- Email: [email protected]
Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio
Environmental Pollution xxx (2017) 1e8
Contents lists available at ScienceDirect
Environmental Pollution journal homepage: www.elsevier.com/locate/envpol
Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio* Zhenghua Duan a, Yanshuai Xing b, Zhitong Feng a, Huiyuan Zhang a, Caixia Li c, Zhiyuan Gong c, Lei Wang b, *, Hongwen Sun b a
School of Environmental Science and Safety Engineering, Tianjin University of Technology, Tianjin 300384, China Ministry of Education Key Laboratory of Pollution Processes and Environmental Criteria, Tianjin Key Laboratory of Environmental Remediation and Pollution Control, Nankai University, Tianjin 300071, China c Department of Biological Sciences, National University of Singapore, Singapore 117543, Singapore b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 10 November 2016 Received in revised form 11 February 2017 Accepted 24 February 2017 Available online xxx
As an emerging contaminant, 1-H-benzotriazole (1H-BTR) has been detected in the engineered and natural aquatic environments, which usually coexists with heavy metals and causes combined pollution. In the present study, wild-type and transgenic zebrafish Danio rerio were used to explore the acute toxicity as well as the single and joint hepatotoxicity of cadmium (Cd) and 1H-BTR. Although the acute toxicity of 1H-BTR to zebrafish was low, increased expression of liver-specific fatty acid binding protein was observed in transgenic zebrafish when the embryos were exposed to 5.0 mM of 1H-BTR for 30 days. Besides, co-exposure to 1H-BTR not only reduced the acute toxic effects induced by Cd, but also alleviated the Cd-induced liver atrophy in transgenic fish. Correspondingly, effects of combined exposure to 1H-BTR on the Cd-induced expressions of several signal pathway-related genes and superoxide dismutase and glutathione-s-transferase proteins were studied. Based on the determination of Cd bioaccumulation in fish and the complexing stability constant (b) of Cd-BTR complex in solution, the detoxification mechanism of co-existing 1H-BTR on Cd to the zebrafish was discussed. © 2017 Elsevier Ltd. All rights reserved.
Keywords: Benzotriazole Cadmium Zebrafish Hepatotoxicity Complexation
1. Introduction 1-H-benzotriazole (1H-BTR) is widely used as corrosion inhibitor in engine antifreeze and printing inks (Avagyan et al., 2015; Liang et al., 2014). Reportedly, at least 9000 tons of BTR compounds were produced in the USA in 1999 (Hart et al., 2004). Given the high solubility of 1H-BTR in water (Table S1 in the Supplementary data), they can directly enter various aquatic ecosystems through municipal wastewater effluents and surface runoffs. Widespread occurrence of 1H-BTR in freshwater and marine environments has been reported (Seeland et al., 2012; Wang et al., 2016), occasionally at high levels of mg/L or even mg/L (Cancilla et al., 1998; Giger et al., 2006). The reported sub-lethal impacts and sub-inhibitory effects of 1H-BTR to aquatic organisms and animals are commonly low. As
*
This paper has been recommended for acceptance by Dr. Chen Da. * Corresponding author. Nankai University, 94 Weijin Road, Tianjin 300071, China. E-mail address: [email protected] (L. Wang).
found in the acute tests with Daphnia magna (Seeland et al., 2012), the 48 h EC10 and EC50 values of 1H-BTR were 3.94 and 107 mg/L, while in the 21-day reproduction tests 1H-BTR showed no adverse effect. Kadar et al. (2010) reported that the lowest observed effective concentration of 1H-BTR for the 48 h hatch rate in Ciona intestinalis was 32 mg/L (Kadar et al., 2010). However, more knowledge about 1H-BTR's physiological toxicity, such as hepatotoxicity to the aquatic organisms, is still needed (Liang et al., 2014). Combined pollutants usually coexist in the engineered and natural aquatic environments, which might result in complicated toxic effect. For example, cadmium (Cd)-phenanthrene mixtures produced a less-than additive mortality in the oligochaete, Ilyodrilus templetoni in sediments (Gust and Fleeger, 2006), while a more-than-additive lethality induced by Cd-phenanthrene coexposure was found in the waterborne copepod, Amphiascoides atopus (Fleeger et al., 2007). 1H-BTR is applied to retard the corrosion of metal surfaces by forming metal-BTR complexes (Health Council of the Netherlands, 2000). Although both of 1HBTR and heavy metals are frequently detected in the aquatic environments, little is known about their combined toxic effects on the
http://dx.doi.org/10.1016/j.envpol.2017.02.055 0269-7491/© 2017 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055
2
Z. Duan et al. / Environmental Pollution xxx (2017) 1e8
aquatic organisms. In this study, wild-type and transgenic zebrafish (Danio rerio) were chosen as the test organisms, and the acute and developmental toxicity of 1H-BTR and cadmium (Cd) in their single and combined exposure treatments were assessed. The expressions of the genes related several typical pathways and the oxidative stressrelated enzymes in liver of zebrafish in different exposure treatments were contrasted. Based on the measured distribution of Cd species in 1H-BTR solution, joint toxicity of co-existing Cd and 1HBTR was further explained.
2. Materials and methods 2.1. Chemicals 1H-BTR and cadmium chloride (CdCl2) were purchased from Sigma-Aldrich (>99.9% purity) and dissolved in egg water (60 mg/L sea salt dissolved in reconstituted water). The reconstituted purified water was prepared according to the ISO standard (7346-3: 1996), with pH of 8.0 and the hardness of approximately 150 mg/L of calcium carbonate (CaCO3).
2.2. Zebrafish Two kinds of zebrafish (Danio rerio) were applied in toxic test of this study. Wild-type zebrafish were purchased from local ornamental fish suppliers. The LiPan transgenic zebrafish line Tg (lfabp10a: dsRed; elaA: EGFP) used in this study was established previously in the laboratory in Singapore (Korzh et al., 2008), in which the size changes of the liver under pollutants exposure can be observed directly. All the adult zebrafish were maintained indoors at an ambient temperature of approximately 26 ± 1 C with a natural dark/light cycle of 10/14 h in the zebrafish aquarium facility at the Department of Biological Sciences, National University of Singapore. During the spawning period, the fish were fed brine shrimp (World Aquafeeds, USA) once each day. Embryos were collected by siphoning with a plastic pipe the next morning. Studies involving zebrafish and embryo were conducted in accordance with national and institutional guidelines for the protection of human subjects and animal welfare.
2.3. Developmental toxicity of Cd and 1H-BTR on zebrafish embryos According to the method of OECD TG 236 (OECD Guidelines for the Testing of Chemicals, Test No.236: Fish Embryo Acute Toxicity Test), the developing embryos (wide-type) were exposed to a nominal concentration of 5.0 mM of 1H-BTR and 1.0 mM of Cd singly or jointly in 24-well multi-plates. In detail, 2 mL of solvent control or treatment solution was added to each plate of the 24 wells, which were then placed in an incubator at 26 ± 1 C. Each well contained one embryo. The medium (with or without chemicals) was replenished every two days during the total four days exposure. Four independent plate replications were performed. The developmental status of the zebrafish embryos was observed with an inverted microscope (8e50X) (IMT 2, Olympus Corp., Tokyo, Japan). Consequently, 24 h post-fertilization (hpf) blood circulation according to the pre-experiment results and 56 hpf survival and hatching rates were recorded as indicators for chemical toxicity. The exposure concentrations in the experiments, i.e. 5.0 mM for 1HBTR and 1.0 mM for Cd, were designed based on the actual concentrations in the water environments and the toxicity data obtained through the pre-experiments.
2.4. Developmental toxicity of Cd and 1H-BTR on transgenic zebrafish liver The adult LiPan fish were used to cross with wild-type fish in order to obtain 100% semizygous transgenic embryos. Embryos were collected and incubated in six-well plates for 3e6 days in egg water. The developing embryos were exposed to a nominal concentration of 1.0 mM Cd singly or jointly with 1H-BTR at gradient concentrations, i.e. 0.2, 1.0 and 5.0 mM. Thus there were totally five batches in this experiment, including the four treatment batches and a control. In each batch, fifty embryos were placed in a well with 10 mL of solution contained. The solution was refreshed every two days, and four independent replications were performed. After 30-day exposure, ten larvae were randomly selected from each batch and anaesthetized with 0.1% 2-phenoxyethanol for the purpose of photographing. Green/red fluorescent protein (GFP/RFP) fluorescence in the fry was observed under a fluorescent microscope (Axiovert 200M, Zeiss, German) with GFP/RFP filters and photographed with a digital camera (AxiocCam HRC, Zeiss, German) under the same lateral view of the liver region of each fry. The average RFP intensity in the liver under the same magnification and fixed exposure time was then quantified by Image J software (Wayne Rasband, National Institutes of Health, USA). 2.5. Expressions of typical genes and enzymes in zebrafish liver induced by Cd and 1H-BTR To further discuss the toxicity mechanism of Cd and 1H-BTR to the fish liver, a 30-day sub-chronic toxicity test was performed on zebrafish in control together with that in five treatments, including 1H-BTR singly at 5.0 mM; Cd singly at 1.0 mM; combined exposure of 1H-BTR (5.0 mM) and Cd (1.0 mM) concurrently (namely “Meantime” group); 1H-BTR (5.0 mM) exposed singly for 24 h with subsequent addition of Cd (1.0 mM) into the solution for 30-day exposure (namely “BTR/Cd” group); and Cd (1.0 mM) exposed singly for 30 days with subsequent addition of 1H-BTR (5.0 mM) into the solution for another 24 h (namely “Cd/BTR” group). To avoid potential gender difference, only female fish were selected in this experiment. For each group, 26 wild-type adult female zebrafish was added to 50 L treatment solution in a glass aquarium (50 cm 40 cm 30 cm). Two-thirds fresh solution was replenished every day. After 30-day exposure, 20 fish were dissected and the liver tissue obtained from every four fish was collected together as one sample, resulting in five replications for each group. The fresh liver samples were frozen immediately and stored at 80 C for subsequent mRNA and protein expression analysis. The remaining 6 fish were frozen at 20 C for the further analysis of Cd. The expression of eight genes involved in four typical signal pathways, metallothionein (zmt, dmt), inflammation (tnf, serp), carcinogenesis (p53, mdm2) and apoptosis signaling (b1p1, tnfr), was studied in wild-type adult zebrafish liver. Total RNA was extracted through TRIzol-based RNA extraction methods and reverse-transcribed to cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche, USA). Quantitative PCR was performed with the LightCycler 480 SYBR Green I Master-Kit (Roche, USA) in observance of the accompanying guidelines. The relative expression ratio (fold change) was calculated based on DDCt (DDCt ¼ ðCt;target Ct;bactin Þtreatment ðCt;target Ct;bactin Þcontrol ) and the fold change of 2DDCt . The primers of targeted genes and references genes are shown in Table 1. Two enzymes activity indices related to oxidative stress in fish liver, i.e. superoxide dismutase (SOD) and glutathione-s-transferase (GST), were also detected. Tissue Protein Extraction Reagent (TPER) was purchased from Pierce Biotechnology (Rockford, IL, USA).
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055
Z. Duan et al. / Environmental Pollution xxx (2017) 1e8
3
statistically different, and p < 0.01 statistically significantly different.
Table 1 The primers of targeted genes and references genes. Genes
Pathways
Primer seq
Size (bp)
zf -action
Reference gene
200
3. Results
zmt
Metallothionein
130
3.1. Toxicity of Cd and 1H-BTR on the wild-type zebrafish embryo
dmt
Metallothionein
serp
Inflammation
tnf
Inflammation
p53
Carcinogenesis
mdm2
Carcinogenesis
b1p1
Apoptosis signaling
tnfr
Apoptosis signaling
F:CCGTGACATCAAGGATAAGCT R:TCGTGGATACCGCAAGATTCC F: GCCAAGACTGGAACTTGCAAC R: CGCAGCCAGAGGCACACT F: ACTCCGCACTCGTCAAGTCT R: CGTAGAAGGCCTCAGCAAAC F:AGGAGGAACACGAACACTCG R: TGAAGACTGAGACTGGGAGACG F:TGATGATGACCGTATATCTCGC R: TCATGTCTCTTAAAGCCGACC F:ATTTAGGCTCAGGTTCCCG R: GCCAAGTTATCTCCATCCG F:AGTGAAGAGAGCGAAGACTCAG R: AAGAGGAGGGTTGAACTGGTC F: AGAGCGTGATGGATGAGGTG R: TCTTGCGATTTCCTGCTTTCC F:ACCATCAGCCTCAAATAGCAC R:TCCTCCTCTTTCTCCAGTCCTG
162 261 289 243 199 202 215
SOD assay kit (CS 19160) and GST assay kit (CS 0410) were purchased from Sigma-Aldrich (USA). The total protein of the fish liver was extracted using 60 mL of T-PER and 0.6 mL of 1:100 Complete Protease Inhibitor Cocktail (Roche, USA). The protein concentration was tested at the 595 nm wavelength, while 1 mg/mL BSA (Bovine Serum Albumin) was considered to be the standard. 2.6. Cadmium analysis The frozen fish were lyophilized and ground into powder in agate mortars. After that, 0.2 g of the samples from each fish were accurately weighed, and then digested with 5 mL of nitric acid (w%, 65%), 3 mL of hydrofluoric acid (w%, 40%) and 1 mL oxydol (w%, 30%) in a microwave digestion vessel for 10 min at 130 C, followed by 5 min at 150 C, and then 20 min at 190 C. The digests were then transferred to a centrifuge tube and diluted to 50 mL with ultrapure water (MilliQ water, Millipore, 18 MU). Cd concentrations in the diluted digests were determined by an ICP-MS (Elan drc-e, Perkin-Elmer Co.) and the dry weight concentrations of Cd in fish were calculated. The Cd speciation was analyzed based on the complexing stability constant (b) of Cd-BTR complex. The value of b was measured by using potentiometric titration method, with the detailed information provided in Table S2. In brief, the titration data obtained from an automatic potentiometric titrator (Fig. S1&S2 in the Supplementary data) was used to calculate the optimal b by a chemical equilibrium calculation program, FITEQL (version 3.1) (Herbelin and Westall, 1994). All of the possible complex formations were input into the program to obtain the most reasonable complex formation. Based on the laboratory results, the speciation of Cd in the presence or in the absence of 1H-BTR at different pH values was calculated using a chemical equilibrium model, visual MINTEQ (version 3.0) (Gustafsson, 2011). The optimal value of b was added to the database of visual MINTEQ to calculate the Cd speciation.
According to the pre-experiment, 24 hpf blood-circulation inhibition, 56 hpf hatch rate inhibition, and 56 hpf survival rate of the wild-type zebrafish embryo were selected as the observed endpoints in this experiment. At each of the three endpoints, significant toxic effects of Cd (1.0 mM, single exposure) were found (p < 0.05) (Fig. 1). However, no significant effect at any endpoint was found when the embryos were exposed to 5.0 mM of 1H-BTR. Notably, when 1H-BTR (5.0 mM) presented concurrently with Cd (1.0 mM), the ratios of 24 hpf no blood-circulation inhibition (p < 0.01) in the zebrafish embryos decreased from 20.8% (singly exposed to Cd) to 6.9% (jointly exposed to Cd and BTR), while that of 56 hpf no hatch (p < 0.05) decreased from 100% to 83.3%. More significant detoxification effect of 1H-BTR to Cd was observed on the 56 h death rate of the zebrafish embryo. While a 56 h death rate of 27.8% (p ¼ 0.01) induced by the single exposure of Cd (1 mM) was observed, it decreased to 11.1% when the embryo was exposed to the mixture solution of Cd (1 mM) and 1H-BTR (5 mM). 3.2. Single and joint toxicity of Cd and 1H-BTR on the transgenic zebrafish liver Both of the two exogenous compounds of this study, 1H-BTR and Cd, showed toxic effect to liver of the transgenic zebrafish larvae, but with opposite symptoms (Fig. 2). Exposure to 1H-BTR resulted in the increased expression of liver-specific fatty acid binding protein 10a (lfabp10a, marked by red fluorescence in Fig. 2) and the increased fish liver size, suggesting an increased risk of fatty liver. Cd treatment led to the decreased expressions of lfabp10a, and thereby the fish liver size decreased. As shown in Figs. 2 and 3, single exposure of 1H-BTR and Cd led to adverse impacts on the liver size of the fish. The average liver size increased (p < 0.05) when LiPan fish larvae were exposed to 1H-BTR (5.0 mM). On the contrary, the liver size decreased (p < 0.05) when the larvae were exposed to Cd (1.0 mM). In addition, the fish liver sizes decreased in all the co-exposure treatments which verified that the expression of lfabp10a in fish liver was down-regulated (Fig. 3). However, with the increasing concentration of 1H-BTR in the mixture solution, the degree of liver atrophy was reduced. The
2.7. Statistical analysis Data from microscopic examinations of the embryos/fish and gene/enzyme expressions were categorized according to types and severities of effects, and the final results were shown as the mean ± S.D. Normality and homogeneity of variance for all data were checked using SPSS 19.0 (SPSS, Inc., Chicago, IL, USA), and comparison analyses between control and treated groups were carried out by the student t-test. A p value of <0.05 was considered
Fig. 1. The single and joint toxicities of 1H-BTR and Cd in the development of wildtype zebrafish embryos.
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055
4
Z. Duan et al. / Environmental Pollution xxx (2017) 1e8
Fig. 2. The general view of the hepatotoxicities of 1H-BTR and Cd using LiPan transgenic zebrafish line Tg (lfabp10a: dsRed; elaA:EGFP) under a fluorescent microscope. Ctr: in fish of the control group; 5 mM 1H-BTR: in fish of the 5.0 mM 1H-BTR treatment; 1 mM Cd: in fish of the 1.0 mM Cd treatment; and Combined: in fish of the combined exposure treatment of 5.0 mM 1H-BTR and 1.0 mM Cd.
Fig. 3. The statistical data about the influence of 1H-BTR on the hepatotoxicity of 1.0 mM Cd using LiPan transgenic zebrafish line Tg (lfabp10a: dsRed; elaA:EGFP). Different letters (a or b) indicate significant difference (p < 0.05) compared with control or single exposure to 1.0 mM Cd, respectively.
RTF fluorescence intensity of lfabp10a in fish liver exposed at 0, 0.2, 1.0 and 5.0 mM of 1H-BTR combined with 1.0 mM of Cd were 4.09, 4.35, 4.37 and 4.83 (103), respectively, indicates that the expression of lfabp10a was weakened in a dosage-dependent manner with increasing exposure to 1H-BTR (R2 ¼ 0.884).
expression of tnfr (Fig. 4). For example, the expression of zmt and dmt mRNA in the fish liver exposed to 1.0 mM Cd was much higher than those exposed to 5.0 mM 1H-BTR (zmt, p ¼ 0.011; dmt, p ¼ 0.009). The exposure sequence of fish to Cd and 1H-BTR also affects the gene expression level. As shown in Fig. 4, when the fish were exposed to 5.0 mM 1H-BTR and 1.0 mM Cd concurrently, the respective expressions of zmt and dmt mRNA were not decreased as compared to separate, single exposures. Moreover, compared to the expression of dmt mRNA in the group exposed to Cd singly, jointly exposure of Cd and 1H-BTR in different sequences induced an increasing expression of dmt (Fig. 4). The expressions of tnf and serp in fish liver could also be greatly induced by single exposures of 5.0 mM 1H-BTR and 1.0 mM Cd (p < 0.05). When the fish were exposed to the two chemicals with three different combination conditions, the induction degrees of tnf and serp were significantly decreased in comparison to those in Cd single exposure. In particular, when the fish were first treated with Cd for 30 days and then 1H-BTR was added, the up-regulation of tnf and serp mRNA expression was dramatically decreased (p < 0.01). This phenomenon was also observed in the expressions of p53, mdm2, b1p1 and tnfr. 3.4. Expression of the oxidative stress-related enzyme in the zebrafish liver
3.3. Expression level of typical genes in the adult zebrafish liver The expression of eight genes involved in four typical signal pathways, i.e. zmt and dmt (metallothionein related), tnf and serp (inflammation related), p53 and mdm2 (carcinogenesis related), as well as b1p1 and tnfr (apoptosis signaling related), in wild-type adult zebrafish liver was measured. All eight genes were induced when the fish were exposed to 5.0 mM of 1H-BTR or 1.0 mM of Cd (p < 0.05), while the induction level of the eight genes induced by Cd was significantly higher than induced by 1H-BTR, except for the
As shown in Fig. 5, there was no significant change in SOD expression in the fish liver when fish was exposed to 5.0 mM of 1HBTR singly (p ¼ 0.118). However, Cd at 1.0 mM could induce the expression of SOD protein (p < 0.01). SOD expression was also affected by the exposure sequence of Cd and 1H-BTR. In the fish of “Cd/BTR” group, which were firstly exposed to Cd (1.0 mM) for 30 days before the adding of 1H-BTR into the solution, no significant difference existed in comparison to that in fish exposed to Cd alone (p ¼ 0.106) (Fig. 5). However, in the
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055
Z. Duan et al. / Environmental Pollution xxx (2017) 1e8
5
Fig. 4. The single and joint toxicities of 1H-BTR (5.0 mM) and Cd (1.0 mM) in the expressions of several typical signal pathway-related genes. Meantime: combined exposure of 1H-BTR (5.0 mM) and Cd (1.0 mM) concurrently; and BTR/Cd: 1H-BTR (5.0 mM) exposed singly for 24 h with subsequent addition of Cd (1.0 mM) into the solution for 30-day exposure; Cd/BTR: Cd (1.0 mM) exposed singly for 30-day with subsequent addition of 1H-BTR (5.0 mM) into the solution for another 24 h exposure. Different letters (a or b) indicate significant difference (p < 0.05) compared with control or single exposure to 1.0 mM Cd, respectively.
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055
6
Z. Duan et al. / Environmental Pollution xxx (2017) 1e8
Fig. 5. The expressions of SOD proteins in adult zebrafish liver and the Cd bioaccumulation concentrations in different treatments. Meantime: combined exposure of 1H-BTR (5.0 mM) and Cd (1.0 mM) concurrently; and BTR/Cd: 1H-BTR (5.0 mM) exposed singly for 24 h with subsequent addition of Cd (1.0 mM) into the solution for 30-day exposure; Cd/BTR: Cd (1.0 mM) exposed singly for 30-day with subsequent addition of 1H-BTR (5.0 mM) into the solution for another 24 h exposure. Different letters (a or b) indicate significant difference (p < 0.05) compared with control or single exposure to 1.0 mM Cd, respectively.
group of “Meantime”, i.e. fish exposed to the mixture solution of Cd (1.0 mM) and 1H-BTR (5.0 mM), the up-regulation of SOD expression was dramatically decreased (p < 0.01). When the fish were treated with 5.0 mM of 1H-BTR solution for 24 h prior to 30-day Cd exposure (i.e. the group of “BTR/Cd”), there was a further decrease in the up-regulation of SOD expression in the fish liver, compared to that in fish singly exposed to Cd solution. GST expression in the fish liver could be induced by both of 1HBTR and Cd (p < 0.01) (Fig. S3). At this endpoint, more toxic effect was observed in group of “1.0 mM Cd”. The joint toxicity level indicated by GST expression in fish of the three combined exposure groups, i.e. “Cd/BTR”, “Meantime”, and “BTR/Cd”, decreased compared to that observed in the group of “1.0 mM Cd”, particularly in the group of “BTR/Cd”. 3.5. Cd bioaccumulation in adult zebrafish In adult zebrafish exposed to Cd at 1.0 mM for 30 days, a bioaccumulation concentration of 17.42 mg/kg were detected (Fig. 5). In the fish of “Meantime” group which were exposed to the mixture solution of Cd (1.0 mM) and 1H-BTR (5.0 mM), a higher Cd bioaccumulation of 20.38 mg/kg. On the contrary, when the fish was firstly exposed to Cd (1.0 mM) for 30 days and then exposed to 1HBTR (5.0 mM) for another 24 h, a much lower Cd bioaccumulation of 9.47 mg/kg were detected in this “Cd/BTR” group. Interestingly, significantly higher bioaccumulation of Cd was observed in the fish of “BTR/Cd” group. When the zebrafish was firstly exposed to 1HBTR (5.0 mM) for 24 h, Cd concentration of 99.87 mg/kg in fish was observed after a 30-day Cd exposure (1.0 mM). 3.6. Cd species distribution in solution Cd-BTR complex might present in the solutions containing both of Cd and 1H-BTR. The fitting results indicate that CdðBTR Þ2 is the major form of the complex (eq (1)), while the logb of the complex was calculated to be 7.10 (more details are shown in Table S2).
Cd þ 2BTR ¼ Cd BTR þ 2Hþ 2
(1)
Based on the value of b, speciation of Cd can be calculated by using Visual MINTEQ (Gustafsson, 2011). Distribution of Cd species in the presence or absence of 1H-BTR at different pH values is illustrated in Fig. 6. In solutions at pH 8.0 used in the present study, Cd2þ is the major existing (Fig. 6(A)). With the adding of 1H-BTR in solution, distribution of Cd2þ decreased significantly, while percentage of CdðBTR Þ2 increased accordingly (Fig. S4 (A&B)). In
Fig. 6. The distribution of Cd species at different pH levels in solutions of Cd alone (A) and Cd:1H-BTR ¼ 1:5 (B).
solution with co-existing Cd and 1H-BTR at mole ration of 1:5, almost all Cd2þ transformed to the complex specie, i.e. CdðBTR Þ2 (Fig. 6(B)).
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055
Z. Duan et al. / Environmental Pollution xxx (2017) 1e8
4. Discussion 4.1. Low-dose effects of 1H-BTR Due to the widespread application, BTR and derivatives were frequently detected in aquatic environments (Seeland et al., 2012), sometimes at very high concentrations. For example, concentration of methyl-BTR, up to over 2000 mg/L, was reported in the surface waters which related to airport runoffs (Corsi et al., 2003). In embryo of wild-type zebrafish, no developmental toxicity effect was observed with 4-day exposure of 1H-BTR at 5.0 mM (600 mg/L approximately). Liver plays an important role in substance transport and energy metabolism, and it has been considered as a target organ for many xenobiotics. As found in this study, exposure to 1HBTR at 5.0 mM can enlarge the liver size of transgenic zebrafish. The transgenic fish were more sensitive than the wild-type fish in response to the exogenous chemicals. Furthermore, with liverspecific red fluorescent protein (DsRed) expression under the fabp10a promoter, red fluorescence in the liver greatly facilitates the observation of more detailed changes in hepatotoxicity, including liver red fluorescence intensity and liver size, in live Lipan fish (Korzh et al., 2008). Sensitivity of the LiPan transgenic zebrafish line used in the present study had been verified in previous studies. Zhang et al. tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone) in LiPan transgenic zebrafish and demonstrated that those hepatotoxins could significantly reduce the expression of lfabp10a and marked liver size in a dosage-dependent manner (Zhang et al., 2014). Zebrafish lfabp10a is an important constituent in the liver-type fatty acid binding protein family (L-FABP). It was found that L-FABP was related to the absorption, translocation and metabolic regulation of fatty acid, and that it may participate in signal transduction, mitosis and antioxidant function (Nguyen et al., 2012). Landrier et al. (2004) also reported that the induction of L-FABP expression had a significant correlation to the occurrence of fatty liver. The expressions of eight typical genes involved in the signal pathways of metallothionein, inflammation, carcinogenesis and apoptosis signaling in liver of the wild-type adult zebrafish, were all induced by 1H-BTR at 5.0 mM. The expressions of the inflammationrelated genes, i.e. tnf and serp, could also be greatly induced by single exposures to 5.0 mM of 1H-BTR. This may corroborate the physiological size increase of the fish liver shown in Fig. 2. Besides, GST is one of the key enzymes that mediate phase II of cellular detoxification. In this study, GST expression in liver of adult widetype zebrafish was induced by 5.0 mM of 1H-BTR. Considering that relatively high concentrations of BTR have been detected in the environments in some cases, the health risks of BTR contamination to aquatic organisms should be of concern.
7
vital role in an organism's self-protection system for the oxidative damage. Detoxification effect can be also observed in SOD expression. Although Cd exposure resulted in a significant increase of SOD in fish liver, less changes of SOD in liver of fish of the combined exposure treatments were observed. Due to the lone-electron pairs on the nitrogen and sulfur atoms of BTR molecular, BTR might readily integrate with various heavy-metal ions in combined pollution environments. Toxicities of heavy metals could be dramatically reduced by organic complexion (Gauthier et al., 2015; Liu et al., 2016), as the concentrations of metal ions in their free form was reduced through this process. For example, the toxicities of metal supramolecular anticancer drugs could be reduced when the metal ions were chelated with thiazole groups (Tamasi et al., 2010). Many chelating agents have been demonstrated to be an effective antioxidant to Cd, such as humic acid (Kamunde and MacPhail, 2011), EDTA (Gil et al., 2011; Loureiro et al., 2011), monensin (Ivanova et al., 2014), phytochelatins (Figueira et al., 2014), chitosan (Li et al., 2014), and Epigallocatechin-3-gallat (An et al., 2014). According to the measured Cd-BTR complexing stability constant (b) of up to 107, almost all Cd exist as the Cd-BTR complex form in the combined exposure solution. Therefore, waterborne co-exposures to 1H-BTR and Cd might result in an overall less-than-additive toxicity, due to the complexation characters of 1H-BTR with the heavy metal ions, even if the Cd accumulation in fish slightly increased. Very similar results were observed in earthworms exposed to copper and ciprofloxacin (Huang et al., 2009). Although the co-existence of ciprofloxacin, a ligand for Cu2þ, increased the uptake of copper in earthworms, the mortality of earthworms induced by copper decreased significantly. Metal-sensitive fraction of heavy metals in the tissues of the earthworms was assumed to decrease with the co-exposure of exogenous organic ligand in that case (Huang et al., 2009). Interestingly, exposure sequence seems to play important role on the detoxification effects. Despite the significant decrease of SOD expression in fish exposed to 1H-BTR and Cd concurrently (compared to that in fish exposed to Cd singly), only slight change of SOD was measured in fish exposed firstly to Cd and then to 1HBTR, although the subsequent addition of 1H-BTR decreased the bioaccumulation of Cd. This indicates that liver damage induced by Cd exposure cannot be recovered by exposure of 1H-BTR. On the contrary, compared with the SOD expression in fish liver of the control group, there is no change in fish exposed firstly to 1H-BTR and then to Cd, even if the highest Cd bioaccumulation was observed in these fish. This might suggest an in vivo complexation of 1H-BTR and Cd in fish, which increase the Cd accumulation but decrease the metal-sensitive fraction of Cd. Considering the frequent detection of BTR compounds in human (Asimakopoulos et al., 2013; Wang et al., 2015), this mechanism might be also has implications for human.
4.2. The potential mechanism for the cadmium detoxification by 1H-BTR In this study, the toxicity of Cd ions (1.0 mM) was reduced by the coexisting 1H-BTR (5.0 mM) at the endpoints of 24 h blood circulation, 56 h hatch-out and the 56 h survival ratio (Fig. 1). Correspondingly, the expressions of inflammation-related genes (serp), carcinogenesis-related genes (p53, mdm2), and apoptosis signaling-related genes (b1p1, tnfr) induced by Cd in fish liver, could also be decreased by the co-exposure to 1H-BTR (Figs. 4 and 5). To the best of our knowledge, it is the first time to report that presence of BTR, a widespread organic emerging contaminant, could decrease the toxicity of heavy metal pollutants. SOD is widely present as a metal enzyme in organisms. An organism's superoxide radical (O2-) can be catalyzed and removed according to its disproportionation reaction. Therefore, it plays a
5. Conclusions Although the acute toxicity of 1H-BTR was verified to be low, its hepatotoxicity, including changes of liver size and abnormal expression of typical genes and enzymes in liver was observed in zebrafish exposed to 1H-BTR at environmental concentration level. In addition, detoxification of Cd in zebrafish by the co-existing 1HBTR was found, while this detoxification effect was not consistent with the changes of Cd bioaccumulation in fish. Based on the result of Cd species analysis, the protective mechanism of BTR to Cd exposure was explained by forming BTR-Cd complex, which might has toxicity lower than Cd ions.
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055
8
Z. Duan et al. / Environmental Pollution xxx (2017) 1e8
Acknowledgements This work was supported by the Tianjin Talent Development Scholarship Fund in China (Grant No. [2013]52); the Tianjin Research Program of Application Foundation and Advanced Technology (14JCYBJC23200); and the Natural Science Foundation of China (Grant No. 21177065). We also thank Dr Xueyuan Gu of Nanjing University for her help in analyzing the potentiometric titration data. The authors declare that there are no conflicts of interest, and any studies involving fish and embryos were conducted in accordance with national and institutional guidelines for the protection of animal welfare. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.envpol.2017.02.055. References An, Z., Qi, Y., Huang, D., Gu, X., Tian, Y., Li, P., Li, H., Zhang, Y., 2014. EGCG inhibits Cd(2þ)-induced apoptosis through scavenging ROS rather than chelating Cd(2þ) in HL-7702 cells. Toxicol. Mech. Methods 24, 259e267. Asimakopoulos, A.G., Wang, L., Thomaidis, N.S., Kannan, K., 2013. Benzotriazoles and benzothiazoles in human urine from several countries: a perspective on occurrence, biotransformation, and human exposure. Enivron. Int. 59, 274e281. n, G., Ostman, C., 2015. Benzothiazole, benzotriazole, Avagyan, R., Luongo, G., Thorse and their derivates in clothing textiles-a potential source of environmental pollutants and human exposure. Environ. Sci. Pollut. Res. 22, 5842e5849. Cancilla, D.A., Martinez, J., van Aggelen, G.C., 1998. Detection of aircraft deicing/ antiicing fluid additives in a perched water monitoring well at an international airport. Environ. Sci. Technol. 32, 3834e3835. Corsi, S.R., Zitomer, D.H., Field, J.A., Cancilla, D.A., 2003. Nonylphenol ethoxylates and other additives in aircraft deicers, antiicers, and waters receiving airport runoff. Environ. Sci. Technol. 37, 4031e4037. Figueira, E., Freitas, R., Guasch, H., Almeida, S.F., 2014. Efficiency of cadmium chelation by phytochelatins in Nitzschia palea (Kützing) W. Smith. Ecotoxicology 23, 285e292. Fleeger, J.W., Gust, K.A., Marlborough, S.J., Tita, G., 2007. Mixtures of metals and polynuclear aromatic hydrocarbons elicit complex, nonadditive toxicological interactions in meiobenthic copepods. Environ. Toxicol. Chem. 26, 1677e1685. Gauthier, P.T., Norwood, W.P., Prepas, E.E., Pyle, G.G., 2015. Metal-polycyclic aromatic hydrocarbon mixture toxicity in hyalella azteca. 2. metal accumulation and oxidative stress as interactive co-toxic mechanisms. Environ. Sci. Technol. 49, 11780e11788. Giger, W., Schaffner, C., Kohler, H.P.E., 2006. Benzotriazole and tolyltriazole as aquatic contaminants. 1. input and occurrence in rivers and lakes. Environ. Sci. Technol. 40, 7186e7192. Gil, H.W., Kang, E.J., Lee, K.H., Yang, J.O., Lee, E.Y., Hong, S.Y., 2011. Effect of glutathione on the cadmium chelation of EDTA in a patient with cadmium intoxication. Hum. Exp. Toxicol. 30, 79e83. Gust, K.A., Fleeger, J.W., 2006. Exposure to cadmium-phenanthrene mixtures elicits complex toxic responses in the freshwater tubificid oligochaete, Ilyodrilus templetoni. Arch. Environ. Contam. Toxicol. 51, 54e60. Gustafsson, J.P., 2011. Visual MINTEQ Ver. 3.0. Department of Land and Water
Resources Engineering. KTH Royal Institute of Technology, Sweden. Hart, D.S., Davis, L.C., Erickson, L.E., Callender, T.M., 2004. Sorption and partitioning parameters of benzotriazole compounds. Microchem. J. 77, 9e17. Health Council of the Netherlands, 2000. Dutch Expert Committee on Occupational Standard 430 (DECOS). 1,2,3-Benzotriazole. Heatlth Council of the Netherlands, The Hague publication no. 2000/14OSH. Herbelin, A.L., Westall, J.C., 1994. FITEQL Version 3.1. Department of Chemistry. Oregon State University, Oregon. Huang, R., Wen, B., Pei, Z., Shan, X., Zhang, S., Williams, P.N., 2009. Accumulation, subcellular distribution and toxicity of copper in earthworm (eisenia fetida) in the presence of ciprofloxacin. Environ. Sci. Technol. 43, 3688e3693. Ivanova, J., Gluhcheva, Y., Arpadjan, S., Mitewa, M., 2014. Effects of cadmium and monensin on renal and cardiac functions of mice subjected to subacute cadmium intoxication. Interdiscip. Toxicol. 7, 111e115. Kadar, E., Dashfield, S., Hutchinson, T.H., 2010. Developmental toxicity of benzotriazole in the protochordate Ciona intestinalis (Chordata, Ascidiae). Anal. Bioanal. Chem. 396, 641e647. Kamunde, C., MacPhail, R., 2011. Effect of humic acid during concurrent chronic waterborne exposure of rainbow trout (Oncorhynchus mykiss) to copper, cadmium and zinc. Ecotoxicol. Environ. Saf. 74, 259e269. Korzh, S., Pan, X.F., Garcia-Lecea, M., Winata, C.L., Pan, X., Wohland, T., Korzh, V., Gong, Z., 2008. Requirement of vasculogenesis and blood circulation in late stages of liver growth in zebrafish. BMC Dev. Biol. 8, 84. Landrier, J.F., Thomas, C., Grober, J., Duez, H., Percevault, F., Souidi, M., Linard, C., Staels, B., Besnard, P., 2004. Statin induction of liver fatty acid-binding protein (L-FABP) gene expression is peroxisome proliferator-activated receptor-alphadependent. J. Biol. Chem. 279, 45512e45518. Li, R., Zhou, Y., Wang, L., Ren, G., Zou, E., 2014. Effects of cadmium alone and in combination with low molecular weight chitosan on metallothionein, glutathione-S-transferase, acid phosphatase, and ATPase of freshwater crab Sinopotamon yangtsekiense. Environ. Toxicol. 29, 298e309. Liang, X., Wang, M., Chen, X., Zha, J., Chen, H., Zhu, L., Wang, Z., 2014. Endocrine disrupting effects of benzotriazole in rare minnow (Gobiocypris rarus) in a sexdependent manner. Chemosphere 112, 154e162. Liu, J., Qu, R., Yan, L., Wang, L., Wang, Z., 2016. Evaluation of single and joint toxicity of perfluorooctane sulfonateand zinc to Limnodrilus hoffmeisteri: acute toxicity, bioaccumulation and oxidative stress. J. Hazard. Mater 301, 342e349. Loureiro, C., Castro, B.B., Pereira, J.L., Gonçalves, F., 2011. Performance of standard media in toxicological assessments with Daphnia magna: chelators and ionic composition versus metal toxicity. Ecotoxicology 20, 139e148. Nguyen, A.T., Emelyanov, A., Koh, C.H., Spitsbergen, J.M., Parinov, S., Gong, Z., 2012. An inducible kras(V12) transgenic zebrafish model for liver tumorigenesis and chemical drug screening. Dis. Model. Mech. 5, 63e72. Seeland, A., Oetken, M., Kiss, A., Fries, E., Oehlmann, J., 2012. Acute and chronic toxicity of benzotriazoles to aquatic organisms. Environ. Sci. Pollut. Res. 19, 1781e1790. Tamasi, G., Casolaro, M., Magnani, A., Sega, A., Chiasserini, L., Messori, L., Gabbiani, C., Valiahdi, S.M., Jakupec, M.A., Keppler, B.K., Hursthouse, M.B., Cini, R., 2010. New platinum-oxicam complexes as anti-cancer drugs. Synthesis, characterization, release studies form smart hydrogels, evaluation of reactivity with selected proteins and cytotoxic activity in vitro. J. Inorg. Biochem. 104, 799e814. Wang, L., Asimakopoulos, A.G., Kannan, K., 2015. Accumulation of 19 environmental phenolic and xenobiotic heterocyclic aromatic compounds in human adipose tissue. Environ. Int. 78, 45e50. Wang, L., Zhang, J., Sun, H., Zhou, Q., 2016. Widespread occurrence of benzotriazoles and benzothiazoles in tap water: influencing factors and contribution to human exposure. Environ. Sci. Technol. 50, 2709e2717. Zhang, X., Li, C., Gong, Z., 2014. Development of a convenient in vivo hepatotoxin assay using a transgenic zebrafish line with liver-specific DsRed expression. PLoS One 9, e91874.
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055
Contents lists available at ScienceDirect
Environmental Pollution journal homepage: www.elsevier.com/locate/envpol
Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio* Zhenghua Duan a, Yanshuai Xing b, Zhitong Feng a, Huiyuan Zhang a, Caixia Li c, Zhiyuan Gong c, Lei Wang b, *, Hongwen Sun b a
School of Environmental Science and Safety Engineering, Tianjin University of Technology, Tianjin 300384, China Ministry of Education Key Laboratory of Pollution Processes and Environmental Criteria, Tianjin Key Laboratory of Environmental Remediation and Pollution Control, Nankai University, Tianjin 300071, China c Department of Biological Sciences, National University of Singapore, Singapore 117543, Singapore b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 10 November 2016 Received in revised form 11 February 2017 Accepted 24 February 2017 Available online xxx
As an emerging contaminant, 1-H-benzotriazole (1H-BTR) has been detected in the engineered and natural aquatic environments, which usually coexists with heavy metals and causes combined pollution. In the present study, wild-type and transgenic zebrafish Danio rerio were used to explore the acute toxicity as well as the single and joint hepatotoxicity of cadmium (Cd) and 1H-BTR. Although the acute toxicity of 1H-BTR to zebrafish was low, increased expression of liver-specific fatty acid binding protein was observed in transgenic zebrafish when the embryos were exposed to 5.0 mM of 1H-BTR for 30 days. Besides, co-exposure to 1H-BTR not only reduced the acute toxic effects induced by Cd, but also alleviated the Cd-induced liver atrophy in transgenic fish. Correspondingly, effects of combined exposure to 1H-BTR on the Cd-induced expressions of several signal pathway-related genes and superoxide dismutase and glutathione-s-transferase proteins were studied. Based on the determination of Cd bioaccumulation in fish and the complexing stability constant (b) of Cd-BTR complex in solution, the detoxification mechanism of co-existing 1H-BTR on Cd to the zebrafish was discussed. © 2017 Elsevier Ltd. All rights reserved.
Keywords: Benzotriazole Cadmium Zebrafish Hepatotoxicity Complexation
1. Introduction 1-H-benzotriazole (1H-BTR) is widely used as corrosion inhibitor in engine antifreeze and printing inks (Avagyan et al., 2015; Liang et al., 2014). Reportedly, at least 9000 tons of BTR compounds were produced in the USA in 1999 (Hart et al., 2004). Given the high solubility of 1H-BTR in water (Table S1 in the Supplementary data), they can directly enter various aquatic ecosystems through municipal wastewater effluents and surface runoffs. Widespread occurrence of 1H-BTR in freshwater and marine environments has been reported (Seeland et al., 2012; Wang et al., 2016), occasionally at high levels of mg/L or even mg/L (Cancilla et al., 1998; Giger et al., 2006). The reported sub-lethal impacts and sub-inhibitory effects of 1H-BTR to aquatic organisms and animals are commonly low. As
*
This paper has been recommended for acceptance by Dr. Chen Da. * Corresponding author. Nankai University, 94 Weijin Road, Tianjin 300071, China. E-mail address: [email protected] (L. Wang).
found in the acute tests with Daphnia magna (Seeland et al., 2012), the 48 h EC10 and EC50 values of 1H-BTR were 3.94 and 107 mg/L, while in the 21-day reproduction tests 1H-BTR showed no adverse effect. Kadar et al. (2010) reported that the lowest observed effective concentration of 1H-BTR for the 48 h hatch rate in Ciona intestinalis was 32 mg/L (Kadar et al., 2010). However, more knowledge about 1H-BTR's physiological toxicity, such as hepatotoxicity to the aquatic organisms, is still needed (Liang et al., 2014). Combined pollutants usually coexist in the engineered and natural aquatic environments, which might result in complicated toxic effect. For example, cadmium (Cd)-phenanthrene mixtures produced a less-than additive mortality in the oligochaete, Ilyodrilus templetoni in sediments (Gust and Fleeger, 2006), while a more-than-additive lethality induced by Cd-phenanthrene coexposure was found in the waterborne copepod, Amphiascoides atopus (Fleeger et al., 2007). 1H-BTR is applied to retard the corrosion of metal surfaces by forming metal-BTR complexes (Health Council of the Netherlands, 2000). Although both of 1HBTR and heavy metals are frequently detected in the aquatic environments, little is known about their combined toxic effects on the
http://dx.doi.org/10.1016/j.envpol.2017.02.055 0269-7491/© 2017 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055
2
Z. Duan et al. / Environmental Pollution xxx (2017) 1e8
aquatic organisms. In this study, wild-type and transgenic zebrafish (Danio rerio) were chosen as the test organisms, and the acute and developmental toxicity of 1H-BTR and cadmium (Cd) in their single and combined exposure treatments were assessed. The expressions of the genes related several typical pathways and the oxidative stressrelated enzymes in liver of zebrafish in different exposure treatments were contrasted. Based on the measured distribution of Cd species in 1H-BTR solution, joint toxicity of co-existing Cd and 1HBTR was further explained.
2. Materials and methods 2.1. Chemicals 1H-BTR and cadmium chloride (CdCl2) were purchased from Sigma-Aldrich (>99.9% purity) and dissolved in egg water (60 mg/L sea salt dissolved in reconstituted water). The reconstituted purified water was prepared according to the ISO standard (7346-3: 1996), with pH of 8.0 and the hardness of approximately 150 mg/L of calcium carbonate (CaCO3).
2.2. Zebrafish Two kinds of zebrafish (Danio rerio) were applied in toxic test of this study. Wild-type zebrafish were purchased from local ornamental fish suppliers. The LiPan transgenic zebrafish line Tg (lfabp10a: dsRed; elaA: EGFP) used in this study was established previously in the laboratory in Singapore (Korzh et al., 2008), in which the size changes of the liver under pollutants exposure can be observed directly. All the adult zebrafish were maintained indoors at an ambient temperature of approximately 26 ± 1 C with a natural dark/light cycle of 10/14 h in the zebrafish aquarium facility at the Department of Biological Sciences, National University of Singapore. During the spawning period, the fish were fed brine shrimp (World Aquafeeds, USA) once each day. Embryos were collected by siphoning with a plastic pipe the next morning. Studies involving zebrafish and embryo were conducted in accordance with national and institutional guidelines for the protection of human subjects and animal welfare.
2.3. Developmental toxicity of Cd and 1H-BTR on zebrafish embryos According to the method of OECD TG 236 (OECD Guidelines for the Testing of Chemicals, Test No.236: Fish Embryo Acute Toxicity Test), the developing embryos (wide-type) were exposed to a nominal concentration of 5.0 mM of 1H-BTR and 1.0 mM of Cd singly or jointly in 24-well multi-plates. In detail, 2 mL of solvent control or treatment solution was added to each plate of the 24 wells, which were then placed in an incubator at 26 ± 1 C. Each well contained one embryo. The medium (with or without chemicals) was replenished every two days during the total four days exposure. Four independent plate replications were performed. The developmental status of the zebrafish embryos was observed with an inverted microscope (8e50X) (IMT 2, Olympus Corp., Tokyo, Japan). Consequently, 24 h post-fertilization (hpf) blood circulation according to the pre-experiment results and 56 hpf survival and hatching rates were recorded as indicators for chemical toxicity. The exposure concentrations in the experiments, i.e. 5.0 mM for 1HBTR and 1.0 mM for Cd, were designed based on the actual concentrations in the water environments and the toxicity data obtained through the pre-experiments.
2.4. Developmental toxicity of Cd and 1H-BTR on transgenic zebrafish liver The adult LiPan fish were used to cross with wild-type fish in order to obtain 100% semizygous transgenic embryos. Embryos were collected and incubated in six-well plates for 3e6 days in egg water. The developing embryos were exposed to a nominal concentration of 1.0 mM Cd singly or jointly with 1H-BTR at gradient concentrations, i.e. 0.2, 1.0 and 5.0 mM. Thus there were totally five batches in this experiment, including the four treatment batches and a control. In each batch, fifty embryos were placed in a well with 10 mL of solution contained. The solution was refreshed every two days, and four independent replications were performed. After 30-day exposure, ten larvae were randomly selected from each batch and anaesthetized with 0.1% 2-phenoxyethanol for the purpose of photographing. Green/red fluorescent protein (GFP/RFP) fluorescence in the fry was observed under a fluorescent microscope (Axiovert 200M, Zeiss, German) with GFP/RFP filters and photographed with a digital camera (AxiocCam HRC, Zeiss, German) under the same lateral view of the liver region of each fry. The average RFP intensity in the liver under the same magnification and fixed exposure time was then quantified by Image J software (Wayne Rasband, National Institutes of Health, USA). 2.5. Expressions of typical genes and enzymes in zebrafish liver induced by Cd and 1H-BTR To further discuss the toxicity mechanism of Cd and 1H-BTR to the fish liver, a 30-day sub-chronic toxicity test was performed on zebrafish in control together with that in five treatments, including 1H-BTR singly at 5.0 mM; Cd singly at 1.0 mM; combined exposure of 1H-BTR (5.0 mM) and Cd (1.0 mM) concurrently (namely “Meantime” group); 1H-BTR (5.0 mM) exposed singly for 24 h with subsequent addition of Cd (1.0 mM) into the solution for 30-day exposure (namely “BTR/Cd” group); and Cd (1.0 mM) exposed singly for 30 days with subsequent addition of 1H-BTR (5.0 mM) into the solution for another 24 h (namely “Cd/BTR” group). To avoid potential gender difference, only female fish were selected in this experiment. For each group, 26 wild-type adult female zebrafish was added to 50 L treatment solution in a glass aquarium (50 cm 40 cm 30 cm). Two-thirds fresh solution was replenished every day. After 30-day exposure, 20 fish were dissected and the liver tissue obtained from every four fish was collected together as one sample, resulting in five replications for each group. The fresh liver samples were frozen immediately and stored at 80 C for subsequent mRNA and protein expression analysis. The remaining 6 fish were frozen at 20 C for the further analysis of Cd. The expression of eight genes involved in four typical signal pathways, metallothionein (zmt, dmt), inflammation (tnf, serp), carcinogenesis (p53, mdm2) and apoptosis signaling (b1p1, tnfr), was studied in wild-type adult zebrafish liver. Total RNA was extracted through TRIzol-based RNA extraction methods and reverse-transcribed to cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche, USA). Quantitative PCR was performed with the LightCycler 480 SYBR Green I Master-Kit (Roche, USA) in observance of the accompanying guidelines. The relative expression ratio (fold change) was calculated based on DDCt (DDCt ¼ ðCt;target Ct;bactin Þtreatment ðCt;target Ct;bactin Þcontrol ) and the fold change of 2DDCt . The primers of targeted genes and references genes are shown in Table 1. Two enzymes activity indices related to oxidative stress in fish liver, i.e. superoxide dismutase (SOD) and glutathione-s-transferase (GST), were also detected. Tissue Protein Extraction Reagent (TPER) was purchased from Pierce Biotechnology (Rockford, IL, USA).
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055
Z. Duan et al. / Environmental Pollution xxx (2017) 1e8
3
statistically different, and p < 0.01 statistically significantly different.
Table 1 The primers of targeted genes and references genes. Genes
Pathways
Primer seq
Size (bp)
zf -action
Reference gene
200
3. Results
zmt
Metallothionein
130
3.1. Toxicity of Cd and 1H-BTR on the wild-type zebrafish embryo
dmt
Metallothionein
serp
Inflammation
tnf
Inflammation
p53
Carcinogenesis
mdm2
Carcinogenesis
b1p1
Apoptosis signaling
tnfr
Apoptosis signaling
F:CCGTGACATCAAGGATAAGCT R:TCGTGGATACCGCAAGATTCC F: GCCAAGACTGGAACTTGCAAC R: CGCAGCCAGAGGCACACT F: ACTCCGCACTCGTCAAGTCT R: CGTAGAAGGCCTCAGCAAAC F:AGGAGGAACACGAACACTCG R: TGAAGACTGAGACTGGGAGACG F:TGATGATGACCGTATATCTCGC R: TCATGTCTCTTAAAGCCGACC F:ATTTAGGCTCAGGTTCCCG R: GCCAAGTTATCTCCATCCG F:AGTGAAGAGAGCGAAGACTCAG R: AAGAGGAGGGTTGAACTGGTC F: AGAGCGTGATGGATGAGGTG R: TCTTGCGATTTCCTGCTTTCC F:ACCATCAGCCTCAAATAGCAC R:TCCTCCTCTTTCTCCAGTCCTG
162 261 289 243 199 202 215
SOD assay kit (CS 19160) and GST assay kit (CS 0410) were purchased from Sigma-Aldrich (USA). The total protein of the fish liver was extracted using 60 mL of T-PER and 0.6 mL of 1:100 Complete Protease Inhibitor Cocktail (Roche, USA). The protein concentration was tested at the 595 nm wavelength, while 1 mg/mL BSA (Bovine Serum Albumin) was considered to be the standard. 2.6. Cadmium analysis The frozen fish were lyophilized and ground into powder in agate mortars. After that, 0.2 g of the samples from each fish were accurately weighed, and then digested with 5 mL of nitric acid (w%, 65%), 3 mL of hydrofluoric acid (w%, 40%) and 1 mL oxydol (w%, 30%) in a microwave digestion vessel for 10 min at 130 C, followed by 5 min at 150 C, and then 20 min at 190 C. The digests were then transferred to a centrifuge tube and diluted to 50 mL with ultrapure water (MilliQ water, Millipore, 18 MU). Cd concentrations in the diluted digests were determined by an ICP-MS (Elan drc-e, Perkin-Elmer Co.) and the dry weight concentrations of Cd in fish were calculated. The Cd speciation was analyzed based on the complexing stability constant (b) of Cd-BTR complex. The value of b was measured by using potentiometric titration method, with the detailed information provided in Table S2. In brief, the titration data obtained from an automatic potentiometric titrator (Fig. S1&S2 in the Supplementary data) was used to calculate the optimal b by a chemical equilibrium calculation program, FITEQL (version 3.1) (Herbelin and Westall, 1994). All of the possible complex formations were input into the program to obtain the most reasonable complex formation. Based on the laboratory results, the speciation of Cd in the presence or in the absence of 1H-BTR at different pH values was calculated using a chemical equilibrium model, visual MINTEQ (version 3.0) (Gustafsson, 2011). The optimal value of b was added to the database of visual MINTEQ to calculate the Cd speciation.
According to the pre-experiment, 24 hpf blood-circulation inhibition, 56 hpf hatch rate inhibition, and 56 hpf survival rate of the wild-type zebrafish embryo were selected as the observed endpoints in this experiment. At each of the three endpoints, significant toxic effects of Cd (1.0 mM, single exposure) were found (p < 0.05) (Fig. 1). However, no significant effect at any endpoint was found when the embryos were exposed to 5.0 mM of 1H-BTR. Notably, when 1H-BTR (5.0 mM) presented concurrently with Cd (1.0 mM), the ratios of 24 hpf no blood-circulation inhibition (p < 0.01) in the zebrafish embryos decreased from 20.8% (singly exposed to Cd) to 6.9% (jointly exposed to Cd and BTR), while that of 56 hpf no hatch (p < 0.05) decreased from 100% to 83.3%. More significant detoxification effect of 1H-BTR to Cd was observed on the 56 h death rate of the zebrafish embryo. While a 56 h death rate of 27.8% (p ¼ 0.01) induced by the single exposure of Cd (1 mM) was observed, it decreased to 11.1% when the embryo was exposed to the mixture solution of Cd (1 mM) and 1H-BTR (5 mM). 3.2. Single and joint toxicity of Cd and 1H-BTR on the transgenic zebrafish liver Both of the two exogenous compounds of this study, 1H-BTR and Cd, showed toxic effect to liver of the transgenic zebrafish larvae, but with opposite symptoms (Fig. 2). Exposure to 1H-BTR resulted in the increased expression of liver-specific fatty acid binding protein 10a (lfabp10a, marked by red fluorescence in Fig. 2) and the increased fish liver size, suggesting an increased risk of fatty liver. Cd treatment led to the decreased expressions of lfabp10a, and thereby the fish liver size decreased. As shown in Figs. 2 and 3, single exposure of 1H-BTR and Cd led to adverse impacts on the liver size of the fish. The average liver size increased (p < 0.05) when LiPan fish larvae were exposed to 1H-BTR (5.0 mM). On the contrary, the liver size decreased (p < 0.05) when the larvae were exposed to Cd (1.0 mM). In addition, the fish liver sizes decreased in all the co-exposure treatments which verified that the expression of lfabp10a in fish liver was down-regulated (Fig. 3). However, with the increasing concentration of 1H-BTR in the mixture solution, the degree of liver atrophy was reduced. The
2.7. Statistical analysis Data from microscopic examinations of the embryos/fish and gene/enzyme expressions were categorized according to types and severities of effects, and the final results were shown as the mean ± S.D. Normality and homogeneity of variance for all data were checked using SPSS 19.0 (SPSS, Inc., Chicago, IL, USA), and comparison analyses between control and treated groups were carried out by the student t-test. A p value of <0.05 was considered
Fig. 1. The single and joint toxicities of 1H-BTR and Cd in the development of wildtype zebrafish embryos.
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055
4
Z. Duan et al. / Environmental Pollution xxx (2017) 1e8
Fig. 2. The general view of the hepatotoxicities of 1H-BTR and Cd using LiPan transgenic zebrafish line Tg (lfabp10a: dsRed; elaA:EGFP) under a fluorescent microscope. Ctr: in fish of the control group; 5 mM 1H-BTR: in fish of the 5.0 mM 1H-BTR treatment; 1 mM Cd: in fish of the 1.0 mM Cd treatment; and Combined: in fish of the combined exposure treatment of 5.0 mM 1H-BTR and 1.0 mM Cd.
Fig. 3. The statistical data about the influence of 1H-BTR on the hepatotoxicity of 1.0 mM Cd using LiPan transgenic zebrafish line Tg (lfabp10a: dsRed; elaA:EGFP). Different letters (a or b) indicate significant difference (p < 0.05) compared with control or single exposure to 1.0 mM Cd, respectively.
RTF fluorescence intensity of lfabp10a in fish liver exposed at 0, 0.2, 1.0 and 5.0 mM of 1H-BTR combined with 1.0 mM of Cd were 4.09, 4.35, 4.37 and 4.83 (103), respectively, indicates that the expression of lfabp10a was weakened in a dosage-dependent manner with increasing exposure to 1H-BTR (R2 ¼ 0.884).
expression of tnfr (Fig. 4). For example, the expression of zmt and dmt mRNA in the fish liver exposed to 1.0 mM Cd was much higher than those exposed to 5.0 mM 1H-BTR (zmt, p ¼ 0.011; dmt, p ¼ 0.009). The exposure sequence of fish to Cd and 1H-BTR also affects the gene expression level. As shown in Fig. 4, when the fish were exposed to 5.0 mM 1H-BTR and 1.0 mM Cd concurrently, the respective expressions of zmt and dmt mRNA were not decreased as compared to separate, single exposures. Moreover, compared to the expression of dmt mRNA in the group exposed to Cd singly, jointly exposure of Cd and 1H-BTR in different sequences induced an increasing expression of dmt (Fig. 4). The expressions of tnf and serp in fish liver could also be greatly induced by single exposures of 5.0 mM 1H-BTR and 1.0 mM Cd (p < 0.05). When the fish were exposed to the two chemicals with three different combination conditions, the induction degrees of tnf and serp were significantly decreased in comparison to those in Cd single exposure. In particular, when the fish were first treated with Cd for 30 days and then 1H-BTR was added, the up-regulation of tnf and serp mRNA expression was dramatically decreased (p < 0.01). This phenomenon was also observed in the expressions of p53, mdm2, b1p1 and tnfr. 3.4. Expression of the oxidative stress-related enzyme in the zebrafish liver
3.3. Expression level of typical genes in the adult zebrafish liver The expression of eight genes involved in four typical signal pathways, i.e. zmt and dmt (metallothionein related), tnf and serp (inflammation related), p53 and mdm2 (carcinogenesis related), as well as b1p1 and tnfr (apoptosis signaling related), in wild-type adult zebrafish liver was measured. All eight genes were induced when the fish were exposed to 5.0 mM of 1H-BTR or 1.0 mM of Cd (p < 0.05), while the induction level of the eight genes induced by Cd was significantly higher than induced by 1H-BTR, except for the
As shown in Fig. 5, there was no significant change in SOD expression in the fish liver when fish was exposed to 5.0 mM of 1HBTR singly (p ¼ 0.118). However, Cd at 1.0 mM could induce the expression of SOD protein (p < 0.01). SOD expression was also affected by the exposure sequence of Cd and 1H-BTR. In the fish of “Cd/BTR” group, which were firstly exposed to Cd (1.0 mM) for 30 days before the adding of 1H-BTR into the solution, no significant difference existed in comparison to that in fish exposed to Cd alone (p ¼ 0.106) (Fig. 5). However, in the
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055
Z. Duan et al. / Environmental Pollution xxx (2017) 1e8
5
Fig. 4. The single and joint toxicities of 1H-BTR (5.0 mM) and Cd (1.0 mM) in the expressions of several typical signal pathway-related genes. Meantime: combined exposure of 1H-BTR (5.0 mM) and Cd (1.0 mM) concurrently; and BTR/Cd: 1H-BTR (5.0 mM) exposed singly for 24 h with subsequent addition of Cd (1.0 mM) into the solution for 30-day exposure; Cd/BTR: Cd (1.0 mM) exposed singly for 30-day with subsequent addition of 1H-BTR (5.0 mM) into the solution for another 24 h exposure. Different letters (a or b) indicate significant difference (p < 0.05) compared with control or single exposure to 1.0 mM Cd, respectively.
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055
6
Z. Duan et al. / Environmental Pollution xxx (2017) 1e8
Fig. 5. The expressions of SOD proteins in adult zebrafish liver and the Cd bioaccumulation concentrations in different treatments. Meantime: combined exposure of 1H-BTR (5.0 mM) and Cd (1.0 mM) concurrently; and BTR/Cd: 1H-BTR (5.0 mM) exposed singly for 24 h with subsequent addition of Cd (1.0 mM) into the solution for 30-day exposure; Cd/BTR: Cd (1.0 mM) exposed singly for 30-day with subsequent addition of 1H-BTR (5.0 mM) into the solution for another 24 h exposure. Different letters (a or b) indicate significant difference (p < 0.05) compared with control or single exposure to 1.0 mM Cd, respectively.
group of “Meantime”, i.e. fish exposed to the mixture solution of Cd (1.0 mM) and 1H-BTR (5.0 mM), the up-regulation of SOD expression was dramatically decreased (p < 0.01). When the fish were treated with 5.0 mM of 1H-BTR solution for 24 h prior to 30-day Cd exposure (i.e. the group of “BTR/Cd”), there was a further decrease in the up-regulation of SOD expression in the fish liver, compared to that in fish singly exposed to Cd solution. GST expression in the fish liver could be induced by both of 1HBTR and Cd (p < 0.01) (Fig. S3). At this endpoint, more toxic effect was observed in group of “1.0 mM Cd”. The joint toxicity level indicated by GST expression in fish of the three combined exposure groups, i.e. “Cd/BTR”, “Meantime”, and “BTR/Cd”, decreased compared to that observed in the group of “1.0 mM Cd”, particularly in the group of “BTR/Cd”. 3.5. Cd bioaccumulation in adult zebrafish In adult zebrafish exposed to Cd at 1.0 mM for 30 days, a bioaccumulation concentration of 17.42 mg/kg were detected (Fig. 5). In the fish of “Meantime” group which were exposed to the mixture solution of Cd (1.0 mM) and 1H-BTR (5.0 mM), a higher Cd bioaccumulation of 20.38 mg/kg. On the contrary, when the fish was firstly exposed to Cd (1.0 mM) for 30 days and then exposed to 1HBTR (5.0 mM) for another 24 h, a much lower Cd bioaccumulation of 9.47 mg/kg were detected in this “Cd/BTR” group. Interestingly, significantly higher bioaccumulation of Cd was observed in the fish of “BTR/Cd” group. When the zebrafish was firstly exposed to 1HBTR (5.0 mM) for 24 h, Cd concentration of 99.87 mg/kg in fish was observed after a 30-day Cd exposure (1.0 mM). 3.6. Cd species distribution in solution Cd-BTR complex might present in the solutions containing both of Cd and 1H-BTR. The fitting results indicate that CdðBTR Þ2 is the major form of the complex (eq (1)), while the logb of the complex was calculated to be 7.10 (more details are shown in Table S2).
Cd þ 2BTR ¼ Cd BTR þ 2Hþ 2
(1)
Based on the value of b, speciation of Cd can be calculated by using Visual MINTEQ (Gustafsson, 2011). Distribution of Cd species in the presence or absence of 1H-BTR at different pH values is illustrated in Fig. 6. In solutions at pH 8.0 used in the present study, Cd2þ is the major existing (Fig. 6(A)). With the adding of 1H-BTR in solution, distribution of Cd2þ decreased significantly, while percentage of CdðBTR Þ2 increased accordingly (Fig. S4 (A&B)). In
Fig. 6. The distribution of Cd species at different pH levels in solutions of Cd alone (A) and Cd:1H-BTR ¼ 1:5 (B).
solution with co-existing Cd and 1H-BTR at mole ration of 1:5, almost all Cd2þ transformed to the complex specie, i.e. CdðBTR Þ2 (Fig. 6(B)).
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055
Z. Duan et al. / Environmental Pollution xxx (2017) 1e8
4. Discussion 4.1. Low-dose effects of 1H-BTR Due to the widespread application, BTR and derivatives were frequently detected in aquatic environments (Seeland et al., 2012), sometimes at very high concentrations. For example, concentration of methyl-BTR, up to over 2000 mg/L, was reported in the surface waters which related to airport runoffs (Corsi et al., 2003). In embryo of wild-type zebrafish, no developmental toxicity effect was observed with 4-day exposure of 1H-BTR at 5.0 mM (600 mg/L approximately). Liver plays an important role in substance transport and energy metabolism, and it has been considered as a target organ for many xenobiotics. As found in this study, exposure to 1HBTR at 5.0 mM can enlarge the liver size of transgenic zebrafish. The transgenic fish were more sensitive than the wild-type fish in response to the exogenous chemicals. Furthermore, with liverspecific red fluorescent protein (DsRed) expression under the fabp10a promoter, red fluorescence in the liver greatly facilitates the observation of more detailed changes in hepatotoxicity, including liver red fluorescence intensity and liver size, in live Lipan fish (Korzh et al., 2008). Sensitivity of the LiPan transgenic zebrafish line used in the present study had been verified in previous studies. Zhang et al. tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone) in LiPan transgenic zebrafish and demonstrated that those hepatotoxins could significantly reduce the expression of lfabp10a and marked liver size in a dosage-dependent manner (Zhang et al., 2014). Zebrafish lfabp10a is an important constituent in the liver-type fatty acid binding protein family (L-FABP). It was found that L-FABP was related to the absorption, translocation and metabolic regulation of fatty acid, and that it may participate in signal transduction, mitosis and antioxidant function (Nguyen et al., 2012). Landrier et al. (2004) also reported that the induction of L-FABP expression had a significant correlation to the occurrence of fatty liver. The expressions of eight typical genes involved in the signal pathways of metallothionein, inflammation, carcinogenesis and apoptosis signaling in liver of the wild-type adult zebrafish, were all induced by 1H-BTR at 5.0 mM. The expressions of the inflammationrelated genes, i.e. tnf and serp, could also be greatly induced by single exposures to 5.0 mM of 1H-BTR. This may corroborate the physiological size increase of the fish liver shown in Fig. 2. Besides, GST is one of the key enzymes that mediate phase II of cellular detoxification. In this study, GST expression in liver of adult widetype zebrafish was induced by 5.0 mM of 1H-BTR. Considering that relatively high concentrations of BTR have been detected in the environments in some cases, the health risks of BTR contamination to aquatic organisms should be of concern.
7
vital role in an organism's self-protection system for the oxidative damage. Detoxification effect can be also observed in SOD expression. Although Cd exposure resulted in a significant increase of SOD in fish liver, less changes of SOD in liver of fish of the combined exposure treatments were observed. Due to the lone-electron pairs on the nitrogen and sulfur atoms of BTR molecular, BTR might readily integrate with various heavy-metal ions in combined pollution environments. Toxicities of heavy metals could be dramatically reduced by organic complexion (Gauthier et al., 2015; Liu et al., 2016), as the concentrations of metal ions in their free form was reduced through this process. For example, the toxicities of metal supramolecular anticancer drugs could be reduced when the metal ions were chelated with thiazole groups (Tamasi et al., 2010). Many chelating agents have been demonstrated to be an effective antioxidant to Cd, such as humic acid (Kamunde and MacPhail, 2011), EDTA (Gil et al., 2011; Loureiro et al., 2011), monensin (Ivanova et al., 2014), phytochelatins (Figueira et al., 2014), chitosan (Li et al., 2014), and Epigallocatechin-3-gallat (An et al., 2014). According to the measured Cd-BTR complexing stability constant (b) of up to 107, almost all Cd exist as the Cd-BTR complex form in the combined exposure solution. Therefore, waterborne co-exposures to 1H-BTR and Cd might result in an overall less-than-additive toxicity, due to the complexation characters of 1H-BTR with the heavy metal ions, even if the Cd accumulation in fish slightly increased. Very similar results were observed in earthworms exposed to copper and ciprofloxacin (Huang et al., 2009). Although the co-existence of ciprofloxacin, a ligand for Cu2þ, increased the uptake of copper in earthworms, the mortality of earthworms induced by copper decreased significantly. Metal-sensitive fraction of heavy metals in the tissues of the earthworms was assumed to decrease with the co-exposure of exogenous organic ligand in that case (Huang et al., 2009). Interestingly, exposure sequence seems to play important role on the detoxification effects. Despite the significant decrease of SOD expression in fish exposed to 1H-BTR and Cd concurrently (compared to that in fish exposed to Cd singly), only slight change of SOD was measured in fish exposed firstly to Cd and then to 1HBTR, although the subsequent addition of 1H-BTR decreased the bioaccumulation of Cd. This indicates that liver damage induced by Cd exposure cannot be recovered by exposure of 1H-BTR. On the contrary, compared with the SOD expression in fish liver of the control group, there is no change in fish exposed firstly to 1H-BTR and then to Cd, even if the highest Cd bioaccumulation was observed in these fish. This might suggest an in vivo complexation of 1H-BTR and Cd in fish, which increase the Cd accumulation but decrease the metal-sensitive fraction of Cd. Considering the frequent detection of BTR compounds in human (Asimakopoulos et al., 2013; Wang et al., 2015), this mechanism might be also has implications for human.
4.2. The potential mechanism for the cadmium detoxification by 1H-BTR In this study, the toxicity of Cd ions (1.0 mM) was reduced by the coexisting 1H-BTR (5.0 mM) at the endpoints of 24 h blood circulation, 56 h hatch-out and the 56 h survival ratio (Fig. 1). Correspondingly, the expressions of inflammation-related genes (serp), carcinogenesis-related genes (p53, mdm2), and apoptosis signaling-related genes (b1p1, tnfr) induced by Cd in fish liver, could also be decreased by the co-exposure to 1H-BTR (Figs. 4 and 5). To the best of our knowledge, it is the first time to report that presence of BTR, a widespread organic emerging contaminant, could decrease the toxicity of heavy metal pollutants. SOD is widely present as a metal enzyme in organisms. An organism's superoxide radical (O2-) can be catalyzed and removed according to its disproportionation reaction. Therefore, it plays a
5. Conclusions Although the acute toxicity of 1H-BTR was verified to be low, its hepatotoxicity, including changes of liver size and abnormal expression of typical genes and enzymes in liver was observed in zebrafish exposed to 1H-BTR at environmental concentration level. In addition, detoxification of Cd in zebrafish by the co-existing 1HBTR was found, while this detoxification effect was not consistent with the changes of Cd bioaccumulation in fish. Based on the result of Cd species analysis, the protective mechanism of BTR to Cd exposure was explained by forming BTR-Cd complex, which might has toxicity lower than Cd ions.
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055
8
Z. Duan et al. / Environmental Pollution xxx (2017) 1e8
Acknowledgements This work was supported by the Tianjin Talent Development Scholarship Fund in China (Grant No. [2013]52); the Tianjin Research Program of Application Foundation and Advanced Technology (14JCYBJC23200); and the Natural Science Foundation of China (Grant No. 21177065). We also thank Dr Xueyuan Gu of Nanjing University for her help in analyzing the potentiometric titration data. The authors declare that there are no conflicts of interest, and any studies involving fish and embryos were conducted in accordance with national and institutional guidelines for the protection of animal welfare. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.envpol.2017.02.055. References An, Z., Qi, Y., Huang, D., Gu, X., Tian, Y., Li, P., Li, H., Zhang, Y., 2014. EGCG inhibits Cd(2þ)-induced apoptosis through scavenging ROS rather than chelating Cd(2þ) in HL-7702 cells. Toxicol. Mech. Methods 24, 259e267. Asimakopoulos, A.G., Wang, L., Thomaidis, N.S., Kannan, K., 2013. Benzotriazoles and benzothiazoles in human urine from several countries: a perspective on occurrence, biotransformation, and human exposure. Enivron. Int. 59, 274e281. n, G., Ostman, C., 2015. Benzothiazole, benzotriazole, Avagyan, R., Luongo, G., Thorse and their derivates in clothing textiles-a potential source of environmental pollutants and human exposure. Environ. Sci. Pollut. Res. 22, 5842e5849. Cancilla, D.A., Martinez, J., van Aggelen, G.C., 1998. Detection of aircraft deicing/ antiicing fluid additives in a perched water monitoring well at an international airport. Environ. Sci. Technol. 32, 3834e3835. Corsi, S.R., Zitomer, D.H., Field, J.A., Cancilla, D.A., 2003. Nonylphenol ethoxylates and other additives in aircraft deicers, antiicers, and waters receiving airport runoff. Environ. Sci. Technol. 37, 4031e4037. Figueira, E., Freitas, R., Guasch, H., Almeida, S.F., 2014. Efficiency of cadmium chelation by phytochelatins in Nitzschia palea (Kützing) W. Smith. Ecotoxicology 23, 285e292. Fleeger, J.W., Gust, K.A., Marlborough, S.J., Tita, G., 2007. Mixtures of metals and polynuclear aromatic hydrocarbons elicit complex, nonadditive toxicological interactions in meiobenthic copepods. Environ. Toxicol. Chem. 26, 1677e1685. Gauthier, P.T., Norwood, W.P., Prepas, E.E., Pyle, G.G., 2015. Metal-polycyclic aromatic hydrocarbon mixture toxicity in hyalella azteca. 2. metal accumulation and oxidative stress as interactive co-toxic mechanisms. Environ. Sci. Technol. 49, 11780e11788. Giger, W., Schaffner, C., Kohler, H.P.E., 2006. Benzotriazole and tolyltriazole as aquatic contaminants. 1. input and occurrence in rivers and lakes. Environ. Sci. Technol. 40, 7186e7192. Gil, H.W., Kang, E.J., Lee, K.H., Yang, J.O., Lee, E.Y., Hong, S.Y., 2011. Effect of glutathione on the cadmium chelation of EDTA in a patient with cadmium intoxication. Hum. Exp. Toxicol. 30, 79e83. Gust, K.A., Fleeger, J.W., 2006. Exposure to cadmium-phenanthrene mixtures elicits complex toxic responses in the freshwater tubificid oligochaete, Ilyodrilus templetoni. Arch. Environ. Contam. Toxicol. 51, 54e60. Gustafsson, J.P., 2011. Visual MINTEQ Ver. 3.0. Department of Land and Water
Resources Engineering. KTH Royal Institute of Technology, Sweden. Hart, D.S., Davis, L.C., Erickson, L.E., Callender, T.M., 2004. Sorption and partitioning parameters of benzotriazole compounds. Microchem. J. 77, 9e17. Health Council of the Netherlands, 2000. Dutch Expert Committee on Occupational Standard 430 (DECOS). 1,2,3-Benzotriazole. Heatlth Council of the Netherlands, The Hague publication no. 2000/14OSH. Herbelin, A.L., Westall, J.C., 1994. FITEQL Version 3.1. Department of Chemistry. Oregon State University, Oregon. Huang, R., Wen, B., Pei, Z., Shan, X., Zhang, S., Williams, P.N., 2009. Accumulation, subcellular distribution and toxicity of copper in earthworm (eisenia fetida) in the presence of ciprofloxacin. Environ. Sci. Technol. 43, 3688e3693. Ivanova, J., Gluhcheva, Y., Arpadjan, S., Mitewa, M., 2014. Effects of cadmium and monensin on renal and cardiac functions of mice subjected to subacute cadmium intoxication. Interdiscip. Toxicol. 7, 111e115. Kadar, E., Dashfield, S., Hutchinson, T.H., 2010. Developmental toxicity of benzotriazole in the protochordate Ciona intestinalis (Chordata, Ascidiae). Anal. Bioanal. Chem. 396, 641e647. Kamunde, C., MacPhail, R., 2011. Effect of humic acid during concurrent chronic waterborne exposure of rainbow trout (Oncorhynchus mykiss) to copper, cadmium and zinc. Ecotoxicol. Environ. Saf. 74, 259e269. Korzh, S., Pan, X.F., Garcia-Lecea, M., Winata, C.L., Pan, X., Wohland, T., Korzh, V., Gong, Z., 2008. Requirement of vasculogenesis and blood circulation in late stages of liver growth in zebrafish. BMC Dev. Biol. 8, 84. Landrier, J.F., Thomas, C., Grober, J., Duez, H., Percevault, F., Souidi, M., Linard, C., Staels, B., Besnard, P., 2004. Statin induction of liver fatty acid-binding protein (L-FABP) gene expression is peroxisome proliferator-activated receptor-alphadependent. J. Biol. Chem. 279, 45512e45518. Li, R., Zhou, Y., Wang, L., Ren, G., Zou, E., 2014. Effects of cadmium alone and in combination with low molecular weight chitosan on metallothionein, glutathione-S-transferase, acid phosphatase, and ATPase of freshwater crab Sinopotamon yangtsekiense. Environ. Toxicol. 29, 298e309. Liang, X., Wang, M., Chen, X., Zha, J., Chen, H., Zhu, L., Wang, Z., 2014. Endocrine disrupting effects of benzotriazole in rare minnow (Gobiocypris rarus) in a sexdependent manner. Chemosphere 112, 154e162. Liu, J., Qu, R., Yan, L., Wang, L., Wang, Z., 2016. Evaluation of single and joint toxicity of perfluorooctane sulfonateand zinc to Limnodrilus hoffmeisteri: acute toxicity, bioaccumulation and oxidative stress. J. Hazard. Mater 301, 342e349. Loureiro, C., Castro, B.B., Pereira, J.L., Gonçalves, F., 2011. Performance of standard media in toxicological assessments with Daphnia magna: chelators and ionic composition versus metal toxicity. Ecotoxicology 20, 139e148. Nguyen, A.T., Emelyanov, A., Koh, C.H., Spitsbergen, J.M., Parinov, S., Gong, Z., 2012. An inducible kras(V12) transgenic zebrafish model for liver tumorigenesis and chemical drug screening. Dis. Model. Mech. 5, 63e72. Seeland, A., Oetken, M., Kiss, A., Fries, E., Oehlmann, J., 2012. Acute and chronic toxicity of benzotriazoles to aquatic organisms. Environ. Sci. Pollut. Res. 19, 1781e1790. Tamasi, G., Casolaro, M., Magnani, A., Sega, A., Chiasserini, L., Messori, L., Gabbiani, C., Valiahdi, S.M., Jakupec, M.A., Keppler, B.K., Hursthouse, M.B., Cini, R., 2010. New platinum-oxicam complexes as anti-cancer drugs. Synthesis, characterization, release studies form smart hydrogels, evaluation of reactivity with selected proteins and cytotoxic activity in vitro. J. Inorg. Biochem. 104, 799e814. Wang, L., Asimakopoulos, A.G., Kannan, K., 2015. Accumulation of 19 environmental phenolic and xenobiotic heterocyclic aromatic compounds in human adipose tissue. Environ. Int. 78, 45e50. Wang, L., Zhang, J., Sun, H., Zhou, Q., 2016. Widespread occurrence of benzotriazoles and benzothiazoles in tap water: influencing factors and contribution to human exposure. Environ. Sci. Technol. 50, 2709e2717. Zhang, X., Li, C., Gong, Z., 2014. Development of a convenient in vivo hepatotoxin assay using a transgenic zebrafish line with liver-specific DsRed expression. PLoS One 9, e91874.
Please cite this article in press as: Duan, Z., et al., Hepatotoxicity of benzotriazole and its effect on the cadmium induced toxicity in zebrafish Danio rerio, Environmental Pollution (2017), http://dx.doi.org/10.1016/j.envpol.2017.02.055