- Email: [email protected]
Hepatitis C virus replication and antibodies to structural and nonstructural viral proteins in chronic hepatitis C
Journal of Hepatology 1994; 20:421-425 Printed in Denmark. All rights reserved Munksgaard. Copenhagen
Cop.rrtght© Journalof Hepatology 1994 Journal of Hepatology ISSN 0168.8278
Hepatitis C virus replication and antibodies to structural and nonstructural viral proteins in chronic hepatitis C N o b u k a z u Yuki, N o r i o H a y a s h i , Hideki H a g i w a r a , M a s a f u m i N a i t o , A k i n o r i K a s a h a r a , H i d e y u k i F u s a m o t o and T a k e n o b u K a m a d a First Department o f Medichw, Osaka Universi O, Medical School, Osaka, Japan
(Received 10 November 1992)
The correlation between hepatitis C virus replication and antibodies to both structural (core) and nonstructural (C100-3) hepatitis C virus proteins (anti-HCVcore and anti-C100-3, respectively) was assessed. The concentration of serum hepatitis C virus RNA was determined by a competitive reverse transcription-polymerase chain reaction assay, and antibody titers were determined by endpoint dilution. No correlation was found between viremic levels and antibody titers in 42 chronic hepatitis C patients. At the end of a 6-month course of interferon-o~ therapy, 18 patients became negative for hepatitis C virus RNA. In the other 24 patients, post-treatment viremic levels ranged from 10-65-100.5 of pretreatment levels. Both anti-C100-3 and anti-HCVcore frequently decreased in patients whose viremic levels dropped to the negative range or to <10 -2 of pretreatment levels. Anti-C100-3 decreased in all such cases (25/25), while anti-HCVcore decreased in 18/25 (72%) (p<0.01), indicating that anti-C100-3 is more likely to decrease following suppression of viral replication than antiHCVcore. These data suggest that hepatitis C virus antibodies may serve as a marker of suppression of viremia following interferon therapy even in patients who do not clear the virus. © Journal of Hepatology. Key words: Antibody to C100-3 antigen; Antibody to hepatitis C virus core antigen; Hepatitis C virus RNA; Interferon-
c~; Non-A, non-B hepatitis; Polymerase chain reaction.
Once the genome of hepatitis C virus (HCV) was cloned (1), the development of screening assays for antibodies to structural and nonstructural HCV proteins led to dramatic advances in understanding this agent and in ability to detect the virus. The first-generation HCV antibody assays detect antibodies to the C100-3 antigen, a product of the third and fourth nonstructural genes of HCV (2). The recent identification of additional immunoreactive recombinant HCV antigens from the core and third nonstructural genes and the subsequent development of second-generation HCV antibody assays has increased the sensitivity of screening procedures (3-6). However, various antibody responses have not yet been extensively evaluated in relation to HCV replicative states, and the clinical significance of HCV antibody titers is still controversial.
Recently, we designed an assay for quantifying serum HCV RNA by competitive reverse transcription-polymerase chain reaction (7). In this study, the correlation between serum HCV RNA levels and titers of serum antibodies to both structural (core) and nonstructural (CI003) HCV proteins (anti-HCVcore and anti-C100-3, respectively) was assessed in chronic hepatitis C patients. Changes in HCV antibody titers in relation to the antiviral effect of interferon on HCV replication were also investigated. Materials and Methods Patients
Forty-two patients with chronic non-A, non-B liver disease who were positive for HCV antibody according to
Correspondence to: Norio Hayashi, M.D., First Department of Medicine, Osaka University Medical School, Fukushima 1-1-50, Fukushima-ku,
Osaka 553, Japan
N. YUKI et al.
422
the first-generation assay were studied. There were 32 males and 10 females, ranging from 20 to 66 years old. All patients were negative for hepatitis B surface antigen (HBsAg) and showed no evidence of alcoholic, autoimmune or drug-induced liver disease. Of these 42 patients, 15 had had blood transfusions 3-31 years earlier. All the patients had undergone liver biopsy, with chronic persistent hepatitis in six (14%) and chronic active hepatitis in 36 (86%), and were treated with interferon-a (IFN-~). Three or six megaunits (MU) of natural IFN-~x (Sumiferon, Sumitomo Pharmaceuticals Co., Ltd., Osaka, Japan) were administered intramuscularly for 26 weeks (by daily injection during the first 2 weeks and three times/ week thereafter). Serum samples drawn immediately before and at the end of therapy were stored at - 8 0 ° C and were tested for both HCV RNA levels and HCV antibody titers.
Serological testhTg HBsAg was determined using a commercially available radioimmunoassay (Dainabot Co., Ltd., Tokyo, Japan). Anti-C100-3 was tested with an ELISA system (Ortho Diagnostic Systems Co., Ltd., Tokyo, Japan) according to the manufacturer's instructions. Serum antibody to HCV core protein was also tested with an ELISA system as described elsewhere (8). An HCV cDNA fragment spanning the putative core region (nucleotides 369-700) (9) was expressed in Escherichia coli, and a specific antiHCVcore ELISA was developed using the purified core protein with a calculated molecular weight of 15.3. All assays for HCV antibodies were done in duplicate. The ratio of the mean optical density of the duplicate results to the cut-off value (cut-off index) was useless for comparing ELISA results of different samples because of the high titers of the antibodies. Based on these observations, the absolute antibody titers were expressed as the highest twofold dilution of the test serum showing positive resuits. Detection and quantification on serum H C V R N A HCV RNA was extracted from 100 pl of serum samples, copied into cDNA by reverse transcription, and amplified by the polymerase chain reaction (PCR) as described elsewhere (10-12). Primers were derived from the 5'-noncoding region of the published sequence (9), which is highly conserved among HCV clones; antisense primer 5 ' A T G G T G C A C G G T C T A C G A G A C C T C C 3 ' and sense primer 5'CACTCCCCTGTGAGGAACTACTGTC3'. The PCR mixtures were amplified in a D N A thermal cycler (Perkin-Elmer Cetus, Norwalk, CT) for 40 cycles (94°C for 0.5 min; 55°C for 1 min; 72°C for 1 min), followed by a 10-min final extension at 72°C. An aliquot of the PCR
products was fractionated by agarose gel electrophoresis, transferred onto a nylon membrane, hybridized to a rip_ labelled HCV cDNA between the two primers, and autoradiographed. To quantify serum HCV RNA in positive samples, a competitive reverse transcription-polymerase chain reaction assay was performed as described elsewhere (7). Mutant HCV RNA was produced from an HCV cDNA (M642) to have a novel EcoRI site after amplification by PCR. Reverse transcription-polymerase chain reaction was performed on serum samples in the presence of serial 10°5-fold amounts of mutant HCV RNA. Portions of the PCR products were fractionated by agarose gel electrophoresis after digestion with EcoRI, transferred onto a nylon membrane, hybridized to a rip_ labelled HCV cDNA, and autoradiographed. Serum HCV RNA amounts were estimated by the equilibrium of the signal intensity of a 306-bp undigested DNA fragment derived from serum HCV RNA and that o f a 198-bp EcoRI-digested DNA fragment derived from defined amounts of mutant HCV RNA.
Statistical analysis Statistical analysis for group comparisons was done by the chi-square method.
Results
All serum samples from the 42 chronic hepatitis C patients tested positive for anti-Cl00-3, anti-HCVcore and serum HCV RNA. The reciprocal titers of anti-C100-3 in these sera ranged from 20-27, and those of anti-HCVcore ranged from 26-2 II. The concentration of serum HCV RNA varied from 105-109 copies/ml. There was no corre-
2 7" O)
=
2 8•
:=. .=.
2 5• L,. (3. L..
•
2'-
=
•
v
03
23 -
i 0 Q
22 -
U i
2-
ca
1-
0"
I()s Serum
i
I0 6 HCV
1 ~)r RNA
10 8
|
10 9
(copies/ml)
Fig. 1. Relationship between anti-Cl00-3 and serum HCV RNA in patients with chronic hepatitis C.
HCV REPLICATION AND ANTIBODIES TO HCV
423
2 II--
210.
•
•
.
2 9"
•
•
...
.-.
P
¢'1 "U
..
~J ~
2 8"
0
>o Q3 "1-
..."
2 7.
.
L
E
2 6"
2s 10" Serum HCV RNA
(copies/ml)
Fig. 2. Relationship between anti-HCVcore and serum HCV RNA in patients with chronic hepatitis C.
~
2-
-~ > 1. .................................................................... ,~
|i I
2-"
|
•
.
4-.-4---e---e---~---o ....
:
•
.
.
.
.
•
i
.
i
a reduction of anti-C100-3 by 2-]-2 -3, and three patients became negative for anti-C100-3 at the end of therapy. In the remaining 24 patients, anti-C100-3 decreased by 2-~-2 -2 in all seven patients with a reduction of HCV R N A to < 10 -2 of the pretreatment level and in 5/17 (29%) patients who did not. In contrast, anti-HCVcore titers decreased by 2-t-2 -3 in 13/18 (72%) patients who were negative for serum HCV R N A at the end of therapy. AntiHCVcore decreased by 2 -~ in 5/7 (71%) patients who showed a reduction of serum HCV R N A to < 10 -2 of pretreatment levels and in only one (6%) of the 17 patients who did not (Fig. 4). Reduction of anti-C100-3 and anti-HCVcore occurred more frequently in patients whose viremic levels dropped to the negative range or to < 10 -2 of the pretreatment level than in patients who did not show a reduction of serum HCV R N A to this range (p<0.01) (Table 1). In the former group, anti-C100-3 decreased in 25/25 (100%) patients, while anti-HCVcore decreased in 18/25 (72%) (p<0.01). Increases in anti-C100-3 and anti-HCVcore titers were seen only in patients with post-treatment viremic levels ->10-'- of pretreatment [5/17 (29%) and 1/17 (6%), respectively]. A detailed analysis of HCV R N A levels and the behav-
To ~._o
2_~.
"~ Negative-
2"
| r..-~,t¢
, Negative 10-'
10-"
I0"
10-'
10 -=
l(J -z
10-'
1'0
.
•
1 ......... "!:...........................................................
" : + H
........
Serum HCV RNA Levels after Therapy (ratio to pratreatmant level)
Fig. 3. Changes in anti-C100-3 and changes in serum HCV RNA following interferon-~z therapy in patients with chronic hepatitis C.
®a
2-z.
|
to > o 2-~. I o
lation between anti-C100-3 titers and the concentration of serum HCV R N A (Fig. 1) or between anti-HCVcore titers and the concentration of serum HCV R N A (Fig. 2). HCV antibody titers could be low in highly viremic patients, and conversely, high titers of HCV antibodies could be found in low viremic patients. Changes in HCV antibody titers after a 6-month course of interferon-a therapy were also investigated in relation to changes in the concentration of serum HCV R N A . Serum HCV R N A became undetectable at the end of therapy in 18 (43%) patients, and the concentration decreased to 10-°5-10 -65 of pretreatment levels in 19 (45%). Four patients showed no change in serum HCV R N A levels, while one patient showed a slight increase, of 10°5. Fig. 3 shows the relationship between changes in antiC100-3 and those in serum HCV R N A . Anti-Cl00-3 titers decreased in all patients who tested negative for serum HCV R N A at the end o f therapy. Fifteen patients showed
r---~/ ,
Negative 10"7
1(}-a
10-'
10"
10"
10 -z
llJ-'
1'0
Serum HCV RNA Levels after Therapy (ratio to pretraatment level)
Fig. 4. Changes in anti-HCVcore and changes in serum HCV RNA
following interferon-a therapy in patients with chronic hepatitis C.
TABLE 1 Reductions of antibodies to HCV after interferon-cx therapy in relation to cessation of HCV replication No. of Reductions of antibodies to Serum HCV RNA patients HCV after IFN-a therapy (% of pretreatment levels) anti-C100-3 anti-HCVcore ='1% <1% Negative
17 7 18
5/17 (29%)" 7/7 (100%) 18/18 (100%)
1/17 (6%)" 5/7 (71%) 13/18(72%)
" p<0.01 vs. patients with serum HCV RNA <1% and patients negative for serum HCV RNA.
424 ior of HCV antibodies was impossible during and after therapy withdrawal. Six months after therapy withdrawal, serum HCV R N A was found in nine of the 18 patients who cleared the virus at the end of therapy although the concentration was not available. Increases in anti-C100-3 and anti-HCVcore titers were seen at this point in four (44%) and five (56')0) of these nine cases, respectively. Decreases in anti-Cl00-3 titers were seen in one of the nine cases. Serum alanine aminotransferase (ALT) normalization was observed at the end of therapy in the 18 patients who tested negative for HCV R N A and in another six patients, who showed a reduction of serum HCV R N A to 10-°5-10 -65 of pretreatment levels. Sustained serum A L T normalization was observed in nine cases showing sustained virus clearance and in one case showing transient virus clearance at the end of therapy.
Discussion Recently developed tests for antibodies to HCV have revealed the overwhelming prevalence of HCV infection in chronic non-A, non-B hepatitis patients. There is accumulating evidence that detection of HCV antibodies is closely correlated with the presence of viremia in this population (3-6). Quantitative estimation of antibodies to both structural (core) and nonstructural (C100-3) HCV antigens relative to the levels of viremia in chronic hepatitis C are reported here. These findings do not show a correlation between HCV antibody titers and the levels of viremia among chronic hepatitis C patients. Neither antiC100-3 nor anti-HCVcore titer corresponded to the concentration of serum HCV R N A , indicating different host immune responses to viral antigens among individuals. However, the results of this study showed that a reduction of HCV antibodies occurs following antiviral therapy in association with the suppression of HCV replication. In this study, both anti-C100-3 and anti-HCVcore titers frequently decreased at the end of the 6-month course of interferon-a therapy in patients who showed a reduction of serum HCV R N A levels to the negative range or to <10 -2 of pretreatment levels. In contrast, reduction of HCV antibody titers occurred less frequently in patients whose serum HCV R N A levels did not fall to this range. These data also showed the distinctive characteristics of the two HCV antibodies. Anti-C100-3 decreased more frequently than anti-HCVcore following suppression of HCV replication, and a more marked reduction was observed in anti-Cl00-3 than in anti-HCVcore. Longitudinal studies have also shown that anti-C100-3 decreases quickly following recovery from hepatitis C compared with anti-HCVcore (13). This study supports such observations. Thus, low titers of anti-HCVcore may exist as the
N. YUKI et al. sole HCV marker many years after recovery, indicating previous exposure to HCV, as is the case with low titers of antibody to hepatitis B core antigen (anti-HBc). The difference in immune responses to core and C1003 proteins may be due to the higher immunogenicity of HCV core protein than C100-3 antigen. The C100-3 antigen, which corresponds to a part of the nonstructural region of the HCV genome, might have only weak antigenicity or simply may not be well exposed to the host immune system during HCV propagation. These findings further our understanding o f antibody responses to HCV. This study and other investigations have shown that interferon lowers serum HCV R N A levels, accompanied by improvement of the disease (11,14,15). However, polymerase chain reaction techniques for the detection of HCV R N A are not routinely available, and quantitative estimation of serum HCV R N A levels in positive sera is still impractical. The present study suggests that the concentration of serum HCV R N A frequently decreases after interferon therapy, even in patients who persistently test positive for serum HCV R N A in the polymerase chain reaction. Determination of HCV antibody titers may serve as a simple marker of suppression of viremia following interferon therapy in these cases as well as in those in which clearance of the virus has occurred after therapy. However, data on the quantitative analysis of serum HCV R N A and HCV antibodies are limited in the current study. Further quantitative studies are necessary for full elucidation of the behavior of HCV antibodies during and after interferon therapy.
Acknowledgement This work was supported by a Grant-in-Aid from the Ministry of Education, Science and Culture, Japan.
References 1. Choo Q-L, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M. Isolation of a cDNA clone derived from a bloodborne non-A, non-B viral hepatitis genome. Science 1989: 244: 359-62. 2. Kuo G, Choo Q-L, Alter HJ, et al. An assay lbr circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis. Science 1989; 244: 362-4. 3. Allain J-P, Dailey SH, Laurian Y, et al. Evidence for persistent hepatitis C virus (HCV) infection in hemophiliacs. J Clin Invest 1991: 88: 1672-9. 4. Lok ASF, Cheung R, Chan R, Liu V. Hepatitis C viremia in patients with hepatitis C virus infection. Hepatology 1992; 15: 1007-12. 5. Yuki N, Hayashi N. Hagiwara H, et al. Improved serodiagnosis of chronic hepatitis C in Japan by a second-generation enzymelinked immunosorbent assay. J Med Virol 1992; 37: 237-40. 6. Yuki N, Hayashi N, Hagiwara H, et al. Serodiagnosis of chronic
HCV REPLICATION AND ANTIBODIES TO HCV
7.
8.
9
10
11
hepatitis C in Japan by second generation recombinant immunoblot assay. J Hepatol 1993; 17: 170-4. Hagiwara H, Hayashi N, Mita E, et al. Quantitative analysis of hepatitis C virus ribonucleic acid in serum during interferon-a therapy. Gastroenterology (in press). Yuki N, Hayashi N, Hagiwara H, et al. HCV RNA and antibody to HCV core protein in Japanese patients with chronic liver disease. Dig Dis Sci 1992; 37: 1483-8. Takamizawa A, Mori C, Fuke I, et al. Structure and organization of the hepatitis C virus genome isolated from human carriers. J Virol 1991; 65: 1105-13. Hagiwara H, Hayashi N, Mita E, et al. Detection of hepatitis C virus RNA in chronic non-A, non-B liver disease. Gastroenterology 1992; 102: 692-4. Hagiwara H, Hayashi N, Mita E, et al. Detection of hepatitis C
425
12
13
14
15
virus RNA in serum of patients with chronic hepatitis C treated with interferon-a. Hepatology 1992; 15: 37-41. Takehara T, Hayashi N, Mita E, et al. Detection of the minus strand of hepatitis C virus RNA by reverse transcription and polymerase chain reaction: implications for hepatitis C virus replication in infected tissue. Hepatology 1992; 15: 387-90. Abe K, Inchauspe G, Shikata T, Prince AM. Three different patterns of hepatitis C virus infection in chimpanzees. Hepatology 1992; 15: 690-5. Chayama K, Saitoh S, Arase Y, et al. Effect of interferon administration on serum hepatitis C virus RNA in patients with chronic hepatitis C. Hepatology 1991; 13: 1040-3. Shindo M, DiBisceglie AM, Hoofnagle JH. Long-term followup of patients with chronic hepatitis C treated with a-interferon. Hepatology 1992; 15: 1013-6.
Cop.rrtght© Journalof Hepatology 1994 Journal of Hepatology ISSN 0168.8278
Hepatitis C virus replication and antibodies to structural and nonstructural viral proteins in chronic hepatitis C N o b u k a z u Yuki, N o r i o H a y a s h i , Hideki H a g i w a r a , M a s a f u m i N a i t o , A k i n o r i K a s a h a r a , H i d e y u k i F u s a m o t o and T a k e n o b u K a m a d a First Department o f Medichw, Osaka Universi O, Medical School, Osaka, Japan
(Received 10 November 1992)
The correlation between hepatitis C virus replication and antibodies to both structural (core) and nonstructural (C100-3) hepatitis C virus proteins (anti-HCVcore and anti-C100-3, respectively) was assessed. The concentration of serum hepatitis C virus RNA was determined by a competitive reverse transcription-polymerase chain reaction assay, and antibody titers were determined by endpoint dilution. No correlation was found between viremic levels and antibody titers in 42 chronic hepatitis C patients. At the end of a 6-month course of interferon-o~ therapy, 18 patients became negative for hepatitis C virus RNA. In the other 24 patients, post-treatment viremic levels ranged from 10-65-100.5 of pretreatment levels. Both anti-C100-3 and anti-HCVcore frequently decreased in patients whose viremic levels dropped to the negative range or to <10 -2 of pretreatment levels. Anti-C100-3 decreased in all such cases (25/25), while anti-HCVcore decreased in 18/25 (72%) (p<0.01), indicating that anti-C100-3 is more likely to decrease following suppression of viral replication than antiHCVcore. These data suggest that hepatitis C virus antibodies may serve as a marker of suppression of viremia following interferon therapy even in patients who do not clear the virus. © Journal of Hepatology. Key words: Antibody to C100-3 antigen; Antibody to hepatitis C virus core antigen; Hepatitis C virus RNA; Interferon-
c~; Non-A, non-B hepatitis; Polymerase chain reaction.
Once the genome of hepatitis C virus (HCV) was cloned (1), the development of screening assays for antibodies to structural and nonstructural HCV proteins led to dramatic advances in understanding this agent and in ability to detect the virus. The first-generation HCV antibody assays detect antibodies to the C100-3 antigen, a product of the third and fourth nonstructural genes of HCV (2). The recent identification of additional immunoreactive recombinant HCV antigens from the core and third nonstructural genes and the subsequent development of second-generation HCV antibody assays has increased the sensitivity of screening procedures (3-6). However, various antibody responses have not yet been extensively evaluated in relation to HCV replicative states, and the clinical significance of HCV antibody titers is still controversial.
Recently, we designed an assay for quantifying serum HCV RNA by competitive reverse transcription-polymerase chain reaction (7). In this study, the correlation between serum HCV RNA levels and titers of serum antibodies to both structural (core) and nonstructural (CI003) HCV proteins (anti-HCVcore and anti-C100-3, respectively) was assessed in chronic hepatitis C patients. Changes in HCV antibody titers in relation to the antiviral effect of interferon on HCV replication were also investigated. Materials and Methods Patients
Forty-two patients with chronic non-A, non-B liver disease who were positive for HCV antibody according to
Correspondence to: Norio Hayashi, M.D., First Department of Medicine, Osaka University Medical School, Fukushima 1-1-50, Fukushima-ku,
Osaka 553, Japan
N. YUKI et al.
422
the first-generation assay were studied. There were 32 males and 10 females, ranging from 20 to 66 years old. All patients were negative for hepatitis B surface antigen (HBsAg) and showed no evidence of alcoholic, autoimmune or drug-induced liver disease. Of these 42 patients, 15 had had blood transfusions 3-31 years earlier. All the patients had undergone liver biopsy, with chronic persistent hepatitis in six (14%) and chronic active hepatitis in 36 (86%), and were treated with interferon-a (IFN-~). Three or six megaunits (MU) of natural IFN-~x (Sumiferon, Sumitomo Pharmaceuticals Co., Ltd., Osaka, Japan) were administered intramuscularly for 26 weeks (by daily injection during the first 2 weeks and three times/ week thereafter). Serum samples drawn immediately before and at the end of therapy were stored at - 8 0 ° C and were tested for both HCV RNA levels and HCV antibody titers.
Serological testhTg HBsAg was determined using a commercially available radioimmunoassay (Dainabot Co., Ltd., Tokyo, Japan). Anti-C100-3 was tested with an ELISA system (Ortho Diagnostic Systems Co., Ltd., Tokyo, Japan) according to the manufacturer's instructions. Serum antibody to HCV core protein was also tested with an ELISA system as described elsewhere (8). An HCV cDNA fragment spanning the putative core region (nucleotides 369-700) (9) was expressed in Escherichia coli, and a specific antiHCVcore ELISA was developed using the purified core protein with a calculated molecular weight of 15.3. All assays for HCV antibodies were done in duplicate. The ratio of the mean optical density of the duplicate results to the cut-off value (cut-off index) was useless for comparing ELISA results of different samples because of the high titers of the antibodies. Based on these observations, the absolute antibody titers were expressed as the highest twofold dilution of the test serum showing positive resuits. Detection and quantification on serum H C V R N A HCV RNA was extracted from 100 pl of serum samples, copied into cDNA by reverse transcription, and amplified by the polymerase chain reaction (PCR) as described elsewhere (10-12). Primers were derived from the 5'-noncoding region of the published sequence (9), which is highly conserved among HCV clones; antisense primer 5 ' A T G G T G C A C G G T C T A C G A G A C C T C C 3 ' and sense primer 5'CACTCCCCTGTGAGGAACTACTGTC3'. The PCR mixtures were amplified in a D N A thermal cycler (Perkin-Elmer Cetus, Norwalk, CT) for 40 cycles (94°C for 0.5 min; 55°C for 1 min; 72°C for 1 min), followed by a 10-min final extension at 72°C. An aliquot of the PCR
products was fractionated by agarose gel electrophoresis, transferred onto a nylon membrane, hybridized to a rip_ labelled HCV cDNA between the two primers, and autoradiographed. To quantify serum HCV RNA in positive samples, a competitive reverse transcription-polymerase chain reaction assay was performed as described elsewhere (7). Mutant HCV RNA was produced from an HCV cDNA (M642) to have a novel EcoRI site after amplification by PCR. Reverse transcription-polymerase chain reaction was performed on serum samples in the presence of serial 10°5-fold amounts of mutant HCV RNA. Portions of the PCR products were fractionated by agarose gel electrophoresis after digestion with EcoRI, transferred onto a nylon membrane, hybridized to a rip_ labelled HCV cDNA, and autoradiographed. Serum HCV RNA amounts were estimated by the equilibrium of the signal intensity of a 306-bp undigested DNA fragment derived from serum HCV RNA and that o f a 198-bp EcoRI-digested DNA fragment derived from defined amounts of mutant HCV RNA.
Statistical analysis Statistical analysis for group comparisons was done by the chi-square method.
Results
All serum samples from the 42 chronic hepatitis C patients tested positive for anti-Cl00-3, anti-HCVcore and serum HCV RNA. The reciprocal titers of anti-C100-3 in these sera ranged from 20-27, and those of anti-HCVcore ranged from 26-2 II. The concentration of serum HCV RNA varied from 105-109 copies/ml. There was no corre-
2 7" O)
=
2 8•
:=. .=.
2 5• L,. (3. L..
•
2'-
=
•
v
03
23 -
i 0 Q
22 -
U i
2-
ca
1-
0"
I()s Serum
i
I0 6 HCV
1 ~)r RNA
10 8
|
10 9
(copies/ml)
Fig. 1. Relationship between anti-Cl00-3 and serum HCV RNA in patients with chronic hepatitis C.
HCV REPLICATION AND ANTIBODIES TO HCV
423
2 II--
210.
•
•
.
2 9"
•
•
...
.-.
P
¢'1 "U
..
~J ~
2 8"
0
>o Q3 "1-
..."
2 7.
.
L
E
2 6"
2s 10" Serum HCV RNA
(copies/ml)
Fig. 2. Relationship between anti-HCVcore and serum HCV RNA in patients with chronic hepatitis C.
~
2-
-~ > 1. .................................................................... ,~
|i I
2-"
|
•
.
4-.-4---e---e---~---o ....
:
•
.
.
.
.
•
i
.
i
a reduction of anti-C100-3 by 2-]-2 -3, and three patients became negative for anti-C100-3 at the end of therapy. In the remaining 24 patients, anti-C100-3 decreased by 2-~-2 -2 in all seven patients with a reduction of HCV R N A to < 10 -2 of the pretreatment level and in 5/17 (29%) patients who did not. In contrast, anti-HCVcore titers decreased by 2-t-2 -3 in 13/18 (72%) patients who were negative for serum HCV R N A at the end of therapy. AntiHCVcore decreased by 2 -~ in 5/7 (71%) patients who showed a reduction of serum HCV R N A to < 10 -2 of pretreatment levels and in only one (6%) of the 17 patients who did not (Fig. 4). Reduction of anti-C100-3 and anti-HCVcore occurred more frequently in patients whose viremic levels dropped to the negative range or to < 10 -2 of the pretreatment level than in patients who did not show a reduction of serum HCV R N A to this range (p<0.01) (Table 1). In the former group, anti-C100-3 decreased in 25/25 (100%) patients, while anti-HCVcore decreased in 18/25 (72%) (p<0.01). Increases in anti-C100-3 and anti-HCVcore titers were seen only in patients with post-treatment viremic levels ->10-'- of pretreatment [5/17 (29%) and 1/17 (6%), respectively]. A detailed analysis of HCV R N A levels and the behav-
To ~._o
2_~.
"~ Negative-
2"
| r..-~,t¢
, Negative 10-'
10-"
I0"
10-'
10 -=
l(J -z
10-'
1'0
.
•
1 ......... "!:...........................................................
" : + H
........
Serum HCV RNA Levels after Therapy (ratio to pratreatmant level)
Fig. 3. Changes in anti-C100-3 and changes in serum HCV RNA following interferon-~z therapy in patients with chronic hepatitis C.
®a
2-z.
|
to > o 2-~. I o
lation between anti-C100-3 titers and the concentration of serum HCV R N A (Fig. 1) or between anti-HCVcore titers and the concentration of serum HCV R N A (Fig. 2). HCV antibody titers could be low in highly viremic patients, and conversely, high titers of HCV antibodies could be found in low viremic patients. Changes in HCV antibody titers after a 6-month course of interferon-a therapy were also investigated in relation to changes in the concentration of serum HCV R N A . Serum HCV R N A became undetectable at the end of therapy in 18 (43%) patients, and the concentration decreased to 10-°5-10 -65 of pretreatment levels in 19 (45%). Four patients showed no change in serum HCV R N A levels, while one patient showed a slight increase, of 10°5. Fig. 3 shows the relationship between changes in antiC100-3 and those in serum HCV R N A . Anti-Cl00-3 titers decreased in all patients who tested negative for serum HCV R N A at the end o f therapy. Fifteen patients showed
r---~/ ,
Negative 10"7
1(}-a
10-'
10"
10"
10 -z
llJ-'
1'0
Serum HCV RNA Levels after Therapy (ratio to pretraatment level)
Fig. 4. Changes in anti-HCVcore and changes in serum HCV RNA
following interferon-a therapy in patients with chronic hepatitis C.
TABLE 1 Reductions of antibodies to HCV after interferon-cx therapy in relation to cessation of HCV replication No. of Reductions of antibodies to Serum HCV RNA patients HCV after IFN-a therapy (% of pretreatment levels) anti-C100-3 anti-HCVcore ='1% <1% Negative
17 7 18
5/17 (29%)" 7/7 (100%) 18/18 (100%)
1/17 (6%)" 5/7 (71%) 13/18(72%)
" p<0.01 vs. patients with serum HCV RNA <1% and patients negative for serum HCV RNA.
424 ior of HCV antibodies was impossible during and after therapy withdrawal. Six months after therapy withdrawal, serum HCV R N A was found in nine of the 18 patients who cleared the virus at the end of therapy although the concentration was not available. Increases in anti-C100-3 and anti-HCVcore titers were seen at this point in four (44%) and five (56')0) of these nine cases, respectively. Decreases in anti-Cl00-3 titers were seen in one of the nine cases. Serum alanine aminotransferase (ALT) normalization was observed at the end of therapy in the 18 patients who tested negative for HCV R N A and in another six patients, who showed a reduction of serum HCV R N A to 10-°5-10 -65 of pretreatment levels. Sustained serum A L T normalization was observed in nine cases showing sustained virus clearance and in one case showing transient virus clearance at the end of therapy.
Discussion Recently developed tests for antibodies to HCV have revealed the overwhelming prevalence of HCV infection in chronic non-A, non-B hepatitis patients. There is accumulating evidence that detection of HCV antibodies is closely correlated with the presence of viremia in this population (3-6). Quantitative estimation of antibodies to both structural (core) and nonstructural (C100-3) HCV antigens relative to the levels of viremia in chronic hepatitis C are reported here. These findings do not show a correlation between HCV antibody titers and the levels of viremia among chronic hepatitis C patients. Neither antiC100-3 nor anti-HCVcore titer corresponded to the concentration of serum HCV R N A , indicating different host immune responses to viral antigens among individuals. However, the results of this study showed that a reduction of HCV antibodies occurs following antiviral therapy in association with the suppression of HCV replication. In this study, both anti-C100-3 and anti-HCVcore titers frequently decreased at the end of the 6-month course of interferon-a therapy in patients who showed a reduction of serum HCV R N A levels to the negative range or to <10 -2 of pretreatment levels. In contrast, reduction of HCV antibody titers occurred less frequently in patients whose serum HCV R N A levels did not fall to this range. These data also showed the distinctive characteristics of the two HCV antibodies. Anti-C100-3 decreased more frequently than anti-HCVcore following suppression of HCV replication, and a more marked reduction was observed in anti-Cl00-3 than in anti-HCVcore. Longitudinal studies have also shown that anti-C100-3 decreases quickly following recovery from hepatitis C compared with anti-HCVcore (13). This study supports such observations. Thus, low titers of anti-HCVcore may exist as the
N. YUKI et al. sole HCV marker many years after recovery, indicating previous exposure to HCV, as is the case with low titers of antibody to hepatitis B core antigen (anti-HBc). The difference in immune responses to core and C1003 proteins may be due to the higher immunogenicity of HCV core protein than C100-3 antigen. The C100-3 antigen, which corresponds to a part of the nonstructural region of the HCV genome, might have only weak antigenicity or simply may not be well exposed to the host immune system during HCV propagation. These findings further our understanding o f antibody responses to HCV. This study and other investigations have shown that interferon lowers serum HCV R N A levels, accompanied by improvement of the disease (11,14,15). However, polymerase chain reaction techniques for the detection of HCV R N A are not routinely available, and quantitative estimation of serum HCV R N A levels in positive sera is still impractical. The present study suggests that the concentration of serum HCV R N A frequently decreases after interferon therapy, even in patients who persistently test positive for serum HCV R N A in the polymerase chain reaction. Determination of HCV antibody titers may serve as a simple marker of suppression of viremia following interferon therapy in these cases as well as in those in which clearance of the virus has occurred after therapy. However, data on the quantitative analysis of serum HCV R N A and HCV antibodies are limited in the current study. Further quantitative studies are necessary for full elucidation of the behavior of HCV antibodies during and after interferon therapy.
Acknowledgement This work was supported by a Grant-in-Aid from the Ministry of Education, Science and Culture, Japan.
References 1. Choo Q-L, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M. Isolation of a cDNA clone derived from a bloodborne non-A, non-B viral hepatitis genome. Science 1989: 244: 359-62. 2. Kuo G, Choo Q-L, Alter HJ, et al. An assay lbr circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis. Science 1989; 244: 362-4. 3. Allain J-P, Dailey SH, Laurian Y, et al. Evidence for persistent hepatitis C virus (HCV) infection in hemophiliacs. J Clin Invest 1991: 88: 1672-9. 4. Lok ASF, Cheung R, Chan R, Liu V. Hepatitis C viremia in patients with hepatitis C virus infection. Hepatology 1992; 15: 1007-12. 5. Yuki N, Hayashi N. Hagiwara H, et al. Improved serodiagnosis of chronic hepatitis C in Japan by a second-generation enzymelinked immunosorbent assay. J Med Virol 1992; 37: 237-40. 6. Yuki N, Hayashi N, Hagiwara H, et al. Serodiagnosis of chronic
HCV REPLICATION AND ANTIBODIES TO HCV
7.
8.
9
10
11
hepatitis C in Japan by second generation recombinant immunoblot assay. J Hepatol 1993; 17: 170-4. Hagiwara H, Hayashi N, Mita E, et al. Quantitative analysis of hepatitis C virus ribonucleic acid in serum during interferon-a therapy. Gastroenterology (in press). Yuki N, Hayashi N, Hagiwara H, et al. HCV RNA and antibody to HCV core protein in Japanese patients with chronic liver disease. Dig Dis Sci 1992; 37: 1483-8. Takamizawa A, Mori C, Fuke I, et al. Structure and organization of the hepatitis C virus genome isolated from human carriers. J Virol 1991; 65: 1105-13. Hagiwara H, Hayashi N, Mita E, et al. Detection of hepatitis C virus RNA in chronic non-A, non-B liver disease. Gastroenterology 1992; 102: 692-4. Hagiwara H, Hayashi N, Mita E, et al. Detection of hepatitis C
425
12
13
14
15
virus RNA in serum of patients with chronic hepatitis C treated with interferon-a. Hepatology 1992; 15: 37-41. Takehara T, Hayashi N, Mita E, et al. Detection of the minus strand of hepatitis C virus RNA by reverse transcription and polymerase chain reaction: implications for hepatitis C virus replication in infected tissue. Hepatology 1992; 15: 387-90. Abe K, Inchauspe G, Shikata T, Prince AM. Three different patterns of hepatitis C virus infection in chimpanzees. Hepatology 1992; 15: 690-5. Chayama K, Saitoh S, Arase Y, et al. Effect of interferon administration on serum hepatitis C virus RNA in patients with chronic hepatitis C. Hepatology 1991; 13: 1040-3. Shindo M, DiBisceglie AM, Hoofnagle JH. Long-term followup of patients with chronic hepatitis C treated with a-interferon. Hepatology 1992; 15: 1013-6.