Herpes virus-mediated preproenkephalin gene transfer in the ventral striatum mimics behavioral changes produced by olfactory bulbectomy in rats

Brain Research 988 (2003) 43–55 www.elsevier.com / locate / brainres

Research report

Herpes virus-mediated preproenkephalin gene transfer in the ventral striatum mimics behavioral changes produced by olfactory bulbectomy in rats Stefany D. Primeaux a ,1 , Marlene A. Wilson a , Steven P. Wilson a , Amanda N. Guth b , Nadia B. Lelutiu b , Philip V. Holmes b , * a

Department of Pharmacology & Physiology, University of South Carolina School of Medicine, Columbia, SC 29208, USA b Neuroscience and Behavior Program, Department of Psychology, University of Georgia, Athens, GA 30602, USA Accepted 16 July 2003

Abstract The syndrome of behavioral, physiological, and neurochemical changes caused by ablation of the olfactory bulbs (OBX) in rats serves as a reliable and well-validated model of depression. Previous experiments have demonstrated that OBX leads to increased expression of the preproenkephalin (ENK) gene in the olfactory tubercle (OT) portion of the ventral striatum in rats. The aim of the present experiments was to investigate the role of OBX-induced ENK overexpression in the OT in the behavioral abnormalities exhibited by bulbectomized rats. A recombinant herpes virus carrying human preproENK cDNA was used to manipulate ENK gene expression in the OT of bulbectomized and sham-operated rats. Motivational deficits were assessed by the sucrose preference test, and ‘agitation-like’ behaviors were measured with the novel open field and footshock-induced freezing tests. ENK gene transfer in sham-operated rats mimicked some of the effects of OBX; it decreased freezing behavior in response to mild footshock and produced behavioral activation in the open field. In another experiment, virally mediated ENK gene transfer into the OT of intact rats decreased footshock-induced freezing, and this effect was reversed by naltrexone administration. PreproENK gene transfer into the OT did not produce analgesic effects in the tail-flick test. No effects on freezing behavior were observed following preproENK gene transfer into the frontal cortex. An additional experiment revealed that naltrexone administration attenuated the OBX-induced abnormality in freezing behavior. The results indicate that overexpression of the preproENK gene in the ventral striatum may mediate the ‘agitation-like’ behavior exhibited by bulbectomized rats.  2003 Elsevier B.V. All rights reserved. Theme: Disorders of the nervous system Topic: Neuropsychiatric disorders Keywords: Olfactory bulbectomy; Depression; Psychomotor agitation; Animal model; Ventral striatum; Enkephalin

1. Introduction A well-established syndrome of behavioral, physiological, and neurochemical changes resembling those seen in clinical depression emerges in rodents following bilateral ablation of the olfactory bulbs (OBX). These changes typically require 1–2 weeks to develop, last for at least 30 *Corresponding author. Tel.: 11-706-542-3105; fax: 11-706-5423275. E-mail address: [email protected] (P.V. Holmes). 1 Current address: Pennington Biomedical Research Center, 6400 Perkins Road, Baton Rouge, LA 70808, USA. 0006-8993 / 03 / $ – see front matter  2003 Elsevier B.V. All rights reserved. doi:10.1016 / S0006-8993(03)03337-7

days, and occur independently of sensory deprivation [5,23,36,37,42,44]. Behavioral effects of OBX include abnormal, stress-induced increases in locomotor activity and increases in various measures of irritability or impulsivity [4,21,22,24,31,35,38]. Such behaviors resemble psychomotor agitation, a diagnostic criterion for depression [2]. OBX-induced decreases in appetitively motivated behaviors, such as diminished sexual activity and decreased sucrose preference, suggest an ‘anhedonic-like’ state [21,40]. Circadian rhythmicity and sleep patterns are also disrupted in bulbectomized rats [30]. Elevated corticosterone levels have been observed in bulbectomized rats as well [17]. OBX alters adrenergic, serotonergic, and

44

S.D. Primeaux et al. / Brain Research 988 (2003) 43–55

excitatory amino acid receptors in cortical and limbic areas similarly to the receptor alterations observed in suicide victims [9,14,15,23,26,43]. OBX also suppresses immune functions in a manner consistent with the immunosuppression seen in clinical depression [39]. The responses of bulbectomized rats to antidepressant treatments are similar to that of depressed patients. Chronic but not acute administration of a variety of anti-depressant drugs will reverse OBX-induced behavioral and physiological abnormalities [9,17,22,23,25,26,28,39,45]. Alterations in enkephalin (ENK) levels in the nervous system have been observed in depressed patients, and ENK levels are influenced by various antidepressant treatments [8,27,33]. Dysregulation in endogenous ENK systems has also been observed in animal models of depression [13,32,41]. Previous experiments using in situ hybridization and radioimmunoassay have demonstrated that OBX increases levels of preproENK mRNA and met-ENK-like immunoreactivity in the olfactory tubercle (OT) portion of the ventral striatum of rats [13,32]. Enkephalin is preferentially expressed in striatal medium spiny neurons that project to the ventral pallidum [11,12]. Since microinjections of opiate receptor agonists in the ventral striatum and ventral pallidum produce locomotor activation [1,3,18], an increase in the expression of enkephalin in ventral striatal neurons would be expected to produce locomotor hyperactivity. The present experiments were designed to test the hypothesis that the OBX-induced elevations or ‘overexpression’ of enkephalin in the ventral striatum may mediate the stress-induced locomotor activation or ‘agitationlike’ behavior exhibited by bulbectomized rats. The recombinant, replication-defective herpes virus carrying the human preproENK cDNA was used in these experiments to genetically increase ENK production in the OT. Previous research using virally mediated ENK gene transfer in the amygdala suggests both region-specific and transient effects; with peak expression occurring 2–4 days post infection [19,20]. The same procedure was used in the present studies to produce similar region-specific infection and transient ENK gene expression in the OT. Overall, it was predicted that virally mediated preproENK gene transfer in sham-operated rats would produce behavioral effects similar to those caused by OBX. The effects of preproENK gene transfer on an appetitively motivated behavior, sucrose consumption, was examined as well. The first experiment investigated virally mediated ENK gene transfer in bulbectomized and sham-operated rats in the sucrose preference test, the open-field test, and the footshock-induced freezing test. This design afforded a direct statistical comparison between the effect of OBX and that of gene transfer. It also provided the opportunity to assess an alternative hypothesis: ENK overexpression in bulbectomized rats may represent a compensatory response to the lesion that serves to mitigate the ensuing behavioral abnormalities. According to this alternative hypothesis,

preproENK gene transfer might be expected to normalize the behavior of bulbectomized rats. The second experiment investigated the effects of the opiate receptor antagonist naltrexone on the deficits in footshock-induced freezing produced by preproENK gene transfer in the OT. The effects of preproENK gene transfer on tail flick latencies were measured to assess changes in pain sensitivity, and the behavioral effects of preproENK gene transfer in the frontal cortex were examined to determine the anatomical specificity of the observed effects. The effects of naltrexone administration on the behavior of bulbectomized rats was also examined. The aim of this experiment was to determine the extent to which OBX-induced overexpression of endogenous ENK mediates ‘agitation-like’ behavior.

2. Materials and methods

2.1. Subjects and olfactory bulbectomy surgery Experimentally naive male Sprague–Dawley rats (Harlan, Indianapolis, IN, USA) weighing 260–300 g at time of surgery were used. Rats were individually housed following herpes virus mediated gene transfer in a temperaturecontrolled room (2261 8C) on a 12:12 light / dark cycle (lights on at 07.00 h). Food and water were available ad libitum. All experiments were conducted in accordance with the University of Georgia Animal Use and Care Committee and followed the guidelines described in the National Research Council’s Guide for the Care and Use of Laboratory Animals. Olfactory bulbectomy surgeries began 1 week following arrival of the rats at the University of Georgia animal facilities. All surgeries were conducted under aseptic conditions. Following anesthetization with a combination of sodium pentobarbital (Nembutal, 25 mg / kg, i.p.; Abbott Laboratories) and ketamine hydrochloride (Vetamine, 40 mg / kg, i.p.; Mallinckrodt), the scalp was shaved, and a midline incision was made. Two 3 mm diameter burr holes were drilled 6 mm rostral to bregma and 1 mm to the right and left of the midline. The olfactory bulbs were aspirated in bulbectomized rats with a 2 mm diameter plastic pipette tip, and the cavity was filled with Gelfoam (Upjohn) to control bleeding. Special care was taken to avoid damage to the frontal cortex. Sham-operated rats were treated comparably to the bulbectomized rats, however the olfactory bulbs were not removed. An injection of flunixin meglumine (Banamine, 1.1 mg / kg, s.c.; Schering-Plough) was given following surgery for postoperative analgesia.

2.2. Microinjection of recombinant herpes virus Rats were anesthetized with sodium pentobarbital and ketamine hydrochloride as described above, the scalp was shaved, and the head was positioned in a stereotaxic

S.D. Primeaux et al. / Brain Research 988 (2003) 43–55

instrument. A midline incision was made, two burr holes were drilled, and bilateral microinjections were made in the OT / ventral striatum using the coordinates: 1.0 mm anterior to bregma, lateral562.5 mm, and ventral528.5 mm below the skull surface, which roughly corresponds to plate 17 of the rat brain atlas of Paxinos and Watson [29]. Injections consisted of 2 ml of a suspension of either recombinant herpes virus containing human preproENK cDNA (DPE, 2.5310 6 plaque-forming units, pfu), control virus containing lacZ (DPZ, 2.5310 6 pfu), or vehicle (10% glycerol in culture medium) infused over a period of 5 min. An additional period of 5 min was allowed for diffusion before the microsyringe was retracted. All microinjections were made manually with a 10 ml Hamilton syringe. Following surgery, an injection of flunixin meglumine (1.1 mg / kg, s.c.) was given for postoperative analgesia.

2.3. Behavioral effects of virus injections into the OT of olfactory bulbectomized and sham-operated rats: sucrose preference, open-field activity, and footshock-induced immobility Bulbectomized or sham operated rats were randomly assigned to receive injections of either the DPE (ENK) or vehicle (VEH) virus. The four conditions for these experiments were thus OBX-DPE, OBX-VEH, SHAM-DPE, SHAM-VEH. The timing of behavioral testing following virus injections was based on previous experiments defining the time course of virus-induced gene expression and behavioral changes [19,20]. Sucrose preference testing began 1 day prior to microinjections of virus, which corresponded to 11 days following bulbectomy / sham surgeries. Measurements of sucrose and water consumption continued for an additional 4 days following microinjections. Each rat had continuous access to a water bottle containing tap water and a water bottle containing 1% sucrose / water solution in the home cage. Placement of water bottles was counterbalanced in an attempt to counter potential position preferences. Measurement of water and sucrose / water consumption consisted of weighing the water bottles. Sucrose preference testing began at 08.30 h and consumption was subsequently measured every 11–13 h. Testing ended at 08.30 h, 4 days following microinjections. A sucrose preference score was calculated for each day, with sucrose preference5(sucrose intake / total intake)3100. Open-field testing began on the second day following microinjection of virus and took place between 09.00 and 12.00 h. The open-field apparatus was a four-sided 503 50343 cm, Plexiglas chamber with a black painted floor and transparent sides. A 150 W light was attached to a video camera 1 m above the floor of the chamber. Animals were individually transported into the testing room and placed into the center of the open-field apparatus. Immobility and distance traveled were measured with an

45

automated video image analyzer (Videomex-V; Columbus Instruments) programmed to concurrently record activity in a central 15 cm 2 area, the perimeter, and the entire openfield. An experimenter unaware of the rat’s experimental condition recorded rearing and the number of fecal boli. Each subject was tested for one 3-min period. A white noise generator provided low level masking noise. The chamber was cleaned with a 10% chlorine bleach solution between each subject. On the third day following microinjections, animals were tested in a footshock-induced immobility paradigm. Testing took place between 09.00 and 12.00 h. Rats were placed in a Lafayette shuttlebox apparatus (Lafayette Instruments), which consists of a chamber measuring 603 21319 cm with two 6 W bulbs, encased in the lid of the chamber. The primary behavioral measure in this test is immobility or ‘freezing’ behavior, which is defined as the lack of movement except for that associated with respiration. During a 3-min habituation period prior to footshock, the number of crossings of the midline of the chamber and the total duration of immobility were measured. Following this period, rats were given three, 2 s, 0.3 mA scrambled footshocks at 20 s intervals. Current was delivered by a Lafayette scrambled shock generator (Model 82404 / 5-SS). Following the footshocks, rats were observed for 10 min and crossings of the midline, and total duration of freezing behavior were measured. Observations were made through a one-way window by an experimenter unaware of the rats’ group assignments. The chamber was cleaned with a 10% chlorine bleach solution between each subject.

2.4. Behavioral effects of virus injections into the OT of intact rats: naltrexone antagonism A separate experiment was conducted in intact rats to determine whether the effects of preproENK gene transfer could be reversed by naltrexone. The effect of DPE or DPZ virus on footshock-induced freezing behavior was examined in a group of previously unoperated rats. A group receiving injections of glycerol vehicle was included as an additional control to detect the possible influence of viral infection alone. Rats were randomly assigned to the following conditions: DPE, DPZ, or VEH. Microinjections began 2 weeks following arrival to the facility and were performed using the same procedures and doses described above. Rats injected with DPE were further divided into two groups receiving either six injections of naltrexone (7 mg / kg i.p.; Sigma–Aldrich) or saline administered twice daily for 3 days. Three days following microinjections, animals were tested in a footshock-induced immobility paradigm as described above. On the following day, tail flick latencies to radiant heat were measured in all subjects using an automated analgesia meter system (IITC Model 3). Rats were placed on a transparent surface and were covered by an inverted 20310310 cm plastic tub cage. A radiant heat

46

S.D. Primeaux et al. / Brain Research 988 (2003) 43–55

source was focused 2 cm from the tip of the tail and the latency to withdraw the tail was automatically recorded. A cutoff of 15 s maximal latency was imposed. Each rat received five trials with inter-trial intervals of 5 min. The mean latencies for trials 2–5 were recorded for each rat.

2.5. Behavioral effects of virus injections into the frontal cortex of intact rats A separate group of previously unoperated rats received microinjections of either DPE or DPZ virus into the frontal cortex. Microinjections of DPE or DPZ were performed as described above except injections were targeted to the following coordinates: 1.0 mm anterior to bregma, lateral5 62.5 mm, and ventral522.5 mm below the skull surface [29]. Three days following microinjections, animals were tested in a footshock-induced immobility paradigm as described above.

2.6. Behavioral effects of naltrexone administration in olfactory bulbectomized rats An additional experiment was conducted to determine whether the abnormal, stress-induced increase in locomotor activity exhibited by bulbectomized rats could be reversed by naltrexone. Rats received OBX or sham surgery as described above. Two weeks following surgery, rats were treated with naltrexone (7 mg / kg i.p.; Sigma– Aldrich) or saline and were placed in the footshockinduced immobility apparatus 20 min later and tested as described above.

2.7. Histological procedures On the day following the final behavioral procedure, rats were euthanized by rapid decapitation and olfactory bulb lesions were confirmed by visually assessing brain tissue and by weighing any remaining olfactory bulb tissue as previously described [13,31]. The criterion for a sufficient lesion to the olfactory bulb is a tissue weight of less than 30% of the tissue weight of an intact olfactory bulb. Four rats were excluded from the experiment because lesions failed to meet this criterion. Brains were removed, frozen on dry ice, and stored at 280 8C. Proper placement of microinjections was assessed by sectioning brains using a Microm cryostat and noting the mechanical damage caused by the needle and the presence of red, necrotic tissue surrounding the needle tract and injection site. The criterion for acceptable placement of the needle terminus was broad, including an area covering a region of the ventral striatum 2 mm medial–lateral, 1 mm anterior–posterior, and 1 mm dorsal–ventral from the target coordinates given above, which corresponds to plate 17 of the rat brain atlas of Paxinos and Watson [29]. This region is primarily comprised of the OT, though other ventral striatal structures are contained in this area as well. Evidence of injection sites within this region was observed

in all but one subject receiving virus injections, and this subject was removed from the experiment. b-Galactosidase histochemical staining was also used to verify microinjection coordinates and to confirm gene transfer. Two naive male Sprague–Dawley rats weighing approximately 300 g were used for verification of herpes virus-mediated gene transfer. Rats were unilaterally injected in the OT with the DPZ virus encoding lacZ as described above. Rats were killed by rapid decapitation 2 days following gene transfer surgery. Brains were frozen on dry ice, and 12 mm sections were sliced using a Microm cryostat. Sections were mounted on gelatin / chromium potassium sulfate-coated microscope slides. Slides were stained using a b-galactosidase histochemical stain [7]. The working stain was made immediately prior to use by combining distilled H 2 O, 0.5 M NaPi (pH 7.6), 1 M MgCl 2 , 250 mM K 4 Fe(CN) 6 , 250 mM K 3 Fe(CN) 6 and 50 mg / ml X-Gal. The slides were rinsed three times in 0.1 M NaPi (pH 7.6), and placed on a flat glass plate with 100 ml of working stain added to each slide. Slides were covered with parafilm and incubated for 20–24 h in a humid chamber at 37 8C. After removal from the humid chamber, the slides were rinsed with 0.1 M NaPi (pH 7.6). A purple / blue stain on the affected tissue indicates evidence of herpes virus mediated gene transfer. Slides were then counterstained with Neutral Red (Sigma–Aldrich).

2.8. Verification of virus-mediated alterations in preproENK gene expression in the OT by reverse transcriptase polymerase chain reaction The herpes virus encoding human preproENK (DPE, 2.03106 pfu / ml) was injected unilaterally into the left OT of two rats, while the control virus encoding b-galactosidase (DPZ, 2.03106 pfu / ml) was injected unilaterally into the right OT of the same rats. Expression of human preproENK following injection of DPE or DPZ constructs was assessed by reverse transcriptase polymerase chain reaction (RT-PCR). Four days following injections, rats were killed by rapid decapitation and each OT was dissected on ice and immediately homogenized in RNA lysis buffer (Ambion, Austin, TX, USA) for 20 s using a motorized tissue homogenizer (Tekmar, Cincinnati, OH, USA). RNA from the OT was isolated using RNAqueous procedures (Ambion). Briefly, 64% aqueous ethanol was added to lysate, and the lysate / ethanol mixture was filtered through a vacuum manifold apparatus. Following several washes, elution solution was added to the filter cartridges and heated for 10 min at 70 8C. The eluate was recovered by centrifugation and subjected to a lithium chloride precipitation procedure. The remaining pellet was washed with cold 70% ethanol, recentrifuged and the supernatant was aspirated. Pellets were reconstituted with diethylpyrocarbonate (DEPC) treated water and stored at 280 8C. RT-PCR was performed using the Enhanced Avian HS-RT-PCR kit (Sigma, St. Louis, MO, USA) with primers selective for human (compared to rat) preproENK.

S.D. Primeaux et al. / Brain Research 988 (2003) 43–55

The following primers were used: human preproENK 59TCAAGATGGCACCAGCACC-39 and 59-AACTTTCGCCTTCTTCGTCG-39 [518 base pairs (bp)] and cyclophilin 59-TCAACCCCACCGTGTTCTTC-39 and 59AGACCACATGCTTGCCATCC39 (381 bp). For RT, 3 ml of RNA was added to oligo (dT)23 and incubated in a thermal cycler (Eppendorf, Mastercycler gradient) for 10 min at 75 8C. Tubes were removed, placed on ice, and then RT buffer, dNTP mix, RT, and RNase inhibitor was added. Tubes were vortexed and returned to the thermal cycler for 15 min at 25 8C and then 50 min at 45 8C. For PCR, 5 ml of the RT reaction product was added to 103 AccuTaq buffer, JumpStart AccuTaq LA DNA polymerase mix, and deoxynucleotide mix. The cycling parameters consisted of an initial denaturation period of 4.5 min at 95 8C, followed by a 30 s denaturation period at 95 8C, a 30 s annealing period at 55 8C and a 45 s extension period at 72 8C. Amplified fragments were separated by gel electrophoresis on a 1.5% agarose gel in 89 mM Tris-borate, 2.5 mM EDTA, pH 8.3 and 0.001% ethidium bromide with 10 ml of PCR product added to each lane. Cylophilin expression was used to normalize mRNA levels, although amplification of cyclophilin and human preproENK were performed separately to optimize cycling parameters and to insure data collection from the exponential phase of the reaction. Band intensity for human preproENK (34 cycles) was compared to cyclophilin bands (24 cycles) using the Kodak Electrophoresis Documentation and Analysis System (EDAS) 290.

47

2.9. Statistical analysis Behavioral data were analyzed by one-way or 232 between subjects analyses of variance (ANOVAs). In the sucrose preference test, OBX / SHAM comparisons prior to herpes mediated gene transfer were analyzed by t-test. Difference in preproENK and cyclophilin band intensities were analyzed by t-test. The significance level for all tests was set at P,0.05.

3. Results

3.1. Sucrose preference OBX significantly reduced sucrose preference prior to preproENK gene transfer, t(43)521.735, P,0.05, but did not affect sucrose intake, water intake, or total fluid intake. Following the virus injection procedure, neither OBX / SHAM surgery nor preproENK gene transfer affected sucrose preference or water intake on days 3, 4, or 5, nor were significant interactions between the experimental conditions detected.

3.2. Open field activity Bulbectomized rats produced more fecal boli, F(1,40)5 28.153, P,0.001 (Fig. 1), and reared more, F(1,40)5 10.716, P,0.01 (Fig. 2), than sham-operated rats in the

Fig. 1. Effects of olfactory bulbectomy (OBX) and enkephalin (ENK) gene transfer on fecal boli counts in a novel open field. Rats underwent OBX or sham surgery and received injections of vehicle or DPE (ENK) virus into the ventral striatum 2 weeks later. Open field testing was conducted 2 days later. Data are presented as means6S.E.M. * Main effect of OBX (P,0.05). n59–12 rats per group.

48

S.D. Primeaux et al. / Brain Research 988 (2003) 43–55

Fig. 2. Effects of olfactory bulbectomy (OBX) and enkephalin (ENK) gene transfer on rearing behavior in a novel open field. Rats underwent OBX or sham surgery and received injections of vehicle or DPE (ENK) virus into the ventral striatum 2 weeks later. Open field testing was conducted 2 days later. Data are presented as means6S.E.M. * Main effect of OBX (P,0.05). n59–12 rats per group.

open field. No significant interactions for these measures were detected. PreproENK gene transfer did not significantly affect the number of fecal boli or the number of rears. Distance traveled in the perimeter of the open-field was significantly increased by preproENK gene transfer F(1,40)54.029, P,0.05, but not affected by OBX / SHAM

surgery (Fig. 3). Planned comparisons revealed a significant increase in distance traveled in the perimeter of the open-field in SHAM-DPE (ENK)-treated rats as compared to SHAM-VEH treated rats, t(20)522.232, P,0.05. No difference was found in distance traveled between OBXDPE (ENK) and OBX-VEH treated rats. Neither distance

Fig. 3. Effects of olfactory bulbectomy (OBX) and enkephalin (ENK) gene transfer on distance traveled in the perimeter of a novel open field. Rats underwent OBX or sham surgery and received injections of vehicle or DPE (ENK) virus into the ventral striatum 2 weeks later. Open field testing was conducted 2 days later. Data are presented as means6S.E.M. * Significantly different from SHAM-VEH (P,0.05). n59–12 rats per group.

S.D. Primeaux et al. / Brain Research 988 (2003) 43–55

traveled in the center of the open-field, nor total distance in the open-field, nor duration of immobility were affected by OBX / SHAM surgery or viral construct.

3.3. Footshock-induced freezing The duration of immobility following footshock was significantly reduced in bulbectomized rats, F(1,40)5 9.346, P,0.005 (Fig. 4). A main effect of virus administration on freezing was also found, F(1,40)55.261, P, 0.05. Planned comparisons revealed a significant decrease in duration of immobility in SHAM-DPE (ENK)-treated rats as compared to SHAM-VEH treated rats, t(19)53.723, P,0.01. No difference in the duration of immobility was found between OBX-DPE (ENK) and OBX-VEH rats. Bulbectomized rats made more crossings of the midline following footshock than did sham-operated rats, F(1,40)57.183, P,0.01. No significant main effect of viral construct was detected on this measure.

3.4. Effects of naltrexone administration on the behavioral effects of preproENK gene transfer No differences were found between rats receiving vehicle injections and rats receiving DPZ injections on the freezing duration following footshock. Therefore, these groups were combined to form one control group. A significant difference was found on time spent freezing following footshock F(2,22)58.977, P,0.001 (Fig. 5). Bonferroni post-hoc tests revealed DPE (ENK)-treated rats receiving saline spent less time freezing than either DPE

49

(ENK)-treated rats receiving naltrexone (P50.003) or control rats (P50.005). No difference was found between DPE (ENK)-treated rats receiving naltrexone or control rats. No differences were found between rats receiving vehicle injections and rats receiving DPZ injections on latency to tail flick. Therefore, these groups were combined to make a single control group. No differences were found on latency to tail flick between rats in the control group, DPE (ENK)-treated rats receiving saline, or DPE (ENK)-treated rats receiving chronic naltrexone injections. Mean latencies ranged from 4.0 to 6.2 s.

3.5. Effects of preproENK gene transfer into the frontal cortex on footshock-induced freezing No differences were observed between rats injected in the frontal cortex with DPE (ENK) and DPZ (lacZ). Mean durations of freezing were 526 s (655 S.E.M.) for the DPE group and 461 s (613 S.E.M.) for the DPZ group.

3.6. Effects of naltrexone administration on the behavior of bulbectomized rats Bulbectomized rats exhibited the typical deficits in defensive freezing observed in this test. Two-way ANOVA revealed a significant main effect of surgery, F(1,24)5 6.38, P,0.05, but no significant main effect of drug treatment. Planned comparisons revealed a significant difference between sham-operated and bulbectomized rats treated with saline, t(13)52.31, P,0.05. Though no

Fig. 4. Effects of olfactory bulbectomy (OBX) and enkephalin (ENK) gene transfer on footshock-induced freezing. On the third day following injections of lacZ or ENK virus into the ventral striatum, bulbectomized and sham-operated rats were tested in the footshock-induced freezing paradigm. Data are presented as means6S.E.M. * Significantly different from VEH (P,0.05). n59–12 rats per group.

50

S.D. Primeaux et al. / Brain Research 988 (2003) 43–55

Fig. 5. Effects of naltrexone on the deficits in freezing behavior induced by ENK gene transfer in intact rats. Rats received injections of glycerol vehicle, DPZ (lacZ), or DPE (ENK) virus into the ventral striatum and were tested for footshock-induced freezing 3 days later. Half of the DPE (ENK)-treated rats received twice-daily injections of naltrexone (NAL, 7 mg / kg i.p.) during this period and the other half received similar saline (SAL) injections. No significant differences between glycerol-treated (VEH) and DPZ (lacZ)-treated rats were observed, so the two groups were collapsed as a single control group. Data are presented as means6S.E.M. * Significantly different from control and ENK / NAL (P,0.05). n58–10 rats per group.

significant interaction between surgery and drug treatment was observed, planned comparisons between bulbectomized rats treated with saline and bulbectomized rats treated with naltrexone revealed a marginally significant difference, t(14)521.7, P50.052, suggesting that naltrexone pretreatment attenuated the deficits in freezing behavior in bulbectomized rats. No significant differences were observed for baseline (preshock) behaviors or postshock crossings of the chamber (Fig. 6).

3.7. Histology b-Galactosidase histochemical staining was evident in the ventral striatum of rats treated with DPZ for the purposes of verifying gene transfer and microinjection coordinates (Fig. 7). Staining was also evident in the frontal cortex of rats tested in the footshock-induced freezing paradigm for the purposes of determining the anatomical specificity of gene transfer (data not shown).

3.8. Reverse transcriptase polymerase chain reaction analysis of virus-mediated preproENK gene transfer in the OT RT-PCR analysis revealed increases in human preproENK gene expression in the OT following herpes virus mediated gene transfer. Band intensities were used to determine the amount of human preproENK in the OT following injection of the herpes virus encoding for human preproENK. Human preproENK / cyclophilin densities were increased in the OT 4 days following viral injections,

t(2)521.75, P,0.01, as compared to rats injected with control (b-galactosidase) virus (Figs. 8 and 9).

4. Discussion The aim of these experiments was to investigate the role that increased ENK gene expression in the OT might play in the enhanced stress-induced locomotor activation exhibited by olfactory bulbectomized rats. Previous studies have revealed that OBX increases the expression of the preproENK gene in the OT [13,32]. Since opiate receptor activation in the basal ganglia stimulates locomotion [1,3,18,34], OBX-induced increases in endogenous opioid transmission in the ventral striatum may mediate the behavioral activation observed in bulbectomized rats. In the present experiments, OBX produced the expected increases in rearing and defecation in a novel, brightly lit open field. Virally mediated increases in ENK did not influence these measures. Virally mediated ENK gene transfer increased distance traveled in the perimeter of the open field. This effect has been reliably observed in bulbectomized rats in previous experiments [31]. However, in the present experiment, OBX did not increase perimeter distance traveled. The surgical manipulation 2 days prior to testing is the major procedural difference between the present and previous studies that may account for the lack of expected effects in the open field test. Although locomotor activity in a novel, brightly lit open field is probably the most common measure of OBXrelated behavior, previous work from this laboratory

S.D. Primeaux et al. / Brain Research 988 (2003) 43–55

51

Fig. 6. Effects of naltrexone on the deficits in freezing behavior induced by OBX. Rats underwent olfactory bulbectomy (OBX) or sham surgery and were tested for footshock-induced freezing 14 days later. Twenty minutes prior to testing rats received either naltrexone (NAL, 7 mg / kg, i.p.) or saline. Data are presented as means6S.E.M. * Significantly different from Sham / Saline (P,0.05). 1 Marginally significant difference from OBX / Saline (P50.052). n56–8 rats per group.

Fig. 7. Representative photomicrograph of a section through the ventral striatum of a rat injected with DPZ (lacZ). The dark blue / purple areas indicate b-galactosidase histochemical staining. Sections were counterstained with neutral red. ICj: Islands of Calleja; ON: optic nerve; OT: olfactory tubercle.

52

S.D. Primeaux et al. / Brain Research 988 (2003) 43–55

Fig. 8. Semi-quantitative RT-PCR was conducted to determine if herpes virus mediated gene transfer of human preproENK increased gene expression in the olfactory tubercle 4 days post injection. Human preproENK (DPE) was injected unilaterally into the left OT, while the control virus encoding b-galactosidase (DPZ) was injected unilaterally into the right OT. Human preproENK / cyclophilin densities suggest an increase in human peproENK gene expression in the OT of rats following viral injections. * P,0.05.

indicates that measuring the freezing response to mild footshock may be a more sensitive index of the stressinduced locomotor activation exhibited by bulbectomized rats [31,32]. One distinct advantage of this technique is the greater control over the stressful stimulus (i.e., footshock over novelty). In the present experiments, bulbectomized rats exhibited less immobility than sham-operated controls in the footshock-induced freezing test, as expected. Virally mediated ENK gene transfer in sham-operated rats mimicked the effects of OBX. Bulbectomized rats also showed the expected increases in locomotor activity following footshock as measured by chamber crossings. Virally mediated ENK gene transfer tended to increase activity by this measure, but this effect did not reach statistical significance. Bulbectomized rats consumed less of a 1% sucrose solution than sham-operated controls, as previously re-

ported [40]. This effect is consistent with an ‘anhedonialike’ process induced by OBX. ENK gene transfer produced no consistent effects on sucrose preference or total intake of sucrose solution or water, and no interactions between ENK gene transfer and OBX surgery were observed. The present results therefore suggest that OBXinduced overexpression of ENK is not directly involved in the decreased sucrose preference exhibited by bulbectomized rats. However, OBX-induced ENK overexpression and ‘anhedonic-like’ behavior may both be linked to changes in ventral striatal dopamine functions. Decreased appetitively motivated behavior in bulbectomized rats may be mediated by the putative changes in dopamine transmission caused by OBX [16]. Such dysregulation in dopamine transmission may also lead to increased striatal ENK expression [10], which may in turn mediate some of the other behavioral abnormalities in bulbectomized rats.

Fig. 9. Electrophoretic gels from RT-PCR analysis of human preproENK and cyclophilin products. Virus encoding human preproENK (DPE) was injected unilaterally into the left OT, while the control virus encoding b-galactosidase (DPZ) was injected unilaterally into the right OT of the same animals. Expected size of human preproENK was 518 bp and cyclophilin was 381 bp.

S.D. Primeaux et al. / Brain Research 988 (2003) 43–55

In a separate experiment, the effect of virally mediated ENK gene transfer on footshock-induced freezing was replicated in intact rats. This effect was reversed by repeated injections of the opiate receptor antagonist naltrexone, suggesting that the behavioral activation produced by ENK gene transfer was mediated by enhanced opioid transmission. Comparisons between rats treated with the DPZ (lacZ) virus and vehicle revealed that viral infection alone was not responsible for the observed behavioral effects of ENK gene transfer. The differences observed between DPE (ENK) and DPZ (lacZ)-treated rats in the first experiment further support this conclusion. Virally mediated ENK gene transfer in the OT did not affect tail flick latencies. This result indicates that the decreased immobility following footshock caused by gene transfer was not due to analgesic effects. Naltrexone administration attenuated the deficits in footshock-induced freezing behavior exhibited by bulbectomized rats. Though the difference between bulbectomized rats treated with saline and those treated with naltrexone was only marginally significant, the partial reversal of OBX-induced behavioral deficits suggest that opiate receptor activation plays a role in this test. Taken together with the results of the gene transfer experiments, these results suggest that increased ENK transmission in the ventral striatum is both sufficient and necessary for some of the abnormalities in locomotor behavioral exhibited by bulbectomized rats. However, the extent to which preproENK overexpression is involved in the ‘agitation-like’ behavior of bulbectomized rats is limited, as not all behavioral measures of this syndrome were influenced by gene transfer (e.g., rearing and defecation in the open field). It is likely that the dysregulation in other neurotransmitter systems in other brain regions that is caused by OBX contributes to the abnormalities in ‘agitation-like’ behavior as well [23,24]. Indeed, one of the strengths of the OBX model derives from the fact that, like depression, it involves myriad behavioral abnormalities and perturbations in multiple neurotransmitter systems. The present studies provide evidence that dysregulation in a single neurotransmitter system, enkephalin, may play a role in some specific symptoms related to psychomotor agitation. Nonetheless, employing the OBX model to study the neurobiological basis of other depression symptoms requires further investigation of abnormalities in multiple neurotransmitter systems and the interactions between these systems. Histological analysis using b-galactosidase histochemical staining confirmed gene transfer and demonstrated that the coordinates used for virus injections targeted the OT portion of the ventral striatum (see Fig. 7). The anatomical specificity of the effects of ENK gene transfer in the OT was also demonstrated by the lack of effect of frontal cortical DPE (ENK) injections on footshock-induced freezing. Though the presence of b-galactosidase histochemical staining in the frontal cortex indicated successful gene

53

transfer, no differences in footshock-induced freezing were observed between DPE (ENK)-transfected rats and controls following injections into the frontal cortex. The capacity for the herpes viral vector to specifically induce expression of the preproENK gene was demonstrated by RT-PCR. Although in situ hybridization analyses using oligonucleotide probes revealed increases in preproENK mRNA in bulbectomized rats as previously reported [13,32], no changes were observed following virally mediated gene transfer (data not shown). This result suggests that oligonucleotide-based in situ hybridization may not be sensitive enough to detect the effects of the DEP virus. It also suggests that a relatively low level increase in preproENK gene expression in the OT is sufficient to modify behavior. The present findings reveal a possible neurobiological basis for the psychomotor agitation that frequently occurs in clinical depression. Many aspects of the behavioral syndrome associated with OBX have been previously characterized as an ‘agitation-like’ phenomenon, and psychomotor agitation serves as a diagnostic criterion for typical, major depressive episodes [2]. Though this symptom includes a cognitive component of anxiety, which cannot be directly measured in rats, psychomotor agitation may also be defined behaviorally as an abnormal increase in motor activity in response to stress. This operational definition is easily amenable to behavioral paradigms in rats. The enhanced locomotor activity following stress does not appear to be the result of decreased defensive or fear-related behavior for the following reasons: Bulbectomized rats do not show increased activity in the center of a novel open field [31], which would be expected following a manipulation that reduces fear-related behavior. Bulbectomized rats also produce more fecal boli in the open field and footshock induced freezing test (Ref. [31] and present results). The behavioral pattern in bulbectomized rats is thus better characterized analogously to psychomotor agitation. The present results suggest that ENK overexpression may contribute to the ‘agitation-like’ phenomenon in bulbectomized rats, and clinical evidence reveals similar neurochemical changes in depressed patients as well. Previous clinical studies have reported increased levels of ENK in the cerebrospinal fluid of depressed patients [27]. Although the anatomical specificity of this effect has yet to be determined, other clinical studies using neuroimaging techniques suggest dysregulation in striatal circuits that may lead to ENK overexpression. Neuroimaging studies with dopamine receptor ligands have revealed that depressed patients exhibit increased densities of striatal D-2 receptors [6]. This upregulation may result from alterations in dopamine transmission. Since decreases in dopamine transmission elevate ENK gene expression in striatal neurons [10] it is reasonable to speculate that ENK overexpression may occur in the ventral striatum of depressed patients. Further studies of ENK dysregulation

54

S.D. Primeaux et al. / Brain Research 988 (2003) 43–55

in animal models and depressed patients may shed new light on the role of endogenous opioid systems in the etiology and symptoms of depression.

[17]

Acknowledgements

[18]

This work was supported by a Public Health Service grant [MH59317 to P.V.H.

[19]

References [1] M. Amalric, G. Koob, Low doses of methylnaloxonium in the nucleus accumbens antagonize hyperactivity induced by heroin in the rat, Pharmacol. Biochem. Behav. 23 (1985) 411–415. [2] American Psychiatric Association, Diagnostic and Statistical Manual of Mental Disorders, 4th Edition, American Psychiatric Association, Washington, DC, 1994. [3] M.C. Austin, P.W. Kalivas, Blockade of enkephalinergic and GABAergic mediated locomotion in the nucleus accumbens by muscimol in the ventral pallidum, Jpn. J. Pharmacol. 50 (1989) 487–490. [4] H.D. Baumbach, M.H. Sieck, Temporal effects of discrete lesions in the olfactory and limbic systems on open field behavior and dyadic encounters in male hooded rats, Physiol. Behav. 18 (1977) 617–637. [5] D.J. Calcagnetti, L.A. Quatrella, M.D. Schechter, Olfactory bulbectomy disrupts the expression of cocaine-induced conditioned place preference, Physiol. Behav. 59 (1996) 597–604. [6] H. D’haenen, A. Bossuyt, Dopamine D2 receptors in the brain measured with SPECT, Biol. Psychiatry 35 (1994) 128–132. [7] A.T. Dobson, T.P. Margois, F. Sedarati, J.G. Stevens, L.T. Feldman, A latent, nonpathogenic HSV-1-derived vector stably expresses bgalactosidase in mouse neurons, Neuron 5 (1990) 353–360. [8] M. Dziedzicka-Wasylewska, R. Rogoz, The effect of prolonged treatment with imipramine and electroconvulsive shock on the levels of endogenous enkephalins in the nucleus accumbens and the ventral tegmentum of the rat, J. Neural Transm. 102 (1995) 221–228. [9] B. Early, M. Glennon, M. Lally, B.E. Leonard, J.L. Junien, Autoradiographic distribution of cholinergic muscarinic receptor and serotonin 2 receptors in olfactory bulbectomized (OB) rats after chronic treatment with miasnserin and desipramine, Hum. Psychopharmacol. 9 (1994) 397–407. [10] C.R. Gerfen, J.F. McGinty, W.S. Young, Dopamine differentially regulates dynorphin, substance P and enkephalin expression in striatal neurons: In situ hybridization histochemical analysis, J. Neurosci. 11 (1991) 1016–1031. [11] A.M. Graybiel, Neurotransmitters and neuromodulators in the basal ganglia, Trends Neurosci. 13 (1990) 244–254. [12] L. Heimer, D.S. Zahn, G.F. Alheid, Basal ganglia, in: G. Paxinos (Ed.), The Rat Nervous System, Academic Press, San Diego, CA, 1995, pp. 579–628. [13] P.V. Holmes, Olfactory bulbectomy increases preproENKephalin mRNA levels in the ventral striatum in rats, Neuropeptides 33 (1999) 206–211. [14] Y.-J. Ho, T.-M. Liu, Z.-H. Wen, R.S.-S. Chow, Y.-R. Tsai, C.-S. Wong, Effects of olfactory bulbectomy on NMDA receptor density in the rat brain: [3-H] MK-801 binding assay, Brain Res. 900 (2001) 214–218. [15] K.W. Hong, W.S. Lee, B.Y. Rhim, Role of central alpha-2-adrenoceptors on the development of muricidal behaviors in olfactory bulbectomized rats: effect of alpha-2-adrenoceptors antagonists, Physiol. Behav. 39 (1987) 535–539. [16] K. Iwasaki, M. Fujiwara, S. Shibata, S. Ueki, Changes in brain

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29] [30]

[31]

[32]

[33]

[34]

[35]

[36]

catecholamine levels following olfactory bulbectomy and the effect of acute and chronic administration of desipramine in rats, Pharmacol. Biochem. Behav. 24 (1986) 1715–1719. J.A. Jesberger, J.S. Richardson, Effects of antidepressant drugs on the behavior of olfactory bulbectomized and sham-operated rats, Behav. Neurosci. 100 (1986) 256–274. P.W. Kalivas, E. Widerlov, D. Stanley, G. Breese, A.J. Prange, Enkephalin action on the mesolimbic system: a dopamine-dependent and a dopamine-independent increase in locomotor activity, J. Pharmacol. Exp. Ther. 227 (1983) 229–237. W. Kang, M.A. Wilson, M.A. Bender, J. Glorioso, S.P. Wilson, Herpes virus-mediated preproenkephalin gene transfer to the amygdala is antinociceptive, Brain Res. 792 (1998) 133–135. W. Kang, S.P. Wilson, M.A. Wilson, Overexpression of proenkephalin in the amygdala potentiates the anxiolytic effects of benzodiazepines, Neuropsychopharmacology 22 (2000) 77–88. J.P. Kelly, B.E. Leonard, An investigation of the hyperactive response in the olfactory bulbectomised rat model of depression, Med. Sci. Res. 23 (1995) 837–838. J.P. Kelly, B.E. Leonard, Effects of chronic desipramine on waiting behaviour for a food reward in olfactory bulbectomized rats, J. Psychopharmacol. 10 (1996) 153–156. J.P. Kelly, A.S. Wrynn, B.E. Leonard, The olfactory bulbectomized rat as a model of depression: an update, Pharmacol. Ther. 74 (1997) 299–316. A.R. Lumia, M.H. Teicher, F. Salchli, E. Ayers, B. Possidente, Olfactory bulbectomy as model for agitated hyposerotonergic depression, Brain Res. 587 (1992) 181–185. C. McGrath, T.R. Norman, The effect of venlafaxine treatment on the behavioural and neurochemical changes in the olfactory bulbectomised rat, Psychopharmacology 136 (1998) 394–401. N.T. Mudunkotuwa, R.W. Horton, Desipramine administration in the olfactory bulbectomized rat: changes in brain b-adrenoceptor and 5-HT2A binding sites and their relationship to behavior, Br. J. Pharmacol. 117 (1996) 1481–1486. F. Nyberg, L. Terenius, Neurochemical methods in the study of the role of endorphins in psychiatric disorders, in: R.J. Rodgers, S.J. Cooper (Eds.), Endorphins, Opiates and Behavioural Processes, Wiley, New York, 1988, pp. 311–325. W.T. O’Connor, B.E. Leonard, Behavioural and neuropharmacological properties of the dibenzazepines, desipramine and loepramine: studies on the olfactory bulbectomized rat model of depression, Prog. Neuro-Psychopharmacol. Biol. Psychiatry 12 (1988) 41–51. G. Paxinos, C. Watson, The Rat Brain in Stereotaxic Coordinates, 3rd Edition, Academic Press, San Diego, CA, 1997. B. Possidente, A.R. Lumia, M.Y. McGinnis, C. Pratt, C. Page, Chronological dimensions of an olfactory bulbectomized rodent animal model for agitated depression, Biol. Rhythm Res. 31 (2000) 416–434. S.D. Primeaux, P.V. Holmes, Role of aversively-motivated behavior in the olfactory bulbectomy syndrome, Physiol. Behav. 67 (1999) 41–47. S.D. Primeaux, P.V. Holmes, Olfactory bulbectomy increases metenkephalin and neuropeptide-Y-like immunoreactivity in rat limbic structures, Pharmacol. Biochem. Behav. 67 (2000) 331–337. R. Przewlocki, W. Lason, J. Turchan, B. Przewlocka, Imipramine induces alterations in proenkephalin and prodynorphin mRNAs level in the nucleus accumbens and striatum in the rat, Polish J. Pharmacol. 49 (1997) 351–355. S. Schildein, A. Agmo, J.P. Huston, R.K.W. Schwarting, Intraaccumbens injections of substance P, morphine, and amphetamine: effects on conditioned place preference and behavioral activity, Brain Res. 790 (1998) 185–194. M.H. Sieck, Selective olfactory system lesion in the rats and changes in appetitive and aversive behavior, Physiol. Behav. 10 (1972) 731–739. M.H. Sieck, H.D. Baumbach, Differential effects of peripheral and

S.D. Primeaux et al. / Brain Research 988 (2003) 43–55

[37]

[38]

[39]

[40]

central anosmia producing techniques on spontaneous behavior patterns, Physiol. Behav. 13 (1974) 407–425. M.H. Sieck, H.D. Baumbach, B.L. Gordon, J.F. Turner, Changes in spontaneous, odor modulated and shock induced behavior patterns following discrete olfactory system lesions, Physiol. Behav. 13 (1974) 427–439. M.H. Sieck, B.L. Gordon, Selective olfactory bulb lesions: reactivity changes and avoidance learning in rats, Physiol. Behav. 9 (1972) 545–552. C. Song, B.E. Leonard, Serotonin reuptake inhibitors reverse the impairments in behavior, neurotransmitter and immune functions in the olfactory bulbectomized rat, Hum. Psychopharmacol. 9 (1994) 135–146. H.S. Stock, K. Ford, M.A. Wilson, Gender and gonadal hormone effects in the olfactory bulbectomy animal model of depression, Pharmacol. Biochem. Behav. 67 (2000) 183–191.

55

[41] P. Tejedor-Real, J.A. Mico, C. Smadja, R. Maldonado, B.P. Roues, J. Gibert-Rahola, Involvement of d-opioid receptors in the effects induced by endogenous enkephalins on learned helplessness model, Eur. J. Pharmacol. 354 (1998) 1–7. [42] P.B. Tiffany, S. Mollenauer, R. Plotnik, M. White, Olfactory bulbectomy: emotional behavior and defense responses in the rat, Physiol. Behav. 22 (1979) 311–317. [43] A.H.K. Tiong, J.S. Richardson, Differential effects of olfactory bulbectomy on b-adrenoceptors in rat amygdala, hippocampus, and cerebral cortex, Brain Res. 531 (1990) 269–275. [44] H. van Riezen, B.E. Leonard, Effects of psychotropic drugs on the behavior and neurochemistry of olfactory bulbectomized rats, Pharmacol. Ther. 47 (1990) 21–34. [45] H. van Riezen, H. Schnieden, A.F. Wren, Olfactory bulb ablation in the rat: Behavioural changes and their reversal by antidepressant drugs, Br. J. Pharmacol. 60 (1977) 521–528.