- Email: [email protected]
Hereditary breast cancer associated with a germline BRCA2 mutation in identical female twins with similar disease expression
Cancer Genetics and Cytogenetics 133 (2002) 24–28
Hereditary breast cancer associated with a germline BRCA2 mutation in identical female twins with similar disease expression Lucía Delgadoa,b,*, Graciela Fernándezb, Andrés Gonzálezb, Brigitte Bressac-de Pailleretsc, Gabriela Gualcod, Johny Bombledd, Sandra Cataldia, Graciela Sabinia, Ricardo Rocab, Ignacio M. Muséa a
Servicio de Oncología Clínica, Hospital de Clínicas, Universidad de la República, Avda. Italia s/n, Montevideo, Uruguay b Departamento Básico de Medicina, Hospital de Clínicas, Universidad de la República, Montevideo, Uruguay c Service de Génétique, Institut Gustave Roussy, Villejuif, France d Departamento de Anatomía Patológica, Hospital de Clínicas, Universidad de la República, Montevideo, Uruguay Received 18 April 2001; received in revised form 21 June 2001; accepted 26 June 2001
Abstract
The relative contribution of heritable and nonheritable factors to disease expression in BRCA2 mutation carriers is largely unknown. This report describes a familial breast cancer syndrome in a pair of identical female twins. These twins showed an extremely high concordance in their clinical histories; both twins exhibited similar cancer-related risk factors, and developed breast cancer at the same age with the same disease stage and identical histological features. No differences were detected in hormone receptors status, p53, bcl-2, erbB-2 and LI Ki67 expression by immunohistochemistry. A BRCA2 exon 11 protein truncation test showed a lower molecular weight band than the one expected for a normal allele, in both twins. Sequence analysis of DNA showed a 6 bp insertion between nucleotides 4359-4360, which resulted in a premature stop codon at position 1378. The remarkable disease similarity observed in this identical twin pair is in accordance with an important role for heritable factors in disease expression among patients carrying BRCA germline mutations. © 2002 Elsevier Science Inc. All rights reserved.
1. Introduction
2. Case report
Germline mutations in BRCA2 gene are estimated to account for approximately 10–30% of breast cancers developed in the context of autosomal dominant inheritance [1–5]. These mutations are also associated with an increased risk of developing another cancers, in particular ovarian cancer [1,5]. Women carrying a BRCA2 mutation have a lifetime risk of 50–85% and 10–20% for developing breast cancer and ovarian cancer respectively [1,3,6]. The relative contribution of heritable and non-heritable factors to disease penetrance and expression in individuals with constitutional BRCA2 mutations remains to be determined. This report describes a familial breast cancer syndrome in an identical female twin pair. Hereditary factors and other risk factors that could be associated with disease expression are discussed.
Two premenopausal 46-year-old women, identical twins of Italian ancestry, both of whom developed breast cancer, were referred for genetic risk evaluation to the Department of Clinical Oncology at the Clinical Hospital of the University of Uruguay. Zygosity determination was based on the independent answers of each twin and their mother to questions on similarity and confusion in childhood using a validated questionnaire [7]. These patients showed a history of familial breast cancer (Fig. 1). Both twins (patients A and B) developed breast cancer at age 39 and have relatives affected with breast cancer in the paternal branch of the family. Neither the twins nor their relatives developed ovarian cancer or other malignancies. Complete clinical reports of the twins and their affected cousin confirming breast cancer diagnosis were obtained. It was not possible to recover the reports of the paternal grandmother and her sister. The main characteristics of the clinical history of the twins are shown in Table 1. Hematoxylin-eosin sections
* Corresponding author. Tel.: 598-2-487-20-75; fax: 598-2-48720-75. E-mail address: [email protected] (L. Delgado).
0165-4608/02/$ – see front matter © 2002 Elsevier Science Inc. All rights reserved. PII: S0165-4608(01)00 5 4 1 - 6
L. Delgado et al. / Cancer Genetics and Cytogenetics 133 (2002) 24–28
25
Fig. 1. Pedigree of the family studied.
were reviewed by the same pathologist (GG). Besides the relevant data exhibited in Table 1, it is also important to point out that they lived together until their midtwenties, their diets and weights were similar and there was no known shared exposure to carcinogens. Once they were diagnosed with breast cancer they both received the same treatment, consisting in conservative surgery and identical adjuvant therapy. After six years of follow-up, they are disease free.
3. Materials and methods 3.1. Informed consent Clinical information, pathology reports, tumor pathology slides, tumor paraffin blocks for immunohistochemistry and blood samples for genetic studies were obtained with the written informed consent of patients and under the approval of the Clinical Hospital Ethics Committee.
Table 1 Main characteristics of the clinical histories of the twins Characteristic
Patient A
Patient B
Age at diagnosis (years) Topography of breast cancer Histopathological type Histological gradea Glandular nontumoral tissue Stage at diagnosis (TNM) Size of primary tumor (mm) Axillary nodal status Other tumors Age of first menstrual period Number of children Age at first full term pregnancy (years) Oral contraceptive pill use (years)
39 Left breast, UOQ DIC NOS; DCIS 20% III Nonproliferative changes IIA 10 Positive (4/13) None 13 2 (females) 29 9
39 Left breast, UOQ DIC NOS; DCIS 20% III Nonproliferative changes IIA 20 Positive (4/8) None 13 2 (females) 33 10
Abbreviations: DCIS, ductal carcinoma in situ; DIC NOS, ductal infiltrating carcinoma not otherwise specified; TNM, tumor-nodes-metastisis; UOQ, upper outer quadrant. a Nottingham modification of the Bloom-Richardson grading system.
26
L. Delgado et al. / Cancer Genetics and Cytogenetics 133 (2002) 24–28
3.2. Patients’ material Blood for molecular studies was obtained only from both twins and the daughters of patient A. Patient B did not give her consent for her daughters’ genetic testing. In addition, the twins’ father and his parents were dead and other paternal relatives were unavailable for this study. We could only obtain tumor pathology slides and tumor paraffin blocks from the twins. 3.3. DNA isolation Blood samples were treated with red blood cells lysis solution (Tris 10mM pH7.6, NaCl 9.9 mM, MgCl2 5mM), centrifuged, and the white blood cells pellet was lysed with white blood cells lysis solution (Tris 10 mM pH 7.6, NaCl 50 mM, EDTA 100 mM, SDS 0.2%). After enzymatic treatment with RNAse and Proteinase K (50 g/ml final concentration, each) DNA purification, precipitation and quantification was performed as previously described [8]. DNA quality was assesed by agarose gel electrophoresis. 3.4. BRCA2 exon 11 protein truncation test Exon 11 of BRCA2 was amplified by PCR as four overlapping fragments from genomic DNA with the primers reported by Serova et al. [9]. Each protein truncation test (PTT) forward primer included a sequence consisting of the T7 promoter and an eukariotic consensus-translation-initiation site at the 5 end: 5GGATCCTAATACGACTCACT ATAGGAACAGACCACCATG3. PCR was performed as follows: an initial denaturation step at 94C for 4 min followed by 30 cycles at 94C for 1 min, 55C 1 min and 72C for 4 min. Final extension consisted in 5 min at 72C. Polymerase chain reactions (PCR) were performed in a final volume of 10 l with 400 ng of genomic DNA, 200 M dNTPs, 0.4 M of each primer and 0.75 units of Taq DNA polymerase (Promega). After amplification, PCR products were analysed by electrophoresis on 1% agarose gel. PTT was performed by adding 2 l of PCR product directly to TNT/T7 coupled Reticulocyte Lysate System (Promega) following manufacturer’s instructions. 35S Methionine (Amersham) was used as radiolabeled aminoacid for protein detection. An aliquot (3 l) of the translation product was separated in 12% polyacrylamide minigels at constant 120V. After electrophoresis the gels were fixed, soaked in Amplify (Amersham), dried and exposed for autoradiography. 3.5. Sequencing PCR products that presented abnormal PTT patterns were analyzed by direct sequencing. Primers for PCR and sequencing were BRCA2 11-9 F (5-GATGGCAGTGAT TCAAGTAAA-3) and BRCA2 11-9R (5-AAATGACTC TTTGGCGACAC-3). PCR products were purified with Sephacryl™ S-400 (Amersham Pharmacia Biotech). Sequencing reactions were performed with the BigDye™ Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems) following manufacturer’s instructions. Products
Table 2 Primary antibodies used for immunohistochemical analysis and experimental conditions Incub. time Antibodies to Clones Manufacturers AG retrievala Dilution (4C) PR p53 Ki67 ER c-erbB-2 bcl-2
1A6 DO7 MIB-1 1D5 CB11 100
Immunotech Dako Immunotech Immunotech Biogenex Biogenex
20 minutes 20 minutes 20 minutes 20 minutes 30 minutes 30 minutes
1/50 1/50 1/100 1/50 1/20 1/200
Overnight Overnight Overnight Overnight Overnight Overnight
Abbreviations: ER, estrogen receptor; PR, progesterone receptor. a Microwave in citrate buffer 10 mM, ph 6.
were purified on Sephadex™ G-50 (Amersham Pharmacia Biotech), loaded on an EllioSeq gel (Ellios Biomedia) and ran on an automated 377 sequencer (PE Applied Biosystems). 3.6. Immunohistochemical analysis Immunostaining was performed on histological sections on sylane pretreated slides. The LSAB detection system (DAKO) was used for all analyzed antibodies (Ab). We used diamino-benzidine as chromogen. The sections were counterstained in hematoxylin. Before the incubation with the primary Ab, antigen retrieval was performed according to a HIER method described previously [10]. Primary Ab used are shown in Table 2. Pertinent controls were tested simultaneously and reacted appropriately. Technical control consisted of the omission of primary Ab. Criteria used to classify a tumor as positive or negative for each antigen were as follows: tumor cells were considered positive for Ki67 only when there was a clear nuclear staining. The number of positively stained tumor cells per 500 tumor cells, in the invasive portion of the tumor, was counted. The percentage of positively stained cells was recorded as Ki67 LI (labeling index). A high proliferative rate was an LI of 15% or more. For bcl-2, tumors were considered positive if more than 10% of cells showed positive cytoplasmic staining. p53 expression was assessed by the percentage of positive tumor cell nuclei in 500 tumor cells. The same cut-off for bcl-2 (above 10%) was used for p53, based on prior studies [11]. Cases exhibiting distinct and complete membrane staining in 10% or more tumor cells were identified as positive for c-erbB-2 protein overexpression. Estrogen and progesterone receptor status was evaluated on the percentage of malignant cells with positive nuclear staining and on staining intensity graded as low (), moderate () and intense (). Less than 10% of stained cells were considered negative. 4. Results 4.1. BRCA2 analysis PTT analysis of BRCA2 exon 11 performed on DNA from both twins showed a truncated band when PCR prod-
L. Delgado et al. / Cancer Genetics and Cytogenetics 133 (2002) 24–28
27
Table 3 Ki67, p53, c-erbB-2, bcl-2, ER and PR immunostaining results Ki67 LI p53 c-erbB-2 bcl-2 ER PR
Patient A
Patient B
39 16 Negative Positive (intense) Positive () Negative
38.6 20.2 Negative Positive (intense) Positive () Negative
Abbreviations: ER, estrogen receptor; PR, progesterone receptor.
Fig. 2. Detection of a BRCA2 truncating mutation in patients A and B (A patient A; B patient B; N normal; TB truncated band).
ucts corresponding to the second fragment of exon 11 (nucleotides 3505–5064; mRNA position) were examined (Fig. 2). Sequence analysis of this region revealed a 6 bp insertion (TGAGGA) between nucleotides 4359–4360 (Fig. 3). Of these six extra nucleotides the first triplet led to an UGA stop codon that resulted in a truncated protein of 1377 aminoacids. Patient A’s daughters PTT revealed the same truncated band (not shown). 4.2. Immunohistochemistry of breast tumors The results are shown in Table 3. The expression of all the antigens studied was nearly the same in the tumors of this twin pair. Both cases exhibited a high proliferative rate with a strong Ki 67 immunopositivity. In each tumor nuclear accumulation of p53 protein was detected in a large number of tumor cells, displaying a mean value of 16 and 20.2%. Bcl-2 expression was very intense in more than 80% of the cells. The tumors were estrogen receptor positive. Neither progesterone receptor nor c-erbB-2 showed positivity. 5. Discussion The results of this study show that this identical twin pair with similar nongenetic cancer-related risk factors are carriers of the same BRCA2 mutation in the germline and have an extremely high disease similarity.
Fig. 3. Sequence analysis of the second fragment of exon 11 revealed a 6 bp insertion between nucleotides 4359-4360. This insertion resulted in a premature UGA stop codon. Wild type and mutant sequences are shown.
The family history suggests that the BRCA2 mutation could be transmitted by the paternal branch. Since the father and his parents died and other paternal relatives are unavailable for molecular studies, we could not confirm neither the paternal transmission nor that breast cancer segregated with the mutation. Nevertheless, this mutation is deleterious since it determines the loss of approximately 60% of the protein including important functional domains such as RAD51 interaction domains, BRCT domains, and a nuclear localization sequence [12]. This mutation has been previously reported in the Breast Cancer Information Core database [13] on November 23, 1998, also in a family of Italian ancestry. Disease penetrance and expressivity in BRCA2 germline mutation carriers is variable. This inter-individual variability may depend on several factors including BRCA2 mutation type or position [5], genes at other loci [14], reproductive history and exogenous exposures [15–17]. These identical twins share the same genotype, including the same mutant BRCA2 allele and the same cancer risk modifier genes. Additionally, no significant differences in nongenetic cancerrelated risk factors existed between these twins. Also, in both sisters the major clinical, histological and immunohistochemical features are almost identical, as was previously referred. To our knowledge this is the first report of a germline BRCA2 mutation in identical twins. Few studies about disease expression in monozygotic twins with a germline BRCA1 mutation have been reported [18–20]. Miesfeldt et al. [18] studied an identical twin pair carrying a germline BRCA1 mutation who developed ovarian cancer and had very similar clinical histories. Recently, Wistuba et al. [19] reported an identical twin pair with a constitutional BRCA1 mutation showing a remarkable similarity in clinical histories, histopathological features and acquired breast cancer somatic mutations. Interestingly, they also studied 17 sporadic breast carcinomas which showed a wide range of acquired genetic alterations. These results support an important role for heritable factors in breast carcinogenesis and disease phenotype. In contrast, Diez et al. [20] reported an identical twin pair, carrying the same germline BRCA1 mutation, one of whom remained healthy while the other developed breast cancer 17 years ago and ovarian cancer later. In the present study, the identical twin pair carrying a germline BRCA2 mutation and with scarce differences in
28
L. Delgado et al. / Cancer Genetics and Cytogenetics 133 (2002) 24–28
nongenetic risk factors, showed an extremely similar disease expression. Although it is not possible to estimate the relative roles of genotype, nongenetic factors and chance from this study, the remarkable disease similarity observed is in accordance with the results obtained in the above referred studies in which a large role for hereditary factors in disease expression among patients with familial breast cancer is suggested. Acknowledgments We thank María Musto and Virginia Ortega for their support in immunohistochemical techniques and Christine Machavoine for her expert technical assistance. We thank Hugo Deneo who provided the paraffin blocks of the tumors. This work was partially supported by grants from Comisión Honoraria de Lucha Contra el Cancer (Grants numbers 83 and 102), Montevideo, Uruguay. References [1] Ford D, Easton DF, Stratton M, Narod S, Goldgar D, Devilee P, Bishop DT, Weber B, Lenoir G, Chang-Claude J, Sobol H, Teare MD, Strewing J, Arason A, Scherneck S, Peto J, Rebbeck TR, Tonin P, Neuhansen S, Barkardottir R, Eyfojrd J, Lynch H, Ponder BA, Gayther SA, Zelada-Hedman M, the Breast Cancer Linkage Consortium. Genetic heterogeneity and penetrance analysis of the BRCA1 and BRCA2 genes in breast cancer families. The Breast Cancer Linkage Consortium. Am J Hum Genet 1998;62:676–89. [2] Hakansson S, Johansson O, Johansson U, Sellberg G, Loman N, Gerdes AM, Holmberg E, Dahl N, Pandis N, Kristoffersson U, Olsson H, Borg A. Moderate frequency of BRCA1 and BRCA2 germ-line mutations in Scandinavian familial breast cancer. Am J Hum Genet 1997; 60:1068–78. [3] Schubert EL, Lee MK, Mefford HC, Argonza RH, Morrow JE, Hull J, Dann JL. BRCA2 in American families with four or more cases of breast or ovarian cancer: recurrent and novel mutations, variable expression, penetrance, and the possibility of families whose cancer is not attributable to BRCA1 or BRCA2. Am J Hum Genet 1997;60: 1031–40. [4] Abeliovich D, Kaduri L, Lerer I, Weinberg N, Amir G, Sagi M, Zlotogora J, Heching N, Peretz T. The founder mutations 185delAG and 5382insC in BRCA1 and 6174delT in BRCA2 appear in 60% of ovarian cancer and 30% of early-onset breast cancer patients among Ashkenazi women. Am J Hum Genet 1997;60:505–14. [5] Gayther SA, Mangioni J, Rusell P, Seal S, Barfoot R, Ponder BA, Stratton MR, Easton D. Variation of risks of breast and ovarian cancer associated with different germline mutations of the BRCA2 gene. Nat Genet 1997;15:103–5.
[6] Easton DF, Steele L, Fields P, Ormiston W, Averill D, Daly PA, McManus R, Neuhausen SL, Ford D, Wooster R, Cannon-Albright LA, Stratton MR, Goldgar DE. Cancer risks in two large breast cancer families linked to BRCA2 on chromosome 13q12-13. Am J Hum Genet 1997;61:120–8. [7] Sarna S, Kaprio J, Sistonen P, Koskenvuo M. (1978): Diagnosis of twin zygosity by mailed questionnaire. Hum Hered 1997;28:241–54. [8] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Press, 1989. [9] Serova OM, Mazoyer S, Puget N, Dubois V, Tonin P, Shugart YY, Goldgar D, Narod SA, Lynch HT, Lenoir GM. Mutations in BRCA1 and BRCA2 in breast cancer families: are there more breast cancersusceptibility genes? Am J Hum Genet 1997;60:486–95. [10] Shi SR, Key ME, Kalra KL. Antigen retrieval in formalin-fixed, paraffin-embedded tissues: an enhancement method for immunohistochemical staining based on microwave oven heating of tissue sections. J Histochem Cytochem 1991;39:741–8. [11] Jansen RHL, Joosten-Achjanie SR, Volovics A, Arends JW, Hupperets PS, Hillen HF, Schouten HC. Relevance of expression of bcl-2 in combination with p53 as a prognostic factor in breast cancer. Anticancer Res 1998;18:4455–62. [12] Welsch PL, Owens KN, King MC. Insights into functions of BRCA1 and BRCA2. Trends Genet 2000;16:69–74. [13] Breast Cancer Information Core database. Available at: http://www. nchgr.nih.gov:80/Intramural_research/Lab_transfer/Bic/. [14] Brunet JS, Vesprini D, Abrahamson J, Neuhansen S, Narod S. Breast Cancer Risk in BRCA1/BRCA2 carriers is modified by the CYP1A1 gene. Am J Hum Genet 1998;63:A247 [15] Kaduri L, Gibs M, Hubert A, Sagi M, Heching N, Lerer I, Uziely B, Weinberg N, Abeliovich D, Peretz T. Genetic testing of breast and ovarian cancer patients: clinical characteristics and hormonal risk modifiers. Eur J Obstet Gynecol Reprod Biol 1999;85:75–80. [16] Brunet JS, Ghadirian P, Rebbeck TR, Lerman C Garber JE, Tonin PN, Abrahamson J, Foulkes WD, Daly M, Wagner-Costales J, Godwin A, Olopade OI, Moslehi R, Liede A, Futreal PA, Weber BL, Lenoir GM, Lynch HT, Narod SA. Effect of smoking on breast cancer in carriers of mutant BRCA1 or BRCA2 genes. J Natl Cancer Inst 1998;90:761–6. [17] Narod SA, Risch H, Moslehi R, Dorum A, Neuhausen S, Olsson H, Provencher D, Radice P, Evans G, Bishop S, Brunet JS, Ponder BA. Oral contraceptives and the risk of hereditary ovarian cancer. Hereditary Ovarian Cancer Clinical Study Group. N Engl Med. 1998;339:424–8. [18] Meisfeldt S, Turner BL, Lovell MA, Cooper MR, Lescallet J, Jones SM. A novel BRCA1 mutation in an identical twin pair with similar clinical histories. Cancer Genet Cytogenet 1998;100:43–8 [19] Wistuba II, Tomlinson GE, Behrens C, Virmani A, Gerdts J, Blum JL, Minna JD, Gazdar AF.: Two identical triplet sisters carrying a germline BRCA1 gene mutation acquire very similar breast cancer somatic mutations at multiple other sites throughout the genome. Genes Chromosomes Cancer 2000;28:359–69. [20] Diez O, Brunet J, Sanz J, del Rio E, Alonso MC, Baiget M. Differences in phenotypic expression of a new BRCA1 mutation in identical twins. Lancet 1997;350:713.
Hereditary breast cancer associated with a germline BRCA2 mutation in identical female twins with similar disease expression Lucía Delgadoa,b,*, Graciela Fernándezb, Andrés Gonzálezb, Brigitte Bressac-de Pailleretsc, Gabriela Gualcod, Johny Bombledd, Sandra Cataldia, Graciela Sabinia, Ricardo Rocab, Ignacio M. Muséa a
Servicio de Oncología Clínica, Hospital de Clínicas, Universidad de la República, Avda. Italia s/n, Montevideo, Uruguay b Departamento Básico de Medicina, Hospital de Clínicas, Universidad de la República, Montevideo, Uruguay c Service de Génétique, Institut Gustave Roussy, Villejuif, France d Departamento de Anatomía Patológica, Hospital de Clínicas, Universidad de la República, Montevideo, Uruguay Received 18 April 2001; received in revised form 21 June 2001; accepted 26 June 2001
Abstract
The relative contribution of heritable and nonheritable factors to disease expression in BRCA2 mutation carriers is largely unknown. This report describes a familial breast cancer syndrome in a pair of identical female twins. These twins showed an extremely high concordance in their clinical histories; both twins exhibited similar cancer-related risk factors, and developed breast cancer at the same age with the same disease stage and identical histological features. No differences were detected in hormone receptors status, p53, bcl-2, erbB-2 and LI Ki67 expression by immunohistochemistry. A BRCA2 exon 11 protein truncation test showed a lower molecular weight band than the one expected for a normal allele, in both twins. Sequence analysis of DNA showed a 6 bp insertion between nucleotides 4359-4360, which resulted in a premature stop codon at position 1378. The remarkable disease similarity observed in this identical twin pair is in accordance with an important role for heritable factors in disease expression among patients carrying BRCA germline mutations. © 2002 Elsevier Science Inc. All rights reserved.
1. Introduction
2. Case report
Germline mutations in BRCA2 gene are estimated to account for approximately 10–30% of breast cancers developed in the context of autosomal dominant inheritance [1–5]. These mutations are also associated with an increased risk of developing another cancers, in particular ovarian cancer [1,5]. Women carrying a BRCA2 mutation have a lifetime risk of 50–85% and 10–20% for developing breast cancer and ovarian cancer respectively [1,3,6]. The relative contribution of heritable and non-heritable factors to disease penetrance and expression in individuals with constitutional BRCA2 mutations remains to be determined. This report describes a familial breast cancer syndrome in an identical female twin pair. Hereditary factors and other risk factors that could be associated with disease expression are discussed.
Two premenopausal 46-year-old women, identical twins of Italian ancestry, both of whom developed breast cancer, were referred for genetic risk evaluation to the Department of Clinical Oncology at the Clinical Hospital of the University of Uruguay. Zygosity determination was based on the independent answers of each twin and their mother to questions on similarity and confusion in childhood using a validated questionnaire [7]. These patients showed a history of familial breast cancer (Fig. 1). Both twins (patients A and B) developed breast cancer at age 39 and have relatives affected with breast cancer in the paternal branch of the family. Neither the twins nor their relatives developed ovarian cancer or other malignancies. Complete clinical reports of the twins and their affected cousin confirming breast cancer diagnosis were obtained. It was not possible to recover the reports of the paternal grandmother and her sister. The main characteristics of the clinical history of the twins are shown in Table 1. Hematoxylin-eosin sections
* Corresponding author. Tel.: 598-2-487-20-75; fax: 598-2-48720-75. E-mail address: [email protected] (L. Delgado).
0165-4608/02/$ – see front matter © 2002 Elsevier Science Inc. All rights reserved. PII: S0165-4608(01)00 5 4 1 - 6
L. Delgado et al. / Cancer Genetics and Cytogenetics 133 (2002) 24–28
25
Fig. 1. Pedigree of the family studied.
were reviewed by the same pathologist (GG). Besides the relevant data exhibited in Table 1, it is also important to point out that they lived together until their midtwenties, their diets and weights were similar and there was no known shared exposure to carcinogens. Once they were diagnosed with breast cancer they both received the same treatment, consisting in conservative surgery and identical adjuvant therapy. After six years of follow-up, they are disease free.
3. Materials and methods 3.1. Informed consent Clinical information, pathology reports, tumor pathology slides, tumor paraffin blocks for immunohistochemistry and blood samples for genetic studies were obtained with the written informed consent of patients and under the approval of the Clinical Hospital Ethics Committee.
Table 1 Main characteristics of the clinical histories of the twins Characteristic
Patient A
Patient B
Age at diagnosis (years) Topography of breast cancer Histopathological type Histological gradea Glandular nontumoral tissue Stage at diagnosis (TNM) Size of primary tumor (mm) Axillary nodal status Other tumors Age of first menstrual period Number of children Age at first full term pregnancy (years) Oral contraceptive pill use (years)
39 Left breast, UOQ DIC NOS; DCIS 20% III Nonproliferative changes IIA 10 Positive (4/13) None 13 2 (females) 29 9
39 Left breast, UOQ DIC NOS; DCIS 20% III Nonproliferative changes IIA 20 Positive (4/8) None 13 2 (females) 33 10
Abbreviations: DCIS, ductal carcinoma in situ; DIC NOS, ductal infiltrating carcinoma not otherwise specified; TNM, tumor-nodes-metastisis; UOQ, upper outer quadrant. a Nottingham modification of the Bloom-Richardson grading system.
26
L. Delgado et al. / Cancer Genetics and Cytogenetics 133 (2002) 24–28
3.2. Patients’ material Blood for molecular studies was obtained only from both twins and the daughters of patient A. Patient B did not give her consent for her daughters’ genetic testing. In addition, the twins’ father and his parents were dead and other paternal relatives were unavailable for this study. We could only obtain tumor pathology slides and tumor paraffin blocks from the twins. 3.3. DNA isolation Blood samples were treated with red blood cells lysis solution (Tris 10mM pH7.6, NaCl 9.9 mM, MgCl2 5mM), centrifuged, and the white blood cells pellet was lysed with white blood cells lysis solution (Tris 10 mM pH 7.6, NaCl 50 mM, EDTA 100 mM, SDS 0.2%). After enzymatic treatment with RNAse and Proteinase K (50 g/ml final concentration, each) DNA purification, precipitation and quantification was performed as previously described [8]. DNA quality was assesed by agarose gel electrophoresis. 3.4. BRCA2 exon 11 protein truncation test Exon 11 of BRCA2 was amplified by PCR as four overlapping fragments from genomic DNA with the primers reported by Serova et al. [9]. Each protein truncation test (PTT) forward primer included a sequence consisting of the T7 promoter and an eukariotic consensus-translation-initiation site at the 5 end: 5GGATCCTAATACGACTCACT ATAGGAACAGACCACCATG3. PCR was performed as follows: an initial denaturation step at 94C for 4 min followed by 30 cycles at 94C for 1 min, 55C 1 min and 72C for 4 min. Final extension consisted in 5 min at 72C. Polymerase chain reactions (PCR) were performed in a final volume of 10 l with 400 ng of genomic DNA, 200 M dNTPs, 0.4 M of each primer and 0.75 units of Taq DNA polymerase (Promega). After amplification, PCR products were analysed by electrophoresis on 1% agarose gel. PTT was performed by adding 2 l of PCR product directly to TNT/T7 coupled Reticulocyte Lysate System (Promega) following manufacturer’s instructions. 35S Methionine (Amersham) was used as radiolabeled aminoacid for protein detection. An aliquot (3 l) of the translation product was separated in 12% polyacrylamide minigels at constant 120V. After electrophoresis the gels were fixed, soaked in Amplify (Amersham), dried and exposed for autoradiography. 3.5. Sequencing PCR products that presented abnormal PTT patterns were analyzed by direct sequencing. Primers for PCR and sequencing were BRCA2 11-9 F (5-GATGGCAGTGAT TCAAGTAAA-3) and BRCA2 11-9R (5-AAATGACTC TTTGGCGACAC-3). PCR products were purified with Sephacryl™ S-400 (Amersham Pharmacia Biotech). Sequencing reactions were performed with the BigDye™ Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems) following manufacturer’s instructions. Products
Table 2 Primary antibodies used for immunohistochemical analysis and experimental conditions Incub. time Antibodies to Clones Manufacturers AG retrievala Dilution (4C) PR p53 Ki67 ER c-erbB-2 bcl-2
1A6 DO7 MIB-1 1D5 CB11 100
Immunotech Dako Immunotech Immunotech Biogenex Biogenex
20 minutes 20 minutes 20 minutes 20 minutes 30 minutes 30 minutes
1/50 1/50 1/100 1/50 1/20 1/200
Overnight Overnight Overnight Overnight Overnight Overnight
Abbreviations: ER, estrogen receptor; PR, progesterone receptor. a Microwave in citrate buffer 10 mM, ph 6.
were purified on Sephadex™ G-50 (Amersham Pharmacia Biotech), loaded on an EllioSeq gel (Ellios Biomedia) and ran on an automated 377 sequencer (PE Applied Biosystems). 3.6. Immunohistochemical analysis Immunostaining was performed on histological sections on sylane pretreated slides. The LSAB detection system (DAKO) was used for all analyzed antibodies (Ab). We used diamino-benzidine as chromogen. The sections were counterstained in hematoxylin. Before the incubation with the primary Ab, antigen retrieval was performed according to a HIER method described previously [10]. Primary Ab used are shown in Table 2. Pertinent controls were tested simultaneously and reacted appropriately. Technical control consisted of the omission of primary Ab. Criteria used to classify a tumor as positive or negative for each antigen were as follows: tumor cells were considered positive for Ki67 only when there was a clear nuclear staining. The number of positively stained tumor cells per 500 tumor cells, in the invasive portion of the tumor, was counted. The percentage of positively stained cells was recorded as Ki67 LI (labeling index). A high proliferative rate was an LI of 15% or more. For bcl-2, tumors were considered positive if more than 10% of cells showed positive cytoplasmic staining. p53 expression was assessed by the percentage of positive tumor cell nuclei in 500 tumor cells. The same cut-off for bcl-2 (above 10%) was used for p53, based on prior studies [11]. Cases exhibiting distinct and complete membrane staining in 10% or more tumor cells were identified as positive for c-erbB-2 protein overexpression. Estrogen and progesterone receptor status was evaluated on the percentage of malignant cells with positive nuclear staining and on staining intensity graded as low (), moderate () and intense (). Less than 10% of stained cells were considered negative. 4. Results 4.1. BRCA2 analysis PTT analysis of BRCA2 exon 11 performed on DNA from both twins showed a truncated band when PCR prod-
L. Delgado et al. / Cancer Genetics and Cytogenetics 133 (2002) 24–28
27
Table 3 Ki67, p53, c-erbB-2, bcl-2, ER and PR immunostaining results Ki67 LI p53 c-erbB-2 bcl-2 ER PR
Patient A
Patient B
39 16 Negative Positive (intense) Positive () Negative
38.6 20.2 Negative Positive (intense) Positive () Negative
Abbreviations: ER, estrogen receptor; PR, progesterone receptor.
Fig. 2. Detection of a BRCA2 truncating mutation in patients A and B (A patient A; B patient B; N normal; TB truncated band).
ucts corresponding to the second fragment of exon 11 (nucleotides 3505–5064; mRNA position) were examined (Fig. 2). Sequence analysis of this region revealed a 6 bp insertion (TGAGGA) between nucleotides 4359–4360 (Fig. 3). Of these six extra nucleotides the first triplet led to an UGA stop codon that resulted in a truncated protein of 1377 aminoacids. Patient A’s daughters PTT revealed the same truncated band (not shown). 4.2. Immunohistochemistry of breast tumors The results are shown in Table 3. The expression of all the antigens studied was nearly the same in the tumors of this twin pair. Both cases exhibited a high proliferative rate with a strong Ki 67 immunopositivity. In each tumor nuclear accumulation of p53 protein was detected in a large number of tumor cells, displaying a mean value of 16 and 20.2%. Bcl-2 expression was very intense in more than 80% of the cells. The tumors were estrogen receptor positive. Neither progesterone receptor nor c-erbB-2 showed positivity. 5. Discussion The results of this study show that this identical twin pair with similar nongenetic cancer-related risk factors are carriers of the same BRCA2 mutation in the germline and have an extremely high disease similarity.
Fig. 3. Sequence analysis of the second fragment of exon 11 revealed a 6 bp insertion between nucleotides 4359-4360. This insertion resulted in a premature UGA stop codon. Wild type and mutant sequences are shown.
The family history suggests that the BRCA2 mutation could be transmitted by the paternal branch. Since the father and his parents died and other paternal relatives are unavailable for molecular studies, we could not confirm neither the paternal transmission nor that breast cancer segregated with the mutation. Nevertheless, this mutation is deleterious since it determines the loss of approximately 60% of the protein including important functional domains such as RAD51 interaction domains, BRCT domains, and a nuclear localization sequence [12]. This mutation has been previously reported in the Breast Cancer Information Core database [13] on November 23, 1998, also in a family of Italian ancestry. Disease penetrance and expressivity in BRCA2 germline mutation carriers is variable. This inter-individual variability may depend on several factors including BRCA2 mutation type or position [5], genes at other loci [14], reproductive history and exogenous exposures [15–17]. These identical twins share the same genotype, including the same mutant BRCA2 allele and the same cancer risk modifier genes. Additionally, no significant differences in nongenetic cancerrelated risk factors existed between these twins. Also, in both sisters the major clinical, histological and immunohistochemical features are almost identical, as was previously referred. To our knowledge this is the first report of a germline BRCA2 mutation in identical twins. Few studies about disease expression in monozygotic twins with a germline BRCA1 mutation have been reported [18–20]. Miesfeldt et al. [18] studied an identical twin pair carrying a germline BRCA1 mutation who developed ovarian cancer and had very similar clinical histories. Recently, Wistuba et al. [19] reported an identical twin pair with a constitutional BRCA1 mutation showing a remarkable similarity in clinical histories, histopathological features and acquired breast cancer somatic mutations. Interestingly, they also studied 17 sporadic breast carcinomas which showed a wide range of acquired genetic alterations. These results support an important role for heritable factors in breast carcinogenesis and disease phenotype. In contrast, Diez et al. [20] reported an identical twin pair, carrying the same germline BRCA1 mutation, one of whom remained healthy while the other developed breast cancer 17 years ago and ovarian cancer later. In the present study, the identical twin pair carrying a germline BRCA2 mutation and with scarce differences in
28
L. Delgado et al. / Cancer Genetics and Cytogenetics 133 (2002) 24–28
nongenetic risk factors, showed an extremely similar disease expression. Although it is not possible to estimate the relative roles of genotype, nongenetic factors and chance from this study, the remarkable disease similarity observed is in accordance with the results obtained in the above referred studies in which a large role for hereditary factors in disease expression among patients with familial breast cancer is suggested. Acknowledgments We thank María Musto and Virginia Ortega for their support in immunohistochemical techniques and Christine Machavoine for her expert technical assistance. We thank Hugo Deneo who provided the paraffin blocks of the tumors. This work was partially supported by grants from Comisión Honoraria de Lucha Contra el Cancer (Grants numbers 83 and 102), Montevideo, Uruguay. References [1] Ford D, Easton DF, Stratton M, Narod S, Goldgar D, Devilee P, Bishop DT, Weber B, Lenoir G, Chang-Claude J, Sobol H, Teare MD, Strewing J, Arason A, Scherneck S, Peto J, Rebbeck TR, Tonin P, Neuhansen S, Barkardottir R, Eyfojrd J, Lynch H, Ponder BA, Gayther SA, Zelada-Hedman M, the Breast Cancer Linkage Consortium. Genetic heterogeneity and penetrance analysis of the BRCA1 and BRCA2 genes in breast cancer families. The Breast Cancer Linkage Consortium. Am J Hum Genet 1998;62:676–89. [2] Hakansson S, Johansson O, Johansson U, Sellberg G, Loman N, Gerdes AM, Holmberg E, Dahl N, Pandis N, Kristoffersson U, Olsson H, Borg A. Moderate frequency of BRCA1 and BRCA2 germ-line mutations in Scandinavian familial breast cancer. Am J Hum Genet 1997; 60:1068–78. [3] Schubert EL, Lee MK, Mefford HC, Argonza RH, Morrow JE, Hull J, Dann JL. BRCA2 in American families with four or more cases of breast or ovarian cancer: recurrent and novel mutations, variable expression, penetrance, and the possibility of families whose cancer is not attributable to BRCA1 or BRCA2. Am J Hum Genet 1997;60: 1031–40. [4] Abeliovich D, Kaduri L, Lerer I, Weinberg N, Amir G, Sagi M, Zlotogora J, Heching N, Peretz T. The founder mutations 185delAG and 5382insC in BRCA1 and 6174delT in BRCA2 appear in 60% of ovarian cancer and 30% of early-onset breast cancer patients among Ashkenazi women. Am J Hum Genet 1997;60:505–14. [5] Gayther SA, Mangioni J, Rusell P, Seal S, Barfoot R, Ponder BA, Stratton MR, Easton D. Variation of risks of breast and ovarian cancer associated with different germline mutations of the BRCA2 gene. Nat Genet 1997;15:103–5.
[6] Easton DF, Steele L, Fields P, Ormiston W, Averill D, Daly PA, McManus R, Neuhausen SL, Ford D, Wooster R, Cannon-Albright LA, Stratton MR, Goldgar DE. Cancer risks in two large breast cancer families linked to BRCA2 on chromosome 13q12-13. Am J Hum Genet 1997;61:120–8. [7] Sarna S, Kaprio J, Sistonen P, Koskenvuo M. (1978): Diagnosis of twin zygosity by mailed questionnaire. Hum Hered 1997;28:241–54. [8] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Press, 1989. [9] Serova OM, Mazoyer S, Puget N, Dubois V, Tonin P, Shugart YY, Goldgar D, Narod SA, Lynch HT, Lenoir GM. Mutations in BRCA1 and BRCA2 in breast cancer families: are there more breast cancersusceptibility genes? Am J Hum Genet 1997;60:486–95. [10] Shi SR, Key ME, Kalra KL. Antigen retrieval in formalin-fixed, paraffin-embedded tissues: an enhancement method for immunohistochemical staining based on microwave oven heating of tissue sections. J Histochem Cytochem 1991;39:741–8. [11] Jansen RHL, Joosten-Achjanie SR, Volovics A, Arends JW, Hupperets PS, Hillen HF, Schouten HC. Relevance of expression of bcl-2 in combination with p53 as a prognostic factor in breast cancer. Anticancer Res 1998;18:4455–62. [12] Welsch PL, Owens KN, King MC. Insights into functions of BRCA1 and BRCA2. Trends Genet 2000;16:69–74. [13] Breast Cancer Information Core database. Available at: http://www. nchgr.nih.gov:80/Intramural_research/Lab_transfer/Bic/. [14] Brunet JS, Vesprini D, Abrahamson J, Neuhansen S, Narod S. Breast Cancer Risk in BRCA1/BRCA2 carriers is modified by the CYP1A1 gene. Am J Hum Genet 1998;63:A247 [15] Kaduri L, Gibs M, Hubert A, Sagi M, Heching N, Lerer I, Uziely B, Weinberg N, Abeliovich D, Peretz T. Genetic testing of breast and ovarian cancer patients: clinical characteristics and hormonal risk modifiers. Eur J Obstet Gynecol Reprod Biol 1999;85:75–80. [16] Brunet JS, Ghadirian P, Rebbeck TR, Lerman C Garber JE, Tonin PN, Abrahamson J, Foulkes WD, Daly M, Wagner-Costales J, Godwin A, Olopade OI, Moslehi R, Liede A, Futreal PA, Weber BL, Lenoir GM, Lynch HT, Narod SA. Effect of smoking on breast cancer in carriers of mutant BRCA1 or BRCA2 genes. J Natl Cancer Inst 1998;90:761–6. [17] Narod SA, Risch H, Moslehi R, Dorum A, Neuhausen S, Olsson H, Provencher D, Radice P, Evans G, Bishop S, Brunet JS, Ponder BA. Oral contraceptives and the risk of hereditary ovarian cancer. Hereditary Ovarian Cancer Clinical Study Group. N Engl Med. 1998;339:424–8. [18] Meisfeldt S, Turner BL, Lovell MA, Cooper MR, Lescallet J, Jones SM. A novel BRCA1 mutation in an identical twin pair with similar clinical histories. Cancer Genet Cytogenet 1998;100:43–8 [19] Wistuba II, Tomlinson GE, Behrens C, Virmani A, Gerdts J, Blum JL, Minna JD, Gazdar AF.: Two identical triplet sisters carrying a germline BRCA1 gene mutation acquire very similar breast cancer somatic mutations at multiple other sites throughout the genome. Genes Chromosomes Cancer 2000;28:359–69. [20] Diez O, Brunet J, Sanz J, del Rio E, Alonso MC, Baiget M. Differences in phenotypic expression of a new BRCA1 mutation in identical twins. Lancet 1997;350:713.