- Email: [email protected]
Herpes simplex virus encephalitis in a renal transplant patient: Diagnosis by polymerase chain reaction detection of HSV DNA
CASE REPORTS
Herpes Simplex Virus Encephalitis in a Renal Transplant Patient: Diagnosis by Polymerase Chain Reaction Detection of HSV DNA Ernest0 G6mez, MD, Santiago Melbn, MD, Sixto Aguado, MD, Jo& Emilio SBnchez, MD, Carmen Portal, MD, Ana Fernandez, MD, Ana Martinez, MD, Maria Luisa Sbchez, MD, and Jaime Alvarez, MD 0 A case of herpes simplex virus (HSV) encephalitis with disseminated primary HSV infection in a renal transplant patient is described. The diagnosis of the disease was achieved by nested polymerase chain reaction (PC%)-DNA in cerebrospinal fluid (CSF). Other diagnostic measures (immunoglobulin [lg] M and virological cultures both in blood and CSF) were negative. Blood IgG gave a false-positive signal. Although ganciclovir is not the drug of choice, its concomitant administration in our patient as a prophylactic measure against CMV infection may have decreased the usual severity normally expected in this kind of primary HSV infection. The subsequent increase in ganciclovir dose to full therapeutic range, which was implemented before the diagnosis was achieved, led to the disappearance of symptoms. The detection of PCR-DNA in CSF will probably become the diagnostic method of choice. One of its great advantages, in addition to its diagnostic reliability, is that it may obviate the performance of many cerebral biopsies. 0 7997
by the
National
Kidney
Foundation,
INDEX WORDS: Herpes simplex; encephalitis;
Inc.
PCR; renal transplant.
H
ERPES simplex virus (HSV) encephalitis is an uncommon disease in immunocompromised patients.’ The diagnosis used to be made by culture of the virus in brain tissue, because other methods were unreliable. Thus, viral culture in cerebrospinal fluid (CSF) was achieved in only 4% of patients2 Furthermore, because the production of antibodies is delayed in these immunosuppressed patients, any treatment based on its detection in CSF may begin too late to be effective.3 Recent reports have shown that isolation of the viral genome by polymerase chain reaction (PCR) in CSF allows a rapid diagnosis of the disease.4‘6 These findings have now been confirmed by further studies that compare the detection of PCR in CSF with viral cultures of brain tissue obtained by biopsy or necropsy.7 The high sensitivity and specificity of PCR tests has led to this technique being the diagnostic method of choice. We describe a case of disseminated disease with primary HSV encephalitis diagnosed using HSV-DNA detection in CSF by nested PCR. Diagnostic and therapeutic problems are also discussed. CASE
REPORT
A 36-year-old white man who began hemodialysis in December 1976 because of end-stage renal failure of unknown origin received a first cadaveric renal transplant in March 1979. In June 1982, the patient underwent further hemodialyAmerican
Journal
of Kidney
Diseases,
Vol 30, No 3 (September),
sis because of chronic rejection. The serological status of both donor and recipient regarding HSV was unknown. In November 1987 a second cadaveric renal transplant was implanted. Pretransplantation serology showed that the patient was cytomegalovirus (CMV) immunoglobulin (Ig) G positive, varicella zoster virus (VZV) IgG positive, and Epstein-Barr virus (EBV) IgG positive, but HSV 1 and HSV 2 IgG negative. This second graft lasted until June 1988, when the patient once again underwent hemodialysis because of chronic rejection. In March 1993, a new serology was obtained, showing identical results. On April 6, 1995, the patient received a third cadaveric kidney graft. At this moment, the patient had received a total of 51 blood transfusions. However, pretransplantation serology remained unchanged with respect to the last determination. Pretransplantation anti-hepatitis C virus (HCV) antibodies were positive, whereas tests for hepatitis B and human immunodeficiency virus (HIV) were negative. The donor was a 21-year-old woman who died of cranial trauma. Premortem viral serology showed serum IgG positivity against HSV. Serological (IgG) tests for CMV, VZV, and EBV were all positive, and hepatitis B surface antigen (HBsAg), anti-HCV, and anti-HIV tests were all negative. The immunosuppressive protocol included monoclonal OKT3 antibodies, low-dose prednisone, azathioprine, and cyclosporine. Ganciclovir was included prophylactically against CMV, following the protocol previously described.8 From the Nephrology and Microbiology Services, Hospital Central de Asturias, Oviedo, Spain. Received July 15, 1996; accepted in revised form March 11, 1997. Address reprint requests to Ernest0 Gdmez, MD, Nephrology Service, Hospital Central de Asturias, c/ Celestino Villamil s/n, 33006 Oviedo, Spain. 0 1997 by the National Kidney Foundation, Inc. 0272-6386/97/3003-0015$3.00/O 1997:
pp 423-427
423
424
This protocol included weekly and fortnightly determinations of the following anti-CMV tests? serum IgG and IgM, antigenemia, shell vial blood cultures, and PCR determination on peripheral blood leukocytes. In urine, shell vial and conventional virological cultures were simultaneously performed. Because all tests were always negative, we can reject CMV infection. The patient was finally discharged 13 days later, completely asymptomatic and with a serum creatinine of 2.1 mg/dL. On April 25, 19 days after transplantation, the patient was hospitalized with a clinical picture consistent with fever, malaise, headache, vomiting, and dyspnea. At admission, the patient was febrile (38”C), confused, and had incoherent and blurred speech and motor incoordination. There were no signs of meningeal irritation, hemiplegia, hemianopsia, diplopia, seizures, nor cutaneous or genital lesions suggestive of HSV. Laboratory data were as follows: hemoglobin, 12.5 g/dL; leukocyte count, 3,19O/kL (44% polymorphonuclear, 49% lymphocytes, and 7% monocytes); platelet count, 149,000/ pL; serum creatinine, 2.2 mg/dL; cyclosporine level, 252 ng/ mL (monoclonal antibody, Tdx, Abbott, Chicago, IL); glucose, 190 mg/dL; glutamic oxalo-acetic transaminase (GOT), 99 IU/L; glutamic pyruvic-acetic transaminase (GPT), 343 IU/L; arterial gasometiy with the patient breathing air, pH 7.4, p02 45 mm Hg, pCOz 35 mm Hg, C03H 21 mm/L. A chest radiography showed a bilateral and diffuse alveolar infiltrate. An electrocardiogram was normal. A computed cranial tomography showed signs of slight cerebral atrophy. Blood and urine cultures for bacteria and fungi showed nor-
GOMEZ
Fig 2. Relationship serum creatinine levels. 22nd postransplantation lower than recommended.
between ganciclovir Note that between days, ganciclovir
ET AL
dose and the 8th and dose is
ma1 results. Conventional viral and shell vial cultures of pharyngeal exudates for HSVI, HSV2, CMV, Coxsackie A and B, adenoviruses, and echoviruses were negative. A lumbar puncture showed CSF pleocytosis with 37 leukocytes/pL (28% polymorphonuclear and 72% lymphocytes). Glucose was 87 mg/dL and proteins 88 mg/dL. Nested PCR detected HSVI DNA (Fig 1). Nested PCR was also positive against HSVl in blood the week before the appearance of the symptoms. PCR DNA was negative for VZV and CMV. Bacterial, fungal, and Lowenstein’s cultures in CSF were all negative. CMV, HSVl, and HSV2 conventional cultures were negative. Coxsackie A and B and adenovirus shell vial cultures were negative. CSF serology (IgG) against CMV, HSV, EBV, VZV, measles, and toxoplasmosis were all negative. As a consequence of these findings, immunosuppression was decreased, and the ganciclovir dose was increased to full therapeutic range adjusted to renal function (Fig 2). A few days later, the patient began to feel better, with fever, dyspnea, and neurological symptoms progressively disappearing. Ganciclovir was maintained at full therapeutic dose for a period of 4 weeks. The follow-up viral tests performed after diagnosis are shown in Fig 3. The patient was finally discharged after completion of ganciclovir treatment, and 12 months later, he remained asymptomatic with a serum creatinine level of 1.8 mg/dL. METHODS
Preparation of DNA for PCR
Fig 1. Agarose gel electrophoresis showing amplified HSVl-DNA of the patient samples. Arrow indicates 138 base pair glicoprotein D of HSVI. Lane M was molecular weight ladder; lanes 1 to 5 are blood samples, in which lane 2 is positive; lane 3 is CSF sample positive; lanes 8 and 7 are negative and positive controls.
Blood samples were homogenized and pelleted by centrifugation at 1,SOOgfor 5 minutes and supernatant was removed. Then, 100 PL lysis solution (10 mmol/L Tris-HCl [Bio-Rad, Richmond, VA] pH 8.3, 50 mmol/L potassium chloride [Sigma Chemical, St Louis, MO], 2.5 mmol/L magnesium chloride [Sigma Chemical], 0.5% Nonidet P-40 [Sigma Chemical], 0.5% Tween 20 [Sigma Chemical], and 10 pg proteinase K) was added, mixed, and incubated 45 minutes at 56°C and then for 10 minutes at 96°C to inactivate proteinase K (Boehringer Mannheim, GmbH Biochemica Mannheim, Germany). The CSF sample was directly processed
HERPES
SIMPLEX
ENCEPHALITIS
IN A RENAL
)
Disease
PCR-HSVI (CSF)
425
TRANSPLANT
/
+
-
_
_
_ _
_ _
_ _
_ -
-
+
-
-
-
_
-
_
_
-
-
nd
-
-
_
-
_
_
-
nd
-
+
+
+
-
_
-
1
IO
20
28
37
58
86
89
109
CMV-PCR CMV-Ag
-
HSVI-PCR
-
HSV-IgM HSV-IgG
_
Postransplant Fig 3. HSVl and CMV blood determinations. formed on the 20th postransplantation day (large surgery and on May 5.
days
The lumbar puncture with arrow). Blood transfusions
without the previous preparation. The amount of DNA in samples was determined using a spectrophotometer (Pharmacia LKB-Ultrospec III) and adjusted to a final concentration of 0.1 PgIpL. HSVI nested PCR method. A 138-bp fragment belonging to the glycoprotein D encoding-gen of HSVl was amplified using oligonucleotide primers. Oligonucleotides were synthesized using an Applied Biosystems DNA synthesizer and an adaptation of Aurelius PCR methodology.” Briefly, reaction mixture containing 10 mmol/L Tris-HCl pH 8.3, 50 mmol/L potassium chloride, 1.5 mmol/L magnesium chloride, 1 U recombinant Tuq DNA polymerase (Gibco, Grand Island, NY), 125 pmol/L each deoxynucleoside triphosphate, and 0.25 pmol/L each of the oligonucleotides (BJHSV1.l: S’ATCACGGTAGCCCGGCCGTGTGACA-3’ [19-431 and BJHSV1.2: 5’-CATACCGGAACGCACCACACAA-3’ [2392181) were batch-prepared. Forty microliters of this mixture were distributed into 500-,uL reaction tubes, overlaid with 30 PL mineral oil, and stored at -20°C for a maximum of 90 days. Aliquot tubes were thawed immediately before the reaction was made, and 1 pg DNA was added. The first-round amplification comprises 22 cycles of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and elongation at 72°C for 1 minute followed by an additional final extension step of 10 minutes at 72’C. After the first round of amplification, 1 U recombinant Tuq DNA polymerase (Gibco) and 25 pmol/L each of the inner oligonucleotides (BJHSVl.3: 5’CCAACCGACCACACCGACGA-3’ [51-711 and BJHSV1.4: 5’-GGTAGTTGGTCGTTCGCGCTGAA-3’ [188-1661) was added to the same tube, and a second-round amplification was performed. This second round comprises 35 cycles of
-
PCR-HSV detection (small arrows) were
on CSF performed
was
perduring
denaturation at 95°C for 30 seconds, annealing at 61°C for 30 seconds, and elongation at 72°C for 1 minute followed by a final extension step at 72°C for an additional 10 minutes. Ten microliters of the second-round PCR products were subjected to electrophoretic migration in 3% agarose gel containing ethidium bromide and were examined with UV light. Each test included a positive control (HSVl DNA) and two negative controls, one of generic DNA without infection and the other of water. To avoid false-positive results caused by contamination, each stage of preparation of the PCR reaction mixture was undertaken in a separate room. The reagents were aliquoted and stored at -2o”C, and specific pipettes were used for each manipulation. PCR products were specific for HSVl DNA; no bands containing CMV, VZV, HSV2, or bacterial DNA were observed after amplification and gel electrophoresis of specimens. In our experience, 12 of 103 samples of CSF of patients suspicious of having herpetic encephalitis showed positive results, for HSVl, but not for HSV2 (data not shown). Other virological methods. Determination of anti-HSV IgG and IgM antibodies was performed with a commercially available enzyme-linked immunosorbent assay (ELISA) (Behring, Marburg, Germany). To determine avidity of antiHSV IgG, after the first step of the usual ELISA procedure, a washing is performed with an 8 mol/L urea-containing solution. The reduction in optical density should be greater than 60% when avidity is high. Anti-IgG was also determined by complement fixation assay (Whittaker, Walkersvielle, Germany). CMV DNA was detected using the primers corresponding to protein pp65 (~~65-1: TACGCGCCGCTCAAGATG, ~~65-11: TGGTGGCGCTGTTCTCC) and probe-pp65
426
GOMEZ
(CGTCAGCAGAACCAGTGGAAAGA).” CMV antigenemia was determined by detection of the pp65 antigen, as previously described.’
DISCUSSION
Viral encephalopathy is a rare complication of renal transplant patients, and is most frequently attributable to infection by viruses of the herpes group.“,13 Other causes of encephalopathy may affect these patients. 14*15Although ganciclovir administration has also been claimed to produce encephalopathy,16 the clinical improvement and disappearance of fever that followed the increase in dose argues against this possibility. Thus, we concluded that our patient was suffering from HSV encephalitis with disseminated primary HSVl infection. The diagnosis was based, in spite of the negativity of CSF viral cultures, on the isolation of HSVl-DNA in CSF, and the negativity of CMV-DNA and VZVDNA. The specificity of the method employed and the controls that were made suggest that the DNA detected is HSVl. Conversely, most of the cases of herpetic encephalitis are produced by HSV 1. Furthermore, HSV 1 was detected in the patient blood. This finding spared the patient the performance of a cerebral biopsy, an aggressive technique with potentially serious side effects, which in addition is not free of false-negative results, especially when the specimen is obtained from a noncolonized area. Although data are not yet available, the results obtained from DNA detection in CSF will prove, with all probability, to be far more reliable than those obtained from serology. This is so because the latency period required to develop the serological response is longer. 17,18Obviously, this period may produce unacceptable delays at the beginning of therapy. Furthermore, many immunosuppressed patients are unable to develop this response, especially when challenged by overwhelming infections. This may have been the case of our patient, as suggested by the lack of IgM seroconversion. The evanescent IgG detection in blood (Fig 3), together with the fact that the IgG detected was of the “high avidity class,” the absence of increase in the IgG levels, and its fast disappearance of blood, all may suggest that this is the result of passive immunization from a blood
ET AL
transfusion performed just before seroconversion. If this is the case, we are facing here another well-documented case of false-positive serological diagnosis. Although primary HSV infections are much less frequent than secondary ones, they are frequently fatal if proper treatment is not begun early.‘g,20 In our group of renal transplants, 95% of the patients (data not shown) are seropositive when grafted. The infection in these seronegative patients may be acquired by nosocomial infection or through the graft. In two previous reports of graft transmission, the infection was due to HSV2 and was characterized in both patients by fulminant hepatitis.20,21 HSVl encephalitis in our patient is exceptional. No cases were found of HSVl encephalitis in renal transplant, even after an extensive Medline search. The fact that our patient developed the infection while receiving a prophylactic dose of ganciclovir may have induced a decreased severity of the infection. Although ganciclovir is not the drug of choice,22 it is active against HSV through a virustatic mechanism, and this may explain the disappearance of symptoms that followed the increase in its dose to full therapeutic range (Fig 2). In conclusion, PCR detection of HSV DNA in CSF is a rapid diagnostic method, which may detect the disease with greater sensibility than conventional viral cultures. The lack of serological response in these patients cannot be considered as proof of absence of infection. REFERENCES 1. Linnerman CC Jr, First MR, Alvira MM, Alexander JW, Schiff GM: Herpes virus type 2 meningoencephalitis following renal transplantation. Am J Med 61:703-708, 1976 2. Kahlon J, Chartterjee S, Lakerman ID, Nahmias AJ, Whitley RJ: Detection of antibodies to herpes simplex virus in the cerebrospinal fluid of patients with herpes simplex encephalitis. J Infect Dis 155:38-44, 1987 3. Hooper DC, Pruitt AA, Rubin RH: Central nervous system infection in the chronically immunosuppressed. Medicine (Baltimore) 61:166-168, 1982 4. Chou J, Kern ER, Whitley RJ, Roizman B: Mapping of herpes simplex virus-l neurovirulence to g 1 34.5, a gene non-essential for growth in culture. Science 2.50:1262-1265, 1990 5. Rowley AH, Whitley RJ, Lakerman FD, Wolinsky SM: Rapid detection of herpes simplex virus DNA in cerebrospinal fluid of patients with herpes simplex encephalitis. Lancet 335440-441, 1991 6. Guffond T, Dewilde A, Lobert PE, Caparros-Lefebvre D, Hober D, Wattre P: Significance and clinical rev-
HERPES
SIMPLEX
ENCEPHALITIS
IN A RENAL
TRANSPLANT
elance of the detection of herpes simplex virus DNA by the polymerase chain reaction in cerebrospinal fluid from patients with presumed encephalitis. Clin Infect Dis 18:744-749,
1994
7. Lakerman FD, Whitley RJ, National Institute of Allergy and Infectious Diseases Collaborative Antiviral Study Group: Diagnosis of herpes simplex encephalitis: Application of polymerase chain reaction to cerebrospinal fluid from brainbiopsied patients and correlation with disease. .I Infect Dis 171:857-863,
1995
8. Gomez E, de Ofia M, Aguado S, Tejada F, Nufiez M, Portal C, Diaz-Corte C, Sanchez E, Ortega F, Alvarez-Grande J: Cytomegalovirus (CMV) preemptive therapy with ganciclovir in renal transplant patients treated with OKT3. Nephron 741367-372, 1996 9. G6mez E, Aguado S, Melon S, Martmez A, De Ofia M, Cimadevilla R, Gorostidi M, Gonzalez E, Alvarez-Grande .I: A prospective study about the usefulness of rapid diagnostic tests in monitoring cytomegalovirus infection in renal transplants. Transplant Proc 24:2631-2633, 1992 10. Aurelius E, Johansson B, Skoldenberg A, S&land A, Forsgren M: Rapid diagnosis of herpes simplex encephalitis by nested polymerase chain reaction assay of cerebrospinal fluid. Lancet 337:189-192, 1991 11. Bitsch A, Kirchner H, Hayes J, Fucke L, Steinhoff J, Sack K, Bein G: The long persistence of CMV DNA in the blood of renal transplant patients after recovery from CMV infection. Transplantation 56: 108-l 13, 1993 12. Donaghy M: Neurological complications, in Morris PJ (ed): Kidney Transplantation. Principles and Practice, chap 26 (ed 3). Philadelphia, PA, Saunders, 1994, pp 356-363 13. Chan CL, Weinstein SS, Wrigth ChE, Bowers VD, Alveranga DY, Shires DL, Ackermann JR, LeFor WW, Kahana L: Encephalopathy associated with OKT3 administra-
427 tion: Possible interaction with indomethacin. Transplantation 52:148-150, 1991 14. Bamborschke S, Wullen T, Huber M, Neveling M, Baldamus CA, Kom K, Jahn G: Early diagnosis and successful treatment of acute cytomegalovirus encephalitis in a renal transplant recipient. J Neurol 239:205-208, 1992 15. Pedneault L, Katz Bz, Miller G: Detection of EpsteinBarr virus in the brain by the polymerase chain reaction. Ann Neurol 32:184-192, 1992 16. Davis CL, Springmeyer S, Gmerek BJ: Central nervous system side effects of ganciclovir. N Engl J Med 322:933-934, 1990 17. Nahmias AJ, Whitley RJ, Visintine AN, Takey Y, Alford CA, Collaborative Antiviral Study Group: Herpes simplex virus encephalitis: Laboratory evaluations and their diagnostic significance. J Infect Dis 145:829-836, 1983 18. Wang HS, Huang SC: Value of serum anti-herpes simplex viral IgM antibody testing in empirical antiviral treatment of herpex simplex encephalitis. J Child Neurol 8:378382, 1993 19. Taylor RH, Saul SH, Dowling JN, Hakala TR, Peel RL, Ho M: Primary disseminated herpes simplex infection with fulminant hepatitis following renal transplantation. Arch Intern Med 141:1519-1521, 1981 20. Konera B, Tzakis AG, DePuydt LE, Demetrius AJ: Transmision of fatal herpes simplex infection through renal transplantation. Transplantation 45:653-656, 1988 21. Matthews T, Boehme R: Antiviral activity and mechanism of action of ganciclovir. Rev Infect Dis lO:S490-S494, 1988 (suppl 3) 22. Dummer JS, Armstrong J, Somers J, Kusne S, Carpenter J, Rosenthal JT, Ho M: Transmission of infection with herpes simplex virus by renal transplantation. J Infect Dis 155:202-206, 1987
Herpes Simplex Virus Encephalitis in a Renal Transplant Patient: Diagnosis by Polymerase Chain Reaction Detection of HSV DNA Ernest0 G6mez, MD, Santiago Melbn, MD, Sixto Aguado, MD, Jo& Emilio SBnchez, MD, Carmen Portal, MD, Ana Fernandez, MD, Ana Martinez, MD, Maria Luisa Sbchez, MD, and Jaime Alvarez, MD 0 A case of herpes simplex virus (HSV) encephalitis with disseminated primary HSV infection in a renal transplant patient is described. The diagnosis of the disease was achieved by nested polymerase chain reaction (PC%)-DNA in cerebrospinal fluid (CSF). Other diagnostic measures (immunoglobulin [lg] M and virological cultures both in blood and CSF) were negative. Blood IgG gave a false-positive signal. Although ganciclovir is not the drug of choice, its concomitant administration in our patient as a prophylactic measure against CMV infection may have decreased the usual severity normally expected in this kind of primary HSV infection. The subsequent increase in ganciclovir dose to full therapeutic range, which was implemented before the diagnosis was achieved, led to the disappearance of symptoms. The detection of PCR-DNA in CSF will probably become the diagnostic method of choice. One of its great advantages, in addition to its diagnostic reliability, is that it may obviate the performance of many cerebral biopsies. 0 7997
by the
National
Kidney
Foundation,
INDEX WORDS: Herpes simplex; encephalitis;
Inc.
PCR; renal transplant.
H
ERPES simplex virus (HSV) encephalitis is an uncommon disease in immunocompromised patients.’ The diagnosis used to be made by culture of the virus in brain tissue, because other methods were unreliable. Thus, viral culture in cerebrospinal fluid (CSF) was achieved in only 4% of patients2 Furthermore, because the production of antibodies is delayed in these immunosuppressed patients, any treatment based on its detection in CSF may begin too late to be effective.3 Recent reports have shown that isolation of the viral genome by polymerase chain reaction (PCR) in CSF allows a rapid diagnosis of the disease.4‘6 These findings have now been confirmed by further studies that compare the detection of PCR in CSF with viral cultures of brain tissue obtained by biopsy or necropsy.7 The high sensitivity and specificity of PCR tests has led to this technique being the diagnostic method of choice. We describe a case of disseminated disease with primary HSV encephalitis diagnosed using HSV-DNA detection in CSF by nested PCR. Diagnostic and therapeutic problems are also discussed. CASE
REPORT
A 36-year-old white man who began hemodialysis in December 1976 because of end-stage renal failure of unknown origin received a first cadaveric renal transplant in March 1979. In June 1982, the patient underwent further hemodialyAmerican
Journal
of Kidney
Diseases,
Vol 30, No 3 (September),
sis because of chronic rejection. The serological status of both donor and recipient regarding HSV was unknown. In November 1987 a second cadaveric renal transplant was implanted. Pretransplantation serology showed that the patient was cytomegalovirus (CMV) immunoglobulin (Ig) G positive, varicella zoster virus (VZV) IgG positive, and Epstein-Barr virus (EBV) IgG positive, but HSV 1 and HSV 2 IgG negative. This second graft lasted until June 1988, when the patient once again underwent hemodialysis because of chronic rejection. In March 1993, a new serology was obtained, showing identical results. On April 6, 1995, the patient received a third cadaveric kidney graft. At this moment, the patient had received a total of 51 blood transfusions. However, pretransplantation serology remained unchanged with respect to the last determination. Pretransplantation anti-hepatitis C virus (HCV) antibodies were positive, whereas tests for hepatitis B and human immunodeficiency virus (HIV) were negative. The donor was a 21-year-old woman who died of cranial trauma. Premortem viral serology showed serum IgG positivity against HSV. Serological (IgG) tests for CMV, VZV, and EBV were all positive, and hepatitis B surface antigen (HBsAg), anti-HCV, and anti-HIV tests were all negative. The immunosuppressive protocol included monoclonal OKT3 antibodies, low-dose prednisone, azathioprine, and cyclosporine. Ganciclovir was included prophylactically against CMV, following the protocol previously described.8 From the Nephrology and Microbiology Services, Hospital Central de Asturias, Oviedo, Spain. Received July 15, 1996; accepted in revised form March 11, 1997. Address reprint requests to Ernest0 Gdmez, MD, Nephrology Service, Hospital Central de Asturias, c/ Celestino Villamil s/n, 33006 Oviedo, Spain. 0 1997 by the National Kidney Foundation, Inc. 0272-6386/97/3003-0015$3.00/O 1997:
pp 423-427
423
424
This protocol included weekly and fortnightly determinations of the following anti-CMV tests? serum IgG and IgM, antigenemia, shell vial blood cultures, and PCR determination on peripheral blood leukocytes. In urine, shell vial and conventional virological cultures were simultaneously performed. Because all tests were always negative, we can reject CMV infection. The patient was finally discharged 13 days later, completely asymptomatic and with a serum creatinine of 2.1 mg/dL. On April 25, 19 days after transplantation, the patient was hospitalized with a clinical picture consistent with fever, malaise, headache, vomiting, and dyspnea. At admission, the patient was febrile (38”C), confused, and had incoherent and blurred speech and motor incoordination. There were no signs of meningeal irritation, hemiplegia, hemianopsia, diplopia, seizures, nor cutaneous or genital lesions suggestive of HSV. Laboratory data were as follows: hemoglobin, 12.5 g/dL; leukocyte count, 3,19O/kL (44% polymorphonuclear, 49% lymphocytes, and 7% monocytes); platelet count, 149,000/ pL; serum creatinine, 2.2 mg/dL; cyclosporine level, 252 ng/ mL (monoclonal antibody, Tdx, Abbott, Chicago, IL); glucose, 190 mg/dL; glutamic oxalo-acetic transaminase (GOT), 99 IU/L; glutamic pyruvic-acetic transaminase (GPT), 343 IU/L; arterial gasometiy with the patient breathing air, pH 7.4, p02 45 mm Hg, pCOz 35 mm Hg, C03H 21 mm/L. A chest radiography showed a bilateral and diffuse alveolar infiltrate. An electrocardiogram was normal. A computed cranial tomography showed signs of slight cerebral atrophy. Blood and urine cultures for bacteria and fungi showed nor-
GOMEZ
Fig 2. Relationship serum creatinine levels. 22nd postransplantation lower than recommended.
between ganciclovir Note that between days, ganciclovir
ET AL
dose and the 8th and dose is
ma1 results. Conventional viral and shell vial cultures of pharyngeal exudates for HSVI, HSV2, CMV, Coxsackie A and B, adenoviruses, and echoviruses were negative. A lumbar puncture showed CSF pleocytosis with 37 leukocytes/pL (28% polymorphonuclear and 72% lymphocytes). Glucose was 87 mg/dL and proteins 88 mg/dL. Nested PCR detected HSVI DNA (Fig 1). Nested PCR was also positive against HSVl in blood the week before the appearance of the symptoms. PCR DNA was negative for VZV and CMV. Bacterial, fungal, and Lowenstein’s cultures in CSF were all negative. CMV, HSVl, and HSV2 conventional cultures were negative. Coxsackie A and B and adenovirus shell vial cultures were negative. CSF serology (IgG) against CMV, HSV, EBV, VZV, measles, and toxoplasmosis were all negative. As a consequence of these findings, immunosuppression was decreased, and the ganciclovir dose was increased to full therapeutic range adjusted to renal function (Fig 2). A few days later, the patient began to feel better, with fever, dyspnea, and neurological symptoms progressively disappearing. Ganciclovir was maintained at full therapeutic dose for a period of 4 weeks. The follow-up viral tests performed after diagnosis are shown in Fig 3. The patient was finally discharged after completion of ganciclovir treatment, and 12 months later, he remained asymptomatic with a serum creatinine level of 1.8 mg/dL. METHODS
Preparation of DNA for PCR
Fig 1. Agarose gel electrophoresis showing amplified HSVl-DNA of the patient samples. Arrow indicates 138 base pair glicoprotein D of HSVI. Lane M was molecular weight ladder; lanes 1 to 5 are blood samples, in which lane 2 is positive; lane 3 is CSF sample positive; lanes 8 and 7 are negative and positive controls.
Blood samples were homogenized and pelleted by centrifugation at 1,SOOgfor 5 minutes and supernatant was removed. Then, 100 PL lysis solution (10 mmol/L Tris-HCl [Bio-Rad, Richmond, VA] pH 8.3, 50 mmol/L potassium chloride [Sigma Chemical, St Louis, MO], 2.5 mmol/L magnesium chloride [Sigma Chemical], 0.5% Nonidet P-40 [Sigma Chemical], 0.5% Tween 20 [Sigma Chemical], and 10 pg proteinase K) was added, mixed, and incubated 45 minutes at 56°C and then for 10 minutes at 96°C to inactivate proteinase K (Boehringer Mannheim, GmbH Biochemica Mannheim, Germany). The CSF sample was directly processed
HERPES
SIMPLEX
ENCEPHALITIS
IN A RENAL
)
Disease
PCR-HSVI (CSF)
425
TRANSPLANT
/
+
-
_
_
_ _
_ _
_ _
_ -
-
+
-
-
-
_
-
_
_
-
-
nd
-
-
_
-
_
_
-
nd
-
+
+
+
-
_
-
1
IO
20
28
37
58
86
89
109
CMV-PCR CMV-Ag
-
HSVI-PCR
-
HSV-IgM HSV-IgG
_
Postransplant Fig 3. HSVl and CMV blood determinations. formed on the 20th postransplantation day (large surgery and on May 5.
days
The lumbar puncture with arrow). Blood transfusions
without the previous preparation. The amount of DNA in samples was determined using a spectrophotometer (Pharmacia LKB-Ultrospec III) and adjusted to a final concentration of 0.1 PgIpL. HSVI nested PCR method. A 138-bp fragment belonging to the glycoprotein D encoding-gen of HSVl was amplified using oligonucleotide primers. Oligonucleotides were synthesized using an Applied Biosystems DNA synthesizer and an adaptation of Aurelius PCR methodology.” Briefly, reaction mixture containing 10 mmol/L Tris-HCl pH 8.3, 50 mmol/L potassium chloride, 1.5 mmol/L magnesium chloride, 1 U recombinant Tuq DNA polymerase (Gibco, Grand Island, NY), 125 pmol/L each deoxynucleoside triphosphate, and 0.25 pmol/L each of the oligonucleotides (BJHSV1.l: S’ATCACGGTAGCCCGGCCGTGTGACA-3’ [19-431 and BJHSV1.2: 5’-CATACCGGAACGCACCACACAA-3’ [2392181) were batch-prepared. Forty microliters of this mixture were distributed into 500-,uL reaction tubes, overlaid with 30 PL mineral oil, and stored at -20°C for a maximum of 90 days. Aliquot tubes were thawed immediately before the reaction was made, and 1 pg DNA was added. The first-round amplification comprises 22 cycles of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and elongation at 72°C for 1 minute followed by an additional final extension step of 10 minutes at 72’C. After the first round of amplification, 1 U recombinant Tuq DNA polymerase (Gibco) and 25 pmol/L each of the inner oligonucleotides (BJHSVl.3: 5’CCAACCGACCACACCGACGA-3’ [51-711 and BJHSV1.4: 5’-GGTAGTTGGTCGTTCGCGCTGAA-3’ [188-1661) was added to the same tube, and a second-round amplification was performed. This second round comprises 35 cycles of
-
PCR-HSV detection (small arrows) were
on CSF performed
was
perduring
denaturation at 95°C for 30 seconds, annealing at 61°C for 30 seconds, and elongation at 72°C for 1 minute followed by a final extension step at 72°C for an additional 10 minutes. Ten microliters of the second-round PCR products were subjected to electrophoretic migration in 3% agarose gel containing ethidium bromide and were examined with UV light. Each test included a positive control (HSVl DNA) and two negative controls, one of generic DNA without infection and the other of water. To avoid false-positive results caused by contamination, each stage of preparation of the PCR reaction mixture was undertaken in a separate room. The reagents were aliquoted and stored at -2o”C, and specific pipettes were used for each manipulation. PCR products were specific for HSVl DNA; no bands containing CMV, VZV, HSV2, or bacterial DNA were observed after amplification and gel electrophoresis of specimens. In our experience, 12 of 103 samples of CSF of patients suspicious of having herpetic encephalitis showed positive results, for HSVl, but not for HSV2 (data not shown). Other virological methods. Determination of anti-HSV IgG and IgM antibodies was performed with a commercially available enzyme-linked immunosorbent assay (ELISA) (Behring, Marburg, Germany). To determine avidity of antiHSV IgG, after the first step of the usual ELISA procedure, a washing is performed with an 8 mol/L urea-containing solution. The reduction in optical density should be greater than 60% when avidity is high. Anti-IgG was also determined by complement fixation assay (Whittaker, Walkersvielle, Germany). CMV DNA was detected using the primers corresponding to protein pp65 (~~65-1: TACGCGCCGCTCAAGATG, ~~65-11: TGGTGGCGCTGTTCTCC) and probe-pp65
426
GOMEZ
(CGTCAGCAGAACCAGTGGAAAGA).” CMV antigenemia was determined by detection of the pp65 antigen, as previously described.’
DISCUSSION
Viral encephalopathy is a rare complication of renal transplant patients, and is most frequently attributable to infection by viruses of the herpes group.“,13 Other causes of encephalopathy may affect these patients. 14*15Although ganciclovir administration has also been claimed to produce encephalopathy,16 the clinical improvement and disappearance of fever that followed the increase in dose argues against this possibility. Thus, we concluded that our patient was suffering from HSV encephalitis with disseminated primary HSVl infection. The diagnosis was based, in spite of the negativity of CSF viral cultures, on the isolation of HSVl-DNA in CSF, and the negativity of CMV-DNA and VZVDNA. The specificity of the method employed and the controls that were made suggest that the DNA detected is HSVl. Conversely, most of the cases of herpetic encephalitis are produced by HSV 1. Furthermore, HSV 1 was detected in the patient blood. This finding spared the patient the performance of a cerebral biopsy, an aggressive technique with potentially serious side effects, which in addition is not free of false-negative results, especially when the specimen is obtained from a noncolonized area. Although data are not yet available, the results obtained from DNA detection in CSF will prove, with all probability, to be far more reliable than those obtained from serology. This is so because the latency period required to develop the serological response is longer. 17,18Obviously, this period may produce unacceptable delays at the beginning of therapy. Furthermore, many immunosuppressed patients are unable to develop this response, especially when challenged by overwhelming infections. This may have been the case of our patient, as suggested by the lack of IgM seroconversion. The evanescent IgG detection in blood (Fig 3), together with the fact that the IgG detected was of the “high avidity class,” the absence of increase in the IgG levels, and its fast disappearance of blood, all may suggest that this is the result of passive immunization from a blood
ET AL
transfusion performed just before seroconversion. If this is the case, we are facing here another well-documented case of false-positive serological diagnosis. Although primary HSV infections are much less frequent than secondary ones, they are frequently fatal if proper treatment is not begun early.‘g,20 In our group of renal transplants, 95% of the patients (data not shown) are seropositive when grafted. The infection in these seronegative patients may be acquired by nosocomial infection or through the graft. In two previous reports of graft transmission, the infection was due to HSV2 and was characterized in both patients by fulminant hepatitis.20,21 HSVl encephalitis in our patient is exceptional. No cases were found of HSVl encephalitis in renal transplant, even after an extensive Medline search. The fact that our patient developed the infection while receiving a prophylactic dose of ganciclovir may have induced a decreased severity of the infection. Although ganciclovir is not the drug of choice,22 it is active against HSV through a virustatic mechanism, and this may explain the disappearance of symptoms that followed the increase in its dose to full therapeutic range (Fig 2). In conclusion, PCR detection of HSV DNA in CSF is a rapid diagnostic method, which may detect the disease with greater sensibility than conventional viral cultures. The lack of serological response in these patients cannot be considered as proof of absence of infection. REFERENCES 1. Linnerman CC Jr, First MR, Alvira MM, Alexander JW, Schiff GM: Herpes virus type 2 meningoencephalitis following renal transplantation. Am J Med 61:703-708, 1976 2. Kahlon J, Chartterjee S, Lakerman ID, Nahmias AJ, Whitley RJ: Detection of antibodies to herpes simplex virus in the cerebrospinal fluid of patients with herpes simplex encephalitis. J Infect Dis 155:38-44, 1987 3. Hooper DC, Pruitt AA, Rubin RH: Central nervous system infection in the chronically immunosuppressed. Medicine (Baltimore) 61:166-168, 1982 4. Chou J, Kern ER, Whitley RJ, Roizman B: Mapping of herpes simplex virus-l neurovirulence to g 1 34.5, a gene non-essential for growth in culture. Science 2.50:1262-1265, 1990 5. Rowley AH, Whitley RJ, Lakerman FD, Wolinsky SM: Rapid detection of herpes simplex virus DNA in cerebrospinal fluid of patients with herpes simplex encephalitis. Lancet 335440-441, 1991 6. Guffond T, Dewilde A, Lobert PE, Caparros-Lefebvre D, Hober D, Wattre P: Significance and clinical rev-
HERPES
SIMPLEX
ENCEPHALITIS
IN A RENAL
TRANSPLANT
elance of the detection of herpes simplex virus DNA by the polymerase chain reaction in cerebrospinal fluid from patients with presumed encephalitis. Clin Infect Dis 18:744-749,
1994
7. Lakerman FD, Whitley RJ, National Institute of Allergy and Infectious Diseases Collaborative Antiviral Study Group: Diagnosis of herpes simplex encephalitis: Application of polymerase chain reaction to cerebrospinal fluid from brainbiopsied patients and correlation with disease. .I Infect Dis 171:857-863,
1995
8. Gomez E, de Ofia M, Aguado S, Tejada F, Nufiez M, Portal C, Diaz-Corte C, Sanchez E, Ortega F, Alvarez-Grande J: Cytomegalovirus (CMV) preemptive therapy with ganciclovir in renal transplant patients treated with OKT3. Nephron 741367-372, 1996 9. G6mez E, Aguado S, Melon S, Martmez A, De Ofia M, Cimadevilla R, Gorostidi M, Gonzalez E, Alvarez-Grande .I: A prospective study about the usefulness of rapid diagnostic tests in monitoring cytomegalovirus infection in renal transplants. Transplant Proc 24:2631-2633, 1992 10. Aurelius E, Johansson B, Skoldenberg A, S&land A, Forsgren M: Rapid diagnosis of herpes simplex encephalitis by nested polymerase chain reaction assay of cerebrospinal fluid. Lancet 337:189-192, 1991 11. Bitsch A, Kirchner H, Hayes J, Fucke L, Steinhoff J, Sack K, Bein G: The long persistence of CMV DNA in the blood of renal transplant patients after recovery from CMV infection. Transplantation 56: 108-l 13, 1993 12. Donaghy M: Neurological complications, in Morris PJ (ed): Kidney Transplantation. Principles and Practice, chap 26 (ed 3). Philadelphia, PA, Saunders, 1994, pp 356-363 13. Chan CL, Weinstein SS, Wrigth ChE, Bowers VD, Alveranga DY, Shires DL, Ackermann JR, LeFor WW, Kahana L: Encephalopathy associated with OKT3 administra-
427 tion: Possible interaction with indomethacin. Transplantation 52:148-150, 1991 14. Bamborschke S, Wullen T, Huber M, Neveling M, Baldamus CA, Kom K, Jahn G: Early diagnosis and successful treatment of acute cytomegalovirus encephalitis in a renal transplant recipient. J Neurol 239:205-208, 1992 15. Pedneault L, Katz Bz, Miller G: Detection of EpsteinBarr virus in the brain by the polymerase chain reaction. Ann Neurol 32:184-192, 1992 16. Davis CL, Springmeyer S, Gmerek BJ: Central nervous system side effects of ganciclovir. N Engl J Med 322:933-934, 1990 17. Nahmias AJ, Whitley RJ, Visintine AN, Takey Y, Alford CA, Collaborative Antiviral Study Group: Herpes simplex virus encephalitis: Laboratory evaluations and their diagnostic significance. J Infect Dis 145:829-836, 1983 18. Wang HS, Huang SC: Value of serum anti-herpes simplex viral IgM antibody testing in empirical antiviral treatment of herpex simplex encephalitis. J Child Neurol 8:378382, 1993 19. Taylor RH, Saul SH, Dowling JN, Hakala TR, Peel RL, Ho M: Primary disseminated herpes simplex infection with fulminant hepatitis following renal transplantation. Arch Intern Med 141:1519-1521, 1981 20. Konera B, Tzakis AG, DePuydt LE, Demetrius AJ: Transmision of fatal herpes simplex infection through renal transplantation. Transplantation 45:653-656, 1988 21. Matthews T, Boehme R: Antiviral activity and mechanism of action of ganciclovir. Rev Infect Dis lO:S490-S494, 1988 (suppl 3) 22. Dummer JS, Armstrong J, Somers J, Kusne S, Carpenter J, Rosenthal JT, Ho M: Transmission of infection with herpes simplex virus by renal transplantation. J Infect Dis 155:202-206, 1987