepatitis C virus core protein enhances p53 function through augmentation of DNA binding affinity and transcriptional ability. J. Biol. Chem. 275, 34122–34130. Perkins, N.D., Felzien, L.K., Betts, J.C., Leung, K., Beach, D.H., Nabel, G.J., 1997. Regulation of NF-kappaB by cyclin-dependent kinases associated with the p300 coactivator. Science 275, 523–527. Ray, R.B., Lagging, L.M., Meyer, K., Ray, R., 1996. Hepatitis C virus core protein cooperates with ras and transforms primary rat embryo fibroblasts to tumorigenic phenotype. J. Virol. 70, 4438 – 4443. Ray, R.B., Lagging, L.M., Meyer, K., Steele, R., Ray, R., 1995. Transcriptional regulation of cellular and viral promoters by the hepatitis C virus core protein. Virus Res. 37, 209 –220. Ray, R.B., Ray, R., 2001. Hepatitis C virus core protein: intriguing properties and functional relevance. FEMS Microbiol. Lett. 202, 149 –156.
H. Nguyen et al. / Virology 312 (2003) 245–253 Ray, R.B., Steele, R., Meyer, K., Ray, R., 1998. Hepatitis C virus core protein represses 21WAF1/Cip1/Sid1 promoter activity. Gene 208, 331–336. Sabile, A., Perlemuter, G., Bono, F., Kohara, K., Demaugre, F., Kohara, M., Matsuura, Y., Miyamura, T., Brechot, C., Barba, G., 1999. Hepatitis C virus core protein binds to apolipoprotein AII and its secretion is modulated by fibrates. Hepatology 30, 1064 –1076. Saito, I., Miyamura, T., Ohbayashi, A., Harada, H., Katayama, T., Kikuchi, S., Watanabe, Y., Koi, S., Onji, M., Choo, Q.-L., Houghton, M., Kuo, G., 1990. Hepatitis C virus infection is associated with the development of hepatocellular carcinoma. Proc. Natl. Acad. Sci. USA 87, 6547– 6549. Salvant, B.S., Fortunato, E.A., Spector, D.H., 1998. Cell cycle dysregulation by human cytomegalovirus: influence of the cell cycle phase at the time of infection and effects on cyclin transcription. J. Virol. 72, 3729–3741. Suzuki, R., Tamura, K., Li, J., Ishii, K., Matsuura, Y., Miyamura, T., Suzuki, T., 2001. Ubiquitin-mediated degradation of hepatitis C virus core protein is regulated by processing at its carboxyl terminus. Virology 280, 301–309.
253
Uchida, T., 1994. Pathology of hepatitis C. Intervirology 37, 126 –132. Yamanaka, T., Kodama, T., Doi, T., 2002. Subcellular localization of HCV core protein regulates its ability for p53 activation and p21 suppression. Biochem. Biophys. Res. Commun. 294, 528 –534. Yamanaka, T., Uchida, M., Doi, T., 2002. Innate form of HCV core protein plays an important role in the localization and the function of HCV core protein. Biochem. Biophys. Res. Commun. 294, 528 –534. Yasui, K., Wakita, T., Tsukiyama-Kohara, K., Funahashi, S.I., Ichikawa, M., Kajita, T., Moradpour, D., Wands, J.R., Kohara, M., 1998. The native form and maturation process of hepatitis C virus core protein. J. Virol. 72, 6048 – 6055. Yoshida, I., Oka, K., Hidajat, R., Nagano-Fujii, M., Ishido, S., Hotta, H., 2001. Inhibition of p21/Waf1/Cip1/Sdi1 expression by hepatitis C virus core protein. Microbiol. Immunol. 45, 689 – 697. Zhang, H., Xiong, Y., Beach, D., 1993. Proliferating cell nuclear antigen and p21 are components of multiple cell cycle kinase complexes. Mol. Biol. Cell 4, 897–906.
Virology 312 (2003) 245–253
www.elsevier.com/locate/yviro
Hepatitis C virus core protein expression leads to biphasic regulation of the p21 cdk inhibitor and modulation of hepatocyte cell cycle Hau Nguyen,a,1 Maria Mudryj,a,b,1 Moraima Guadalupe,a and Satya Dandekara,* a
Department of Medical Microbiology and Immunology, School of Medicine, University of California, Davis, CA 95616, USA b VA NCHS, Mather, CA 95655, USA Received 6 December 2002; accepted 18 February 2003
Abstract Hepatitis C virus (HCV) Core protein is implicated in viral pathogenesis by the modulation of hepatocyte gene expression and function. To determine the effect of Core protein on the cell-cycle control of hepatocytes, a HepG2 cell line containing a Flag-tagged Core under the control of an inducible promoter was generated. Initial Core protein expression included the presence of unprocessed (191 aa) and processed (173 aa) forms of the Core proteins with the processed form becoming dominant later. Expression of the 191 aa form of Core protein corresponded to an increase in the expression of the p21, a decrease in cdk2-dependent kinase activity, and a decrease in the percentage of cells in S-phase along with an accumulation of cells in the G0/G1 phase of the cell cycle. As the processed form accumulated, the p21 levels started to decline, suggesting that Core protein regulates p21 expression in a biphasic manner. These findings implicate Core protein in potentially modulating hepatocyte cell cycle differentially in the early stages of infection through biphasic regulation of p21 cdk kinase inhibitor. © 2003 Elsevier Science (USA). All rights reserved. Keywords: HCV; Core protein; p21; Cell cycle; cdk2; Biphasic
Introduction The hepatitis C virus (HCV) is the etiologic agent of acute and chronic hepatitis affecting more than 100 million people worldwide (Uchida, 1994). Chronic hepatitis is one of the leading causes of liver cirrhosis and hepatocellular carcinoma (Saito et al., 1990), but the precise role of HCV in the development of this cancer has not been elucidated. HCV, a member of the flavivirus family, has a 9.5-kb positive single-stranded RNA genome, which encodes a polyprotein that is processed into at least 10 different structural and nonstructural proteins (Choo et al., 1989; Ray and Ray, 2001). The HCV core protein is derived from the N-terminus of the polypeptide and has a highly basic Nterminal region and a highly hydrophobic C-terminus (Kunkel and Watowich, 2002). In addition to being the
* Corresponding author. E-mail address: [email protected] (S. Dandekar). 1 Nguyen and Mudryj contributed equally to the manuscript.
major component of the viral nucleocapsid, this multifunctional protein has also been implicated in hepatocyte proliferation and transformation. However, its role in hepatocyte proliferation and tumorogenesis has not been well elucidated. HCV Core protein is proteolytically processed and several molecular weight variants of Core protein have been identified. The 191 amino acid (aa) form encodes a 21-kDa protein. This 21-kDa form can be further proteolytically processed to a p19-kDa form that consists of 173 aa or to a minor 16-kDa form (Lo et al., 1995). Lo et al. (1995) reported that the p21 and p19 forms localized to the cytoplasm. Furthermore, Yamanaka et al. (2002) reported that 191 aa form of Core localized to the cytoplasm, while the 173 aa form could localize to the nucleus. Yasui et al. (1998) report that the processed form of Core protein resides in both the cytoplasm and the nucleus, but that the nuclear form has higher order structure that differs from the structure of the cytoplasmic form. In addition, Core protein can be degraded by ubiquitin-mediated proteolysis and that
0042-6822/03/$ – see front matter © 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S0042-6822(03)00209-5
246
H. Nguyen et al. / Virology 312 (2003) 245–253
processing of the C-terminal domain may affect the ubiquitination process (Suzuki et al., 2001). The distinct subcellular localization and differing stability of the various forms of Core protein raises the possibility that they may have distinct biological functions and may impact viral pathogenesis. However, our knowledge of the functions of these different core proteins remains limited. It is also not known how the combination of both immature and mature forms of Core protein will impact hepatocyte proliferation and function. Effects of the Core protein on various cellular processes have been studied in human and nonhuman cells. Expression of the Core protein in the liver of transgenic mice induces hepatic steatosis (Moriya et al., 1997) and promotes the development of hepatocellular carcinomas (Moriya et al., 1998). The ability of Core protein to mimic the HCV disease process argues that the expression of this protein is integral to HCV pathogenesis. Cells that stably express Core protein exhibit an accumulation of lipid droplets and the Core protein colocalizes with apolipoprotein AII (Barba et al., 1997; Sabile et al., 1999). Some studies indicate that HCV Core protein cooperates with the ras oncogene to transform primary rat embryo fibroblasts (REF) (Ray et al., 1996), while others argue that while Core has oncogenic potential, it is not sufficient to cooperate, with ras to transform primary REF (Chang et al., 1998). In addition, Core protein can activate the c-myc promoter but suppresses the fos promoter (Ray et al., 1995). Some studies have reported that cyclin E, a protein instrumental in the transversal of the G1/S checkpoint, is elevated in cells expressing Core protein (Cho et al., 2001a). Lu et al. (1999) reported that the p53 tumor suppressor is activated by expression of Core protein. A number of studies found that Core protein modulates the expression of the p21 cell-cycle-dependent kinase (cdk) inhibitor, a target of the p53 tumor suppressor. However, the results of these studies are conflicting. While some studies indicate that Core protein represses expression of the p21 promoter (Ray et al., 1998; Jung et al., 2001; Yoshida et al., 2001), others report that Core protein enhances p21 expression (Lu et al., 1999; Otsuka et al., 2000). A recent study indicated that the 191 aa form of Core localizes to the cytoplasm and enhances the expression of the p21 (cdk kinase inhibitor), while the processed 173 form represses p21 expression (Yamanaka et al., 2002). These studies suggest that Core protein plays a pivotal role in HCV pathogenesis and modulation of distinct cell-cycle regulatory molecules is a component of this process. However, the kinetics of the expression of Core protein forms in context of hepatocyte cell-cycle modulation are not known. The p21 protein belongs to a family of cdk inhibitors and modulates various biological processes such as cell growth, differentiation, and apoptosis (Dotto, 2000; Harper and Elledge, 1996). In mammalian cells, p21 is found in complexes that consist of cyclins (D and E), cdks, and proliferating cell nuclear antigen (PCNA), a subunit of DNA polymerase (Zhang et al., 1993; Chuang et al., 1997). By
interacting directly with PCNA, p21 prevents DNA synthesis and regulates DNA methylation (Li et al., 1994). It is thus possible that Core protein-dependent modulation of p21 may modify multiple cellular processes and affect cell transformation. However, the effect of immature and mature forms of Core protein on hepatocyte cell-cycle progression has not been fully examined. To determine the role of Core protein in p21 regulation and hepatocyte cell-cycle modulation, we generated a HepG2-derived cell line in which the expression of core protein is under the control of an inducible promoter. We enhanced the detection of Core protein by tagging the amino-terminus of the protein with the Flag epitope. Two isoforms of Core protein were present at early time points following the induction, which corresponded to the immature 191 aa form and the mature 173 aa form that have been previously reported (Yamanaka et al., 2002). At early time points postinduction (4 and 8 h), we observed that the two molecular weight forms were equally abundant in coreexpressing cells, while at later times (16 – 48 h), the mature form accumulated to become the dominant species. Western blot analysis revealed elevation of the p21 inhibitor expression early following induction and was coincident with the appearance of the immature form of Core protein. As the mature form of Core protein accumulated at 16 h, the level of p21 started to decline. The elevation of p21 corresponded with a decrease in cdk2-dependent kinase activity and was accompanied by a decrease in the percentage of cells in S-phase along with an accumulation of cells in the G0/G1 phase of the cell cycle. This study suggests that the immature form of Core protein enhances the expression of the p21 cdk inhibitor, which in turn represses cellular proliferation.
Results Construction of an inducible system for the expression of HCV Core protein in HepG2 cells To study the effect of HCV Core on hepatocytes in a consistent manner, we generated a HepG2 cell line that can be conditionally induced to express Core protein(s). An inducible system reduces variables associated with transient transfection systems and also minimizes the permanent and or injurious effects of constitutive and viral transduction systems. Due to the lack of availability of a sensitive Core protein antibody, we subcloned the full-length coding sequence of HCV-1b Core protein (191 aa) to include a 3XFLAG epitope (Sigma-Aldrich) upstream of the Core start codon. The amino-terminally FLAG-tagged Core sequence was further subcloned into the ecdysone-inducible pIND vector (Invitrogen, Carlsbad, CA) to make pIND-3XCore plasmid (Fig. 1A). The predicted size of the full-length FLAG-tagged Core protein is approximately 27 kDa. Addition of Ponasterone-A resulted in the induction of receptor
H. Nguyen et al. / Virology 312 (2003) 245–253
247
cells using Flag antibodies as shown in Fig. 1B. A very small amount of Core protein was detected in uninduced cells, suggesting low basal levels of expression inherent in this system. In contrast, commercially available antibodies to Core could only detect the protein when it was highly expressed (48 h postinduction). Expression and processing kinetics of Core protein in HepG2 cells
Fig. 1. Inducible expression of Core protein in HepG2 hepatocytes. (A) Schematic diagram of the ecdysone inducible system and the pIND3XFLAG-Core construct. The recombinant RxR and Ecdysone receptors are constitutively expressed under RSV and CMV promoters. Upon the addition of Ponasterone-A, the RxR and Ecdysone receptors bind to the hybrid ecdysone/glucocorticoid response element and induce the expression of FLAG-Core protein. (B) Western blot analysis of HCV Core proteins using anti-Core antibodies (top) and anti-Flag antibodies (bottom) at 4 and 48 h postinduction with 10 M of Ponasterone A. The bottom panel is a stripped blot of the top panel and it demonstrates the superior sensitivity of the anti-FLAG antibodies. NT ⫽ nontransfected cells, UI ⫽ uninduced cells.
dimerization, which in turn stimulated the expression of the FLAG-tagged Core protein. The immediate expression of a viral protein of interest upon induction by this system had been previously demonstrated in our laboratory (Ndolo et al., 2002). Using this inducible system, we generated a tool to monitor the early effects of HCV Core expression on hepatocytes and cell-cycle-related changes. To study the effect of Core expression on hepatocytes, the pIND-Core and pVgRxR plasmids were introduced into the HepG2 hepatocyte cell line. This cell line was chosen because of its hepatic origin. More importantly, HepG2 cells express both p21 cdk kinase inhibitor and wild-type p53. Individual clones were isolated and tested by Western blot analysis for Core protein expression prior to and following the induction by treatment with Ponasterone-A. Core protein was readily detectable in induced hepatocyte
To optimize the expression of Core protein, cells were induced with Ponasterone-A (10 M), harvested at 1, 2, 4, 8, 16, 24, and 48 h following induction, and subjected to Western blot analysis using an anti-Flag antibody. Expression of Core protein was detected within 4 h of induction and continued to increase for 48 h (Fig. 2). We did not observed any obvious indications of apoptosis or cytopathic effects in cells expressing Core protein. Two molecular weight species of Core protein were detected 4 h after induction, but at later time points (16 h) the smaller form dominated. The larger species (27 kDa) corresponds to the full-length native unprocessed FLAG-tagged 191 aa form. The smaller species (approximately 25 kDa) corresponds to the predicted size of a FLAG-tagged processed 173 aa form. During the initial 8 h of induction, the ratios of unprocessed (immature)-to-processed (mature) species of Core were higher than at 16 h or later. The levels of the unprocessed and processed forms were quantitated by densitometric analysis. At 2, 4, and 8 h postinduction the ratio of unprocessed-to-processed forms of Core were 1:2, 1:3, and 1:10, respectively. By 16 h the ratio of unprocessed-to-processed Core was greater than 1:1000. By 48 h of induction the mature form of the protein was so abundant that it obscured detection of the immature form. The heightened sensitivity of the Flag antibody enabled us to detect very early expression of the Core protein, identify two distinct molecular weight species, and follow the kinetics of Core protein processing. The accumulation of the mature form of Core protein at later time points suggests that it may be the dominant species present during the natural course of HCV infection. Previous studies reported that the immature 191 aa form of Core protein localized to the cytoplasm, while the mature, processed 173 aa form localized to the nucleus
Fig. 2. Kinetics of Core expression. Western blot analysis of cells induced to express Core protein at 1, 2, 4, 8, 16, 24, and 48 h. At 4 h postinduction, both forms of Core are abundant and with a ratio of immature to mature of 1:3. The mature form of Core protein is shown to be the predominant species at 16 h postinduction (ratio of immature to mature of 1:⬎1000) and beyond. This panel demonstrates the detection of both the mature and the immature forms of Core protein (marked with arrows). Western blots with Anti-FLAG antibodies were used to detect Core. NT ⫽ nontransfected cells, UI ⫽ uninduced cells.
248
H. Nguyen et al. / Virology 312 (2003) 245–253
Fig. 3. The p21 expression corresponds to the appearance of the immature Core protein. Western blot was used to detect expression of Core and p21 proteins. The top panel shows the levels of endogenous p21 expression corresponding to Core protein expression. The expression of p21 peaked at 4 and 8 h post-Core induction and declined after 8 h post-Core induction. NT ⫽ nontransfected cells, UI ⫽ uninduced cells.
(Yamanaka et al., 2002). The different cellular localization of the two forms of Core protein could have significantly different effects on cellular processes during early and later stages of viral infection. An increase of p21 cdk inhibitor is concurrent with the appearance of the immature Core protein. We utilized our inducible Core expression system to determine whether Core protein expression kinetics affected the cell-cycle regulators in hepatocytes. Cells were induced with Ponasterone-A and harvested 4 and 48 h later. At 4 h postinduction, both immature and mature forms of Core were present, while at 48 h postinduction the mature form predominated. The increased expression of p21 was concurrent with a high ratio of immature-to-mature form of Core protein (Fig. 3). Thus, the data suggested a biphasic regulation of p21 expression, where p21 levels increased early after induction of unprocessed core protein, but started to decline at later time points as the mature form accumulated. These results suggest that elevation of p21 seen in core-expressing cells is associated with the immature form of Core protein. These results also suggest that the immature form of Core protein is a more effective regulatory molecule since enhanced expression of p21 is apparent when very low levels of the immature form of Core protein are present. Previous studies reported that the mature form of Core protein repressed p21 expression. In our system, the accumulation of the mature form of Core was unable to efficiently repress p21 expression. This may be due to the constant presence of the immature form. The modulation of p21 levels is dependent on the ratios of the two Core protein forms that have counteracting effects.
form to mature form is greatest, and at the 48-h time point when most of the Core protein is in the mature form. Cellular extracts prepared from nontransfected (NT), uninduced (UI), and induced cells (IN) were used for Western blot analysis or cdk2-dependent kinase assays (Fig. 4A). The levels of p21 were elevated at the 4-h time point and decreased slightly at the 48 h time point (Fig. 4A). Cdk2 was immunoprecipitated and subjected to a histone kinase assay. The cdk2-dependent kinase activity at 4 and 48 h after Core induction was reduced to 55 and 44%, respectively (Fig. 4B). The reduction in cdk2 activity at 48 h time point reflects the maintenance of p21 up-regulation at 48-h post-Core induction. Cyclin D/cdk4/6-dependent kinase activity was unchanged following the induction of Core protein (data not shown).
Elevation of p21 leads to a repression of cdk2 kinase activity The p21 protein is the universal cyclin kinase inhibitor that acts to repress cyclin-dependent kinase activity. Therefore, we investigated whether the activity of cdk2, the catalytic partner of cyclins A and E, is altered following induction of Core protein expression in HepG2 cells. To investigate the effects of Core on cdk2 activity, we chose the 4-h induction time point when the ratio of the immature
Fig. 4. HCV Core protein enhances p21 expression leading to the repression of Cdk2 kinase activity. (A) Western blot analysis of p21, Cdk2, phospho-p53 shows that the increase of p21 expression was not due to activation of p53 or an increase in expression of Cdk2. (B) Cdk2-dependent histone kinase assays. The kinase activity of Cdk2 was repressed as the result of enhanced p21 expression. Histone H1 was used as a substrate. Cdk2 kinase activities were repressed to the average of 55% at 4 h and 44% at 8 h post-Core induction, as compared to nontransfected HepG2 cells.
H. Nguyen et al. / Virology 312 (2003) 245–253
249
p130, as well as E2F-1 and E2F-4 —were unchanged. These results suggest that only p21 is subject to regulation by Core protein in our system. HCV Core protein reduces the percentage of cells in S-phase
Fig. 5. HCV Core protein(s) does not alter the expression of other key cell-cycle regulators. Western blot analysis shows that the expression of HCV Core does not affect the expression of key cell-cycle regulators of the Rb family, cyclins E, A, and D, the Cdk inhibitors p27 and p16, and the E2F1 and E2F4. Actin serves as a protein loading control.
Previous investigations of Core protein and p21 did not demonstrate the phenotypic effects resulting from the modulation of p21 by Core protein. In this study, we sought to investigate whether the effect of Core protein on p21 expression and cdk2 activity would result in modification of hepatocyte proliferation. Using the BrdU incorporation assay, we examined the effect of Core protein on the cellcycle profile. We demonstrate that Core protein expression corresponded to a lower percentage of cells in the S-phase of the cell cycle at 6 h postinduction (Fig. 6). After 24 and 48 h of Core protein expression, the reduction in the population of cells entering S-phase was accompanied by a reciprocal increase in the number of cells at the G0/G1 phase of the cell cycle. Statistical analysis indicated that the decrease in S-phase cells and an increase in G0/G1 cells were significant (P ⬍ 0.05). The retardation of cells in G0/G1 phase of cell cycle is consistent with an increase of p21, arguing that the elevation of this kinase inhibitor has functional significance.
Expression of HCV Core does not alter the expression of other key cell-cycle regulators The p21 cdk inhibitor is regulated at transcriptional and posttranscriptional levels and is a major transcriptional target of the p53 tumor suppressor (el-Deiry et al., 1993). The p53 protein is phosphorylated and stabilized following DNA damage or genotoxic shock (Appella and Anderson, 2001). An increase in p53 expression induces the transcription of p21, thus initiating a growth arrest cascade. We investigated whether the increase in p21 expression following Core induction was mediated by p53. Western blot analysis of cellular extracts from uninduced cells and cells induced for 4 and 48 h showed that the levels of the phosphorylated p53 remained unchanged following Core protein expression (Fig. 4A). Therefore, we conclude that the increase in p21 levels is mediated by p53 independent mechanisms. The levels of the cdk2 protein were also unchanged (Fig. 4A); thus, the decrease of cdk2 kinase activity is most probably due to the inhibition of the cyclin/cdk2 complex. The effect of core protein on the expression of regulators of the cell cycle was examined by the Western blot analysis. Protein extracts were prepared from hepatocytes induced for 8, 16 and 24 h. The levels of cyclins E, A, and D were unchanged (Fig. 5). The protein levels of the cdk inhibitors p27 and p16 were also unchanged. We also determined that the levels of the RB family of proteins—Rb, p107, and
Fig. 6. Cell-cycle analysis of cells expressing Core protein. Flow cytometric analysis of nontransfected (NT), uninduced (UI), and induced (IN) Core protein expressing HepG2 hepatocyte cells shows a decline in the population of S-phase cells and an increase in the population of cells in G0/G1. The decrease in percentage of cells in S phase and an increase in the percentage of cells in the G0/G1 phase following induction of Core protein is statistically significant (P ⬍ 0.05).
250
H. Nguyen et al. / Virology 312 (2003) 245–253
Discussion The goal of this study was to investigate the effect of HCV core protein on the expression of cell-cycle regulators in hepatocytes. We successfully constructed an inducible system to analyze the kinetics of Core protein expression and processing in hepatocytes. The salient feature of our system is that Core protein can be detected within 4 h postinduction, thus providing us with a convenient tool to study the short-term versus long-term exposure of cells to Core protein(s). This allowed us to demonstrated a biphasic effect of Core protein on endogenous p21 expression after various times of exposure to Core. In previously described inducible systems, Core protein was not detected early following induction; therefore, the detection of early expression of the immature form of the Core protein may have been missed. We have shown that HCV Core protein upregulated p21 levels and repressed cdk2-dependent phosphorylation. In agreement with previously published results (Yamanaka et al., 2002), our data suggest that the immature form of Core up-regulates p21. Importantly, our data also show that p21 expression was enhanced 4 h post-Core protein induction, yet the amount of immature form present in cells at this time was undetectable by commercially available Core protein antibodies. Therefore, we conclude that at 4 h postinduction, Core protein was not overexpressed and that the expression level may closely resemble the expression level of Core protein in natural HCV infections. This analysis provides a plausible explanation for the widely discrepant results obtained from different studies on the regulation of p21 by Core protein. Previous studies by various groups utilized different expression systems that did not address the unique properties of different Core isoforms (Ray et al., 1998; Jung et al., 2001; Yoshida et al., 2001; Lu et al., 1999; Otsuka et al., 2000). Since the immature form is detected predominantly at very early times after Core protein expression, many of the studies analyzed the effect of the mature form of the protein. If the immature form of Core enhances, while the mature form represses expression of p21, then the results obtained are dependent on the form that predominates in the specific experiment. Should the processing kinetics differ in the individual studies, then the effect of Core protein on p21 expression would differ as well. Since we did not detect an increase of p53 activation by Core protein, p53 does not appear to be instrumental in p21 induction. Additional Western blot analysis showed that Core protein had no effect on other key cell-cycle regulators in our system. In contrast to previously published studies (Cho et al., 2001a,b), we did not detect a decrease in the levels of RB or an increase in E2F1 nor an increase of cyclin E expression. It is noteworthy that in the previously published studies, the increase in E2F1 was detected only 72 h after induction of Core protein. However, these studies analyzed the effect of Core protein on cyclin E expression in Rat1 cells; therefore, our studies may not be directly com-
parable (Cho et al., 2001a,b). It is not clear why the immature form of Core up-regulates p21 leading to the repression of cdk2 activity. Previous reports indicate that the immature form of Core localizes to the cytoplasm, while the mature form localizes to the nucleus. Different subcellular localizations may determine the protein–protein interactions of Core protein with the cellular component that results in modulation of p21 expression. An increase in the levels of p21 results in retardation of cell-cycle progression, which is contradictory to the proposed role of Core protein in cellular transformation. Changes in p21 stoichiometry, relative to the other components of these complexes, result in suppression of cdk activity, allowing the accumulation of hypophosphorylated Rb, inhibition of E2F-dependent transcriptional processes, and cell-cycle arrest in G1 (Harper et al., 1995). As predicted, we observed a decrease of cdk2 activity and an accumulation of cells in the G0/G1 phase of cell cycle that was coincident with elevated expression of p21. It is possible that the biphasic effect on important growth control proteins is a component of the viral life cycle. Biphasic effects on key cell-cycle regulators have been demonstrated for human cytomegalovirus (HCMV). Early after HCMV infection, cyclin A expression is repressed, while at later times in the viral infection, cyclin A expression is induced (Salvant et al., 1998). Early in the HCV life cycle, it may be advantageous for the virus to arrest or slow cell proliferation. The cell-cycle arrest may serve to protect cells from apoptosis during the initial stage of infection. An alternative explanation is that during the early stage of infection, the immature Core modulates the expression of proteins that are required for repression of the immune response and facilitates the escape from immunosurveillance. The up-regulation of p21 could also be a result of an increase in TGF-1, a protein that has been shown to activate expression of p21 in a p53-independent manner (Datto et al., 1995). Studies have shown that Core protein modulates p21 expression through the TGF- pathway (Lee et al., 2002). TGF-1 has been shown to have a repressive effect on T cells (Cook et al., 1999). By suppressing the immune system during the early stages of infection, HCV can enhance its ability to establish chronic infection. The evidence of increased TGF- expression in liver samples of HCV-infected patients has been well documented (Nelson et al., 1997). p21 can also stimulate NF-B-dependent gene expression through an interaction with cyclin-dependent kinases, NFB, and the coactivators p300 and CAAT-binding protein (Perkins et al., 1997). The multiple activities of p21 provide a mechanism for the coordination of transcriptional activation with cell-cycle progression. In summary, our results demonstrate that early after induction of Core protein expression, two distinct isoforms corresponding to an immature and mature form of Core protein are detected. During the initial 8 h of induction, the ratios of the immature-to-mature form are higher than at later times, where the mature form accumulates. Core pro-
H. Nguyen et al. / Virology 312 (2003) 245–253
tein modulates the expression of p21 in a biphasic manner and the immature form of the protein is associated with increased expression of this cdk inhibitor. The elevation of p21 coincides with a decrease in cdk2-dependent kinase activity. These changes in p21 and cdk2 activity lead to a decrease in cellular proliferation. Since there was no increase in the level of activated p53, the increase of p21 occurs in a p53-independent manner. We did not detect changes in the levels of 11 other cell-cycle regulatory proteins, suggesting the HCV Core protein primarily targets the p21 to modify cell-cycle controls. These studies provide better insights into the effect of HCV core protein on the cell-cycle regulation of hepatocytes.
Materials and methods Cell culture HepG2 cells were obtained from ATCC (Manassas, VA). Cells were maintained in DMEM supplemented with 10% fetal bovine serum, 2 mM L-glutamine, and 100 U of penicillin-streptomycin/ml (GIBCO-BRL, Rockville, MD). Plasmids The inducible plasmid pIND-3XFLAG-Core was generated by cloning the N-terminus FLAG-tagged Core coding sequence into the inducible expression vector pIND with a neomycin selection marker (Invitrogen). The generation of the 3XFLAG-Core coding sequence involved multiple subcloning steps. Briefly, the HCV-1b coding sequence from plasmid pBR394J1 was obtained from Dr. Miyamura (Aizaki et al., 1998). The Core-E1-E2 coding sequence was excised from the pBR394J1 plasmid with XbaI and NheI restriction enzymes and subcloned into the XbaI site of pUC-18 plasmid to make pUC-18-Core-Env plasmid. The HindIII/EcoRI fragment from pUC-18-Core-Env was further subcloned into the HindIII/EcoRI restriction sites of the p3XFLAG-CMV-10 plasmid (Sigma, St. Louis, MO) to generate p3X-Core-Env plasmid that contains the FLAG tag coding sequence upstream and in-frame of the Core coding sequence. Using 3XFLAG forward primer (ATAACCCCGCCCCGTTGA) and Core-stop reverse primer (AGGAATTCCACTTCCCTAAGCGGA), we amplified the sequence containing the FLAG-Core sequence with a stop codon after Core’s 191st codon (bold) by the polymerase chain reaction (PCR). The FLAG-Core PCR product was digested with SacI and EcoRI restriction enzymes and inserted into the SacI and EcoRI sites of the pIND plasmid to generate the pIND-3XFLAG-Core plasmid. The plasmid pVgRxR (Invitrogen) encodes the RxR and VgEcR ecdysone receptor subunits and contains a Zeocin selection marker.
251
Transfection and establishment of a Core-inducible stable cell line HepG2 cells were cotransfected with linearized pIND3XFLAG-Core and pVgRxR plasmids by electroporation of 5 ⫻ 106 cells in 0.5 ml of growth media without serum at 250 V and 950 F using a Gene Pulser (Bio-Rad, Hercules, CA) and grown on a 60-mm dish overnight. The transfected cells were grown in selection media containing 1000 g/ml of G418 and 200 g/ml of Zeocin for 2 weeks. The surviving cell colonies were isolated and transferred into 24-well plates and maintained in selection media for two to three more weeks. Cell clones that survived the second round of selection were plated in 25-mm flasks and expanded for further evaluation. Immunoblot analysis Cells were lysed in RIPA buffer and 30 g of total protein was separated on SDS–PAGE gels. Each gel was transferred to BA-85 membrane (Schleicher and Schuell, Keene, NH). The membrane was stained with Ponceau S to ensure equal loading of protein and blocked with 5% nonfat dry milk in phosphate-buffered saline (PBS) and 0.1% Tween for 1 h before the addition of specific antibodies. The following antibodies were used: cyclin E antibody (generous gift from Dr. G. Lozano), p21, cdk2, p27, p16, cyclin A, cyclin D, p130, p107, pRB, E2F1, E2F4, and Actin (Santa Cruz Biotechnologies, Santa Cruz, CA), Flag antibodies (Stratagene, La Jolla, CA), and the Core antibody (Maine Biotechnology Services, Inc., Portland, ME). After washing and incubation with secondary mouse monoclonal or rabbit polyclonal horseradish peroxidase linked antibodies (Amersham Pharmacia, Piscataway, NJ), proteins were detected using ECL (Amersham Pharmacia) following manufacturer’s recommendations. In vitro kinase assays In vitro kinase assays were performed as previously described (Chuang et al., 1997). Briefly, cells were lysed in NP-40 lysis buffer, the extracts were precleared and incubated with cdk2 antibodies (Santa Cruz). The antibody/ protein complexes were isolated on Protein A/Protein G agarose beads (Oncogene Science, Cambridge, MA), washed, and resuspended in kinase buffer (1 mg/ml Histone H1, 1 mM ATP, 1 Ci/l [␥32P] ATP, 20 mM HEPES pH 7.0, 80 mM -glycerolphosphate, 20 mM EGTA, 50 mM MgCl2, 5 mM MnCl2, 1 mM DTT, 2.5 mM PMSF, 10 M camp protein kinase inhibitor). The kinase reaction was terminated by addition of gel loading buffer and the protein was separated on 12% SDS–PAGE. The gel was fixed, dried, and autoradiographed. The radioactive bands were excised from the gel and the radioactivity was quantitated using a scintillation counter.
252
H. Nguyen et al. / Virology 312 (2003) 245–253
Measurement of BrdU incorporation and DNA content Cells were seeded at 3 ⫻ 105 cells/well in six-well plates and cultured overnight to allow attachment and growth. Cells were induced for 6, 24, and 48 h with 10 M of Ponasterone A. Cells were labeled with bromodeoxyuridine (BrdU) and 7-aminoactinomycin-D (7-AAD) according to the manufacturer’s recommendations (BD PharMingen, CA). Briefly, cells were incubated with 10 M of BrdU for 45 min and then trypsinized to make single cell suspension. Cells were washed, fixed, and permeabilized with appropriate solutions. Cells were treated with DNAse I for 1 h at 37°C to expose incorporated BrdU. Anti-BrdU antibody and 7-AAD stain were added to cells and cell samples were analyzed by flow cytometry.
Acknowledgments We thank Dr. Miyamura for providing the HCV plasmid and Dr. Michael George for review of the manuscript. This work was supported by a grant from the National Institutes of Health (DK61297) and Veterans Affairs Merit Award.
References Aizaki, H., Aoki, Y., Harada, T., Ishii, K., Suzuki, T., Nagamori, S., Toda, G., Matsuura, Y., Miyamura, T., 1998. Full-length complementary DNA of hepatitis C virus genome from an infectious blood sample. Hepatology 27, 621– 627. Appella, E., Anderson, C.W., 2001. Post-translational modifications and activation of p53 by genotoxic stresses. Eur. J. Biochem. 268, 2764 – 2772. Barba, G., Harper, F., Harada, T., Kohara, M., Goulinet, S., Matsuura, Y., Eder, G., Schaff, Z., Chapman, M.J., Miyamura, T., Brechot, C., 1997. Hepatitis C virus core protein shows a cytoplasmic localization and associates to cellular lipid storage droplets. Proc. Natl. Acad. Sci. USA 94, 1200 –1205. Chang, J., Yang, S.H., Cho, Y.G., Hwang, S.B., Hahn, Y.S., Sung, Y.C., 1998. Hepatitis C virus core from two different genotypes has an oncogenic potential but is not sufficient for transforming primary rat embryo fibroblasts in cooperation with the H-ras oncogene. J. Virol. 72, 3060 –3065. Cho, J., Baek, W., Yang, S., Chang, J., Sung, Y.C., Suh, M., 2001b. HCV core protein modulates Rb pathway through pRb down-regulation and E2F-1 up-regulation. Biochim. Biophys. Acta 1538, 59 – 66. Cho, J.W., Baek, W.K., Suh, S.I., Yang, S.H., Chang, J., Sung, Y.C., Suh, M.H., 2001a. Hepatitis C virus core protein promotes cell proliferation through the upregulation of cyclin E expression levels. Liver 21, 137–142. Choo, Q.L., Kuo, G., Weiner, A.J., Overby, L.R., Bradley, D.W., Houghton, M., 1989. Isolation of a cDNA clone derived from blood-borne non-A, non-B viral hepatitis genome. Science 244, 359 –362. Chuang, L.S., Ian, H.I., Koh, T.W., Ng, H.H., Xu, G., Li, B.F., 1997. Human DNA-(cytosine-5) methyltransferase-PCNA complex as a target for p21WAF1. Science 277, 1996 –2000. Cook, G., Campbell, J.D., Carr, C.E., Boyd, K.S., Franklin, I.M., 1999. Transforming growth factor beta from multiple myeloma cells inhibits proliferation and IL-2 responsiveness in T lymphocytes. J. Leukoc. Biol. 66, 981–988.
Datto, M.B., Li, Y., Panus, J.F., Howe, D.J., Xiong, Y., Wang, X.F., 1995. Transforming growth factor beta induces the cyclin-dependent kinase inhibitor p21 through a p53-independent mechanism. Proc. Natl. Acad. Sci. USA 92, 5545–5549. Dotto, G.P., 2000. p21(WAF1/Cip1): more than a break to the cell cycle? Biochim. Biophys. Acta 1471, M43–M56. el-Deiry, W.S., Tokino, T., Velculescu, V.E., Levy, D.B., Parsons, R., Trent, J.M., Lin, D., Mercer, W.E., Kinzler, K.W., Vogelstein, B., 1993. WAF1, a potential mediator of p53 tumor suppression. Cell 75, 817– 825. Harper, J.W., Elledge, S.J., 1996. Cdk inhibitors in development and cancer. Curr. Opin. Genet. Dev. 6, 56 – 64. Harper, J.W., Elledge, S.J., Keyomarsi, K., Dynlacht, B., Tsai, L.H., Zhang, P., Dobrowolski, S., Bai, C., Connell-Crowley, L., Swindell, E., et al., 1995. Inhibition of cyclin-dependent kinases by p21. Mol. Biol. Cell. 6, 387– 400. Jung, E.Y., Lee, M.N., Yang, H.Y., Yu, D., Jang, K.L., 2001. The repressive activity of hepatitis C virus core protein on the transcription of p21 (waf1) is regulated by protein kinase A-mediated phosphorylation. Virus Res. 79, 109 –115. Kunkel, M., Watowich, S.J., 2002. Conformational changes accompanying self-assembly of the hepatitis C virus core protein. Virology 294, 239 –245. Lee, M.N., Jung, E.Y., Kwun, H.J., Jun, H.K., Yu, D.Y., Choi, Y.H., Jang, K.L., 2002. Hepatitis C virus core protein represses the p21 promoter through inhibition of a TGF-beta pathway. J. Gen. Virol. 83 (Pt 9), 2145–2151. Li, R., Waga, S., Hannon, G.J., Beach, D., Stillman, B., 1994. Differential effects by the p21 CDK inhibitor on PCNA-dependent DNA replication and repair. Nature 371, 534 –537. Lo, S.Y., Masiarz, F., Hwang, S.B., Lai, M.M., Ou, J.H., 1995. Differential subcellular localization of hepatitis C virus core gene products. Virology 213, 455– 461. Lu, W., Lo, S.Y., Chen, M., Wu, K., Fung, Y.K., Ou, J.H., 1999. Activation of p53 tumor suppressor by hepatitis C virus core protein. Virology 264, 134 –141. Moriya, K., Fujie, H., Shintani, Y., Yotsuyanagi, H., Tsutsumi, T., Ishibashi, K., Matsuura, Y., Kimura, S., Miyamura, T., Koike, K., 1998. The core protein of hepatitis C virus induces hepatocellular carcinoma in transgenic mice. Nat. Med. 4, 1065–1067. Moriya, K., Yotsuyanagi, H., Shintani, Y., Fujie, H., Ishibashi, K., Matsuura, Y., Miyamura, T., Koike, K., 1997. Hepatitis C virus core protein induces hepatic steatosis in transgenic mice. J. Gen. Virol. 78 (Pt. 7), 1527–1531. Ndolo, T., Dhillon, N.K., Nguyen, H., Guadalupe, M., Mudryj, M., Dandekar, S., 2002. Simian immunodeficiency virus Nef protein delays the progression of CD4⫹ T cells through G1/S phase of the cell cycle. J. Virol. 76, 3587–3595. Nelson, D.R., Gonzalez-Peralta, R.P., Qian, K., Xu, Y., Marousis, C.G., Davis, G.L., Lau, J.Y., 1997. Transforming growth factor-beta 1 in chronic hepatitis C. J. Viral Hepat. 4, 29 –35. Otsuka, M., Kato, N., Lan, K., Yoshida, H., Kato, J., Goto, T., Shiratori, Y., Omata, M., 2000. Hepatitis C virus core protein enhances p53 function through augmentation of DNA binding affinity and transcriptional ability. J. Biol. Chem. 275, 34122–34130. Perkins, N.D., Felzien, L.K., Betts, J.C., Leung, K., Beach, D.H., Nabel, G.J., 1997. Regulation of NF-kappaB by cyclin-dependent kinases associated with the p300 coactivator. Science 275, 523–527. Ray, R.B., Lagging, L.M., Meyer, K., Ray, R., 1996. Hepatitis C virus core protein cooperates with ras and transforms primary rat embryo fibroblasts to tumorigenic phenotype. J. Virol. 70, 4438 – 4443. Ray, R.B., Lagging, L.M., Meyer, K., Steele, R., Ray, R., 1995. Transcriptional regulation of cellular and viral promoters by the hepatitis C virus core protein. Virus Res. 37, 209 –220. Ray, R.B., Ray, R., 2001. Hepatitis C virus core protein: intriguing properties and functional relevance. FEMS Microbiol. Lett. 202, 149 –156.
H. Nguyen et al. / Virology 312 (2003) 245–253 Ray, R.B., Steele, R., Meyer, K., Ray, R., 1998. Hepatitis C virus core protein represses 21WAF1/Cip1/Sid1 promoter activity. Gene 208, 331–336. Sabile, A., Perlemuter, G., Bono, F., Kohara, K., Demaugre, F., Kohara, M., Matsuura, Y., Miyamura, T., Brechot, C., Barba, G., 1999. Hepatitis C virus core protein binds to apolipoprotein AII and its secretion is modulated by fibrates. Hepatology 30, 1064 –1076. Saito, I., Miyamura, T., Ohbayashi, A., Harada, H., Katayama, T., Kikuchi, S., Watanabe, Y., Koi, S., Onji, M., Choo, Q.-L., Houghton, M., Kuo, G., 1990. Hepatitis C virus infection is associated with the development of hepatocellular carcinoma. Proc. Natl. Acad. Sci. USA 87, 6547– 6549. Salvant, B.S., Fortunato, E.A., Spector, D.H., 1998. Cell cycle dysregulation by human cytomegalovirus: influence of the cell cycle phase at the time of infection and effects on cyclin transcription. J. Virol. 72, 3729–3741. Suzuki, R., Tamura, K., Li, J., Ishii, K., Matsuura, Y., Miyamura, T., Suzuki, T., 2001. Ubiquitin-mediated degradation of hepatitis C virus core protein is regulated by processing at its carboxyl terminus. Virology 280, 301–309.
253
Uchida, T., 1994. Pathology of hepatitis C. Intervirology 37, 126 –132. Yamanaka, T., Kodama, T., Doi, T., 2002. Subcellular localization of HCV core protein regulates its ability for p53 activation and p21 suppression. Biochem. Biophys. Res. Commun. 294, 528 –534. Yamanaka, T., Uchida, M., Doi, T., 2002. Innate form of HCV core protein plays an important role in the localization and the function of HCV core protein. Biochem. Biophys. Res. Commun. 294, 528 –534. Yasui, K., Wakita, T., Tsukiyama-Kohara, K., Funahashi, S.I., Ichikawa, M., Kajita, T., Moradpour, D., Wands, J.R., Kohara, M., 1998. The native form and maturation process of hepatitis C virus core protein. J. Virol. 72, 6048 – 6055. Yoshida, I., Oka, K., Hidajat, R., Nagano-Fujii, M., Ishido, S., Hotta, H., 2001. Inhibition of p21/Waf1/Cip1/Sdi1 expression by hepatitis C virus core protein. Microbiol. Immunol. 45, 689 – 697. Zhang, H., Xiong, Y., Beach, D., 1993. Proliferating cell nuclear antigen and p21 are components of multiple cell cycle kinase complexes. Mol. Biol. Cell 4, 897–906.