- Email: [email protected]
Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day exposed Sprague-Dawley rats
Science of the Total Environment xxx (xxxx) xxx
Contents lists available at ScienceDirect
Science of the Total Environment journal homepage: www.elsevier.com/locate/scitotenv
Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day exposed SpragueDawley rats Yanmin Sun, Yuwei Wang, Baolu Liang, Tian Chen, Dan Zheng, Xuezhen Zhao, Li Jing ⁎, Xianqing Zhou, Zhiwei Sun, Zhixiong Shi ⁎ School of Public Health and Beijing Key Laboratory of Environmental Toxicology, Capital Medical University, Beijing 100069, China
H I G H L I G H T S
G R A P H I C A L
A B S T R A C T
• Hepatotoxicity induced by BDE-209 and DBDPE in rats was studied and compared. • Both BDE-209 and DBDPE can cause liver damage whereas DBDPE is less toxic. • BDE-209 and DBDPE may interfere metabolism in rats through oxidative stress and inflammation.
a r t i c l e
i n f o
Article history: Received 20 July 2019 Received in revised form 23 September 2019 Accepted 24 November 2019 Available online xxxx Editor: Henner Hollert Keywords: Brominated flame retardants Decabromodiphenyl ethane Decabromodiphenyl ether Hepatotoxicity Rat
a b s t r a c t Decabromodiphenyl ether (BDE-209) and its substitute decabromodiphenyl ethane (DBDPE) are heavily used in various industrial products as flame retardant. They have been found to be persistent in the environment and have adverse health effects in humans. Although some former studies have reported toxic effects of BDE-209, the study of DBDPE's toxic effects is still in its infancy, and the effects of DBDPE on hepatotoxicity are also unclear. This study aimed to evaluate and compare the hepatotoxicity induced by BDE-209 and DBDPE using a rat model. Sprague-Dawley rats were administered DBDPE or BDE-209 (5, 50, 500 mg/kg bodyweight) intragastrically once a day for 28 days. Twenty-four hours after the end of treatment, the rats were sacrificed, and body liver weight, blood biochemical parameters, liver pathology, oxidative stress, inflammation, pregnane X receptor (PXR), constitutive androstane receptor (CAR), and changes in cytochrome P450 (CYP3A) enzymes were measured. Our results showed that both BDE-209 and DBDPE could cause liver morphological changes, induce oxidative stress, increase γ-glutamyl transferase and glucose levels in serum, and down-regulate PXR, CAR, and CYP3A expression. In addition, BDE-209 was found to increase liver weight and the ratio of liver/body weight, lead to elevated total bilirubin and indirect bilirubin levels in serum, and induce inflammation. The present study indicated that BDE-209 and DBDPE may interfere with normal metabolism in rats through oxidative stress and inflammation, which inhibit PXR and CAR to induce the expression of CYP3A enzymes, and finally produce hepatotoxic effects
⁎ Corresponding authors. E-mail addresses: [email protected] (L. Jing), [email protected] (Z. Shi).
https://doi.org/10.1016/j.scitotenv.2019.135783 0048-9697/© 2018 Published by Elsevier B.V.
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
2
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx
and cause liver damage in rats. Comparatively, our results show that the damage caused by BDE-209 was more serious than that caused by DBDPE. © 2018 Published by Elsevier B.V.
1. Introduction Brominated flame retardants (BFRs) are widely used as additives in electrical and electronic products, plastics, building materials, and furniture, and they are essential in fire prevention due to their cheapness and excellent flame-retardant properties. Decabrominated diphenyl ether (deca-BDE, mainly composed of BDE-209) is one of the commercial products of polybrominated diphenyl ethers (PBDEs), which are the most frequently used commercial BFRs. BDE-209 accounts for N82% of total usage of PBDEs and has been widely used worldwide since the 1990s (Hardy, 2002; Fonnum and Mariussen, 2009). However, environmental pollution and population health risks brought about by the widespread of BDE-209 are also receiving attention (Lyche et al., 2015; Fromme et al., 2016). BDE-209 has been included on a list of persistent organic pollutants since 2017 and will be totally phased out in the European Union after 2019 (http://chm.pops.int/TheConvention/ ThePOPs). However, BDE-209 has not yet been phased out in China; that is, it is still in production and use. Decabromodiphenyl ethane (DBDPE), as a novel BFR, has been promoted as a substitute for BDE209. Because of its large molecular size, low aqueous solubility, and biological availability, DBDPE is believed to be rarely released into the environment and has low toxicity (Sun et al., 2018). Therefore, after its entry into the BFR market, its output and usage has increased rapidly, and it has become one of the most commonly used BFRs in China (Shi et al., 2018). However, in recent years, DBDPE has been detected in various substrates, including environmental substrates, biological matrices, and human matrices. Previous studies showed that levels of legacy BFRs such as PBDEs were on the decline, whereas contamination levels of DBDPE have risen rapidly, and it has become one of the predominant BFRs in various environmental matrices in China (Liang et al., 2016; Shi et al., 2016). Although the contamination levels of DBDPE are on the rise, data on the toxic effects of DBDPE are lacking. As a persistent organic pollutant, BDE-209 is environmentally persistent, bioaccumulative, and endocrine disruptive (Wang et al., 2010). Several studies found that BDE-209 could be converted into lowbrominated diphenyl ethers by living organisms and therefore, its potential toxicity is increased. Previous studies also showed that BDE209 has potential hepatotoxicity, neurotoxicity, and neonatal risks, and it could affect the thyroid endocrine system in mammals (Birnbaum and Staskal, 2004; Tseng et al., 2006; Tseng et al., 2008; Goodman, 2009). BDE-209 is an environmental pollutant with high lipophilicity and low water solubility and bioconcentration; thus, it must be metabolized by the liver after entering the body. Lee reported that BDE-209 could increase the liver weight of Sprague-Dawley (SD) rats, induce the expression of cytochrome P450 enzymes, and upregulate the constitutive androstane receptor (CAR) and pregnane xenobiotic receptor (PXR) expression levels in the liver (Lee et al., 2010). DBDPE is an alternative to BDE-209. However, it has also been found to be bioaccumulative and has the potential to reach the food chain (Nadjia et al., 2014). Thus, the large-scale application of DBDPE will result in an increase of human exposure and accumulation. It has been reported that 90 days of DBDPE exposure in rats could result in accumulation of DBDPE in the liver; moreover, after DBDPE exposure, the serum total bile acid level significantly increases, suggesting that the liver may be a main target organ after DBDPE exposure (Wang et al., 2010). In addition, some studies have shown that DBDPE could cause liver damage, increase liver weight, lead to obvious pathological changes of the liver in mouse, and cause oxidative stress in the liver of Carassius auratus (Feng et al., 2013; Sun et al., 2018). However, understanding of the hepatotoxicity of DBDPE is still very limited. In addition,
there are no studies systematically comparing the hepatotoxicity of DBDPE and BDE-209. In the present study, we build a rat model to investigate and compare the liver toxicity of DBDPE and BDE-209. 2. Materials and methods 2.1. Animals SD male rats (6 weeks old, weighing 180- to 220 g) were provided by Weitong-Lihua Experimental Animal Center (Beijing, China) and housed under a controlled environmental condition (22 °C, a 12:12 h light: dark cycle, free access to food and water). Before the experiments, all rats were examined daily during acclimation for any overt signs of physical or behavioral issues, and only healthy animals were selected. All procedures involving animals and their care were conducted under the approval of the Committee on the Ethics of Animal Experiments of Capital Medical University (AEEI-2018-015), and were carried out according to the institutional guidelines of the National Institutes of Health. 2.2. Chemicals and treatment Powdered BDE-209 and DBDPE were both with N98% purity and obtained from Acros Organics (NJ, USA). The rats were randomly divided into 7 groups after 1-week acclimation (n = 12 rats per treatment) such that the mean body weights of all groups were statistically comparable at the study initiation. Control animals received corn oil only. BDE209 and DBDPE was dissolved in corn oil as the exposure mixture. The doses for treatment groups were 5, 50, and 500 mg BDE-209 or DBDPE per kilogram of body weight per day (mg/kg bw/day). The BDE-209 and DBDPE treatment dosage were 5, 50, and 500 mg/kg bw/day, which depends on a revised BDE-209 oral reference dose (RfD) of 0.007 mg/kg day suggested by US Environmental Protection Agency Integrated Risk Information System in 2008 and several previous studies (Gill et al., 2004; Lee et al., 2010; Wang et al., 2019). Moreover, our previous study had reported that the estimated daily intake (EDI) levels of BDE-209 and DBDPE found for BDE-209 and DBDPE manufacturing workers were in ranges of 0.67–18.7 μg/kg bw/day and 0.804–27.5 μg/kg bw/day, respectively (Wang et al., 2019a, b). And we found that the max EDI of BDE-209 or DBDPE were higher than RfD. Therefore, in this study, we chose to use 5 mg/kg bw/day for the lowexposure dose on the basis of the product of RfD limitation, dose conversion coefficients (6.25) and 100-fold uncertainty factor and the lowexposure dose (5 mg/kg bw/day) was magnified 10 and 100 times as medium (50 mg/kg bw/day) and high (500 mg/kg bw/day) doses, respectively. The rats were treated orally by gavage administration daily for 28 consecutive days. During these days, they were weighed every 3 days and observed daily behaviors of the rats for signs of toxicity. Twentyfour hours after the last treatment, all rats were anesthetized with chloral hydrate and sacrificed by abdominal aorta blood collection. Serum was separated from blood within 2 h after sacrifice and then immediately sent for clinical chemistry parameter assay. Livers were separated under ice bath and then weighed and stored at −80 °C for further analysis. 2.3. Clinical chemistry parameters assay Serum biochemical indicators including total protein (TP), albuminglobulin ratio (A/G), aspartate aminotransferase (AST), alanine
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx
aminotransferase (ALT), glucose (Glu), albumin (ALB), direct bilirubin (DBIL), total bilirubin (TBIL), indirect bilirubin (IBIL), lactate dehydrogenase (LDH), and γ-glutamyl transferase (GGT) of blood serums were measured by an autoanalyzer (TBA-120, Toshiba, Japan) using standard kits from Roche Diagnostics in the clinical center of Capital Medical University. Since Glu is highly affected by time of day, it should be pointed out that in our study, rats were fasted for N8 h before sacrifice, that is, the Glu detected in our study was fasting serum Glu.
2.4. Determination of oxidative stress parameters About 0.1 g of liver tissue was weighed from each liver, cut into pieces, and then placed in a glass homogenizer. According to the liver tissue mass (g), physiological saline (NaCl) volume (mL) = 1: 9, 0.9 mL of 0.9% NaCl was added and grounded in an ice water bath to obtain 10% liver tissue homogenate. Thereafter, the mixture was centrifuged at 3000 rpm for 10 min, and the supernatant was separated and used for the detection of superoxide dismutase (SOD) activity, malondialdehyde (MDA) and glutathione (GSH) content, in rat liver tissue with xanthine oxidase, thiobarbituric acid and spectrophotometric method and following the manufacturers' instructions of SOD, MDA, and GSH kit (Nanjing Jiancheng Bio-Technology Co., Ltd.).
2.5. Histopathological examination A small piece of liver tissue was cut from the same part of each liver and washed with cold saline and then fixed 48 h in 4% paraformaldehyde, and finally embedded in paraffin wax. Serial 4-μm sections from each liver were stained with Hematoxylin and Eosin (H&E), and examined histopathologically under light microscopy (Olympus BX53, Japan). H&E sections were evaluated by an experienced pathologist. The histological liver structure of the BDE-209 or DBDPE treated groups was compared with that of the control group.
2.6. TNF-α and IL-6 content detection Liver tissue treatment was the same as oxidative stress pretreatment, and 10% liver tissue homogenate was prepared for analysis. The levels of tumor necrosis factor–α (TNF-α) and interleukin (IL)–-6 in liver tissue homogenates were determined using a high-sensitivity enzyme-linked immunosorbent assay kit containing ELR-TNF-α and ELR-IL6 (Raybiotech, USA) based on the manufacturer's instructions.
3
2.8. Quantitative RT-PCR validation of RNA expression Specific primers for the selected genes are listed in Table 1. Amplification was applied on a real-time PCR machine (Eppident) by the PowerUp™ SYBR™ Green Master Mix kit (Thermo Scientific, America) according to the manufacturer's instructions. Reaction conditions were set as: 50 °C for 2 min, 95 °C for 2 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min; melting curve analysis was performed to check for amplification specificity. Relative quantification of the genes was determined using the 2-ΔΔCt method. Moreover, for the specificity of the primer, the following three points were determined in our study: 1) The mRNA sequence of a gene was obtained by querying the NCBI database. After the alignment analysis, the primers of the gene were selected to design primers, and the primer pairs were designed across introns; 2) The primers were specifically analyzed using the NCBI website primer-BLAST tool, and the alignment results showed that the primers were all related sequences of the gene; that is, the primer pairs were specific primers; 3) PCR dye method (SYBR Green I) melting curve analysis. It can be seen from Supplementary Fig. S1 that the melting curves of each gene are single peaks and there are no non-specific peaks, which indicated that the primers have good specific amplification. At the same time, the amplification curve (Supplementary Fig. S2) and amplification efficiency of the primers (Supplementary Fig. S3) were also analyzed. The reverse transcript cDNA of the extracted RNA of the sample was diluted 10 times, and the amplification curve of the primer gradient concentration remained well linear. The linear correlation coefficient (R2) between the Ct value and Log10 Co was higher than 0.9800, which was calculated from the calculation formula of amplification efficiency E = 80.55%–93.34%. This result indicates that the primer has good sensitivity and high amplification efficiency. 2.9. Statistical analysis By using SPSS 20.0 (IBM, NY, USA), the experimental data were represented by mean ± standard error of the mean (SEM). First, the normality test and homogeneity of variance test were performed. For data that did not conform to a normal distribution or had heterogeneity of variance, Kruskal-Wallis H test was performed to compare the difference of data distribution between groups. As for data that conformed to a normal distribution and had homogeneity of variance, least significant difference (LSD) test was used to compare difference of mean between groups. α = 0.05 was set as the level of statistical significance. 3. Results 3.1. Liver weight and ratio of liver/body weight
2.7. RNA extract and reverse transcription polymerase chain reaction (RTPCR) Total RNA was extracted from each liver using TRIzol reagent (Plylai, Beijing). Quality of RNA was detected by a Nano Drop 2000 spectrophotometer (Thermo Fisher Scientific, USA). RNA was stored at −80 °C until assayed. Then, 2 μg of RNA was used for cDNA synthesis with a highcapacity cDNA reverse transcription kit (Thermo Scientific, America) based on the manufacturer's instructions.
During the entire treatment period, there were no behavioral changes. The clinical symptoms of rats associated with BDE-209 and DBDPE were observed, and no significant difference in food intake was observed. Furthermore, no significant difference in body weight was observed among all groups. The liver weight and ratio of liver/body weight did not change in the DBDPE-exposed groups. However, compared with the control group, the liver weight was increased in high-dose (500 mg/kg bw/day) BDE-209 treatment rats, and the medium and
Table 1 Primer sequences used for qRT-PCR. Mouse genes
Gene ID
Forward primer 5′ → 3′
Reverse primer 5′ → 3′
β-actin CAR PXR CYP3A1 CYP3A2
81822 65035 84385 25642 266682
TGTCACCAACTGGGACGATA ACGAACAGTCAGCAAGACCATTGG CACAGTGACTGCGAGCTTCCG TTGCTGTCACCCACGTTCAC GTCTCATAAAGCCCTGTC
GGGGTGTTGAAGGTCTCAAA TGTCTGGCTCTCCGCAGTGC GTTCCAGATGCTGCCGTCTTCTC CACAGGGACAGGTTTGCCTT CTGCTGGTGGTTTCATAG
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
4
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx
Fig. 1. Effects of BDE-209 and DBDPE on liver weight and hepatic body ratio in SD rats (mean ± SEM; n = 8). (*) p b .05 and (**) p b .01 compared to the control group. (#) p b .05 compared to the same dose group.
high doses BDE-209 could increase the ratios of liver/body weight (Fig. 1). 3.2. Clinical biochemical parameters It can be seen from Fig. 2 that the GGT of the rats in medium and high doses BDE-209 and DBDPE exposure groups showed an obviously increase compared with the control group. Medium and high doses BDE-209 caused significant increase in plasma TBIL and IBIL when compared to the control group. However, no significant changes in TBIL or IBIL were observed in any DBDPE treated group. In the high-dose BDE209 and DBDPE exposure groups, serum levels of Glu were increased compared to the control group.
3.3. Histopathological examination The pathological changes of liver in rats after 28 days of exposure to BDE-209 or DBDPE were detected. In the control group, the liver showed a normal lobular structure with a central vein, radiating hepatic cell cords, well-preserved cytoplasm, and prominent nucleus (Fig. 3-A). In the low-dose BDE-209 group, the liver cells had mild swelling and the cytoplasm was loose and transparent (Fig. 3-B). Extensive damage of the liver was found in the groups exposed to medium- and high-dose BDE-209, such as poor lobular structure, disordered hepatic cord and hepatic sinus, and balloon-like edematous hepatocyte, accompanied by feathery necrosis in which the cytoplasm was loose and transparent and the nucleus disappeared, with large lipid droplets in the cytoplasm
Fig. 2. The changes of blood biochemistry of rats after being exposed to BDE-209 and DBDPE (mean ± SEM; n = 8). (*) p b .05 and (**) p b .01 compared to the control group. (#) p b .05 compared to the same dose group.
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx
5
Fig. 3. The histological change in rat's liver after exposed to BDE-209 and DBDPE for 28 oral days (HE, ×400). (A) represent control group; (B–D) represent BDE-209 treated groups in dose of 5, 50, and 500 mg/kg bw/day; (E–G) represent DBDPE treated groups in dose of 5, 50, and 500 mg/kg bw/day. Yellow arrows indicate feathery necrosis, black arrows indicate lipid droplets, and blue arrows indicate inflammatory cell infiltration. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
the medium- and high-dose BDE-209 groups. However, in the DBDPE exposed groups, SOD activity was reduced only in the high-dose group.
and inflammatory cells accumulated around the portal vein infiltration These changes were also found to be more severe in high-dose BDE209 group (Fig. 3-C and 3-D). No obvious pathological changes were found in the livers of the group exposed to low-dose DBDPE (Fig. 3-E). In the medium-dose DBDPE group, the liver showed feathery necrosis. Meanwhile, we found that high DBDPE exposure (500 mg/kg bw/day) caused obvious pathological changes in the form of irregular arrangement of hepatic cords, feathery necrosis, and inflammatory cell infiltration (Fig. 3-F and 3-G). However, these pathological changes were less severe than those in high-dose BDE-209 group.
The two most common inflammatory cytokines (TNF-α and IL-6) were tested in this study (Fig. 5). Compared to control group, medium and high doses of BDE-209 exposure result in a rise in TNF-α and IL-6 levels. However, no significant changes of TNF-α and IL-6 levels were found in all DBDPE exposure groups.
3.4. Parameters of oxidative stress
3.6. mRNA expression levels of certain enzymes
In this study, we examined the MDA, GSH content, and SOD activity in rat livers. As shown in Fig. 4. Compared to control group, mediumand high-dose BDE-209 and DBDPE groups significantly increased the liver MDA levels, and these changes in BDE-209 exposure rats were significantly higher than those of the DBDPE-exposed rats. Although an increase in GSH in the medium dose DBDPE exposure group was observed, GSH levels showed no significant changes in the other groups. SOD activities in the liver were markedly decreased in
Effects of BDE-209 and DBDPE exposure on the relative mRNA expression of CYP3A1, CYP3A2, CAR, and PXR in rat liver are shown in Fig. 6. BDE-209 or DBDPE exposures significantly downregulated CAR and PXR in medium and high dose groups compare to control rats. Notably, in high dose groups, the expression levels of CAR in BDE-209 exposure rats were significantly lower than those in DBDPE exposure rats. Moreover, the relative expression levels of CYP3A1 mRNA decreased in all the BDE-209 and DBDPE exposure groups, and statistical
3.5. Levels of TNF-α and IL-6 in the liver
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
6
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx
Fig. 4. Effects of BDE-209 and DBDPE on content of MDA, GSH and activity of SOD in liver tissue (mean ± SEM; n = 5). (*) p b .05 and (**) p b .01 compared to the control group. (#) p b .05 and (##) p b .01 compared to the same dose group.
differences were also found. Meanwhile, the relative expression levels of CYP3A2 mRNA also decreased in the medium- and high-dose BDE209 groups. However, in the DBDPE treated groups, CYP3A2 mRNA expression levels were significantly lower only in the high-dose group when compared with the control group. 4. Discussion DBDPE, as an alternative to BDE-209, has similar physiochemical properties to BDE-209, and increasing attention has been paid to its adverse health effects. The extensive use of DBDPE may lead to a rapid increase in the level of DBDPE in various matrices. Studies have shown that the liver is a main target organ for the accumulation and exposure of BFRs (Fujimoto et al., 2011; Li et al., 2011; Noyes et al., 2011), and BDE-209 and DBDPE are mainly metabolized by the liver after entering the body. Liver is the target organ for heterogeneous metabolism. It can
transform many nonnutrients from the inside and outside through various biochemical reactions, completely decompose them, or excrete them in their original form to protect the body from damage. A rat model showed that the concentrations of BDE-209 were highest in liver whereas the concentrations of DBDPE were highest in adipose after oral exposure of BDE-209 or DBDPE for 90 days (Wang et al., 2010). This is an indication that the toxicokinetic properties and tissue distribution of the two compounds are different (Sarkar and Singh, 2017). However, current understanding of the hepatotoxic effects of DBDPE is very limited, and a comparison between the hepatotoxic effects of DBDPE and BDE-209 has not been reported. The main objective of the present study was to investigate the hepatotoxic effects of SD rats after 28 days of DBDPE or BDE-209 exposure, and a comparison between the results of DBDPE and BDE-209 was also our purpose. It has been suggested that BDE-209 significantly increased the liver weight and organ coefficient of rats (Lee et al., 2010). Similarly,
Fig. 5. Effects of BDE-209 and DBDPE on the levels of TNF-α and IL-6 in the liver (mean ± SEM; n = 4). (*) p b .05 and (**) p b .01 compared to the control group.
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx
7
Fig. 6. Relative liver mRNA expression of CAR, PXR, CYP3A1 and CYP3A2 from control and BDE-209-exposed or DBDPE-exposed rats (mean ± SEM; n = 4). (*) p b .05 and (**) p b .01 compared to the control group. (#) p b .05 compared to the same dose group.
in our study, we found that the rats showed a significant increase in liver weight and ratio of liver/body weight at high-dose BDE-209 group, and the ratio of liver/body weight also increased in the medium-dose BDE209 group. However, no significant changes were observed in liver weight or in the ratio of liver/body weight in the DBDPE exposures groups. These results indicated that medium and high doses of BDE209 exposure could cause overt toxicity, whereas DBDPE had no effect. However, a former study found that 200 mg/kg bw/day DBDPE exposure could cause a significant increase in liver weight of mice, but this may be caused by species differences (Sun et al., 2018). To further explore hepatotoxic effects induced by DBDPE or BDE-209, we measured the histopathology of liver and found that all three doses of BDE-209 and medium and high doses of DBDPE could lead to changes in liver histopathology. Moreover, the liver histopathology changes were more severe in BDE-209 groups than those in DBDPE groups. Furthermore, we tested a series of biochemical markers of liver damage and function, such as TP, A/G, AST, ALT, ALB, DBIL, TBIL, IBIL, LDH and GGT in serum. The elevation in the serum levels of these markers has been attributed to damage to the structural integrity of the cellular membrane and impairment of the hepatobiliary duct apparatus. In the present study, except for GGT, TBIL, and IBIL, BDE-209 and DBDPE had no effects on other biochemical parameters (data not shown). Our results showed that in medium- and high-dose groups, both BDE-209 and DBDPE could lead to a significant increase in GGT, and BDE-209 could also increase serum IBIL and TBIL levels, indicating hepatotoxicity with severe damage to hepatic tissue membranes. These results were in agreement with the results of liver histopathology changes. The liver is known to be the most important organ in glycolipid metabolism, and liver damage can cause metabolic disorders of glycolipids. Some studies have shown that BDE-209 or DBDPE could disturb glucose homeostasis and elevate blood glucose (Sarkar and Singh, 2017; Sun et al., 2018). We also found that glucose concentrations increased in the serum of groups receiving high-dose BDE-209 and DBDPE. These observations suggested
that BDE-209 and DBDPE could interfere with liver function, and BDE209 may have greater effect. Oxidative stress has been linked to the toxicity of BFRs. Previous studies on thyroid and cardiovascular toxicity found that both BDE209 or DBDPE could cause an oxidative stress response in thyroid, heart, and abdominal aorta (Jing et al., 2019; Wang et al., 2019a, b). It has been found that BDE-209 could decrease SOD activity in mouse liver (Zhu et al., 2019). Feng et al. reported that both BDE-209 and DBDPE could evoke hepatic oxidative stress in Carassius auratus, as indicated by a decrease in GSH level and inhibition of the activities of the antioxidant enzymes, as well as elevation of lipid peroxidation level (Feng et al., 2013). As a lipid peroxidation end product, MDA can be used to infer oxidative damage to the body. GSH is a coenzyme of various enzymes that binds to a variety of chemicals and their metabolites and has a range of biological functions. The level of SOD activity can reflect the body's antioxidant capacity (Silvestre et al., 2006). Therefore, in this study, we selected a panel of classical oxidative stress biomarkers, including MDA, GSH, and SOD, to evaluate oxidative damage to rat liver by BDE-209 or DBDPE. The results showed that medium and high doses of BDE-209 or DBDPE exposure caused a significant increase in MDA content; furthermore, the levels of MDA in the group exposed to BDE-209 were significantly higher than those in the DBDPE exposed group. In addition, SOD activities were found to decrease in mediumand high-dose BDE-209 groups and high-dose DBDPE group. The levels of GSH were significantly increased only in the medium-dose DBDPE group. It is possible that DBDPE is less toxic and that medium dose of DBDPE exposure could induce an increase of GSH to maintain adequate oxygenation of the liver. These results indicate that both BDE-209 and DBDPE could cause oxidative damage in the liver. Compared with DBDPE, BDE-209 has more serious effects on oxidative stress. Inflammation may be one of the biological responses that reflect cumulative exposure to various stressors. Previous studies have shown that PBDEs could cause inflammatory reactions, and there was a positive
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
8
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx
correlation between PBDEs and proinflammatory cytokines such as IL-6 and TNF-α (Zota et al., 2018). BDE-209 was found to induce upregulation of Beas-2B inflammatory cytokine (IL-6, IL-8 and TNF-α mRNA) in a cell model (Zhang et al., 2018). BDE-100 and BDE-209 can also induce a significant increase in IL-6 in dolphin fibroblasts (Rajput et al., 2018). Moreover, BDE-209 exposure also significantly increased production of IL-10, TNF-α, and IL-17A in serum of male offspring (Chen et al., 2019). However, data are lacking on inflammatory factors in the liver of rats after exposure to BDE-209 or DBDPE. In this study, we detected the two most common inflammatory factors TNF-α and IL-6. The results suggested that exposure to BDE-209 could cause significant increases in TNF-α and IL-6 in the rat liver, whereas no significant change was found in DBDPE-exposed groups. This study demonstrates for the first time that BDE-209 can cause inflammatory responses in TNF-α and IL-6 in the liver, whereas DBDPE has no significant effects in this dose range. It is known that liver damage impairs hepatic metabolic capacity. Cytochrome P450 (CYP450) enzyme is one of the most important enzymes involved in the metabolism of exogenous and endogenous substances, especially known for the phase I metabolism of various xenobiotics (Zhou et al., 2003; Wang et al., 2015). Therefore, it is widely used as a biomarker of contaminants in many species (Sanchez-Hernandez et al., 2014; Lu et al., 2017). CYP3A is a member of the CYP450 family of enzymes, which exhibit higher expression in the liver and play an important role in the first-pass and systemic metabolism of many substances (Palatini et al., 2008) and are the most abundant CYPs in humans (Ghosal et al., 1996). Moreover, CYP3A1 and CYP3A2 are considered to be the most important CYP3A isoforms in male rats (Jan et al., 2006). It has been suggested that BFRs could change CYP450 enzyme expression (Wang et al., 2006; Uno et al., 2012). A former study reported that when biotransformations of DBDPE and BDE-209 in rats were studied, increased expression of CYP3A2 in the liver of 100 mg/kg bw/day DBDPE-treated rats was observed (Wang et al., 2010). However, another study found that DBDPE could not change the expression of CYP3A in the mouse (Sun et al., 2018). To confirm the effects of BDE-209 and DBDPE on the expression of CYP3A, our study detected the expression levels of CYP3A, PXR and CAR in rat livers after BDE-209 and DBDPE exposure. PXR and CAR are nuclear receptors, which control the expression of CYP3A enzymes (Gabbia et al., 2017). Based on results in our study, it can be seen that both BDE-209 and DBDPE could downregulated PXR, CAR and CYP3A. Former studies have proved that both oxidative stress and inflammation play important roles in regulating the expression of CYP450 (Morgan, 1997; Siewert et al., 2000). Studies have found that acute inflammation, including IL-6 and TNF-α, could cause PXR and CAR inhibition and contribute to CYP3A suppression (Gahrs et al., 2013; Zeng et al., 2019). Oxidative stress can indirectly affect the expression of CYP450 mRNA by affecting the expression of nuclear receptors (Kakehashi et al., 2013). Therefore, it was assumed that inflammation, increased oxidative stress, and decrement of PXR and CAR downgraded the expression of CYP3A mRNA in BDE-209 and DBDPE treated groups. In the present study, we noticed that the mRNA expression of PXR and CAR was decreased only in the groups exposed to medium and high doses BDE209 and DBDPE. Moreover, inflammation and oxidative stress were exacerbated only in rats treated with the medium and high doses of BDE209 or DBDPE. However, the mRNA expression of CYP3A1 was found to decrease even in the low dose of BDE-209 and DBDPE exposure rats. This is an indication that other factors likely contribute to the regulation of CYP3A, and further studies are required. 5. Conclusion In summary, this is the first study to compare the hepatotoxicity induced by BDE-209 and DBDPE. Our results showed that no significant liver toxicity was observed at relatively low dose comparable with the human exposure levels, however, more severe liver toxicity occurred
under relatively high BDE-209 and DBDPE exposure. BDE-209 and DBDPE could impair liver structure and function and induce oxidative stress and inflammation, inhibiting PXR and CAR expression and contributing to CYP3A suppression and impaired hepatic metabolic capacity. And BDE-209 and DBDPE may interfere metabolism in rats through oxidative stress and inflammation. Moreover, our finding indicated that liver damage caused by BDE-209 was more serious than that caused by DBDPE. In addition, hepatotoxicity may be induced by different mechanisms. In future studies, more attention should be paid to the specific toxic mechanism of DBDPE to determine whether DBDPE is a suitable replacement for BDE-209. Declaration of competing interest The authors have no conflict of interest to declare. Acknowledgements The present research was funded by the National Natural Science Foundation of China (21777107, 21477083, 81703198, 21537001, 31770441), the National Key Research and Development Program of China (2017YFC1600500), and Joint funding of Beijing Natural Science Foundation and Beijing Education Commission (KZ201910025037). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi. org/10.1016/j.scitotenv.2019.135783. References Birnbaum, L.S., Staskal, D.F., 2004. Brominated flame retardants: cause for concern? Environ. Health Perspect. 112, 9–17. Chen, Y., Liu, S., Xu, H., Zheng, H., Bai, C., Pan, W., 2019. Maternal exposure to low dose BDE209 and Pb mixture induced neurobehavioral anomalies in C57BL/6 male offspring. Toxicology 418, 70–80. Feng, M., Li, Y., Qu, R., Wang, L., Wang, Z., 2013. Oxidative stress biomarkers in freshwater fish Carassius auratus exposed to decabromodiphenyl ether and ethane, or their mixture. Ecotoxicology 22, 1101–1110. Fonnum, F., Mariussen, E., 2009. Mechanisms involved in the neurotoxic effects of environmental toxicants such as polychlorinated biphenyls and brominated flame retardants. J. Neurochem. 111, 1327–1347. Fromme, H., Becher, G., Hilger, B., Volkel, W., 2016. Brominated flame retardants - exposure and risk assessment for the general population. Int. J. Hyg. Environ. Health 219, 1–23. Fujimoto, H., Woo, G.H., Inoue, K., Takahashi, M., Hirose, M., Nishikawa, A., 2011. Impaired oligodendroglial development by decabromodiphenyl ether in rat offspring after maternal exposure from mid-gestation through lactation. Reprod. Toxicol. 31, 86–94. Gabbia, D., Pozza, A.D., Albertoni, L., Lazzari, R., Zigiotto, G., Carrara, M., 2017. Pregnane X receptor and constitutive androstane receptor modulate differently CYP3A-mediated metabolism in early- and late-stage cholestasis. World J. Gastroenterol. 23, 7519–7530. Gahrs, M., Roos, R., Andersson, P.L., Schrenk, D., 2013. Role of the nuclear xenobiotic receptors CAR and PXR in induction of cytochromes P450 by non-dioxinlike polychlorinated biphenyls in cultured rat hepatocytes. Toxicol. Appl. Pharmacol. 272, 77–85. Ghosal, A., Satoh, H., Thomas, P.E., Bush, E., Moore, D., 1996. Inhibition and kinetics of cytochrome P4503A activity in microsomes from rat, human, and cdna-expressed human cytochrome P450. Drug Metab. Dispos. 24, 940–947. Gill, U., Chu, I., Ryan, J.J., Feeley, M., 2004. Polybrominated diphenyl ethers: human tissue levels and toxicology. Rev. Environ. Contam. Toxicol. 183, 55–97. Goodman, J.E., 2009. Neurodevelopmental effects of decabromodiphenyl ether (BDE-209) and implications for the reference dose. Regul. Toxicol. Pharmacol. 54, 91–104. Hardy, M.L., 2002. A comparison of the properties of the major commercial PBDPO/PBDE product to those of major PBB and PCB products. Chemosphere 46, 717–728. Jan, Y.H., Mishin, V., Busch, C.M., Thomas, P.E., 2006. Generation of specific antibodies and their use to characterize sex differences in four rat P450 3A enzymes following vehicle and pregnenolone 16alpha-carbonitrile treatment. Arch. Biochem. Biophys. 446, 101–110. Jing, L., Sun, Y., Wang, Y., Liang, B., Chen, T., Zheng, D., 2019. Cardiovascular toxicity of decabrominated diphenyl ethers (BDE-209) and decabromodiphenyl ethane (DBDPE) in rats. Chemosphere 223, 675–685. Kakehashi, A., Hagiwara, A., Imai, N., Nagano, K., Nishimaki, F., Banton, M., 2013. Mode of action of ethyl tertiary-butyl ether hepatotumorigenicity in the rat: evidence for a role of oxidative stress via activation of CAR, PXR and PPAR signaling pathways. Toxicol. Appl. Pharmacol. 273, 390–400.
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx Lee, E., Kim, T.H., Choi, J.S., Nabanata, P., Kim, N.Y., Ahn, M.Y., 2010. Evaluation of liver and thyroid toxicity in Sprague-Dawley rats after exposure to polybrominated diphenyl ether BDE-209. J. Toxicol. Sci. 35, 535–545. Li, J., Liang, Y., Zhang, X., Lu, J., Zhang, J., Ruan, T., 2011. Impaired gas bladder inflation in zebrafish exposed to a novel heterocyclic brominated flame retardant tris(2,3dibromopropyl) isocyanurate. Environ. Sci. Technol. 45, 9750–9757. Liang, S., Xu, F., Tang, W., Zhang, Z., Zhang, W., Liu, L., 2016. Brominated flame retardants in the hair and serum samples from an e-waste recycling area in southeastern China: the possibility of using hair for biomonitoring. Environ. Sci. Pollut. Res. Int. 23, 14889–14897. Lu, X., Li, Y., Thunders, M., Cavanagh, J., Matthew, C., Wang, X., 2017. Differential protein expression and localization of CYP450 enzymes in three species of earthworm; is this a reflection of environmental adaptation? Chemosphere 171, 485–490. Lyche, J.L., Rosseland, C., Berge, G., Polder, A., 2015. Human health risk associated with brominated flame-retardants (BFRs). Environ. Int. 74, 170–180. Morgan, E.T., 1997. Regulation of cytochromes P450 during inflammation and infection. Drug Metab. Rev. 29, 1129–1188. Nadjia, L., Abdelkader, E., Ulrich, M., Bekka, A., 2014. Spectroscopic behavior of saytex 8010 under UV-visible light and comparative thermal study with some flame bromine retardant. J. Photoch. Photobio. A 275, 96–102. Noyes, P.D., Hinton, D.E., Stapleton, H.M., 2011. Accumulation and debromination of decabromodiphenyl ether (BDE-209) in juvenile fathead minnows (Pimephales promelas) induces thyroid disruption and liver alterations. Toxicol. Sci. 122, 265–274. Palatini, P., De Martin, S., Pegoraro, P., Orlando, R., 2008. Enzyme inhibition and induction in liver disease. Curr. Clin. Pharmacol. 3, 56–69. Rajput, I.R., Xiao, Z., Yajing, S., Yaqoob, S., Sanganyado, E., Ying, H., 2018. Establishment of pantropic spotted dolphin (Stenella attenuata) fibroblast cell line and potential influence of polybrominated diphenyl ethers (PBDEs) on cytokines response. Aquat. Toxicol. 203, 1–9. Sanchez-Hernandez, J.C., Narvaez, C., Sabat, P., Martinez Mocillo, S., 2014. Integrated biomarker analysis of chlorpyrifos metabolism and toxicity in the earthworm Aporrectodea caliginosa. Sci. Total Environ. 490, 445–455. Sarkar, D., Singh, S.K., 2017. Maternal exposure to polybrominated diphenyl ether (BDE209) during lactation affects germ cell survival with altered testicular glucose homeostasis and oxidative status through down-regulation of Cx43 and p27Kip1 in prepubertal mice offspring. Toxicology 386, 103–119. Shi, Z., Zhang, L., Li, J., Zhao, Y., Sun, Z., Zhou, X., 2016. Novel brominated flame retardants in food composites and human milk from the Chinese Total diet study in 2011: concentrations and a dietary exposure assessment. Environ. Int. 96, 82–90. Shi, Z., Zhang, L., Li, J., Wu, Y., 2018. Legacy and emerging brominated flame retardants in China: a review on food and human milk contamination, human dietary exposure and risk assessment. Chemosphere 198, 522–536. Siewert, E., Bort, R., Kluge, R., Heinrich, P.C., Castell, J., Jover, R., 2000. Hepatic cytochrome P450 down-regulation during aseptic inflammation in the mouse is interleukin 6 dependent. Hepatology 32, 49–55. Silvestre, F., Dierick, J.F., Dumont, V., Dieu, M., Raes, M., Devos, P., 2006. Differential protein expression profiles in anterior gills of Eriocheir sinensis during acclimation to cadmium. Aquat. Toxicol. 76, 46–58.
9
Sun, R.B., Shang, S., Zhang, W., Lin, B.C., Wang, Q., Shi, Y., 2018. Endocrine disruption activity of 30-day dietary exposure to Decabromodiphenyl ethane in Balb/C mouse. Biomed. Environ. Sci. 31, 12–22. Tseng, L.H., Lee, C.W., Pan, M.H., Tsai, S.S., Li, M.H., Chen, J.R., 2006. Postnatal exposure of the male mouse to 2,2′,3,3′,4,4′,5,5′,6,6′-decabrominated diphenyl ether: decreased epididymal sperm functions without alterations in DNA content and histology in testis. Toxicology 224, 33–43. Tseng, L.H., Li, M.H., Tsai, S.S., Lee, C.W., Pan, M.H., Yao, W.J., 2008. Developmental exposure to decabromodiphenyl ether (PBDE 209): effects on thyroid hormone and hepatic enzyme activity in male mouse offspring. Chemosphere 70, 640–647. Uno, T., Ishizuka, M., Itakura, T., 2012. Cytochrome P450 (CYP) in fish. Environ. Toxicol. Pharmacol. 34, 1–13. Wang, D., Chen, T., Fu, Z., Yang, L., Li, R., Sui, S., Wang, Y., Shi, Z., 2019a. Occupational exposure to polybrominated diphenyl ethers or decabromodiphenyl ethane during chemical manufacturing: occurrence and health risk assessment. Chemosphere 231, 385–392. Wang, F., Wang, J., Dai, J., Hu, G., Wang, J., Luo, X., 2010. Comparative tissue distribution, biotransformation and associated biological effects by decabromodiphenyl ethane and decabrominated diphenyl ether in male rats after a 90-day oral exposure study. Environ. Sci. Technol. 44, 5655–5660. Wang, L., Scheffler, B.E., Willett, K.L., 2006. CYP1C1 messenger RNA expression is inducible by benzo[a]pyrene in Fundulus heteroclitus embryos and adults. Toxicol. Sci. 93, 331–340. Wang, Y., Wu, S., Chen, Z., Zhang, H., Zhao, W., 2015. Inhibitory effects of cytochrome P450 enzymes CYP1A2, CYP2A6, CYP2E1 and CYP3A4 by extracts and alkaloids of Gelsemium elegans roots. J. Ethnopharmacol. 166, 66–73. Wang, Y., Chen, T., Sun, Y., Zhao, X., Zheng, D., Jing, L., 2019b. A comparison of the thyroid disruption induced by decabrominated diphenyl ethers (BDE-209) and decabromodiphenyl ethane (DBDPE) in rats. Ecotoxicol. Environ. Saf. 174, 224–235. Zeng, H., Lin, Y., Gong, J., Lin, S., Gao, J., Li, C., 2019. CYP3A suppression during diet-induced nonalcoholic fatty liver disease is independent of PXR regulation. Chem. Biol. Interact. 308, 185–193. Zhang, Y., Mao, P., Li, G., Hu, J., Yu, Y., An, T., 2018. Delineation of 3D dose-time-toxicity in human pulmonary epithelial Beas-2B cells induced by decabromodiphenyl ether (BDE209). Environ. Pollut. 243, 661–669. Zhou, S., Gao, Y., Jiang, W., Huang, M., Xu, A., Paxton, J.W., 2003. Interactions of herbs with cytochrome P450. Drug Metab. Rev. 35, 35–98. Zhu, Y., Li, X., Liu, J., Zhou, G., Yu, Y., Jing, L., 2019. The effects of decabromodiphenyl ether on glycolipid metabolism and related signaling pathways in mice. Chemosphere 222, 849–855. Zota, A.R., Geller, R.J., Romano, L.E., Coleman-Phox, K., Adler, N.E., Parry, E., 2018. Association between persistent endocrine-disrupting chemicals (PBDEs, OH-PBDEs, PCBs, and PFASs) and biomarkers of inflammation and cellular aging during pregnancy and postpartum. Environ. Int. 115, 9–20.
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
Contents lists available at ScienceDirect
Science of the Total Environment journal homepage: www.elsevier.com/locate/scitotenv
Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day exposed SpragueDawley rats Yanmin Sun, Yuwei Wang, Baolu Liang, Tian Chen, Dan Zheng, Xuezhen Zhao, Li Jing ⁎, Xianqing Zhou, Zhiwei Sun, Zhixiong Shi ⁎ School of Public Health and Beijing Key Laboratory of Environmental Toxicology, Capital Medical University, Beijing 100069, China
H I G H L I G H T S
G R A P H I C A L
A B S T R A C T
• Hepatotoxicity induced by BDE-209 and DBDPE in rats was studied and compared. • Both BDE-209 and DBDPE can cause liver damage whereas DBDPE is less toxic. • BDE-209 and DBDPE may interfere metabolism in rats through oxidative stress and inflammation.
a r t i c l e
i n f o
Article history: Received 20 July 2019 Received in revised form 23 September 2019 Accepted 24 November 2019 Available online xxxx Editor: Henner Hollert Keywords: Brominated flame retardants Decabromodiphenyl ethane Decabromodiphenyl ether Hepatotoxicity Rat
a b s t r a c t Decabromodiphenyl ether (BDE-209) and its substitute decabromodiphenyl ethane (DBDPE) are heavily used in various industrial products as flame retardant. They have been found to be persistent in the environment and have adverse health effects in humans. Although some former studies have reported toxic effects of BDE-209, the study of DBDPE's toxic effects is still in its infancy, and the effects of DBDPE on hepatotoxicity are also unclear. This study aimed to evaluate and compare the hepatotoxicity induced by BDE-209 and DBDPE using a rat model. Sprague-Dawley rats were administered DBDPE or BDE-209 (5, 50, 500 mg/kg bodyweight) intragastrically once a day for 28 days. Twenty-four hours after the end of treatment, the rats were sacrificed, and body liver weight, blood biochemical parameters, liver pathology, oxidative stress, inflammation, pregnane X receptor (PXR), constitutive androstane receptor (CAR), and changes in cytochrome P450 (CYP3A) enzymes were measured. Our results showed that both BDE-209 and DBDPE could cause liver morphological changes, induce oxidative stress, increase γ-glutamyl transferase and glucose levels in serum, and down-regulate PXR, CAR, and CYP3A expression. In addition, BDE-209 was found to increase liver weight and the ratio of liver/body weight, lead to elevated total bilirubin and indirect bilirubin levels in serum, and induce inflammation. The present study indicated that BDE-209 and DBDPE may interfere with normal metabolism in rats through oxidative stress and inflammation, which inhibit PXR and CAR to induce the expression of CYP3A enzymes, and finally produce hepatotoxic effects
⁎ Corresponding authors. E-mail addresses: [email protected] (L. Jing), [email protected] (Z. Shi).
https://doi.org/10.1016/j.scitotenv.2019.135783 0048-9697/© 2018 Published by Elsevier B.V.
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
2
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx
and cause liver damage in rats. Comparatively, our results show that the damage caused by BDE-209 was more serious than that caused by DBDPE. © 2018 Published by Elsevier B.V.
1. Introduction Brominated flame retardants (BFRs) are widely used as additives in electrical and electronic products, plastics, building materials, and furniture, and they are essential in fire prevention due to their cheapness and excellent flame-retardant properties. Decabrominated diphenyl ether (deca-BDE, mainly composed of BDE-209) is one of the commercial products of polybrominated diphenyl ethers (PBDEs), which are the most frequently used commercial BFRs. BDE-209 accounts for N82% of total usage of PBDEs and has been widely used worldwide since the 1990s (Hardy, 2002; Fonnum and Mariussen, 2009). However, environmental pollution and population health risks brought about by the widespread of BDE-209 are also receiving attention (Lyche et al., 2015; Fromme et al., 2016). BDE-209 has been included on a list of persistent organic pollutants since 2017 and will be totally phased out in the European Union after 2019 (http://chm.pops.int/TheConvention/ ThePOPs). However, BDE-209 has not yet been phased out in China; that is, it is still in production and use. Decabromodiphenyl ethane (DBDPE), as a novel BFR, has been promoted as a substitute for BDE209. Because of its large molecular size, low aqueous solubility, and biological availability, DBDPE is believed to be rarely released into the environment and has low toxicity (Sun et al., 2018). Therefore, after its entry into the BFR market, its output and usage has increased rapidly, and it has become one of the most commonly used BFRs in China (Shi et al., 2018). However, in recent years, DBDPE has been detected in various substrates, including environmental substrates, biological matrices, and human matrices. Previous studies showed that levels of legacy BFRs such as PBDEs were on the decline, whereas contamination levels of DBDPE have risen rapidly, and it has become one of the predominant BFRs in various environmental matrices in China (Liang et al., 2016; Shi et al., 2016). Although the contamination levels of DBDPE are on the rise, data on the toxic effects of DBDPE are lacking. As a persistent organic pollutant, BDE-209 is environmentally persistent, bioaccumulative, and endocrine disruptive (Wang et al., 2010). Several studies found that BDE-209 could be converted into lowbrominated diphenyl ethers by living organisms and therefore, its potential toxicity is increased. Previous studies also showed that BDE209 has potential hepatotoxicity, neurotoxicity, and neonatal risks, and it could affect the thyroid endocrine system in mammals (Birnbaum and Staskal, 2004; Tseng et al., 2006; Tseng et al., 2008; Goodman, 2009). BDE-209 is an environmental pollutant with high lipophilicity and low water solubility and bioconcentration; thus, it must be metabolized by the liver after entering the body. Lee reported that BDE-209 could increase the liver weight of Sprague-Dawley (SD) rats, induce the expression of cytochrome P450 enzymes, and upregulate the constitutive androstane receptor (CAR) and pregnane xenobiotic receptor (PXR) expression levels in the liver (Lee et al., 2010). DBDPE is an alternative to BDE-209. However, it has also been found to be bioaccumulative and has the potential to reach the food chain (Nadjia et al., 2014). Thus, the large-scale application of DBDPE will result in an increase of human exposure and accumulation. It has been reported that 90 days of DBDPE exposure in rats could result in accumulation of DBDPE in the liver; moreover, after DBDPE exposure, the serum total bile acid level significantly increases, suggesting that the liver may be a main target organ after DBDPE exposure (Wang et al., 2010). In addition, some studies have shown that DBDPE could cause liver damage, increase liver weight, lead to obvious pathological changes of the liver in mouse, and cause oxidative stress in the liver of Carassius auratus (Feng et al., 2013; Sun et al., 2018). However, understanding of the hepatotoxicity of DBDPE is still very limited. In addition,
there are no studies systematically comparing the hepatotoxicity of DBDPE and BDE-209. In the present study, we build a rat model to investigate and compare the liver toxicity of DBDPE and BDE-209. 2. Materials and methods 2.1. Animals SD male rats (6 weeks old, weighing 180- to 220 g) were provided by Weitong-Lihua Experimental Animal Center (Beijing, China) and housed under a controlled environmental condition (22 °C, a 12:12 h light: dark cycle, free access to food and water). Before the experiments, all rats were examined daily during acclimation for any overt signs of physical or behavioral issues, and only healthy animals were selected. All procedures involving animals and their care were conducted under the approval of the Committee on the Ethics of Animal Experiments of Capital Medical University (AEEI-2018-015), and were carried out according to the institutional guidelines of the National Institutes of Health. 2.2. Chemicals and treatment Powdered BDE-209 and DBDPE were both with N98% purity and obtained from Acros Organics (NJ, USA). The rats were randomly divided into 7 groups after 1-week acclimation (n = 12 rats per treatment) such that the mean body weights of all groups were statistically comparable at the study initiation. Control animals received corn oil only. BDE209 and DBDPE was dissolved in corn oil as the exposure mixture. The doses for treatment groups were 5, 50, and 500 mg BDE-209 or DBDPE per kilogram of body weight per day (mg/kg bw/day). The BDE-209 and DBDPE treatment dosage were 5, 50, and 500 mg/kg bw/day, which depends on a revised BDE-209 oral reference dose (RfD) of 0.007 mg/kg day suggested by US Environmental Protection Agency Integrated Risk Information System in 2008 and several previous studies (Gill et al., 2004; Lee et al., 2010; Wang et al., 2019). Moreover, our previous study had reported that the estimated daily intake (EDI) levels of BDE-209 and DBDPE found for BDE-209 and DBDPE manufacturing workers were in ranges of 0.67–18.7 μg/kg bw/day and 0.804–27.5 μg/kg bw/day, respectively (Wang et al., 2019a, b). And we found that the max EDI of BDE-209 or DBDPE were higher than RfD. Therefore, in this study, we chose to use 5 mg/kg bw/day for the lowexposure dose on the basis of the product of RfD limitation, dose conversion coefficients (6.25) and 100-fold uncertainty factor and the lowexposure dose (5 mg/kg bw/day) was magnified 10 and 100 times as medium (50 mg/kg bw/day) and high (500 mg/kg bw/day) doses, respectively. The rats were treated orally by gavage administration daily for 28 consecutive days. During these days, they were weighed every 3 days and observed daily behaviors of the rats for signs of toxicity. Twentyfour hours after the last treatment, all rats were anesthetized with chloral hydrate and sacrificed by abdominal aorta blood collection. Serum was separated from blood within 2 h after sacrifice and then immediately sent for clinical chemistry parameter assay. Livers were separated under ice bath and then weighed and stored at −80 °C for further analysis. 2.3. Clinical chemistry parameters assay Serum biochemical indicators including total protein (TP), albuminglobulin ratio (A/G), aspartate aminotransferase (AST), alanine
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx
aminotransferase (ALT), glucose (Glu), albumin (ALB), direct bilirubin (DBIL), total bilirubin (TBIL), indirect bilirubin (IBIL), lactate dehydrogenase (LDH), and γ-glutamyl transferase (GGT) of blood serums were measured by an autoanalyzer (TBA-120, Toshiba, Japan) using standard kits from Roche Diagnostics in the clinical center of Capital Medical University. Since Glu is highly affected by time of day, it should be pointed out that in our study, rats were fasted for N8 h before sacrifice, that is, the Glu detected in our study was fasting serum Glu.
2.4. Determination of oxidative stress parameters About 0.1 g of liver tissue was weighed from each liver, cut into pieces, and then placed in a glass homogenizer. According to the liver tissue mass (g), physiological saline (NaCl) volume (mL) = 1: 9, 0.9 mL of 0.9% NaCl was added and grounded in an ice water bath to obtain 10% liver tissue homogenate. Thereafter, the mixture was centrifuged at 3000 rpm for 10 min, and the supernatant was separated and used for the detection of superoxide dismutase (SOD) activity, malondialdehyde (MDA) and glutathione (GSH) content, in rat liver tissue with xanthine oxidase, thiobarbituric acid and spectrophotometric method and following the manufacturers' instructions of SOD, MDA, and GSH kit (Nanjing Jiancheng Bio-Technology Co., Ltd.).
2.5. Histopathological examination A small piece of liver tissue was cut from the same part of each liver and washed with cold saline and then fixed 48 h in 4% paraformaldehyde, and finally embedded in paraffin wax. Serial 4-μm sections from each liver were stained with Hematoxylin and Eosin (H&E), and examined histopathologically under light microscopy (Olympus BX53, Japan). H&E sections were evaluated by an experienced pathologist. The histological liver structure of the BDE-209 or DBDPE treated groups was compared with that of the control group.
2.6. TNF-α and IL-6 content detection Liver tissue treatment was the same as oxidative stress pretreatment, and 10% liver tissue homogenate was prepared for analysis. The levels of tumor necrosis factor–α (TNF-α) and interleukin (IL)–-6 in liver tissue homogenates were determined using a high-sensitivity enzyme-linked immunosorbent assay kit containing ELR-TNF-α and ELR-IL6 (Raybiotech, USA) based on the manufacturer's instructions.
3
2.8. Quantitative RT-PCR validation of RNA expression Specific primers for the selected genes are listed in Table 1. Amplification was applied on a real-time PCR machine (Eppident) by the PowerUp™ SYBR™ Green Master Mix kit (Thermo Scientific, America) according to the manufacturer's instructions. Reaction conditions were set as: 50 °C for 2 min, 95 °C for 2 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min; melting curve analysis was performed to check for amplification specificity. Relative quantification of the genes was determined using the 2-ΔΔCt method. Moreover, for the specificity of the primer, the following three points were determined in our study: 1) The mRNA sequence of a gene was obtained by querying the NCBI database. After the alignment analysis, the primers of the gene were selected to design primers, and the primer pairs were designed across introns; 2) The primers were specifically analyzed using the NCBI website primer-BLAST tool, and the alignment results showed that the primers were all related sequences of the gene; that is, the primer pairs were specific primers; 3) PCR dye method (SYBR Green I) melting curve analysis. It can be seen from Supplementary Fig. S1 that the melting curves of each gene are single peaks and there are no non-specific peaks, which indicated that the primers have good specific amplification. At the same time, the amplification curve (Supplementary Fig. S2) and amplification efficiency of the primers (Supplementary Fig. S3) were also analyzed. The reverse transcript cDNA of the extracted RNA of the sample was diluted 10 times, and the amplification curve of the primer gradient concentration remained well linear. The linear correlation coefficient (R2) between the Ct value and Log10 Co was higher than 0.9800, which was calculated from the calculation formula of amplification efficiency E = 80.55%–93.34%. This result indicates that the primer has good sensitivity and high amplification efficiency. 2.9. Statistical analysis By using SPSS 20.0 (IBM, NY, USA), the experimental data were represented by mean ± standard error of the mean (SEM). First, the normality test and homogeneity of variance test were performed. For data that did not conform to a normal distribution or had heterogeneity of variance, Kruskal-Wallis H test was performed to compare the difference of data distribution between groups. As for data that conformed to a normal distribution and had homogeneity of variance, least significant difference (LSD) test was used to compare difference of mean between groups. α = 0.05 was set as the level of statistical significance. 3. Results 3.1. Liver weight and ratio of liver/body weight
2.7. RNA extract and reverse transcription polymerase chain reaction (RTPCR) Total RNA was extracted from each liver using TRIzol reagent (Plylai, Beijing). Quality of RNA was detected by a Nano Drop 2000 spectrophotometer (Thermo Fisher Scientific, USA). RNA was stored at −80 °C until assayed. Then, 2 μg of RNA was used for cDNA synthesis with a highcapacity cDNA reverse transcription kit (Thermo Scientific, America) based on the manufacturer's instructions.
During the entire treatment period, there were no behavioral changes. The clinical symptoms of rats associated with BDE-209 and DBDPE were observed, and no significant difference in food intake was observed. Furthermore, no significant difference in body weight was observed among all groups. The liver weight and ratio of liver/body weight did not change in the DBDPE-exposed groups. However, compared with the control group, the liver weight was increased in high-dose (500 mg/kg bw/day) BDE-209 treatment rats, and the medium and
Table 1 Primer sequences used for qRT-PCR. Mouse genes
Gene ID
Forward primer 5′ → 3′
Reverse primer 5′ → 3′
β-actin CAR PXR CYP3A1 CYP3A2
81822 65035 84385 25642 266682
TGTCACCAACTGGGACGATA ACGAACAGTCAGCAAGACCATTGG CACAGTGACTGCGAGCTTCCG TTGCTGTCACCCACGTTCAC GTCTCATAAAGCCCTGTC
GGGGTGTTGAAGGTCTCAAA TGTCTGGCTCTCCGCAGTGC GTTCCAGATGCTGCCGTCTTCTC CACAGGGACAGGTTTGCCTT CTGCTGGTGGTTTCATAG
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
4
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx
Fig. 1. Effects of BDE-209 and DBDPE on liver weight and hepatic body ratio in SD rats (mean ± SEM; n = 8). (*) p b .05 and (**) p b .01 compared to the control group. (#) p b .05 compared to the same dose group.
high doses BDE-209 could increase the ratios of liver/body weight (Fig. 1). 3.2. Clinical biochemical parameters It can be seen from Fig. 2 that the GGT of the rats in medium and high doses BDE-209 and DBDPE exposure groups showed an obviously increase compared with the control group. Medium and high doses BDE-209 caused significant increase in plasma TBIL and IBIL when compared to the control group. However, no significant changes in TBIL or IBIL were observed in any DBDPE treated group. In the high-dose BDE209 and DBDPE exposure groups, serum levels of Glu were increased compared to the control group.
3.3. Histopathological examination The pathological changes of liver in rats after 28 days of exposure to BDE-209 or DBDPE were detected. In the control group, the liver showed a normal lobular structure with a central vein, radiating hepatic cell cords, well-preserved cytoplasm, and prominent nucleus (Fig. 3-A). In the low-dose BDE-209 group, the liver cells had mild swelling and the cytoplasm was loose and transparent (Fig. 3-B). Extensive damage of the liver was found in the groups exposed to medium- and high-dose BDE-209, such as poor lobular structure, disordered hepatic cord and hepatic sinus, and balloon-like edematous hepatocyte, accompanied by feathery necrosis in which the cytoplasm was loose and transparent and the nucleus disappeared, with large lipid droplets in the cytoplasm
Fig. 2. The changes of blood biochemistry of rats after being exposed to BDE-209 and DBDPE (mean ± SEM; n = 8). (*) p b .05 and (**) p b .01 compared to the control group. (#) p b .05 compared to the same dose group.
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx
5
Fig. 3. The histological change in rat's liver after exposed to BDE-209 and DBDPE for 28 oral days (HE, ×400). (A) represent control group; (B–D) represent BDE-209 treated groups in dose of 5, 50, and 500 mg/kg bw/day; (E–G) represent DBDPE treated groups in dose of 5, 50, and 500 mg/kg bw/day. Yellow arrows indicate feathery necrosis, black arrows indicate lipid droplets, and blue arrows indicate inflammatory cell infiltration. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
the medium- and high-dose BDE-209 groups. However, in the DBDPE exposed groups, SOD activity was reduced only in the high-dose group.
and inflammatory cells accumulated around the portal vein infiltration These changes were also found to be more severe in high-dose BDE209 group (Fig. 3-C and 3-D). No obvious pathological changes were found in the livers of the group exposed to low-dose DBDPE (Fig. 3-E). In the medium-dose DBDPE group, the liver showed feathery necrosis. Meanwhile, we found that high DBDPE exposure (500 mg/kg bw/day) caused obvious pathological changes in the form of irregular arrangement of hepatic cords, feathery necrosis, and inflammatory cell infiltration (Fig. 3-F and 3-G). However, these pathological changes were less severe than those in high-dose BDE-209 group.
The two most common inflammatory cytokines (TNF-α and IL-6) were tested in this study (Fig. 5). Compared to control group, medium and high doses of BDE-209 exposure result in a rise in TNF-α and IL-6 levels. However, no significant changes of TNF-α and IL-6 levels were found in all DBDPE exposure groups.
3.4. Parameters of oxidative stress
3.6. mRNA expression levels of certain enzymes
In this study, we examined the MDA, GSH content, and SOD activity in rat livers. As shown in Fig. 4. Compared to control group, mediumand high-dose BDE-209 and DBDPE groups significantly increased the liver MDA levels, and these changes in BDE-209 exposure rats were significantly higher than those of the DBDPE-exposed rats. Although an increase in GSH in the medium dose DBDPE exposure group was observed, GSH levels showed no significant changes in the other groups. SOD activities in the liver were markedly decreased in
Effects of BDE-209 and DBDPE exposure on the relative mRNA expression of CYP3A1, CYP3A2, CAR, and PXR in rat liver are shown in Fig. 6. BDE-209 or DBDPE exposures significantly downregulated CAR and PXR in medium and high dose groups compare to control rats. Notably, in high dose groups, the expression levels of CAR in BDE-209 exposure rats were significantly lower than those in DBDPE exposure rats. Moreover, the relative expression levels of CYP3A1 mRNA decreased in all the BDE-209 and DBDPE exposure groups, and statistical
3.5. Levels of TNF-α and IL-6 in the liver
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
6
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx
Fig. 4. Effects of BDE-209 and DBDPE on content of MDA, GSH and activity of SOD in liver tissue (mean ± SEM; n = 5). (*) p b .05 and (**) p b .01 compared to the control group. (#) p b .05 and (##) p b .01 compared to the same dose group.
differences were also found. Meanwhile, the relative expression levels of CYP3A2 mRNA also decreased in the medium- and high-dose BDE209 groups. However, in the DBDPE treated groups, CYP3A2 mRNA expression levels were significantly lower only in the high-dose group when compared with the control group. 4. Discussion DBDPE, as an alternative to BDE-209, has similar physiochemical properties to BDE-209, and increasing attention has been paid to its adverse health effects. The extensive use of DBDPE may lead to a rapid increase in the level of DBDPE in various matrices. Studies have shown that the liver is a main target organ for the accumulation and exposure of BFRs (Fujimoto et al., 2011; Li et al., 2011; Noyes et al., 2011), and BDE-209 and DBDPE are mainly metabolized by the liver after entering the body. Liver is the target organ for heterogeneous metabolism. It can
transform many nonnutrients from the inside and outside through various biochemical reactions, completely decompose them, or excrete them in their original form to protect the body from damage. A rat model showed that the concentrations of BDE-209 were highest in liver whereas the concentrations of DBDPE were highest in adipose after oral exposure of BDE-209 or DBDPE for 90 days (Wang et al., 2010). This is an indication that the toxicokinetic properties and tissue distribution of the two compounds are different (Sarkar and Singh, 2017). However, current understanding of the hepatotoxic effects of DBDPE is very limited, and a comparison between the hepatotoxic effects of DBDPE and BDE-209 has not been reported. The main objective of the present study was to investigate the hepatotoxic effects of SD rats after 28 days of DBDPE or BDE-209 exposure, and a comparison between the results of DBDPE and BDE-209 was also our purpose. It has been suggested that BDE-209 significantly increased the liver weight and organ coefficient of rats (Lee et al., 2010). Similarly,
Fig. 5. Effects of BDE-209 and DBDPE on the levels of TNF-α and IL-6 in the liver (mean ± SEM; n = 4). (*) p b .05 and (**) p b .01 compared to the control group.
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx
7
Fig. 6. Relative liver mRNA expression of CAR, PXR, CYP3A1 and CYP3A2 from control and BDE-209-exposed or DBDPE-exposed rats (mean ± SEM; n = 4). (*) p b .05 and (**) p b .01 compared to the control group. (#) p b .05 compared to the same dose group.
in our study, we found that the rats showed a significant increase in liver weight and ratio of liver/body weight at high-dose BDE-209 group, and the ratio of liver/body weight also increased in the medium-dose BDE209 group. However, no significant changes were observed in liver weight or in the ratio of liver/body weight in the DBDPE exposures groups. These results indicated that medium and high doses of BDE209 exposure could cause overt toxicity, whereas DBDPE had no effect. However, a former study found that 200 mg/kg bw/day DBDPE exposure could cause a significant increase in liver weight of mice, but this may be caused by species differences (Sun et al., 2018). To further explore hepatotoxic effects induced by DBDPE or BDE-209, we measured the histopathology of liver and found that all three doses of BDE-209 and medium and high doses of DBDPE could lead to changes in liver histopathology. Moreover, the liver histopathology changes were more severe in BDE-209 groups than those in DBDPE groups. Furthermore, we tested a series of biochemical markers of liver damage and function, such as TP, A/G, AST, ALT, ALB, DBIL, TBIL, IBIL, LDH and GGT in serum. The elevation in the serum levels of these markers has been attributed to damage to the structural integrity of the cellular membrane and impairment of the hepatobiliary duct apparatus. In the present study, except for GGT, TBIL, and IBIL, BDE-209 and DBDPE had no effects on other biochemical parameters (data not shown). Our results showed that in medium- and high-dose groups, both BDE-209 and DBDPE could lead to a significant increase in GGT, and BDE-209 could also increase serum IBIL and TBIL levels, indicating hepatotoxicity with severe damage to hepatic tissue membranes. These results were in agreement with the results of liver histopathology changes. The liver is known to be the most important organ in glycolipid metabolism, and liver damage can cause metabolic disorders of glycolipids. Some studies have shown that BDE-209 or DBDPE could disturb glucose homeostasis and elevate blood glucose (Sarkar and Singh, 2017; Sun et al., 2018). We also found that glucose concentrations increased in the serum of groups receiving high-dose BDE-209 and DBDPE. These observations suggested
that BDE-209 and DBDPE could interfere with liver function, and BDE209 may have greater effect. Oxidative stress has been linked to the toxicity of BFRs. Previous studies on thyroid and cardiovascular toxicity found that both BDE209 or DBDPE could cause an oxidative stress response in thyroid, heart, and abdominal aorta (Jing et al., 2019; Wang et al., 2019a, b). It has been found that BDE-209 could decrease SOD activity in mouse liver (Zhu et al., 2019). Feng et al. reported that both BDE-209 and DBDPE could evoke hepatic oxidative stress in Carassius auratus, as indicated by a decrease in GSH level and inhibition of the activities of the antioxidant enzymes, as well as elevation of lipid peroxidation level (Feng et al., 2013). As a lipid peroxidation end product, MDA can be used to infer oxidative damage to the body. GSH is a coenzyme of various enzymes that binds to a variety of chemicals and their metabolites and has a range of biological functions. The level of SOD activity can reflect the body's antioxidant capacity (Silvestre et al., 2006). Therefore, in this study, we selected a panel of classical oxidative stress biomarkers, including MDA, GSH, and SOD, to evaluate oxidative damage to rat liver by BDE-209 or DBDPE. The results showed that medium and high doses of BDE-209 or DBDPE exposure caused a significant increase in MDA content; furthermore, the levels of MDA in the group exposed to BDE-209 were significantly higher than those in the DBDPE exposed group. In addition, SOD activities were found to decrease in mediumand high-dose BDE-209 groups and high-dose DBDPE group. The levels of GSH were significantly increased only in the medium-dose DBDPE group. It is possible that DBDPE is less toxic and that medium dose of DBDPE exposure could induce an increase of GSH to maintain adequate oxygenation of the liver. These results indicate that both BDE-209 and DBDPE could cause oxidative damage in the liver. Compared with DBDPE, BDE-209 has more serious effects on oxidative stress. Inflammation may be one of the biological responses that reflect cumulative exposure to various stressors. Previous studies have shown that PBDEs could cause inflammatory reactions, and there was a positive
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
8
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx
correlation between PBDEs and proinflammatory cytokines such as IL-6 and TNF-α (Zota et al., 2018). BDE-209 was found to induce upregulation of Beas-2B inflammatory cytokine (IL-6, IL-8 and TNF-α mRNA) in a cell model (Zhang et al., 2018). BDE-100 and BDE-209 can also induce a significant increase in IL-6 in dolphin fibroblasts (Rajput et al., 2018). Moreover, BDE-209 exposure also significantly increased production of IL-10, TNF-α, and IL-17A in serum of male offspring (Chen et al., 2019). However, data are lacking on inflammatory factors in the liver of rats after exposure to BDE-209 or DBDPE. In this study, we detected the two most common inflammatory factors TNF-α and IL-6. The results suggested that exposure to BDE-209 could cause significant increases in TNF-α and IL-6 in the rat liver, whereas no significant change was found in DBDPE-exposed groups. This study demonstrates for the first time that BDE-209 can cause inflammatory responses in TNF-α and IL-6 in the liver, whereas DBDPE has no significant effects in this dose range. It is known that liver damage impairs hepatic metabolic capacity. Cytochrome P450 (CYP450) enzyme is one of the most important enzymes involved in the metabolism of exogenous and endogenous substances, especially known for the phase I metabolism of various xenobiotics (Zhou et al., 2003; Wang et al., 2015). Therefore, it is widely used as a biomarker of contaminants in many species (Sanchez-Hernandez et al., 2014; Lu et al., 2017). CYP3A is a member of the CYP450 family of enzymes, which exhibit higher expression in the liver and play an important role in the first-pass and systemic metabolism of many substances (Palatini et al., 2008) and are the most abundant CYPs in humans (Ghosal et al., 1996). Moreover, CYP3A1 and CYP3A2 are considered to be the most important CYP3A isoforms in male rats (Jan et al., 2006). It has been suggested that BFRs could change CYP450 enzyme expression (Wang et al., 2006; Uno et al., 2012). A former study reported that when biotransformations of DBDPE and BDE-209 in rats were studied, increased expression of CYP3A2 in the liver of 100 mg/kg bw/day DBDPE-treated rats was observed (Wang et al., 2010). However, another study found that DBDPE could not change the expression of CYP3A in the mouse (Sun et al., 2018). To confirm the effects of BDE-209 and DBDPE on the expression of CYP3A, our study detected the expression levels of CYP3A, PXR and CAR in rat livers after BDE-209 and DBDPE exposure. PXR and CAR are nuclear receptors, which control the expression of CYP3A enzymes (Gabbia et al., 2017). Based on results in our study, it can be seen that both BDE-209 and DBDPE could downregulated PXR, CAR and CYP3A. Former studies have proved that both oxidative stress and inflammation play important roles in regulating the expression of CYP450 (Morgan, 1997; Siewert et al., 2000). Studies have found that acute inflammation, including IL-6 and TNF-α, could cause PXR and CAR inhibition and contribute to CYP3A suppression (Gahrs et al., 2013; Zeng et al., 2019). Oxidative stress can indirectly affect the expression of CYP450 mRNA by affecting the expression of nuclear receptors (Kakehashi et al., 2013). Therefore, it was assumed that inflammation, increased oxidative stress, and decrement of PXR and CAR downgraded the expression of CYP3A mRNA in BDE-209 and DBDPE treated groups. In the present study, we noticed that the mRNA expression of PXR and CAR was decreased only in the groups exposed to medium and high doses BDE209 and DBDPE. Moreover, inflammation and oxidative stress were exacerbated only in rats treated with the medium and high doses of BDE209 or DBDPE. However, the mRNA expression of CYP3A1 was found to decrease even in the low dose of BDE-209 and DBDPE exposure rats. This is an indication that other factors likely contribute to the regulation of CYP3A, and further studies are required. 5. Conclusion In summary, this is the first study to compare the hepatotoxicity induced by BDE-209 and DBDPE. Our results showed that no significant liver toxicity was observed at relatively low dose comparable with the human exposure levels, however, more severe liver toxicity occurred
under relatively high BDE-209 and DBDPE exposure. BDE-209 and DBDPE could impair liver structure and function and induce oxidative stress and inflammation, inhibiting PXR and CAR expression and contributing to CYP3A suppression and impaired hepatic metabolic capacity. And BDE-209 and DBDPE may interfere metabolism in rats through oxidative stress and inflammation. Moreover, our finding indicated that liver damage caused by BDE-209 was more serious than that caused by DBDPE. In addition, hepatotoxicity may be induced by different mechanisms. In future studies, more attention should be paid to the specific toxic mechanism of DBDPE to determine whether DBDPE is a suitable replacement for BDE-209. Declaration of competing interest The authors have no conflict of interest to declare. Acknowledgements The present research was funded by the National Natural Science Foundation of China (21777107, 21477083, 81703198, 21537001, 31770441), the National Key Research and Development Program of China (2017YFC1600500), and Joint funding of Beijing Natural Science Foundation and Beijing Education Commission (KZ201910025037). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi. org/10.1016/j.scitotenv.2019.135783. References Birnbaum, L.S., Staskal, D.F., 2004. Brominated flame retardants: cause for concern? Environ. Health Perspect. 112, 9–17. Chen, Y., Liu, S., Xu, H., Zheng, H., Bai, C., Pan, W., 2019. Maternal exposure to low dose BDE209 and Pb mixture induced neurobehavioral anomalies in C57BL/6 male offspring. Toxicology 418, 70–80. Feng, M., Li, Y., Qu, R., Wang, L., Wang, Z., 2013. Oxidative stress biomarkers in freshwater fish Carassius auratus exposed to decabromodiphenyl ether and ethane, or their mixture. Ecotoxicology 22, 1101–1110. Fonnum, F., Mariussen, E., 2009. Mechanisms involved in the neurotoxic effects of environmental toxicants such as polychlorinated biphenyls and brominated flame retardants. J. Neurochem. 111, 1327–1347. Fromme, H., Becher, G., Hilger, B., Volkel, W., 2016. Brominated flame retardants - exposure and risk assessment for the general population. Int. J. Hyg. Environ. Health 219, 1–23. Fujimoto, H., Woo, G.H., Inoue, K., Takahashi, M., Hirose, M., Nishikawa, A., 2011. Impaired oligodendroglial development by decabromodiphenyl ether in rat offspring after maternal exposure from mid-gestation through lactation. Reprod. Toxicol. 31, 86–94. Gabbia, D., Pozza, A.D., Albertoni, L., Lazzari, R., Zigiotto, G., Carrara, M., 2017. Pregnane X receptor and constitutive androstane receptor modulate differently CYP3A-mediated metabolism in early- and late-stage cholestasis. World J. Gastroenterol. 23, 7519–7530. Gahrs, M., Roos, R., Andersson, P.L., Schrenk, D., 2013. Role of the nuclear xenobiotic receptors CAR and PXR in induction of cytochromes P450 by non-dioxinlike polychlorinated biphenyls in cultured rat hepatocytes. Toxicol. Appl. Pharmacol. 272, 77–85. Ghosal, A., Satoh, H., Thomas, P.E., Bush, E., Moore, D., 1996. Inhibition and kinetics of cytochrome P4503A activity in microsomes from rat, human, and cdna-expressed human cytochrome P450. Drug Metab. Dispos. 24, 940–947. Gill, U., Chu, I., Ryan, J.J., Feeley, M., 2004. Polybrominated diphenyl ethers: human tissue levels and toxicology. Rev. Environ. Contam. Toxicol. 183, 55–97. Goodman, J.E., 2009. Neurodevelopmental effects of decabromodiphenyl ether (BDE-209) and implications for the reference dose. Regul. Toxicol. Pharmacol. 54, 91–104. Hardy, M.L., 2002. A comparison of the properties of the major commercial PBDPO/PBDE product to those of major PBB and PCB products. Chemosphere 46, 717–728. Jan, Y.H., Mishin, V., Busch, C.M., Thomas, P.E., 2006. Generation of specific antibodies and their use to characterize sex differences in four rat P450 3A enzymes following vehicle and pregnenolone 16alpha-carbonitrile treatment. Arch. Biochem. Biophys. 446, 101–110. Jing, L., Sun, Y., Wang, Y., Liang, B., Chen, T., Zheng, D., 2019. Cardiovascular toxicity of decabrominated diphenyl ethers (BDE-209) and decabromodiphenyl ethane (DBDPE) in rats. Chemosphere 223, 675–685. Kakehashi, A., Hagiwara, A., Imai, N., Nagano, K., Nishimaki, F., Banton, M., 2013. Mode of action of ethyl tertiary-butyl ether hepatotumorigenicity in the rat: evidence for a role of oxidative stress via activation of CAR, PXR and PPAR signaling pathways. Toxicol. Appl. Pharmacol. 273, 390–400.
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783
Y. Sun et al. / Science of the Total Environment xxx (xxxx) xxx Lee, E., Kim, T.H., Choi, J.S., Nabanata, P., Kim, N.Y., Ahn, M.Y., 2010. Evaluation of liver and thyroid toxicity in Sprague-Dawley rats after exposure to polybrominated diphenyl ether BDE-209. J. Toxicol. Sci. 35, 535–545. Li, J., Liang, Y., Zhang, X., Lu, J., Zhang, J., Ruan, T., 2011. Impaired gas bladder inflation in zebrafish exposed to a novel heterocyclic brominated flame retardant tris(2,3dibromopropyl) isocyanurate. Environ. Sci. Technol. 45, 9750–9757. Liang, S., Xu, F., Tang, W., Zhang, Z., Zhang, W., Liu, L., 2016. Brominated flame retardants in the hair and serum samples from an e-waste recycling area in southeastern China: the possibility of using hair for biomonitoring. Environ. Sci. Pollut. Res. Int. 23, 14889–14897. Lu, X., Li, Y., Thunders, M., Cavanagh, J., Matthew, C., Wang, X., 2017. Differential protein expression and localization of CYP450 enzymes in three species of earthworm; is this a reflection of environmental adaptation? Chemosphere 171, 485–490. Lyche, J.L., Rosseland, C., Berge, G., Polder, A., 2015. Human health risk associated with brominated flame-retardants (BFRs). Environ. Int. 74, 170–180. Morgan, E.T., 1997. Regulation of cytochromes P450 during inflammation and infection. Drug Metab. Rev. 29, 1129–1188. Nadjia, L., Abdelkader, E., Ulrich, M., Bekka, A., 2014. Spectroscopic behavior of saytex 8010 under UV-visible light and comparative thermal study with some flame bromine retardant. J. Photoch. Photobio. A 275, 96–102. Noyes, P.D., Hinton, D.E., Stapleton, H.M., 2011. Accumulation and debromination of decabromodiphenyl ether (BDE-209) in juvenile fathead minnows (Pimephales promelas) induces thyroid disruption and liver alterations. Toxicol. Sci. 122, 265–274. Palatini, P., De Martin, S., Pegoraro, P., Orlando, R., 2008. Enzyme inhibition and induction in liver disease. Curr. Clin. Pharmacol. 3, 56–69. Rajput, I.R., Xiao, Z., Yajing, S., Yaqoob, S., Sanganyado, E., Ying, H., 2018. Establishment of pantropic spotted dolphin (Stenella attenuata) fibroblast cell line and potential influence of polybrominated diphenyl ethers (PBDEs) on cytokines response. Aquat. Toxicol. 203, 1–9. Sanchez-Hernandez, J.C., Narvaez, C., Sabat, P., Martinez Mocillo, S., 2014. Integrated biomarker analysis of chlorpyrifos metabolism and toxicity in the earthworm Aporrectodea caliginosa. Sci. Total Environ. 490, 445–455. Sarkar, D., Singh, S.K., 2017. Maternal exposure to polybrominated diphenyl ether (BDE209) during lactation affects germ cell survival with altered testicular glucose homeostasis and oxidative status through down-regulation of Cx43 and p27Kip1 in prepubertal mice offspring. Toxicology 386, 103–119. Shi, Z., Zhang, L., Li, J., Zhao, Y., Sun, Z., Zhou, X., 2016. Novel brominated flame retardants in food composites and human milk from the Chinese Total diet study in 2011: concentrations and a dietary exposure assessment. Environ. Int. 96, 82–90. Shi, Z., Zhang, L., Li, J., Wu, Y., 2018. Legacy and emerging brominated flame retardants in China: a review on food and human milk contamination, human dietary exposure and risk assessment. Chemosphere 198, 522–536. Siewert, E., Bort, R., Kluge, R., Heinrich, P.C., Castell, J., Jover, R., 2000. Hepatic cytochrome P450 down-regulation during aseptic inflammation in the mouse is interleukin 6 dependent. Hepatology 32, 49–55. Silvestre, F., Dierick, J.F., Dumont, V., Dieu, M., Raes, M., Devos, P., 2006. Differential protein expression profiles in anterior gills of Eriocheir sinensis during acclimation to cadmium. Aquat. Toxicol. 76, 46–58.
9
Sun, R.B., Shang, S., Zhang, W., Lin, B.C., Wang, Q., Shi, Y., 2018. Endocrine disruption activity of 30-day dietary exposure to Decabromodiphenyl ethane in Balb/C mouse. Biomed. Environ. Sci. 31, 12–22. Tseng, L.H., Lee, C.W., Pan, M.H., Tsai, S.S., Li, M.H., Chen, J.R., 2006. Postnatal exposure of the male mouse to 2,2′,3,3′,4,4′,5,5′,6,6′-decabrominated diphenyl ether: decreased epididymal sperm functions without alterations in DNA content and histology in testis. Toxicology 224, 33–43. Tseng, L.H., Li, M.H., Tsai, S.S., Lee, C.W., Pan, M.H., Yao, W.J., 2008. Developmental exposure to decabromodiphenyl ether (PBDE 209): effects on thyroid hormone and hepatic enzyme activity in male mouse offspring. Chemosphere 70, 640–647. Uno, T., Ishizuka, M., Itakura, T., 2012. Cytochrome P450 (CYP) in fish. Environ. Toxicol. Pharmacol. 34, 1–13. Wang, D., Chen, T., Fu, Z., Yang, L., Li, R., Sui, S., Wang, Y., Shi, Z., 2019a. Occupational exposure to polybrominated diphenyl ethers or decabromodiphenyl ethane during chemical manufacturing: occurrence and health risk assessment. Chemosphere 231, 385–392. Wang, F., Wang, J., Dai, J., Hu, G., Wang, J., Luo, X., 2010. Comparative tissue distribution, biotransformation and associated biological effects by decabromodiphenyl ethane and decabrominated diphenyl ether in male rats after a 90-day oral exposure study. Environ. Sci. Technol. 44, 5655–5660. Wang, L., Scheffler, B.E., Willett, K.L., 2006. CYP1C1 messenger RNA expression is inducible by benzo[a]pyrene in Fundulus heteroclitus embryos and adults. Toxicol. Sci. 93, 331–340. Wang, Y., Wu, S., Chen, Z., Zhang, H., Zhao, W., 2015. Inhibitory effects of cytochrome P450 enzymes CYP1A2, CYP2A6, CYP2E1 and CYP3A4 by extracts and alkaloids of Gelsemium elegans roots. J. Ethnopharmacol. 166, 66–73. Wang, Y., Chen, T., Sun, Y., Zhao, X., Zheng, D., Jing, L., 2019b. A comparison of the thyroid disruption induced by decabrominated diphenyl ethers (BDE-209) and decabromodiphenyl ethane (DBDPE) in rats. Ecotoxicol. Environ. Saf. 174, 224–235. Zeng, H., Lin, Y., Gong, J., Lin, S., Gao, J., Li, C., 2019. CYP3A suppression during diet-induced nonalcoholic fatty liver disease is independent of PXR regulation. Chem. Biol. Interact. 308, 185–193. Zhang, Y., Mao, P., Li, G., Hu, J., Yu, Y., An, T., 2018. Delineation of 3D dose-time-toxicity in human pulmonary epithelial Beas-2B cells induced by decabromodiphenyl ether (BDE209). Environ. Pollut. 243, 661–669. Zhou, S., Gao, Y., Jiang, W., Huang, M., Xu, A., Paxton, J.W., 2003. Interactions of herbs with cytochrome P450. Drug Metab. Rev. 35, 35–98. Zhu, Y., Li, X., Liu, J., Zhou, G., Yu, Y., Jing, L., 2019. The effects of decabromodiphenyl ether on glycolipid metabolism and related signaling pathways in mice. Chemosphere 222, 849–855. Zota, A.R., Geller, R.J., Romano, L.E., Coleman-Phox, K., Adler, N.E., Parry, E., 2018. Association between persistent endocrine-disrupting chemicals (PBDEs, OH-PBDEs, PCBs, and PFASs) and biomarkers of inflammation and cellular aging during pregnancy and postpartum. Environ. Int. 115, 9–20.
Please cite this article as: Y. Sun, Y. Wang, B. Liang, et al., Hepatotoxicity of decabromodiphenyl ethane (DBDPE) and decabromodiphenyl ether (BDE-209) in 28-day e..., Science of the Total Environment, https://doi.org/10.1016/j.scitotenv.2019.135783