- Email: [email protected]
Hesperidin, piperine and bee venom synergistically potentiate the anticancer effect of tamoxifen against breast cancer cells
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Hesperidin, piperine and bee venom synergistically potentiate the anticancer effect of tamoxifen against breast cancer cells
T
⁎
Abeer A.A. Khamisa, Ehab M.M. Alib, Mohamed A. Abd El-Moneimc, , ⁎ Mohammad M. Abd-Alhaseebd, Mohammed Abu El-Magde, , Elsayed I. Salimf a
Biochemistry Division, Chemistry Department, Faculty of Science, Tanta University, Tanta, Egypt Biochemistry Division, Chemistry Department, Faculty of Science, King Abdul Aziz University, Jeddah, Saudi Arabia c Biochemistry Department, Faculty of Dentistry, Sinai University, Al-Arish, North Sinai, Egypt d Pharmacology and Toxicology Department, Faculty of Pharmacy, Damanhour University, Damanhour, Egypt e Anatomy Department, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafrelsheikh, Egypt f Zoology Department, Faculty of Science, Tanta University, Tanta b
A R T I C LE I N FO
A B S T R A C T
Keywords: Breast cancer Tamoxifen Hesperidin Piperine Bee venom Synergism
Despite advances in cancer treatment, breast cancer remains one of the main life threatening diseases in women. Most anti-breast cancer drugs cause severe health complications and multidrug resistance. Although, some natural products, such as hesperidin (Hes), piperine (Pip) and bee venom (BV), showed anti-breast cancer effect when used separately, their combined effect together or with the anti-cancer drug tamoxifen (Tam) has not yet been studied. Herein, we hypothesized that these three natural products could potentiate the therapeutic effect of Tam when used together. First, we studied the cytotoxic effect of Hes, Pip, and BV on MCF7 and T47D cells using MTT assay and found reasonable IC50 comparable to that of Tam. Second, we checked the effect of all combinations (n = 67 for each cell line, prepared as non-constant ratio from fractions of IC50 of the four compounds) and found enhanced anti-proliferative effects on MCF7 and T47D and synergistic effect, revealed by combination index (CI) values below one. Next, the best 5 combinations with lowest Tam doses and CI but with highest cell death were selected for further molecular analysis in comparison to single-drug treatment. All singleand combined-treated groups showed a significant increase in apoptosis (indicated by upregulated mRNA level of the pro-apoptotic marker Bax and downregulated mRNA level of the anti-apoptotic marker Bcl2) and a significant decrease in mRNA level of the two breast cancer related receptors EGFR and ERα, with the best effect in combined groups especially that contained the 4 compounds, as compared to vehicle-treated group. Moreover, Pip, BV and all combinations, except Tam + Hes group, arrested MCF7 and T47D in G2/M phase of cell cycle, while Tam and/or Hes caused G0/G1 phase arrest. These results indicate that Hes, Pip and BV synergistically enhance the anti-cancer effect of Tam and could be used as safe adjuvant/vehicle to Tam in treatment of breast cancer after further confirmatory in vivo investigations.
1. Introduction The high incidence and mortality of breast cancer put this disease at the top of all female life threatening diseases [1]. Despite notable advances in treatment strategies of this cancer, side effects and resistance for currently used anti-cancer drugs are among the main causes for treatment failure in 80% of patients [2]. Tamoxifen (Tam) is widely used for treatment of estrogen receptor (ER)-positive breast cancer [3] with better therapeutic outcomes (notable decrease in recurrence and mortality) when given for 10 years rather than 5 years [4,5]. However, such long treatment causes serious side-effects, including ovarian, and
⁎
endometrial hyperplasia and carcinomas in addition to multiple vein thrombosis and pulmonary embolism [4,6]. Thus, there is an urgent need for developing more effective and safer therapeutic approach. Modulation of Tam sensitivity, that results in decreasing its side-effects, resistance and maximizes its therapeutic efficiency, is a desirable goal. Several natural products including hesperidin (Hes), piperine (Pip), and bee venom (BV) have been reported to have anti-cancer effect when used each alone or each in combination with anti-cancer drug [7–9]. Hes, a plant flavonoid abundantly found in citrus fruits, has anti-inflammatory, anti-oxidant, pro-apoptotic, and anti-proliferative properties [7,10]. It also suppresses cell proliferation in several cancer types,
Corresponding authors. E-mail addresses: [email protected] (M.A.A. El-Moneim), [email protected] (M.A. El-Magd).
https://doi.org/10.1016/j.biopha.2018.06.105 Received 14 February 2018; Received in revised form 16 June 2018; Accepted 18 June 2018 0753-3322/ © 2018 Elsevier Masson SAS. All rights reserved.
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
Table 1 Primer sequences used in qPCR. Gene
Forward primer (5′–3′)
Reverse primer (5′–3′)
Bax Bcl2 ERα EGFR β-actin
CCTGTGCACCAAGGTGCCGGAACT AGGAAGTGAACATTTCGGTGAC CCACCAACCAGTGCACCATT TGCCCATGAGAAATTTACAGG CACCAACTGGGACGACAT
CCACCCTGGTCTTGGATCCAGCCC GCTCAGTTCCAGGACCAGGC GGTCTTTTCGTATCCCACCTTTC ATGTTGCTGAGAAAGTCACTGC ACAGCCTGGATAGCAACG
Tam-treated MCF7, Tam-treated T47D, Hes-treated MCF7, Hes-treated T47D, Pip-treated MCF7, Pip-treated T47D, BV-treated MCF7, and BVtreated T47D groups with doses equal to their IC50. All combined treatments (n = 67 for each cell line) were prepared as non-constant ratio from fractions of IC50 of the four compounds. The best 5 combinations for each cell line with lowest Tam doses and CI and highest cell death were selected for further molecular analysis in comparison to single-drug treatment. All treatments were applied on MCF7 and T47D cells at 70–80% confluence and the cells were incubated in CO2 incubator for 24 h, then harvested by trypsinization and immediately processed for molecular and flow cytometric analysis.
such as colon, bladder, liver, and breast cancers, without causing toxic effect on normal cells [7,11–13]. Pip, a dietary phytochemical product extracted from black and long pepper [14], has not only an anti-inflammatory effect [15], but it also inhibits cancer cell growth and metastasis with less toxic effect on healthy cells [16]. The therapeutic properties of Pip with other anti-cancer drugs were tested in various cell types including MCF7 [8,17]. BV has anti-inflammatory and immune modulatory properties [18] as well as inhibitory effect on cancer cells [19]. Induction of apoptosis by BV and its major component melittin was reported in lung cancer [18], hepatocellular carcinoma [20], leukemic cells [19], breast [9], prostate [21] and ovarian cancer cells [22]. Previous studies reported that Hes [10,23], Pip [2], and BV [9,18] each alone or each combined with anti-cancer drug possessed antiproliferative effect on breast cancer cells. However, to date no study investigated the combined anti-cancer effects of these three natural products with Tam. We hypothesized that this combination may achieve synergistic effect and dose reduction. Therefore, we investigated the potential effect of these natural products when given alone or in combination with the hormonal anti-cancer drug Tam on the ER-positive breast cancer MCF7 and T47D cells.
2.4. Gene expression analysis by qPCR Total RNA was isolated from MCF7 and T47D cells using Gene JET RNA Purification Kit (Thermo Scientific, USA). RNA concentration and purity were determined by nanodrop (Q5000, Quawell, USA) and 1% gel electrophoresis. RNA (5 μg) was reverse transcribed using Quantiscript reverse transcriptase. The produced cDNA was used as a template to determine the relative expression of Bax, Bcl2, EGFR and ERα genes using Step One Plus real time PCR system (Applied Biosystem, USA) and specific primers (Table 1). β actin was used as an internal control. The thermal cycling conditions, melting curves temperatures, and calculation of relative expression using 2−ΔΔCt were done as previously described [25,26].
2. Materials and methods 2.1. Cell viability by MTT assay Human breast adenocarcinoma MCF7 and ductal carcinoma T47D cells were separately seeded in a 96-well plate [1 × 104 cells/well, 100 μl/well] containing DMEM medium supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin (all obtained from GIBCO, New York, USA), and 2% L-glutamine (Invitrogen, New York, USA) and incubated at 37 °C for 24 h under 5% CO2, 95% air till 70–80% confluence. Various concentrations (0, 3.125, 6.25, 12.5, 25, 50, and 100 μg/ml) of Tam (Nolvadex®, Astra Zenca Cambridge, UK), Hes, Pip (Acros Organics, USA), and BV (Apis Injeel ™, Heel GMBH, Germany) were added alone or in concomitant combinations (at a non-constant ratio depending on their IC50 value) and cells were incubated for 24 h. The cells were incubated with 5 mg/ml of MTT (Sigma) for 4 h and then the medium was replaced with 100 μl DMSO (Sigma) and vortexed for 20 min. Absorbance was recorded at 570 nm using a microplate reader. The concentration of Tam and the three natural products inhibiting 50% of cells (IC50) was calculated using the sigmoidal curve using GraphPad (Prism) statistic software.
2.5. Cell cycle analysis Following trypsinization, MCF7 and T47D cells were centrifuged at 4500 rpm for 5 min, washed twice, re-suspended in warm PBS, fixed by ice-cold absolute ethanol, and then incubated at −20 °C for 24 h. After twice PBS washes, cells were re-suspended in propidium iodide (PI) solution containing 100 μl (0.02 mg/ml) PI, 50 μl (0.2 mg/ml) RNase A, and 0.1% v/v Triton X-100 in PBS, incubated in darkness for 30–60 min at room temperature, and then analyzed using Attune flow cytometer (Applied Bio-system, USA). 2.6. Statistical analysis Values were analyzed by one-way ANOVA followed by TukeyKramer multiple comparisons test using Graph Pad Prism 5 (Graph Pad Software, Inc., LaJolla, CA, USA). Significant differences among means were estimated at p < 0.05. The results were expressed as mean ± standard error of mean (SEM).
2.2. The combination index (CI) Dose-effect analysis of the combined treatments was carried out using Chou-Talalay method. The type of interaction between the compounds was determined by combination index (CI) using compusyn software with CI < 1 indicates presence of synergism between the tested compounds [24].
3. Results 3.1. Effect of Tam, Hes, Pip and BV on MCF7 and T47D cell viability MTT assay results exhibited significant dose-dependent anti-proliferative activity for Tam, Hes, Pip, and BV on MCF7 and T47D when used either alone or in combinations as compared to vehicle (DMSO)treated cells (Tables 2–5, Fig. 1). All 67 non-constant ratio combinations for each cell line resulted in a significant higher cytotoxic effect on
2.3. Experimental design The MCF7 and T47D cells were divided according single treatments into: vehicle (DMSO)-treated MCF7, vehicle (DMSO)-treated T47D, 1336
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
Table 2 Data for non-constant combination and % of MFC7 cell death for Tam, Hes, Pip and BV. Combination
Non-constant combination (IC50 fraction) % of cell death
Tam+ Hes Tam + Pip Tam + BV Hes + Pip Hes + BV Pip + BV Combination
Tam+ Hes + Pip Tam+ Hes + BV Tam + Pip + BV Hes + Pip + BV Combination
Tam + Hes + Pip + BV a
1/2:1/2
1/3:2/3
2/3:1/3
1/5:4/5
4/5:1/5
87.56 86.71 56.76 83.13 39.26 78.49
86.08 83.97 75.96 87.77a 72.16 58.87
86.92 84.18 82.49 79.33 70.68 82.28
86.08 88.82a 63.30 86.20 43.48 68.15
86.92 88.19 86.29 83.76 61.61 85.24
Non-constant combination (IC50 fraction) % of cell death 1/4:1/4:2/4
1/4:1/4:2/4
1/4:2/4:1/4
2/4:1/4:1/4
1/6:1/6:4/6
1/6:4/6:1/6
4/6:1/6:1/6
68.57 84.86 85.11 83.43
74.27 79.57 81.27 75.74
76.59 84.86 85.35a 86.55a
82.28 86.06 85.35 84.87
80.60 68.04 63.49 65.89
80.39 84.62 85.11 85.11
87.13 86.54 86.79 85.35
Non-constant combination (IC50 fraction) % of cell death 1/4:1/4:1/ 4:1/4
1/5:1/5:1/ 5:2/5
1/5:1/5:2/ 5:1/5
1/5:2/5:1/ 5:1/5
2/5:1/5:1/ 5:1/5
1/7:1/7:1/ 7:4/7
1/7:1/7:4/ 7:1/7
1/7:4/7:1/ 7:1/7
4/7:1/7:1/ 7:1/7
84.63
74.06
80.06
82.47
85.83
61.09
86.07a
82.23
85.59
The best non-constant combination ratio that achieved the highest cell death were selected for molecular and cell cycle analysis.
for MCF7 and T47D cells.
MCF7 and T47D than single drug treatment. Moreover, among these different combinations, 10 combinations (5 for each cell line) with lowest Tam doses [(Tam + Pip), (Hes + Pip), (Tam + Pip + BV), (Hes + Pip + BV) and (Tam + Hes + Pip + BV)] and [(Tam + Pip), (Tam + Hes), (Tam + Hes + BV), (Tam + Pip + BV) and (Tam + Hes + Pip + BV)] exhibited the highest inhibition for MCF7 and T47D viability, respectively. Notably, the (Tam + Hes + Pip + BV) groups which had minimal (1/7 IC50) Tam dose exhibited a maximal inhibition
3.2. Synergistic cytotoxicity of Tam, Hes, Pip and BV against MCF7 and T47D To determine the type of interaction between these four compounds, normalised isobolograms and combination index (CI) plot were constructed. On MCF7 cells, the lowest 5 CI values (0.279, 0.264, 0.281,
Table 3 Combination index (CI) data for non-constant combination of Tam, Hes, Pip and BV against MCF7 cells.
Tam + Pip
Hes + Pip
Tam + Pip + BV
Hes + Pip + BV
Tam + Hes + Pip + BV
a
IC50 fraction μg/ml
IC50/2
1/3:2/3
2/3:1/3
1/5:4/5
4/5:1/5
Tam dose Pip dose % cell death CI value Hes dose Pip dose % cell death CI value
19.03 18.67 86.71 0.30 30.65 18.67 83.13 0.32
12.85 24.89 83.97 0.359 20.43 24.89 87.77a 0.264a
25.69 12.45 84.18 0.343 40.86 12.45 79.33 0.361
7.71 29.87 88.82a 0.279a 12.26 29.87 86.20 0.302
30.81 7.47 88.19 0.27 49.03 7.47 83.76 0.269
IC50 fraction μg/ml
1/3:1/3:13
1/4:1/4:2/4
1/4:2/4:1/4
2/4:1/4:1/4
1/6:1/6:4/6
1/6:4/6:1/6
4/6:1/6:1/6
Tam dose Pip dose BV dose % cell death CI Hes dose Pip dose BV dose % cell death CI value
12.85 12.45 18.27 85.11 0.262 20.43 12.45 18.27 85.11 0.257
9.64 9.34 27.4 81.27 0.285 15.32 9.34 27.4 81.27 0.35
9.64 18.67 13.7 85.35a 0.281a 15.32 18.67 13.7 85.35a 0.236a
19.27 9.34 13.7 85.35 0.271 30.65 9.34 13.7 85.35 0.247
6.42 6.22 36.54 63.49 0.59 10.22 6.22 36.54 63.49 0.516
6.42 24.89 9.14 85.11 0.307 10.22 24.89 9.14 85.11 0.292
25.69 6.22 9.14 86.79 0.26 4.86 6.22 9.14 86.79 0.241
IC50 fraction μg/ml
1/4:1/4:1/ 4:1/4
1/5:1/5:1/ 5:2/5
1/5:1/5:2/ 5:1/5
1/5:2/5:1/ 5:1/5
2/5:1/5:1/ 5:1/5
1/7:1/7:1/ 7:4/7
1/7:1/7:4/ 7:1/7
1/7:4/7:1/ 7:1/7
4/7:1/7:1/ 7:1/7
Tam dose Hes dose Pip dose BV dose % cell death CI value
9.64 15.32 9.34 13.7 84.63 0.275
7.71 12.26 7.47 21.92 74.06 0.406
7.71 12.26 14.94 10.96 80.06 0.354
7.71 24.52 7.47 10.96 82.47 0.287
15.42 12.26 7.47 10.96 85.83 0.253
5.51 8.76 5.33 31.32 61.09 0.659
5.51 8.76 21.34 7.83 86.07a 0.279a
5.51 35.02 5.33 7.83 82.23 0.284
22.2 8.76 5.33 7.83 85.59 0.27
The best CI and % of cell death for non-constant combination ratio which selected for molecular and cell cycle analysis. 1337
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
Table 4 Data for non-constant combination and % of T47D cell death for Tam, Hes, Pip and BV. Combination
Non constant Combination (IC50 fraction) % of cell death 1/2:1/2
Tam-Hes Tam- Pip Tam- BV Hes- Pip Hes- BV Pip-BV Combination
Tam-Hes-Pip Tam-Hes-BV Tam- Pip-BV Hes-Pip-BV Combination
Tam- Hes-Pip-BV a
1/3:2/3
83.34 83.34 62.04 81.65 45.37 70.05
2/3:1/3
81.86 81.23 72.37 79.33 74.06 64.36
1/5:4/5
4/5:1/5
a
84.39 82.92 83.23 83.13 68.15 80.39
87.13 85.45 84.18 80.17 69 82.07
84.27 84.81a 75.32 83.97 41.16 65.83
Non constant Combination (IC50 fraction) % of cell death 1/4:1/4:2/4
1/4:1/4:2/4
1/4:2/4:1/4
2/4:1/4:1/4
1/6:1/6:4/6
1/6:4/6:1/6
4/6:1/6:1/6
72.16 82.94 83.43 82.23
77.85 61.55 78.86 78.14
73.21 83.42 80.3 81.75
83.34 87.74 84.87 80.06
79.33 70.2 66.61 70.94
81.02 87.5a 83.67a 83.19
86.29 81.74 85.83 81.99
Non constant Combination (IC50 fraction) % of cell death 1/4:1/4:1/4:1/ 4
1/5:1/5:1/5:2/ 5
1/5:1/5:2/5:1/ 5
1/5:2/5:1/5:1/ 5
2/5:1/5:1/5:1/ 5
1/7:1/7:1/ 7:4/7
1/7:1/7:4/7:1/ 7
1/7:4/7:1/7:1/ 7
4/7:1/7:1/7:1/ 7
85.11
72.14
82.23
81.27
81.75
73.1
87.99a
80.54
86.31
The best non constant combination ratio that achieved the highest cell death which selected for molecular and cell cycle analysis.
these 10 combinations.
0.236 and 0.279 were noticed in (Tam + Pip), (Hes + Pip), (Tam + Pip + BV), (Hes + Pip + BV) and (Tam + Hes + Pip + BV) groups, respectively (Table 3 and Supplementary 1). Similarly, on T47D, the lowest 5 CI values with lower Tam doses (0.263, 0.315, 0.249, 0.282, and 0.222) were observed in (Tam + Pip), (Tam + Hes), (Tam + Hes + BV), (Tam + Pip + BV) and (Tam + Hes + Pip + BV) groups, respectively (Table 5 and Supplementary 2). CI values below 1 indicate strong synergism in growth inhibition of MCF7 and T47D in
3.3. Effect of Tam, Hes, Pip, and BV on expression of Bax, Bcl2, ERα, and EGFR genes The qPCR results revealed a significant (P ≤ 0.05) downregulation in the expression levels of Bcl2, ERα, and EGFR genes and a significant upregulation in the expression levels of Bax gene in the single- and
Table 5 Combination index (CI) data for non-constant combination of Tam, Hes, Pip and BV against T47D cells.
Tam- Pip
Tam-Hes
Tam- Hes-BV
Tam- Pip-BV
Tam- Hes- PipBV
a
IC50 fraction μg/ml
IC50/2
1/3:2/3
2/3:1/3
1/5:4/5
4/5:1/5
Tam dose Pip dose % cell death CI value Tam dose Hes dose % cell death CI value
10.44 30.53 83.34 0.238 10.44 42.51 83.34 0.266
6.96 40.7 81.23 0.299 6.96 56.67 81.86 0.329
13.92 20.35 82.92 0.216 13.92 28.34 84.39 0.213
4.18 48.84 84.81 0.263a 4.18 68.01 84.27 0.315a
16.7 12.21 85.45 0.16 16.7 17 87.13 0.147
IC50 fraction μg/ml
1/3:1/3:13
1/4:1/4:2/4
1/4:2/4:1/4
2/4:1/4:1/4
1/6:1/6:4/6
1/6:4/6:1/6
4/6:1/6:1/6
Tam dose Hes dose BV dose % cell death CI Hes dose Pip dose BV dose % cell death CI value
6.96 28.34 23.78 82.94 0.281 6.96 20.35 23.78 83.43 0.254
5.22 21.25 35.67 61.55 0.743 5.22 15.26 35.67 78.86 0.340
5.22 42.51 17.83 83.42 0.298 5.22 30.53 17.83 80.3 0.323
10.44 21.25 17.83 87.74 0.177 10.44 15.26 17.83 84.87 0.208
3.48 14.17 47.55 70.2 0.536 3.48 10.18 47.55 66.61 0.600
3.48 56.67 11.89 87.5 0.249a 3.48 40.7 11.89 83.67 0.282a
13.92 14.17 11.89 81.74 0.239 13.92 10.18 11.89 85.83 0.170
IC50 fraction μg/ ml
1/4:1/4:1/ 4:1/4
1/5:1/5:1/ 5:2/5
1/5:1/5:2/ 5:1/5
1/5:2/5:1/ 5:1/5
2/5:1/5:1/ 5:1/5
1/7:1/7:1/ 7:4/7
1/7:1/7:4/ 7:1/7
1/7:4/7:1/ 7:1/7
4/7:1/7:1/ 7:1/7
Tam dose Hes dose Pip dose BV dose % cell death CI value
5.22 21.25 15.26 17.83 85.11 0.256
4.18 17 12.21 28.53 72.14 0.498
4.18 17 24.42 14.27 82.23 0.312
4.18 34 12.21 14.27 81.27 0.341
8.35 17 12.21 14.27 81.75 0.286
2.98 12.14 8.72 40.76 73.1 0.479
2.98 12.14 34.89 10.19 87.99 0.222a
2.9 48.58 8.72 10.19 50.54 0.377
11.93 12.14 8.72 10.19 86.31 0.186
The best CI, % of cell death and Tam low dose for non-constant combination ratio which selected for molecular and cell cycle analysis. 1338
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
Fig. 1. Sigmoidal curve for MTT assay showing IC50 values and the inhibition % of Tam (A), Hes (B), Pip (C) and BV (D) on MCF7 and T47D cells. Each data point represents an average of three independent experiments (n = 9).
combined- treated groups as compared to vehicle-treated MCF7 and T47D groups (Fig. 2). Again, the combined groups, especially in groups containing the 4 compounds, showed more notable changes (higher Bax and lower Bcl2, EGFR, and ERα) than single-treated groups.
However, treatment by Tam and/or Hes resulted in a significant elevated number of MCF7 and T47D cells in G0/G1 phase. All single and combined treatments significantly decreased MCF7 and T47D cells in S phase as compared to vehicle-treated cells.
3.4. Effect of Tam, Hes, Pip, and BV on MCF7 and T47D cell cycle
4. Discussion
The effect of single or combined treatment by Tam, Hes, Pip and BV on MCF7 and T47D cell cycle was determined by flow cytometry using PI which showed significant increase in number of MCF7 and T47D cells in G2/M phase in Pip and BV single-treated groups and all combined-treated groups, except Tam + Hes group, as compared to vehicletreated MCF7 and T47D groups (Fig. 3). Again, the highest cell numbers in G2/M phase was observed in the 4 compounds combined groups.
Tam is widely used as a standard chemotherapy for estrogenic positive breast cancer, but it should be given for long time (5–10 years) to get the best effect. However, this long lasting chemotherapeutic course usually causes severe side effects, including endometrial hyperplasia and polyps, thromboembolic events, and endometrial secondary cancer mainly due to inability of Tam, similar to other chemotherapeutics, to distinguish between highly dividing cancer cells and normal 1339
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
Fig. 2. Real-time quantitative PCR analysis of the expression of Bax, Bcl2, EGFR and ERα genes in MCF7 and T47D cells. Values are expressed as mean ± SEM, n = 9. Means within columns carrying different superscript letters are significantly different (P ≤ 0.05).
we investigated the anti-cancer effect of these three natural products alone and with Tam on MCF7 and T47D breast cancer cells and evaluated which drug combination gave the best anti-cancer effect. Our results revealed, significant dose-dependent anti-proliferative activity for Tam, Hes, Pip, and BV on MCF7 and T47D when used either alone or in combination with best effect for combined treatments. Among the tested 67 combinations for each cell line, 10 combinations with lowest Tam doses [(Tam + Pip), (Hes + Pip), (Tam + Pip + BV),
proliferating cells [6]. Drug combination becomes a widespread strategy in cancer treatment. Natural anti-cancer products are easily available, safe and their combination with anti-cancer drugs could exert synergistic therapeutic effect, reduce dose, toxicity and drug resistance for the chemotherapy [24]. Previous studies reported anti-cancer properties for some natural products, such as Hes [10,23], Pip [2,18,27], and BV [9,18] on breast cancer cells. However, none of these studies investigated their combined effects together or with Tam. Here, 1340
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
Fig. 3. Effect of Tam, Hes, Pip and BV alone or in combination on cell cycle of MCF7 and T47D cells as measured by flow cytometry. Cell cycle histograms of MCF-7 (A) and T47D (C) cells after treatment with individual and combined compounds. The X-axis represents the PI fluorescence based on the DNA content and the Y-axis represents the number of cells in each phase. Graphical presentation of % of cells in G0/G1, S and G2/M cell cycle phases in MCF7 (B) and T47D (D) cells. Values are expressed as mean ± SEM, n = 9. Means within columns carrying different superscript letters are significantly different (P ≤ 0.05).
cancer drugs through not only induction of apoptosis, but also by inhibition of cell migration, invasion and angiogenesis [2,29–31], it is worth to investigate the synergistic effect of this natural products-anticancer drug combination on cancer cell migration, invasion and angiogenesis in vitro and in vivo. In the present study and in consistent with Ip et al. [9] and Yan et al. [32], Pip and BV arrested MCF7 and T47D in G2/M phase of cell cycle. Another breast cancer cell, 4T1 mouse mammary carcinoma, also shows G2/M arrest [33]. However, Greenshields et al. [28] have found a significant decrease in number of MCF7 and triple negative cells in all cell cycle phases after treatment by Pip, suggesting broad inhibitory effect for Pip and failure of arrest at any phase of the cell cycle. In other cancer cell types, such as prostate cancer, Pip induces G1 phase cell cycle arrest [34]. It is likely that Pip may target different cell cycle regulators depending on the cancer cell type. On the other hand, we found that Tam and/or Hes caused G0/G1 phase arrest for MCF7 and T47D. Similar results were reported by other studies [35]. Thus, Tam and Hes act in both a cytostatic (by causing G0/G1 arrest) and cytotoxic (by inducing apoptosis) manner [36]. Interestingly, all combinations, except Tam + Hes group, arrested MCF7 and T47D in G2/M phase of cell cycle with highest number of arrested cells in group containing the 4 compounds. This altered cell cycle arrest phase of Tam and Hes in the 4 compounds group may be due to the synergism between these 4 compounds with predominant effect for Pip and BV. ERα, a major receptor robustly expressed in ER-positive breast cancer cell lines, such as MCF7 and T47D, and mammary epithelium of ER-positive breast cancer patients, plays a critical role in breast cancer progression [37]. The obtained results showed that administration of Tam, Hes, Pip, and BV alone or in combination resulted in a significant decrease in the expression level of ERα with lowest expression level in combination groups especially that contained the 4 compounds. Among the three natural compounds, only Hes was previously reported to inhibit all estrogen sensitive genes in mouse model of breast cancer [38]. To the best of our knowledge this may be the first study to report an
(Hes + Pip + BV) and (Tam + Hes + Pip + BV)] and [(Tam + Pip), (Tam + Hes), (Tam + Hes + BV), (Tam + Pip + BV) and (Tam + Hes + Pip + BV)] exhibited the highest inhibition for MCF7 and T47D viability, respectively. Notably, the (Tam + Hes + Pip + BV) groups which had minimal (1/7 IC50) Tam dose exhibited a maximal inhibition for MCF7 and T47D cells. This indicates the ability of these natural products to potentiate the anti-cancer effect of Tam even when the anticancer drug was used in low doses. Given that most adverse side effects of Tam are attributed to its high prolonged dose, co-administration of anti-cancer natural products with low dose of Tam may robustly inhibit cancer cells proliferation and could probably decrease side effects of Tam. However, this assumption should be experimentally proven on lab animals to evaluate the toxicity of the different combinations of the tested compounds on body systems. The present study revealed that administration of the natural products Hes, Pip, and BV alone or in combination with the anti-cancer drug Tam reduced the cell viability and induced apoptosis in MCF7 and T47D. Apoptosis was evident by significant increase in the expression of the pro-apoptotic Bax gene and significant decrease in the anti-apoptotic Bcl2 gene. MCF7 and T47D cells treated with the combined 4 compounds showed highest Bax and lowest Bcl2 expression, indicating higher apoptotic rate and synergism. These in vitro data confirmed in silico results of the isobologram and combination index and together they indicate synergistic effect for the 4 tested compounds. In agreement with our findings, previous studies showed that Pip, Hes, and BV and its major ingredient melittin had the ability to induce apoptosis and inhibit the growth of ER positive breast cancer MCF7 cells [7,9,28]. The three natural products also induce apoptosis in other cancer cells, including colon cancer [12], hepatocellular carcinoma [29], ovarian adenocarcinoma [27], and pancreatic cancer cells [30] through down regulation of Bcl2 expression, and up-regulation of Bax and caspase3 mRNA. This indicates that the apoptosis-dependant anti-cancer effect of these natural products is not restricted to a single cancer cell type. Because natural products enhance the therapeutic potential of anti1341
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
inhibitory effect for Pip and BV on MCF7 and T47D cells-expressing ERα. It is well-documented that the growth inhibitory effect of Tam on ERα-positive breast cancer cells is attributed to the competitive inhibition of the binding of estrogen to ERα, resulting in the repression of estrogen responsive genes [39]. Based on the above results, it is possible that the synergistic interaction between the three natural products and Tam may involve an ERα signaling blockade. The EGFR, another an important receptor expressed in MCF7 and T47D, plays an important role in the growth and progression of breast cancer. Breast cancer patients with overexpressed EGFR have bad prognosis. Similar to ERα, administration of Tam, Hes, Pip, and BV alone or in combination resulted in a significant decrease in the expression level of EGFR with lowest levels in combination groups particularly the 4 compounds combined group. In support, Hes inhibits cancer cell growth by suppression of EGFR and subsequent attenuation of EGFR/ERK signaling [40]. Moreover, inhibition of EGFR by Tam was reported in glioblastoma [41] and MCF7 [42]. However, following Tam resistance EGFR was overexpressed in breast cancer [43]. Absence of EGFR overexpression in the present study may be due to short duration of Tam treatment, which is not enough to develop drug resistance, or due to synergistic effect of combination therapy between Tam and the three natural products, which may increase drug sensitivity in cancer cells. Further investigations are required to check the effect of Tamnatural products synergism on Tam drug resistance. The obtained in vitro results on MCF7 and T47D cells establish the efficacy of new drugs combination before clinical trials are started and could be used to choose the most effective drug combination in individual patients. However, further in vivo investigations are needed to determine whether it is safe to give high-dose of these natural products to breast cancer patients as some of these products, such as piperine, induced toxicity in rodents when given in large dose [44]. Enhancing the anti-cancer effect is supported by our in vitro data, but the potential of enhanced toxicities of these compounds on other body systems is possible. Hence, in vivo study is necessary to check this possibility.
[4] F. Petrelli, A. Coinu, M. Cabiddu, M. Ghilardi, V. Lonati, S. Barni, Five or more years of adjuvant endocrine therapy in breast cancer: a meta-analysis of published randomised trials, Breast Cancer Res. Treat. 140 (2) (2013) 233–240. [5] C. Davies, H. Pan, J. Godwin, R. Gray, R. Arriagada, V. Raina, M. Abraham, V.H.M. Alencar, A. Badran, X. Bonfill, Long-term effects of continuing adjuvant tamoxifen to 10 years versus stopping at 5 years after diagnosis of oestrogen receptor-positive breast cancer: ATLAS, a randomised trial, Lancet 381 (9869) (2013) 805–816. [6] E.A. Musgrove, R.L. Sutherland, Biological determinants of endocrine resistance in breast cancer, Nat. Rev. Cancer 9 (9) (2009) 631–643. [7] C.J. Lee, L. Wilson, M.A. Jordan, V. Nguyen, J. Tang, G. Smiyun, Hesperidin suppressed proliferations of both human breast cancer and androgen-dependent prostate cancer cells, Phytother. Res. 24 (S1) (2010). [8] D. Bezerra, F. Castro, A. Alves, C. Pessoa, M. Moraes, E. Silveira, M. Lima, F. Elmiro, L. Costa-Lotufo, In vivo growth-inhibition of Sarcoma 180 by piplartine and piperine, two alkaloid amides from Piper, Braz. J. Med. Biol. Res. 39 (6) (2006) 801–807. [9] S.-W. Ip, S.-S. Liao, S.-Y. Lin, J.-P. Lin, J.-S. Yang, M.-L. Lin, G.-W. Chen, H.-F. Lu, M.-W. Lin, S.-M. Han, The role of mitochondria in bee venom-induced apoptosis in human breast cancer MCF7 cells, In Vivo 22 (2) (2008) 237–245. [10] E.J. Choi, Hesperetin induced G1-phase cell cycle arrest in human breast cancer MCF-7 cells: involvement of CDK4 and p21, Nutr. Cancer 59 (1) (2007) 115–119. [11] M. Yang, T. Tanaka, Y. Hirose, T. Deguchi, H. Mori, Y. Kawada, Chemopreventive effects of diosmin and hesperidin on N-butyl-N-(4-hydroxybutyl) nitrosamine-induced urinary-bladder carcinogenesis in male ICR mice, Int. J. Cancer 73 (5) (1997) 719–724. [12] H. Park, M.-J. Kim, E. Ha, J.-H. Chung, Apoptotic effect of hesperidin through caspase3 activation in human colon cancer cells, SNU-C4, Phytomedicine 15 (1) (2008) 147–151. [13] M.-H. Yeh, S.-T. Kao, C.-M. Hung, C.-J. Liu, K.-H. Lee, C.-C. Yeh, Hesperidin inhibited acetaldehyde-induced matrix metalloproteinase-9 gene expression in human hepatocellular carcinoma cells, Toxicol. Lett. 184 (3) (2009) 204–210. [14] A. Samykutty, A.V. Shetty, G. Dakshinamoorthy, M.M. Bartik, G.L. Johnson, B. Webb, G. Zheng, A. Chen, R. Kalyanasundaram, G. Munirathinam, Piperine, a bioactive component of pepper spice exerts therapeutic effects on androgen dependent and androgen independent prostate cancer cells, PLoS One 8 (6) (2013) e65889. [15] C. Pradeep, G. Kuttan, Piperine is a potent inhibitor of nuclear factor-κB (NF-κB), cFos, CREB, ATF-2 and proinflammatory cytokine gene expression in B16F-10 melanoma cells, Int. Immunopharmacol. 4 (14) (2004) 1795–1803. [16] E. Sunila, G. Kuttan, Immunomodulatory and antitumor activity of Piper longum Linn. and piperine, J. Ethnopharmacol. 90 (2) (2004) 339–346. [17] M.N. Motiwala, V.D. Rangari, Combined effect of paclitaxel and piperine on a MCF7 breast cancer cell line in vitro: evidence of a synergistic interaction, Synergy 2 (1) (2015) 1–6. [18] M.-H. Jang, M.-C. Shin, S. Lim, S.-M. Han, H.-J. Park, I. Shin, J.-S. Lee, K.-A. Kim, E.H. Kim, C.-J. Kim, Bee venom induces apoptosis and inhibits expression of cyclooxygenase-2 mRNA in human lung cancer cell line NCI-H1299, J. Pharmacol. Sci. 91 (2) (2003) 95–104. [19] C. Wang, T. Chen, N. Zhang, M. Yang, B. Li, X. Lü, X. Cao, C. Ling, Melittin, a major component of bee venom, sensitizes human hepatocellular carcinoma cells to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis by activating CaMKII-TAK1-JNK/p38 and inhibiting IκBα kinase-NFκB, J. Biol. Chem. 284 (6) (2009) 3804–3813. [20] D.-O. Moon, S.-Y. Park, M.-S. Heo, K.-C. Kim, C. Park, W.S. Ko, Y.H. Choi, G.-Y. Kim, Key regulators in bee venom-induced apoptosis are Bcl-2 and caspase-3 in human leukemic U937 cells through downregulation of ERK and Akt, Int. Immunopharmacol. 6 (12) (2006) 1796–1807. [21] M.H. Park, M.S. Choi, D.H. Kwak, K.W. Oh, D.Y. Yoon, S.B. Han, H.S. Song, M.J. Song, J.T. Hong, Anti-cancer effect of bee venom in prostate cancer cells through activation of caspase pathway via inactivation of NF-κB, Prostate 71 (8) (2011) 801–812. [22] M. Jo, M.H. Park, P.S. Kollipara, B.J. An, H.S. Song, S.B. Han, J.H. Kim, M.J. Song, J.T. Hong, Anti-cancer effect of bee venom toxin and melittin in ovarian cancer cells through induction of death receptors and inhibition of JAK2/STAT3 pathway, Toxicol. Appl. Pharmacol. 258 (1) (2012) 72–81. [23] S. Palit, S. Kar, G. Sharma, P.K. Das, Hesperetin induces apoptosis in breast carcinoma by triggering accumulation of ROS and activation of ASK1/JNK pathway, J. Cell. Physiol. 230 (8) (2015) 1729–1739. [24] T.-C. Chou, Drug combination studies and their synergy quantification using the Chou-Talalay method, Cancer Res. 70 (2) (2010) 440–446. [25] M.A. El-Magd, W.S. Abdo, M. El-Maddaway, N.M. Nasr, R.A. Gaber, E.S. El-Shetry, A.A. Saleh, F.A.A. Alzahrani, D.H. Abdelhady, High doses of S-methylcysteine cause hypoxia-induced cardiomyocyte apoptosis accompanied by engulfment of mitochondaria by nucleus, Biomed. Pharmacother. 94 (2017) 589–597. [26] M.A. El-Magd, S.F. Khalifa, F.A.A. Alzahrani, A.A. Badawy, E.S. El-Shetry, L.M. Dawood, M.M. Alruwaili, H.A. Alrawaili, E.F. Risha, F.M. El-Taweel, H.E. Marei, Incensole acetate prevents beta-amyloid-induced neurotoxicity in human olfactory bulb neural stem cells, Biomed. Pharmacother. 105 (2018) 813–823. [27] M.K. Pal, S.P. Jaiswar, A.K. Srivastav, S. Goyal, A. Dwivedi, A. Verma, J. Singh, A.K. Pathak, P.L. Sankhwar, R.S. Ray, Synergistic effect of piperine and paclitaxel on cell fate via cyt-c, Bax/Bcl-2-caspase-3 pathway in ovarian adenocarcinomas SKOV-3 cells, Eur. J. Pharmacol. 791 (2016) 751–762. [28] A.L. Greenshields, C.D. Doucette, K.M. Sutton, L. Madera, H. Annan, P.B. Yaffe, A.F. Knickle, Z. Dong, D.W. Hoskin, Piperine inhibits the growth and motility of
5. Conclusion The most relevant finding of this study was the discovery of new combination of natural products (Hes, Pip and BV) which synergistically potentiated the activity of the anti-cancer drug Tam against MCF7 and T47D breast cancer cell lines probably through induction of apoptosis, cell cycle arrest, and downregulation of ERα and EGFR. Further in vivo investigations are required to validate the potentiality of this new combination in targeting cancer cell and suppression of multidrug resistance. Conflicts of interest We do not have a financial or personal relationship with other people or organizations that could inappropriately influence the content of this paper. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.biopha.2018.06.105. References [1] D. Forman, J. Ferlay, B. Stewart, C. Wild, The global and regional burden of cancer, World Cancer Report 2014, (2014), pp. 16–53. [2] Y. Deng, S. Sriwiriyajan, A. Tedasen, P. Hiransai, P. Graidist, Anti-cancer effects of Piper nigrum via inducing multiple molecular signaling in vivo and in vitro, J. Ethnopharmacol. 188 (2016) 87–95. [3] M. Dowsett, J. Cuzick, J. Ingle, A. Coates, J. Forbes, J. Bliss, M. Buyse, M. Baum, A. Buzdar, M. Colleoni, Meta-analysis of breast cancer outcomes in adjuvant trials of aromatase inhibitors versus tamoxifen, J. Clin. Oncol. 28 (3) (2009) 509–518.
1342
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
[37] J. Jeong, S. Park, H.-T. An, M. Kang, J. Ko, Small leucine zipper protein functions as a negative regulator of estrogen receptor α in breast cancer, PLoS One 12 (6) (2017) e0180197. [38] F. Li, S. Chow, W.-h. Cheung, F.L. Chan, S. Chen, L.K. Leung, The citrus flavonone hesperetin prevents letrozole-induced bone loss in a mouse model of breast cancer, J. Nutr. Biochem. 24 (6) (2013) 1112–1116. [39] M. Clemons, S. Danson, A. Howell, Tamoxifen (‘Nolvadex’): a review: antitumour treatment, Cancer Treat. Rev. 28 (4) (2002) 165–180. [40] A. Yoshinaga, N. Kajiya, K. Oishi, Y. Kamada, A. Ikeda, P.K. Chigwechokha, T. Kibe, M. Kishida, S. Kishida, M. Komatsu, NEU3 inhibitory effect of naringin suppresses cancer cell growth by attenuation of EGFR signaling through GM3 ganglioside accumulation, Eur. J. Pharmacol. 782 (2016) 21–29. [41] C.D. Graham, N. Kaza, B.J. Klocke, G.Y. Gillespie, L.A. Shevde, S.L. Carroll, K.A. Roth, Tamoxifen induces cytotoxic autophagy in glioblastoma, J. Neuropathol. Exp. Neurol. 75 (10) (2016) 946–954. [42] S.H. Woo, S.-K. Seo, Y. Park, E.-K. Kim, M.-K. Seong, H.-A. Kim, J.-Y. Song, S.G. Hwang, J.K. Lee, W.C. Noh, Dichloroacetate potentiates tamoxifen-induced cell death in breast cancer cells via downregulation of the epidermal growth factor receptor, Oncotarget 7 (37) (2016) 59809. [43] Y. Koibuchi, Y. Iino, T. Uchida, T. Andoh, Y. Horii, M. Nagasawa, J. Horiguchi, M. Maemura, H. Takei, T. Yokoe, Regulation of estrogen receptor and epidermal growth factor receptor by tamoxifen under high and low estrogen environments in MCF-7 cells grown in athymic mice, Oncol. Rep. 7 (1) (2000) 135–175. [44] P. Piyachaturawat, T. Glinsukon, C. Toskulkao, Acute and subacute toxicity of piperine in mice, rats and hamsters, Toxicol. Lett. 16 (3–4) (1983) 351–359.
triple-negative breast cancer cells, Cancer Lett. 357 (1) (2015) 129–140. [29] R. Banjerdpongchai, B. Wudtiwai, P. Khaw-on, W. Rachakhom, N. Duangnil, P. Kongtawelert, Hesperidin from Citrus, Tumor Biol. 37 (1) (2016) 227–237. [30] U.N. Desai, K.P. Shah, S.H. Mirza, D.K. Panchal, S.K. Parikh, R.M. Rawal, Enhancement of the cytotoxic effects of cytarabine in synergism with hesperidine and silibinin in acute myeloid leukemia: an in-vitro approach, J. Cancer Res. Ther. 11 (2) (2015) 352. [31] M.A. El-Magd, A. Khamis, S.K. Nasr Eldeen, W.M. Ibrahim, A.F. Salama, Trehalose enhances the antitumor potential of methotrexate against mice bearing Ehrlich ascites carcinoma, Biomed. Pharmacother. 92 (2017) 870–878. [32] B. Yan, J.-g. Shen, K. Jiang, L.-h. Lai, Q.-h. Fu, Q.-m. Guo, Q.-q. Wang, Q.-y. Chen, Y. Liu, Piperine suppresses tumor growth and metastasis in vitro and in vivo in a 4T1 murine breast cancer model, Acta Pharmacol. Sin. 33 (4) (2012) 523. [33] L.-h. Lai, Q.-h. Fu, Y. Liu, K. Jiang, Q.-m. Guo, Q.-y. Chen, B. Yan, Q.-q. Wang, J.g. Shen, Piperine suppresses tumor growth and metastasis in vitro and in vivo in a 4T1 murine breast cancer model, Acta Pharmacol. Sin. 33 (2012) 523. [34] D.-y. Ouyang, L.-h. Zeng, H. Pan, L.-h. Xu, Y. Wang, K.-p. Liu, X.-h. He, Piperine inhibits the proliferation of human prostate cancer cells via induction of cell cycle arrest and autophagy, Food Chem. Toxicol. 60 (2013) 424–430. [35] Y. Wang, H. Yu, J. Zhang, J. Gao, X. Ge, G. Lou, Hesperidin inhibits HeLa cell proliferation through apoptosis mediated by endoplasmic reticulum stress pathways and cell cycle arrest, BMC Cancer 15 (1) (2015) 682. [36] R.R. Perry, Y. Kang, B. Greaves, Effects of tamoxifen on growth and apoptosis of estrogen-dependent and-independent human breast cancer cells, Ann. Surg. Oncol. 2 (3) (1995) 238–245.
1343
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Hesperidin, piperine and bee venom synergistically potentiate the anticancer effect of tamoxifen against breast cancer cells
T
⁎
Abeer A.A. Khamisa, Ehab M.M. Alib, Mohamed A. Abd El-Moneimc, , ⁎ Mohammad M. Abd-Alhaseebd, Mohammed Abu El-Magde, , Elsayed I. Salimf a
Biochemistry Division, Chemistry Department, Faculty of Science, Tanta University, Tanta, Egypt Biochemistry Division, Chemistry Department, Faculty of Science, King Abdul Aziz University, Jeddah, Saudi Arabia c Biochemistry Department, Faculty of Dentistry, Sinai University, Al-Arish, North Sinai, Egypt d Pharmacology and Toxicology Department, Faculty of Pharmacy, Damanhour University, Damanhour, Egypt e Anatomy Department, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafrelsheikh, Egypt f Zoology Department, Faculty of Science, Tanta University, Tanta b
A R T I C LE I N FO
A B S T R A C T
Keywords: Breast cancer Tamoxifen Hesperidin Piperine Bee venom Synergism
Despite advances in cancer treatment, breast cancer remains one of the main life threatening diseases in women. Most anti-breast cancer drugs cause severe health complications and multidrug resistance. Although, some natural products, such as hesperidin (Hes), piperine (Pip) and bee venom (BV), showed anti-breast cancer effect when used separately, their combined effect together or with the anti-cancer drug tamoxifen (Tam) has not yet been studied. Herein, we hypothesized that these three natural products could potentiate the therapeutic effect of Tam when used together. First, we studied the cytotoxic effect of Hes, Pip, and BV on MCF7 and T47D cells using MTT assay and found reasonable IC50 comparable to that of Tam. Second, we checked the effect of all combinations (n = 67 for each cell line, prepared as non-constant ratio from fractions of IC50 of the four compounds) and found enhanced anti-proliferative effects on MCF7 and T47D and synergistic effect, revealed by combination index (CI) values below one. Next, the best 5 combinations with lowest Tam doses and CI but with highest cell death were selected for further molecular analysis in comparison to single-drug treatment. All singleand combined-treated groups showed a significant increase in apoptosis (indicated by upregulated mRNA level of the pro-apoptotic marker Bax and downregulated mRNA level of the anti-apoptotic marker Bcl2) and a significant decrease in mRNA level of the two breast cancer related receptors EGFR and ERα, with the best effect in combined groups especially that contained the 4 compounds, as compared to vehicle-treated group. Moreover, Pip, BV and all combinations, except Tam + Hes group, arrested MCF7 and T47D in G2/M phase of cell cycle, while Tam and/or Hes caused G0/G1 phase arrest. These results indicate that Hes, Pip and BV synergistically enhance the anti-cancer effect of Tam and could be used as safe adjuvant/vehicle to Tam in treatment of breast cancer after further confirmatory in vivo investigations.
1. Introduction The high incidence and mortality of breast cancer put this disease at the top of all female life threatening diseases [1]. Despite notable advances in treatment strategies of this cancer, side effects and resistance for currently used anti-cancer drugs are among the main causes for treatment failure in 80% of patients [2]. Tamoxifen (Tam) is widely used for treatment of estrogen receptor (ER)-positive breast cancer [3] with better therapeutic outcomes (notable decrease in recurrence and mortality) when given for 10 years rather than 5 years [4,5]. However, such long treatment causes serious side-effects, including ovarian, and
⁎
endometrial hyperplasia and carcinomas in addition to multiple vein thrombosis and pulmonary embolism [4,6]. Thus, there is an urgent need for developing more effective and safer therapeutic approach. Modulation of Tam sensitivity, that results in decreasing its side-effects, resistance and maximizes its therapeutic efficiency, is a desirable goal. Several natural products including hesperidin (Hes), piperine (Pip), and bee venom (BV) have been reported to have anti-cancer effect when used each alone or each in combination with anti-cancer drug [7–9]. Hes, a plant flavonoid abundantly found in citrus fruits, has anti-inflammatory, anti-oxidant, pro-apoptotic, and anti-proliferative properties [7,10]. It also suppresses cell proliferation in several cancer types,
Corresponding authors. E-mail addresses: [email protected] (M.A.A. El-Moneim), [email protected] (M.A. El-Magd).
https://doi.org/10.1016/j.biopha.2018.06.105 Received 14 February 2018; Received in revised form 16 June 2018; Accepted 18 June 2018 0753-3322/ © 2018 Elsevier Masson SAS. All rights reserved.
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
Table 1 Primer sequences used in qPCR. Gene
Forward primer (5′–3′)
Reverse primer (5′–3′)
Bax Bcl2 ERα EGFR β-actin
CCTGTGCACCAAGGTGCCGGAACT AGGAAGTGAACATTTCGGTGAC CCACCAACCAGTGCACCATT TGCCCATGAGAAATTTACAGG CACCAACTGGGACGACAT
CCACCCTGGTCTTGGATCCAGCCC GCTCAGTTCCAGGACCAGGC GGTCTTTTCGTATCCCACCTTTC ATGTTGCTGAGAAAGTCACTGC ACAGCCTGGATAGCAACG
Tam-treated MCF7, Tam-treated T47D, Hes-treated MCF7, Hes-treated T47D, Pip-treated MCF7, Pip-treated T47D, BV-treated MCF7, and BVtreated T47D groups with doses equal to their IC50. All combined treatments (n = 67 for each cell line) were prepared as non-constant ratio from fractions of IC50 of the four compounds. The best 5 combinations for each cell line with lowest Tam doses and CI and highest cell death were selected for further molecular analysis in comparison to single-drug treatment. All treatments were applied on MCF7 and T47D cells at 70–80% confluence and the cells were incubated in CO2 incubator for 24 h, then harvested by trypsinization and immediately processed for molecular and flow cytometric analysis.
such as colon, bladder, liver, and breast cancers, without causing toxic effect on normal cells [7,11–13]. Pip, a dietary phytochemical product extracted from black and long pepper [14], has not only an anti-inflammatory effect [15], but it also inhibits cancer cell growth and metastasis with less toxic effect on healthy cells [16]. The therapeutic properties of Pip with other anti-cancer drugs were tested in various cell types including MCF7 [8,17]. BV has anti-inflammatory and immune modulatory properties [18] as well as inhibitory effect on cancer cells [19]. Induction of apoptosis by BV and its major component melittin was reported in lung cancer [18], hepatocellular carcinoma [20], leukemic cells [19], breast [9], prostate [21] and ovarian cancer cells [22]. Previous studies reported that Hes [10,23], Pip [2], and BV [9,18] each alone or each combined with anti-cancer drug possessed antiproliferative effect on breast cancer cells. However, to date no study investigated the combined anti-cancer effects of these three natural products with Tam. We hypothesized that this combination may achieve synergistic effect and dose reduction. Therefore, we investigated the potential effect of these natural products when given alone or in combination with the hormonal anti-cancer drug Tam on the ER-positive breast cancer MCF7 and T47D cells.
2.4. Gene expression analysis by qPCR Total RNA was isolated from MCF7 and T47D cells using Gene JET RNA Purification Kit (Thermo Scientific, USA). RNA concentration and purity were determined by nanodrop (Q5000, Quawell, USA) and 1% gel electrophoresis. RNA (5 μg) was reverse transcribed using Quantiscript reverse transcriptase. The produced cDNA was used as a template to determine the relative expression of Bax, Bcl2, EGFR and ERα genes using Step One Plus real time PCR system (Applied Biosystem, USA) and specific primers (Table 1). β actin was used as an internal control. The thermal cycling conditions, melting curves temperatures, and calculation of relative expression using 2−ΔΔCt were done as previously described [25,26].
2. Materials and methods 2.1. Cell viability by MTT assay Human breast adenocarcinoma MCF7 and ductal carcinoma T47D cells were separately seeded in a 96-well plate [1 × 104 cells/well, 100 μl/well] containing DMEM medium supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin (all obtained from GIBCO, New York, USA), and 2% L-glutamine (Invitrogen, New York, USA) and incubated at 37 °C for 24 h under 5% CO2, 95% air till 70–80% confluence. Various concentrations (0, 3.125, 6.25, 12.5, 25, 50, and 100 μg/ml) of Tam (Nolvadex®, Astra Zenca Cambridge, UK), Hes, Pip (Acros Organics, USA), and BV (Apis Injeel ™, Heel GMBH, Germany) were added alone or in concomitant combinations (at a non-constant ratio depending on their IC50 value) and cells were incubated for 24 h. The cells were incubated with 5 mg/ml of MTT (Sigma) for 4 h and then the medium was replaced with 100 μl DMSO (Sigma) and vortexed for 20 min. Absorbance was recorded at 570 nm using a microplate reader. The concentration of Tam and the three natural products inhibiting 50% of cells (IC50) was calculated using the sigmoidal curve using GraphPad (Prism) statistic software.
2.5. Cell cycle analysis Following trypsinization, MCF7 and T47D cells were centrifuged at 4500 rpm for 5 min, washed twice, re-suspended in warm PBS, fixed by ice-cold absolute ethanol, and then incubated at −20 °C for 24 h. After twice PBS washes, cells were re-suspended in propidium iodide (PI) solution containing 100 μl (0.02 mg/ml) PI, 50 μl (0.2 mg/ml) RNase A, and 0.1% v/v Triton X-100 in PBS, incubated in darkness for 30–60 min at room temperature, and then analyzed using Attune flow cytometer (Applied Bio-system, USA). 2.6. Statistical analysis Values were analyzed by one-way ANOVA followed by TukeyKramer multiple comparisons test using Graph Pad Prism 5 (Graph Pad Software, Inc., LaJolla, CA, USA). Significant differences among means were estimated at p < 0.05. The results were expressed as mean ± standard error of mean (SEM).
2.2. The combination index (CI) Dose-effect analysis of the combined treatments was carried out using Chou-Talalay method. The type of interaction between the compounds was determined by combination index (CI) using compusyn software with CI < 1 indicates presence of synergism between the tested compounds [24].
3. Results 3.1. Effect of Tam, Hes, Pip and BV on MCF7 and T47D cell viability MTT assay results exhibited significant dose-dependent anti-proliferative activity for Tam, Hes, Pip, and BV on MCF7 and T47D when used either alone or in combinations as compared to vehicle (DMSO)treated cells (Tables 2–5, Fig. 1). All 67 non-constant ratio combinations for each cell line resulted in a significant higher cytotoxic effect on
2.3. Experimental design The MCF7 and T47D cells were divided according single treatments into: vehicle (DMSO)-treated MCF7, vehicle (DMSO)-treated T47D, 1336
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
Table 2 Data for non-constant combination and % of MFC7 cell death for Tam, Hes, Pip and BV. Combination
Non-constant combination (IC50 fraction) % of cell death
Tam+ Hes Tam + Pip Tam + BV Hes + Pip Hes + BV Pip + BV Combination
Tam+ Hes + Pip Tam+ Hes + BV Tam + Pip + BV Hes + Pip + BV Combination
Tam + Hes + Pip + BV a
1/2:1/2
1/3:2/3
2/3:1/3
1/5:4/5
4/5:1/5
87.56 86.71 56.76 83.13 39.26 78.49
86.08 83.97 75.96 87.77a 72.16 58.87
86.92 84.18 82.49 79.33 70.68 82.28
86.08 88.82a 63.30 86.20 43.48 68.15
86.92 88.19 86.29 83.76 61.61 85.24
Non-constant combination (IC50 fraction) % of cell death 1/4:1/4:2/4
1/4:1/4:2/4
1/4:2/4:1/4
2/4:1/4:1/4
1/6:1/6:4/6
1/6:4/6:1/6
4/6:1/6:1/6
68.57 84.86 85.11 83.43
74.27 79.57 81.27 75.74
76.59 84.86 85.35a 86.55a
82.28 86.06 85.35 84.87
80.60 68.04 63.49 65.89
80.39 84.62 85.11 85.11
87.13 86.54 86.79 85.35
Non-constant combination (IC50 fraction) % of cell death 1/4:1/4:1/ 4:1/4
1/5:1/5:1/ 5:2/5
1/5:1/5:2/ 5:1/5
1/5:2/5:1/ 5:1/5
2/5:1/5:1/ 5:1/5
1/7:1/7:1/ 7:4/7
1/7:1/7:4/ 7:1/7
1/7:4/7:1/ 7:1/7
4/7:1/7:1/ 7:1/7
84.63
74.06
80.06
82.47
85.83
61.09
86.07a
82.23
85.59
The best non-constant combination ratio that achieved the highest cell death were selected for molecular and cell cycle analysis.
for MCF7 and T47D cells.
MCF7 and T47D than single drug treatment. Moreover, among these different combinations, 10 combinations (5 for each cell line) with lowest Tam doses [(Tam + Pip), (Hes + Pip), (Tam + Pip + BV), (Hes + Pip + BV) and (Tam + Hes + Pip + BV)] and [(Tam + Pip), (Tam + Hes), (Tam + Hes + BV), (Tam + Pip + BV) and (Tam + Hes + Pip + BV)] exhibited the highest inhibition for MCF7 and T47D viability, respectively. Notably, the (Tam + Hes + Pip + BV) groups which had minimal (1/7 IC50) Tam dose exhibited a maximal inhibition
3.2. Synergistic cytotoxicity of Tam, Hes, Pip and BV against MCF7 and T47D To determine the type of interaction between these four compounds, normalised isobolograms and combination index (CI) plot were constructed. On MCF7 cells, the lowest 5 CI values (0.279, 0.264, 0.281,
Table 3 Combination index (CI) data for non-constant combination of Tam, Hes, Pip and BV against MCF7 cells.
Tam + Pip
Hes + Pip
Tam + Pip + BV
Hes + Pip + BV
Tam + Hes + Pip + BV
a
IC50 fraction μg/ml
IC50/2
1/3:2/3
2/3:1/3
1/5:4/5
4/5:1/5
Tam dose Pip dose % cell death CI value Hes dose Pip dose % cell death CI value
19.03 18.67 86.71 0.30 30.65 18.67 83.13 0.32
12.85 24.89 83.97 0.359 20.43 24.89 87.77a 0.264a
25.69 12.45 84.18 0.343 40.86 12.45 79.33 0.361
7.71 29.87 88.82a 0.279a 12.26 29.87 86.20 0.302
30.81 7.47 88.19 0.27 49.03 7.47 83.76 0.269
IC50 fraction μg/ml
1/3:1/3:13
1/4:1/4:2/4
1/4:2/4:1/4
2/4:1/4:1/4
1/6:1/6:4/6
1/6:4/6:1/6
4/6:1/6:1/6
Tam dose Pip dose BV dose % cell death CI Hes dose Pip dose BV dose % cell death CI value
12.85 12.45 18.27 85.11 0.262 20.43 12.45 18.27 85.11 0.257
9.64 9.34 27.4 81.27 0.285 15.32 9.34 27.4 81.27 0.35
9.64 18.67 13.7 85.35a 0.281a 15.32 18.67 13.7 85.35a 0.236a
19.27 9.34 13.7 85.35 0.271 30.65 9.34 13.7 85.35 0.247
6.42 6.22 36.54 63.49 0.59 10.22 6.22 36.54 63.49 0.516
6.42 24.89 9.14 85.11 0.307 10.22 24.89 9.14 85.11 0.292
25.69 6.22 9.14 86.79 0.26 4.86 6.22 9.14 86.79 0.241
IC50 fraction μg/ml
1/4:1/4:1/ 4:1/4
1/5:1/5:1/ 5:2/5
1/5:1/5:2/ 5:1/5
1/5:2/5:1/ 5:1/5
2/5:1/5:1/ 5:1/5
1/7:1/7:1/ 7:4/7
1/7:1/7:4/ 7:1/7
1/7:4/7:1/ 7:1/7
4/7:1/7:1/ 7:1/7
Tam dose Hes dose Pip dose BV dose % cell death CI value
9.64 15.32 9.34 13.7 84.63 0.275
7.71 12.26 7.47 21.92 74.06 0.406
7.71 12.26 14.94 10.96 80.06 0.354
7.71 24.52 7.47 10.96 82.47 0.287
15.42 12.26 7.47 10.96 85.83 0.253
5.51 8.76 5.33 31.32 61.09 0.659
5.51 8.76 21.34 7.83 86.07a 0.279a
5.51 35.02 5.33 7.83 82.23 0.284
22.2 8.76 5.33 7.83 85.59 0.27
The best CI and % of cell death for non-constant combination ratio which selected for molecular and cell cycle analysis. 1337
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
Table 4 Data for non-constant combination and % of T47D cell death for Tam, Hes, Pip and BV. Combination
Non constant Combination (IC50 fraction) % of cell death 1/2:1/2
Tam-Hes Tam- Pip Tam- BV Hes- Pip Hes- BV Pip-BV Combination
Tam-Hes-Pip Tam-Hes-BV Tam- Pip-BV Hes-Pip-BV Combination
Tam- Hes-Pip-BV a
1/3:2/3
83.34 83.34 62.04 81.65 45.37 70.05
2/3:1/3
81.86 81.23 72.37 79.33 74.06 64.36
1/5:4/5
4/5:1/5
a
84.39 82.92 83.23 83.13 68.15 80.39
87.13 85.45 84.18 80.17 69 82.07
84.27 84.81a 75.32 83.97 41.16 65.83
Non constant Combination (IC50 fraction) % of cell death 1/4:1/4:2/4
1/4:1/4:2/4
1/4:2/4:1/4
2/4:1/4:1/4
1/6:1/6:4/6
1/6:4/6:1/6
4/6:1/6:1/6
72.16 82.94 83.43 82.23
77.85 61.55 78.86 78.14
73.21 83.42 80.3 81.75
83.34 87.74 84.87 80.06
79.33 70.2 66.61 70.94
81.02 87.5a 83.67a 83.19
86.29 81.74 85.83 81.99
Non constant Combination (IC50 fraction) % of cell death 1/4:1/4:1/4:1/ 4
1/5:1/5:1/5:2/ 5
1/5:1/5:2/5:1/ 5
1/5:2/5:1/5:1/ 5
2/5:1/5:1/5:1/ 5
1/7:1/7:1/ 7:4/7
1/7:1/7:4/7:1/ 7
1/7:4/7:1/7:1/ 7
4/7:1/7:1/7:1/ 7
85.11
72.14
82.23
81.27
81.75
73.1
87.99a
80.54
86.31
The best non constant combination ratio that achieved the highest cell death which selected for molecular and cell cycle analysis.
these 10 combinations.
0.236 and 0.279 were noticed in (Tam + Pip), (Hes + Pip), (Tam + Pip + BV), (Hes + Pip + BV) and (Tam + Hes + Pip + BV) groups, respectively (Table 3 and Supplementary 1). Similarly, on T47D, the lowest 5 CI values with lower Tam doses (0.263, 0.315, 0.249, 0.282, and 0.222) were observed in (Tam + Pip), (Tam + Hes), (Tam + Hes + BV), (Tam + Pip + BV) and (Tam + Hes + Pip + BV) groups, respectively (Table 5 and Supplementary 2). CI values below 1 indicate strong synergism in growth inhibition of MCF7 and T47D in
3.3. Effect of Tam, Hes, Pip, and BV on expression of Bax, Bcl2, ERα, and EGFR genes The qPCR results revealed a significant (P ≤ 0.05) downregulation in the expression levels of Bcl2, ERα, and EGFR genes and a significant upregulation in the expression levels of Bax gene in the single- and
Table 5 Combination index (CI) data for non-constant combination of Tam, Hes, Pip and BV against T47D cells.
Tam- Pip
Tam-Hes
Tam- Hes-BV
Tam- Pip-BV
Tam- Hes- PipBV
a
IC50 fraction μg/ml
IC50/2
1/3:2/3
2/3:1/3
1/5:4/5
4/5:1/5
Tam dose Pip dose % cell death CI value Tam dose Hes dose % cell death CI value
10.44 30.53 83.34 0.238 10.44 42.51 83.34 0.266
6.96 40.7 81.23 0.299 6.96 56.67 81.86 0.329
13.92 20.35 82.92 0.216 13.92 28.34 84.39 0.213
4.18 48.84 84.81 0.263a 4.18 68.01 84.27 0.315a
16.7 12.21 85.45 0.16 16.7 17 87.13 0.147
IC50 fraction μg/ml
1/3:1/3:13
1/4:1/4:2/4
1/4:2/4:1/4
2/4:1/4:1/4
1/6:1/6:4/6
1/6:4/6:1/6
4/6:1/6:1/6
Tam dose Hes dose BV dose % cell death CI Hes dose Pip dose BV dose % cell death CI value
6.96 28.34 23.78 82.94 0.281 6.96 20.35 23.78 83.43 0.254
5.22 21.25 35.67 61.55 0.743 5.22 15.26 35.67 78.86 0.340
5.22 42.51 17.83 83.42 0.298 5.22 30.53 17.83 80.3 0.323
10.44 21.25 17.83 87.74 0.177 10.44 15.26 17.83 84.87 0.208
3.48 14.17 47.55 70.2 0.536 3.48 10.18 47.55 66.61 0.600
3.48 56.67 11.89 87.5 0.249a 3.48 40.7 11.89 83.67 0.282a
13.92 14.17 11.89 81.74 0.239 13.92 10.18 11.89 85.83 0.170
IC50 fraction μg/ ml
1/4:1/4:1/ 4:1/4
1/5:1/5:1/ 5:2/5
1/5:1/5:2/ 5:1/5
1/5:2/5:1/ 5:1/5
2/5:1/5:1/ 5:1/5
1/7:1/7:1/ 7:4/7
1/7:1/7:4/ 7:1/7
1/7:4/7:1/ 7:1/7
4/7:1/7:1/ 7:1/7
Tam dose Hes dose Pip dose BV dose % cell death CI value
5.22 21.25 15.26 17.83 85.11 0.256
4.18 17 12.21 28.53 72.14 0.498
4.18 17 24.42 14.27 82.23 0.312
4.18 34 12.21 14.27 81.27 0.341
8.35 17 12.21 14.27 81.75 0.286
2.98 12.14 8.72 40.76 73.1 0.479
2.98 12.14 34.89 10.19 87.99 0.222a
2.9 48.58 8.72 10.19 50.54 0.377
11.93 12.14 8.72 10.19 86.31 0.186
The best CI, % of cell death and Tam low dose for non-constant combination ratio which selected for molecular and cell cycle analysis. 1338
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
Fig. 1. Sigmoidal curve for MTT assay showing IC50 values and the inhibition % of Tam (A), Hes (B), Pip (C) and BV (D) on MCF7 and T47D cells. Each data point represents an average of three independent experiments (n = 9).
combined- treated groups as compared to vehicle-treated MCF7 and T47D groups (Fig. 2). Again, the combined groups, especially in groups containing the 4 compounds, showed more notable changes (higher Bax and lower Bcl2, EGFR, and ERα) than single-treated groups.
However, treatment by Tam and/or Hes resulted in a significant elevated number of MCF7 and T47D cells in G0/G1 phase. All single and combined treatments significantly decreased MCF7 and T47D cells in S phase as compared to vehicle-treated cells.
3.4. Effect of Tam, Hes, Pip, and BV on MCF7 and T47D cell cycle
4. Discussion
The effect of single or combined treatment by Tam, Hes, Pip and BV on MCF7 and T47D cell cycle was determined by flow cytometry using PI which showed significant increase in number of MCF7 and T47D cells in G2/M phase in Pip and BV single-treated groups and all combined-treated groups, except Tam + Hes group, as compared to vehicletreated MCF7 and T47D groups (Fig. 3). Again, the highest cell numbers in G2/M phase was observed in the 4 compounds combined groups.
Tam is widely used as a standard chemotherapy for estrogenic positive breast cancer, but it should be given for long time (5–10 years) to get the best effect. However, this long lasting chemotherapeutic course usually causes severe side effects, including endometrial hyperplasia and polyps, thromboembolic events, and endometrial secondary cancer mainly due to inability of Tam, similar to other chemotherapeutics, to distinguish between highly dividing cancer cells and normal 1339
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
Fig. 2. Real-time quantitative PCR analysis of the expression of Bax, Bcl2, EGFR and ERα genes in MCF7 and T47D cells. Values are expressed as mean ± SEM, n = 9. Means within columns carrying different superscript letters are significantly different (P ≤ 0.05).
we investigated the anti-cancer effect of these three natural products alone and with Tam on MCF7 and T47D breast cancer cells and evaluated which drug combination gave the best anti-cancer effect. Our results revealed, significant dose-dependent anti-proliferative activity for Tam, Hes, Pip, and BV on MCF7 and T47D when used either alone or in combination with best effect for combined treatments. Among the tested 67 combinations for each cell line, 10 combinations with lowest Tam doses [(Tam + Pip), (Hes + Pip), (Tam + Pip + BV),
proliferating cells [6]. Drug combination becomes a widespread strategy in cancer treatment. Natural anti-cancer products are easily available, safe and their combination with anti-cancer drugs could exert synergistic therapeutic effect, reduce dose, toxicity and drug resistance for the chemotherapy [24]. Previous studies reported anti-cancer properties for some natural products, such as Hes [10,23], Pip [2,18,27], and BV [9,18] on breast cancer cells. However, none of these studies investigated their combined effects together or with Tam. Here, 1340
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
Fig. 3. Effect of Tam, Hes, Pip and BV alone or in combination on cell cycle of MCF7 and T47D cells as measured by flow cytometry. Cell cycle histograms of MCF-7 (A) and T47D (C) cells after treatment with individual and combined compounds. The X-axis represents the PI fluorescence based on the DNA content and the Y-axis represents the number of cells in each phase. Graphical presentation of % of cells in G0/G1, S and G2/M cell cycle phases in MCF7 (B) and T47D (D) cells. Values are expressed as mean ± SEM, n = 9. Means within columns carrying different superscript letters are significantly different (P ≤ 0.05).
cancer drugs through not only induction of apoptosis, but also by inhibition of cell migration, invasion and angiogenesis [2,29–31], it is worth to investigate the synergistic effect of this natural products-anticancer drug combination on cancer cell migration, invasion and angiogenesis in vitro and in vivo. In the present study and in consistent with Ip et al. [9] and Yan et al. [32], Pip and BV arrested MCF7 and T47D in G2/M phase of cell cycle. Another breast cancer cell, 4T1 mouse mammary carcinoma, also shows G2/M arrest [33]. However, Greenshields et al. [28] have found a significant decrease in number of MCF7 and triple negative cells in all cell cycle phases after treatment by Pip, suggesting broad inhibitory effect for Pip and failure of arrest at any phase of the cell cycle. In other cancer cell types, such as prostate cancer, Pip induces G1 phase cell cycle arrest [34]. It is likely that Pip may target different cell cycle regulators depending on the cancer cell type. On the other hand, we found that Tam and/or Hes caused G0/G1 phase arrest for MCF7 and T47D. Similar results were reported by other studies [35]. Thus, Tam and Hes act in both a cytostatic (by causing G0/G1 arrest) and cytotoxic (by inducing apoptosis) manner [36]. Interestingly, all combinations, except Tam + Hes group, arrested MCF7 and T47D in G2/M phase of cell cycle with highest number of arrested cells in group containing the 4 compounds. This altered cell cycle arrest phase of Tam and Hes in the 4 compounds group may be due to the synergism between these 4 compounds with predominant effect for Pip and BV. ERα, a major receptor robustly expressed in ER-positive breast cancer cell lines, such as MCF7 and T47D, and mammary epithelium of ER-positive breast cancer patients, plays a critical role in breast cancer progression [37]. The obtained results showed that administration of Tam, Hes, Pip, and BV alone or in combination resulted in a significant decrease in the expression level of ERα with lowest expression level in combination groups especially that contained the 4 compounds. Among the three natural compounds, only Hes was previously reported to inhibit all estrogen sensitive genes in mouse model of breast cancer [38]. To the best of our knowledge this may be the first study to report an
(Hes + Pip + BV) and (Tam + Hes + Pip + BV)] and [(Tam + Pip), (Tam + Hes), (Tam + Hes + BV), (Tam + Pip + BV) and (Tam + Hes + Pip + BV)] exhibited the highest inhibition for MCF7 and T47D viability, respectively. Notably, the (Tam + Hes + Pip + BV) groups which had minimal (1/7 IC50) Tam dose exhibited a maximal inhibition for MCF7 and T47D cells. This indicates the ability of these natural products to potentiate the anti-cancer effect of Tam even when the anticancer drug was used in low doses. Given that most adverse side effects of Tam are attributed to its high prolonged dose, co-administration of anti-cancer natural products with low dose of Tam may robustly inhibit cancer cells proliferation and could probably decrease side effects of Tam. However, this assumption should be experimentally proven on lab animals to evaluate the toxicity of the different combinations of the tested compounds on body systems. The present study revealed that administration of the natural products Hes, Pip, and BV alone or in combination with the anti-cancer drug Tam reduced the cell viability and induced apoptosis in MCF7 and T47D. Apoptosis was evident by significant increase in the expression of the pro-apoptotic Bax gene and significant decrease in the anti-apoptotic Bcl2 gene. MCF7 and T47D cells treated with the combined 4 compounds showed highest Bax and lowest Bcl2 expression, indicating higher apoptotic rate and synergism. These in vitro data confirmed in silico results of the isobologram and combination index and together they indicate synergistic effect for the 4 tested compounds. In agreement with our findings, previous studies showed that Pip, Hes, and BV and its major ingredient melittin had the ability to induce apoptosis and inhibit the growth of ER positive breast cancer MCF7 cells [7,9,28]. The three natural products also induce apoptosis in other cancer cells, including colon cancer [12], hepatocellular carcinoma [29], ovarian adenocarcinoma [27], and pancreatic cancer cells [30] through down regulation of Bcl2 expression, and up-regulation of Bax and caspase3 mRNA. This indicates that the apoptosis-dependant anti-cancer effect of these natural products is not restricted to a single cancer cell type. Because natural products enhance the therapeutic potential of anti1341
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
inhibitory effect for Pip and BV on MCF7 and T47D cells-expressing ERα. It is well-documented that the growth inhibitory effect of Tam on ERα-positive breast cancer cells is attributed to the competitive inhibition of the binding of estrogen to ERα, resulting in the repression of estrogen responsive genes [39]. Based on the above results, it is possible that the synergistic interaction between the three natural products and Tam may involve an ERα signaling blockade. The EGFR, another an important receptor expressed in MCF7 and T47D, plays an important role in the growth and progression of breast cancer. Breast cancer patients with overexpressed EGFR have bad prognosis. Similar to ERα, administration of Tam, Hes, Pip, and BV alone or in combination resulted in a significant decrease in the expression level of EGFR with lowest levels in combination groups particularly the 4 compounds combined group. In support, Hes inhibits cancer cell growth by suppression of EGFR and subsequent attenuation of EGFR/ERK signaling [40]. Moreover, inhibition of EGFR by Tam was reported in glioblastoma [41] and MCF7 [42]. However, following Tam resistance EGFR was overexpressed in breast cancer [43]. Absence of EGFR overexpression in the present study may be due to short duration of Tam treatment, which is not enough to develop drug resistance, or due to synergistic effect of combination therapy between Tam and the three natural products, which may increase drug sensitivity in cancer cells. Further investigations are required to check the effect of Tamnatural products synergism on Tam drug resistance. The obtained in vitro results on MCF7 and T47D cells establish the efficacy of new drugs combination before clinical trials are started and could be used to choose the most effective drug combination in individual patients. However, further in vivo investigations are needed to determine whether it is safe to give high-dose of these natural products to breast cancer patients as some of these products, such as piperine, induced toxicity in rodents when given in large dose [44]. Enhancing the anti-cancer effect is supported by our in vitro data, but the potential of enhanced toxicities of these compounds on other body systems is possible. Hence, in vivo study is necessary to check this possibility.
[4] F. Petrelli, A. Coinu, M. Cabiddu, M. Ghilardi, V. Lonati, S. Barni, Five or more years of adjuvant endocrine therapy in breast cancer: a meta-analysis of published randomised trials, Breast Cancer Res. Treat. 140 (2) (2013) 233–240. [5] C. Davies, H. Pan, J. Godwin, R. Gray, R. Arriagada, V. Raina, M. Abraham, V.H.M. Alencar, A. Badran, X. Bonfill, Long-term effects of continuing adjuvant tamoxifen to 10 years versus stopping at 5 years after diagnosis of oestrogen receptor-positive breast cancer: ATLAS, a randomised trial, Lancet 381 (9869) (2013) 805–816. [6] E.A. Musgrove, R.L. Sutherland, Biological determinants of endocrine resistance in breast cancer, Nat. Rev. Cancer 9 (9) (2009) 631–643. [7] C.J. Lee, L. Wilson, M.A. Jordan, V. Nguyen, J. Tang, G. Smiyun, Hesperidin suppressed proliferations of both human breast cancer and androgen-dependent prostate cancer cells, Phytother. Res. 24 (S1) (2010). [8] D. Bezerra, F. Castro, A. Alves, C. Pessoa, M. Moraes, E. Silveira, M. Lima, F. Elmiro, L. Costa-Lotufo, In vivo growth-inhibition of Sarcoma 180 by piplartine and piperine, two alkaloid amides from Piper, Braz. J. Med. Biol. Res. 39 (6) (2006) 801–807. [9] S.-W. Ip, S.-S. Liao, S.-Y. Lin, J.-P. Lin, J.-S. Yang, M.-L. Lin, G.-W. Chen, H.-F. Lu, M.-W. Lin, S.-M. Han, The role of mitochondria in bee venom-induced apoptosis in human breast cancer MCF7 cells, In Vivo 22 (2) (2008) 237–245. [10] E.J. Choi, Hesperetin induced G1-phase cell cycle arrest in human breast cancer MCF-7 cells: involvement of CDK4 and p21, Nutr. Cancer 59 (1) (2007) 115–119. [11] M. Yang, T. Tanaka, Y. Hirose, T. Deguchi, H. Mori, Y. Kawada, Chemopreventive effects of diosmin and hesperidin on N-butyl-N-(4-hydroxybutyl) nitrosamine-induced urinary-bladder carcinogenesis in male ICR mice, Int. J. Cancer 73 (5) (1997) 719–724. [12] H. Park, M.-J. Kim, E. Ha, J.-H. Chung, Apoptotic effect of hesperidin through caspase3 activation in human colon cancer cells, SNU-C4, Phytomedicine 15 (1) (2008) 147–151. [13] M.-H. Yeh, S.-T. Kao, C.-M. Hung, C.-J. Liu, K.-H. Lee, C.-C. Yeh, Hesperidin inhibited acetaldehyde-induced matrix metalloproteinase-9 gene expression in human hepatocellular carcinoma cells, Toxicol. Lett. 184 (3) (2009) 204–210. [14] A. Samykutty, A.V. Shetty, G. Dakshinamoorthy, M.M. Bartik, G.L. Johnson, B. Webb, G. Zheng, A. Chen, R. Kalyanasundaram, G. Munirathinam, Piperine, a bioactive component of pepper spice exerts therapeutic effects on androgen dependent and androgen independent prostate cancer cells, PLoS One 8 (6) (2013) e65889. [15] C. Pradeep, G. Kuttan, Piperine is a potent inhibitor of nuclear factor-κB (NF-κB), cFos, CREB, ATF-2 and proinflammatory cytokine gene expression in B16F-10 melanoma cells, Int. Immunopharmacol. 4 (14) (2004) 1795–1803. [16] E. Sunila, G. Kuttan, Immunomodulatory and antitumor activity of Piper longum Linn. and piperine, J. Ethnopharmacol. 90 (2) (2004) 339–346. [17] M.N. Motiwala, V.D. Rangari, Combined effect of paclitaxel and piperine on a MCF7 breast cancer cell line in vitro: evidence of a synergistic interaction, Synergy 2 (1) (2015) 1–6. [18] M.-H. Jang, M.-C. Shin, S. Lim, S.-M. Han, H.-J. Park, I. Shin, J.-S. Lee, K.-A. Kim, E.H. Kim, C.-J. Kim, Bee venom induces apoptosis and inhibits expression of cyclooxygenase-2 mRNA in human lung cancer cell line NCI-H1299, J. Pharmacol. Sci. 91 (2) (2003) 95–104. [19] C. Wang, T. Chen, N. Zhang, M. Yang, B. Li, X. Lü, X. Cao, C. Ling, Melittin, a major component of bee venom, sensitizes human hepatocellular carcinoma cells to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis by activating CaMKII-TAK1-JNK/p38 and inhibiting IκBα kinase-NFκB, J. Biol. Chem. 284 (6) (2009) 3804–3813. [20] D.-O. Moon, S.-Y. Park, M.-S. Heo, K.-C. Kim, C. Park, W.S. Ko, Y.H. Choi, G.-Y. Kim, Key regulators in bee venom-induced apoptosis are Bcl-2 and caspase-3 in human leukemic U937 cells through downregulation of ERK and Akt, Int. Immunopharmacol. 6 (12) (2006) 1796–1807. [21] M.H. Park, M.S. Choi, D.H. Kwak, K.W. Oh, D.Y. Yoon, S.B. Han, H.S. Song, M.J. Song, J.T. Hong, Anti-cancer effect of bee venom in prostate cancer cells through activation of caspase pathway via inactivation of NF-κB, Prostate 71 (8) (2011) 801–812. [22] M. Jo, M.H. Park, P.S. Kollipara, B.J. An, H.S. Song, S.B. Han, J.H. Kim, M.J. Song, J.T. Hong, Anti-cancer effect of bee venom toxin and melittin in ovarian cancer cells through induction of death receptors and inhibition of JAK2/STAT3 pathway, Toxicol. Appl. Pharmacol. 258 (1) (2012) 72–81. [23] S. Palit, S. Kar, G. Sharma, P.K. Das, Hesperetin induces apoptosis in breast carcinoma by triggering accumulation of ROS and activation of ASK1/JNK pathway, J. Cell. Physiol. 230 (8) (2015) 1729–1739. [24] T.-C. Chou, Drug combination studies and their synergy quantification using the Chou-Talalay method, Cancer Res. 70 (2) (2010) 440–446. [25] M.A. El-Magd, W.S. Abdo, M. El-Maddaway, N.M. Nasr, R.A. Gaber, E.S. El-Shetry, A.A. Saleh, F.A.A. Alzahrani, D.H. Abdelhady, High doses of S-methylcysteine cause hypoxia-induced cardiomyocyte apoptosis accompanied by engulfment of mitochondaria by nucleus, Biomed. Pharmacother. 94 (2017) 589–597. [26] M.A. El-Magd, S.F. Khalifa, F.A.A. Alzahrani, A.A. Badawy, E.S. El-Shetry, L.M. Dawood, M.M. Alruwaili, H.A. Alrawaili, E.F. Risha, F.M. El-Taweel, H.E. Marei, Incensole acetate prevents beta-amyloid-induced neurotoxicity in human olfactory bulb neural stem cells, Biomed. Pharmacother. 105 (2018) 813–823. [27] M.K. Pal, S.P. Jaiswar, A.K. Srivastav, S. Goyal, A. Dwivedi, A. Verma, J. Singh, A.K. Pathak, P.L. Sankhwar, R.S. Ray, Synergistic effect of piperine and paclitaxel on cell fate via cyt-c, Bax/Bcl-2-caspase-3 pathway in ovarian adenocarcinomas SKOV-3 cells, Eur. J. Pharmacol. 791 (2016) 751–762. [28] A.L. Greenshields, C.D. Doucette, K.M. Sutton, L. Madera, H. Annan, P.B. Yaffe, A.F. Knickle, Z. Dong, D.W. Hoskin, Piperine inhibits the growth and motility of
5. Conclusion The most relevant finding of this study was the discovery of new combination of natural products (Hes, Pip and BV) which synergistically potentiated the activity of the anti-cancer drug Tam against MCF7 and T47D breast cancer cell lines probably through induction of apoptosis, cell cycle arrest, and downregulation of ERα and EGFR. Further in vivo investigations are required to validate the potentiality of this new combination in targeting cancer cell and suppression of multidrug resistance. Conflicts of interest We do not have a financial or personal relationship with other people or organizations that could inappropriately influence the content of this paper. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.biopha.2018.06.105. References [1] D. Forman, J. Ferlay, B. Stewart, C. Wild, The global and regional burden of cancer, World Cancer Report 2014, (2014), pp. 16–53. [2] Y. Deng, S. Sriwiriyajan, A. Tedasen, P. Hiransai, P. Graidist, Anti-cancer effects of Piper nigrum via inducing multiple molecular signaling in vivo and in vitro, J. Ethnopharmacol. 188 (2016) 87–95. [3] M. Dowsett, J. Cuzick, J. Ingle, A. Coates, J. Forbes, J. Bliss, M. Buyse, M. Baum, A. Buzdar, M. Colleoni, Meta-analysis of breast cancer outcomes in adjuvant trials of aromatase inhibitors versus tamoxifen, J. Clin. Oncol. 28 (3) (2009) 509–518.
1342
Biomedicine & Pharmacotherapy 105 (2018) 1335–1343
A.A.A. Khamis et al.
[37] J. Jeong, S. Park, H.-T. An, M. Kang, J. Ko, Small leucine zipper protein functions as a negative regulator of estrogen receptor α in breast cancer, PLoS One 12 (6) (2017) e0180197. [38] F. Li, S. Chow, W.-h. Cheung, F.L. Chan, S. Chen, L.K. Leung, The citrus flavonone hesperetin prevents letrozole-induced bone loss in a mouse model of breast cancer, J. Nutr. Biochem. 24 (6) (2013) 1112–1116. [39] M. Clemons, S. Danson, A. Howell, Tamoxifen (‘Nolvadex’): a review: antitumour treatment, Cancer Treat. Rev. 28 (4) (2002) 165–180. [40] A. Yoshinaga, N. Kajiya, K. Oishi, Y. Kamada, A. Ikeda, P.K. Chigwechokha, T. Kibe, M. Kishida, S. Kishida, M. Komatsu, NEU3 inhibitory effect of naringin suppresses cancer cell growth by attenuation of EGFR signaling through GM3 ganglioside accumulation, Eur. J. Pharmacol. 782 (2016) 21–29. [41] C.D. Graham, N. Kaza, B.J. Klocke, G.Y. Gillespie, L.A. Shevde, S.L. Carroll, K.A. Roth, Tamoxifen induces cytotoxic autophagy in glioblastoma, J. Neuropathol. Exp. Neurol. 75 (10) (2016) 946–954. [42] S.H. Woo, S.-K. Seo, Y. Park, E.-K. Kim, M.-K. Seong, H.-A. Kim, J.-Y. Song, S.G. Hwang, J.K. Lee, W.C. Noh, Dichloroacetate potentiates tamoxifen-induced cell death in breast cancer cells via downregulation of the epidermal growth factor receptor, Oncotarget 7 (37) (2016) 59809. [43] Y. Koibuchi, Y. Iino, T. Uchida, T. Andoh, Y. Horii, M. Nagasawa, J. Horiguchi, M. Maemura, H. Takei, T. Yokoe, Regulation of estrogen receptor and epidermal growth factor receptor by tamoxifen under high and low estrogen environments in MCF-7 cells grown in athymic mice, Oncol. Rep. 7 (1) (2000) 135–175. [44] P. Piyachaturawat, T. Glinsukon, C. Toskulkao, Acute and subacute toxicity of piperine in mice, rats and hamsters, Toxicol. Lett. 16 (3–4) (1983) 351–359.
triple-negative breast cancer cells, Cancer Lett. 357 (1) (2015) 129–140. [29] R. Banjerdpongchai, B. Wudtiwai, P. Khaw-on, W. Rachakhom, N. Duangnil, P. Kongtawelert, Hesperidin from Citrus, Tumor Biol. 37 (1) (2016) 227–237. [30] U.N. Desai, K.P. Shah, S.H. Mirza, D.K. Panchal, S.K. Parikh, R.M. Rawal, Enhancement of the cytotoxic effects of cytarabine in synergism with hesperidine and silibinin in acute myeloid leukemia: an in-vitro approach, J. Cancer Res. Ther. 11 (2) (2015) 352. [31] M.A. El-Magd, A. Khamis, S.K. Nasr Eldeen, W.M. Ibrahim, A.F. Salama, Trehalose enhances the antitumor potential of methotrexate against mice bearing Ehrlich ascites carcinoma, Biomed. Pharmacother. 92 (2017) 870–878. [32] B. Yan, J.-g. Shen, K. Jiang, L.-h. Lai, Q.-h. Fu, Q.-m. Guo, Q.-q. Wang, Q.-y. Chen, Y. Liu, Piperine suppresses tumor growth and metastasis in vitro and in vivo in a 4T1 murine breast cancer model, Acta Pharmacol. Sin. 33 (4) (2012) 523. [33] L.-h. Lai, Q.-h. Fu, Y. Liu, K. Jiang, Q.-m. Guo, Q.-y. Chen, B. Yan, Q.-q. Wang, J.g. Shen, Piperine suppresses tumor growth and metastasis in vitro and in vivo in a 4T1 murine breast cancer model, Acta Pharmacol. Sin. 33 (2012) 523. [34] D.-y. Ouyang, L.-h. Zeng, H. Pan, L.-h. Xu, Y. Wang, K.-p. Liu, X.-h. He, Piperine inhibits the proliferation of human prostate cancer cells via induction of cell cycle arrest and autophagy, Food Chem. Toxicol. 60 (2013) 424–430. [35] Y. Wang, H. Yu, J. Zhang, J. Gao, X. Ge, G. Lou, Hesperidin inhibits HeLa cell proliferation through apoptosis mediated by endoplasmic reticulum stress pathways and cell cycle arrest, BMC Cancer 15 (1) (2015) 682. [36] R.R. Perry, Y. Kang, B. Greaves, Effects of tamoxifen on growth and apoptosis of estrogen-dependent and-independent human breast cancer cells, Ann. Surg. Oncol. 2 (3) (1995) 238–245.
1343