- Email: [email protected]
Heterogeneity in the 5′ untranslated region of the rat glucocorticoid receptor mRNA
J. Steroid Biochem. Molec. Biol. Vol. 46, No. 5, pp. 635--639, 1993 Printed in Great Britain. All rights reserved
0960-0760/93 $6.00 + 0.00 Copyright © 1993 Pergamon Press Ltd
SHORT COMMUNICATION HETEROGENEITY IN THE 5' UNTRANSLATED REGION OF THE RAT GLUCOCORTICOID RECEPTOR mRNA KATHARINE L. GEARING, WILLIAM CAIRNS, SAM OKRET* and JAN-/~KE GUSTAFSSON Karolinska Institute, Department of Medical Nutrition, Huddinge University Hospital, F60 NOVUM, 141 86 Huddinge, Sweden (Received 18 March 1993; accepted 22 July 1993)
S u m m a r y - - W e have cloned several novel sequences upstream from the first coding exon of the rat glucocorticoid receptor (GR) m R N A using PCR. Analysis of these sequences in RNase protection assays showed that one of the cloned sequences represents the major G R 5" non-coding exon which is expressed in all tissues studied, both at different stages of development and under different hormonal conditions. This major exon is homologous to the human G R 5' untranslated region ( U T R ) . Three other sequences were cloned, but could not be detected in the RNase protection assay, suggesting that they are only minor transcripts, at least under the varying conditions of GR expression studied. One of these sequences is identical to a previously described rat G R e D N A sequence, while another was shown to be contiguous with the rat genomic D N A sequence.
INTRODUCTION
The sensitivity of differentiated cells to glucocorticoids appears to be determined mainly by the concentration of glucocorticoid receptor (GR) [1, 2]. GR is expressed in most tissues and its expression is controlled at the level of both transcription and translation [for a review, see 2]. GR is auto-regulated by its own ligands with glucocorticoids down-regulating GR protein and mRNA levels in most systems [3-5]. This regulation occurs mainly at the level of transcription, but a post-translational process is also thought to be involved [4]. The regulation of GR is further complicated since in some tissues the receptor is up-regulated rather than down-regulated by glucocorticoid administration [6-8]. We were interested in whether the complex regulation of GR expression could in part be accounted for by transcription from multiple promoters which could be regulated differently, or by differential splicing in the 5' untranslated region (UTR) which could affect post-transcriptional regulation of GR expression. Since the original 6.3 kb rat GR eDNA was not a full length clone, lacking part of the 5' UTR [9], we first extended the eDNA sequence. GR cDNAs with different sequences in their 5' UTRs were isolated and the relative abundance of these variant sequences was investigated by RNase protection mapping under various conditions of GR expression.
42°C for 1 h and the products were analysed in a 12% polyacrylamide gel. The eDNA was tailed at the 3' end with either dATP or dCTP using terminal transferase and was then converted to double stranded DNA using an oligonucleotide containing either a poly dT or poly dG stretch at the 3' end which is linked to an adapter sequence (PLIT; 5'GACTCGAGTCGACATCGTTTTTTTTTTTTTTTTT or PL2G; 5'GACTCGAGTCGACATCGCCCGGGGGGGGGGGG). The double stranded cDNAs were then amplified by PCR using a GR complementary oligonucleotide (GR2), together with an adapter oligonucleotide (PL3; 5'GACTCGAGTCGACATCG). After 30 cycles of PCR amplification, the products were diluted and re-amplified using another GR specific oligonucleotide (GR3) and PL3. The PCR products were cloned in M13 and recombinant clones containing GR eDNA sequences were identified by hybridization with the oligonucleotide GR4. RNase protection analysis
Total RNA was prepared from adult rat liver, lung, kidney, brain, spleen or thymus, or from liver, lung or brain at different stages of development. RNA was also prepared from liver, spleen and lung of adrenalectomized animals that had been treated twice with either saline solution or betamethasone (3 mg/kg body wt at 25 and 17.5 h prior to sacrifice). Probe preparation
EXPERIMENTAL
PCR amplification o f GR eDNA
The GR specific primers used for primer extension and PCR amplification (GRI~,) are shown in Fig. 2(A). Poly A + RNA prepared from rat liver and lung (1/zg) was annealed with 0.7 ng end labelled GR1 oligonucleotide. The RNA was copied using 15 U AMV reverse transcriptase at *To whom correspondence should be addressed. 635
Part of the sequence of each of the four PCR products [Fig. 2(B)] was subcloned in pGEM3Z (Promega). Antisense RNA, labelled with [nP]UTP (Amersham), was transcribed in vitro from linearized plasmids containing the PCR1, PCR2, PCR3 or PCR4 sequences using SP6 or T7 RNA polymerase. Total RNA (50/~g) or control yeast tRNA was precipitated with 105epm RNA probe. The RNAs were denatured at 85°C for 10 min and annealed at 45°C for 16 h in 80% formamide, 40 mM PIPES (pH 6.4), 1 mM EDTA, 0.4M NaCI. The RNAs were digested with RNase [40/zg/ml RNase A, 2/zg/ml RNase TI in 0.3 M NaCI,
536
Short Communication
10raM Tris-HCl (pH 7.4), 5mM EDTA] for 60min at 37°C, treated with proteinase K, phenol extracted and precipitated. The products were run on 8% denaturing polyacrylamide gels and exposed to film overnight.
•
--J
U'J e-
_J
M
RESULTS AND DISCUSSION kb
PCR amplification o f GR cDNA An oligonucleotide (GR I), complementary to a sequence n the 5' coding region of the reported rat GR cDNA [9], [see Fig. 2(A)] was used in primer extension analysis of poly A + RNA from rat liver and lung (Fig. I). At least 2 primer ;xtension products of approx. 350 and 800 nucleotides were ~roduced in both tissues indicating that up to 0,8 kb of the 5' UTR of GR mRNA was not present in the original cDNA ;lone. We decided to clone and sequence these cDNAs to ]etermine whether they could be the products of differential ;plicing or of transcription from tandem promoters. Several :DNA libraries were screened using the 5' region of the cnown cDNA as a probe, but only GR clones which :erminated within the coding sequence were isolated. We herefore decided to clone the primer extension products Jsing a PCR based procedure (RACE) [10]. The GR specific ~rimers used for PCR amplification and sequences of the bur clones obtained using this procedure (PCRI-4) are ;hown in Fig. 2. All four different cDNA sequences were independently solated from both liver and lung mRNA. These cDNAs ~ere much shorter than those predicted from the size of the ~rimer extension products, varying between 52 and 148 lueleotides in length. This is probably due to the presence )f polydA and polydC tracts in the different GR mRNAs ~hich could hybridize to the PLTI or PLG2 oligonucle)tides used to prime second strand synthesis of the cDNA. I'hese shorter PCR products could then be selectively Lmplified during the 60 rounds of PCR amplification.
1.6
•
0.51 • 0.40 •
0.34 •
7loning of rat GR genornic DNA sequences The four GR cDNA sequences detected all diverge at a :ommon point [Fig. 2(B)]. This corresponds to the position )f an intron-exon junction in both the human and mouse 7R genes [I 1-13]. We have isolated the rat genomic cDNA :lone (2GR I) from a 2 library (Clontech) which hybridized o the first coding exon of the GR cDNA. Analysis of this :lone showed that it contained the entire first coding exon md approx. 1 kb of upstream sequence. A 0.5 kb Nco I Yagment spanning this region was subcloned and was found o contain a sequence identical to the sequence of one of the >CR products (PCR2). The sequence across the divergent "egion is shown in Fig. 2(B). This sequence corresponds to ihat of a consensus splice acceptor site, suggesting that the ?CR2 product could be derived from an incompletely ;pliced RNA. It is also possible that it is derived from ;ontaminating genomic DNA, although this is unlikely as ~oly A ÷ RNA was used in the initial primer extension "eactions.
0.22 •
Fig. 1. Extension products from rat liver poly A+RNA, and from rat lung poly A+RNA using end labelled GR1 oligonucleotide as a primer. End labelled DNA size markers are shown. RNase protection analysis Since not all of the PCR products described above were long enough to design oligonucleotide probes for quantitative PCR or Northern blot analysis, an RNase protection assay was employed to investigate the relative abundance of each of the sequences in the GR m R N A population. Part of the sequence of each of the four PCR products [Fig. 2(B)] was used to generate 32p labelled antisense RNA probes. These RNAs contained a region of 40 nucleotides which correspond to the 5' end of the invariant first coding exon
Fig. ,2 (Opposite) Fig. 2. (A) Partial sequence of the rat GR eDNA ([9], nucleotides 27-182) is shown together with the sequences of the complementary oligonucleotides used in primer extension and PCR amplification. (B) Comparison of rat eDNA from A with rat genomic DNA sequence derived from 2 GR 1 and the four PCR products derived from primer extended rat poly A + RNA. The sequences shown for PCRI, PCR2, PCR3 and PCR4 are the sequences used to prepare antisense probes for the RNase protection assays described in Fig. 3. Only part of PCR4 is shown whereas the PCR1, PCR2 and PCR3 products are shown in their entirety. Regions of difference between these sequences are in bold type, regions differing between PCR products are underlined. The translation initiation codon is also indicated. (C) Comparison of part of the rat PCR4 sequence with the human GR eDNA sequence. The translation start site is indicated, as is the position of the first intron in the human GR gene. (D) Comparison of the rat PCR product sequences across the intron-exon boundary with the 3 different mouse GR 5' non-coding exons and the mouse
1
2
3
4
PCR
PCR
PCR
PCR
•
TTAATATTTGCCAATGGACTCCAAAGAATCCTTAGCTCCC
-CGCGAGCGGGCGAGCGCGCGGGTGCTGAGTTAATATTTGCCAATGGACTCCAAAGAATCCTTAGCTCCC
-~TTAATATTTGCCAATGGACTCCAAAGAATCCTTAGCTCCC
-ATGTCTTTTTTTTTTCTTTTGTAGTTAATATTTGCCAATGGACTCCAAAGAATCCTTAGCTCCC
-
cTTATTATGTCTTTTTTTTTTCTTTTGTAGTTAATATTTGCCAATGGACTCCAAAGAATCCTTAGCTCCCCCTGGTAGA-
GGCGGCACGGAGT~CCCCC~GGGCTCACATTAATATTTGCCA~J3GACTCCAAAGAATCCTTAGCTCCCCCTGGTAGA-
C A G T T T G C T T G G C C ~ G T A A T G G A C T T T T A T ~ C T C 4 ~ T A C A TATTTTCC.C4~CTCCCCTCCTC 5'GRI
5•-GGCGGCA•GGAGT••••••••GGGCTCACATTAATATTTGCCAATGGACTCcAAAGAATCCTTAGCTCccccTGGTAGAGAcGAAGTccCTGGAATTATAAACGGTT~CTG 5'GR4 C~GACCATCTCTGCTTCAG~ ~CU~.TTTCTT~TC~A~G 5'GR3 5'GR2
IC
IB
mouse intron rat PCR 2
mouse exon rat PCR 4
mouse exon rat PCR i
IA
GR cDNA
mouse exon rat PCR 3
D
human
5' 5'
5' 5'
5' 5'
TTTGTAG TTTGTAG
GCTGAG GCTGAG
CTCACA CTCACA
- exon - exon
- intron -
-
- intron
5' A G G A A G - i n t r o n 5' A G G A G A G -
2 2 Fig.
2 ( A - - D ) - - l e g e n d opposite.
*
rat PCR 4 cDNA CGCGTCCGCACGCCA-CTTGTT-ATCT-GGCTGCGGTGGGAGCCGCGA ...... GCGGGCGAGCGCG-CGGGTGCT-GAGTTAATATTTGCCAATGGACTCCAAAGA~ I I I I I II II I IIIII IIII IIIIIIII I I I I I III IIIIIIIIIIII I III IIIII IIIII I IIIIIIIIIIIIIII TGcGTTCAcAAGCTAAGTTGTTTATCTCGGCTGcGGCGGGAACTGcGGACGGTGGcGGGCGAGCGGcTCCTCTGcCAGAGTTGATATTCACTGATGGACTCCAAAGA~
C
cDNA
kGRI
GR
B
GR cDNA (rat)
A
-4
o
o
mo
638
Short Communication
40=~
RNA
PROBE
t
C
4
L
t
C
L
2
t
C
3
L
t
C
L
M P P 1 3
1
Fig. 3. RNase protection analysis of GR mRNA 5' untranslated region. RNase protection assay using each of the four PCR probes (probes 1, 2, 3 and 4) and total RNA from rat hepatoma 762 cells (C), rat liver RNA (L) and control samples using tRNA (t). Undigested probes PCRI and PCR3 are also shown (Pl and P3). The RNase protection products of 40 and 69 nucleotides are indicates (arrow). Sizes of labelled DNA markers (M) are 75, 142, 154, 200, 220, 298, 344, 394, 506, 516 nucleotides and 1.6 kb.
of the GR mRNA and a short upstream sequence which varied in length and composition depending on the PCR product it was derived from. Each probe was hybridized with total RNA prepared from adult rat liver, lung, kidney, brain, spleen or thymus, or from liver, lung or brain at different stages of development. RNA was also prepared from liver, spleen and lung of adrenalectom~zed animals that had been treated twice with either saline solution or the synthetic glueocorticoid betamethasone. The hybrid RNAs were treated with RNase and the digested products were analysed in denaturing polyacrylamide gels. In this assay, if
the sequence of PCRl is present in the pool of GR mRNA then a protected fragment of 53 nucleotides would be produced with an antisense probe to PCRI. If the PCR2, PCR3 or PCR4 sequences are present then fragments of 65, 52 and 69 nucleotides, respectively would be produced with their respective antisense probes. In all cases a 40 nucleotide fragment would be protected by any GR mRNA which did not contain that particular variable sequence. Results from a typical RNase protection assay are shown in Fig. 3. Quantitative differences in the total GR mRNA pool were seen between samples, but no qualitative
Short Communication differences were seen. In all the experimental conditions we tested, the sequence of PCR4 could be detected as a 69 nucleotide fragment whereas PCR1, PCR2 and PCR3 probes produced only the 40 nucleotide fragment corresponding to the invariant first coding exon. This suggests that transcripts containing these sequences may be produced only at very low levels or under certain physiological conditions. The major RNA species detected is highly homologous to the human GR cDNA [Fig. 2(C)] [11, 12], The human GR promoter has recently been characterized and was shown to contain sequences which mediate down-regulation of transcription in response to glucocorticoids [14]. No other transcripts have been described for human GR, although there is also evidence for heterogeneity in the 5' UTR of mouse GR from studies of cell lines expressing mutant forms of the receptor[13] and from a recent report in which three different mouse GR promoters and their corresponding 5' non-translated exons were cloned and characterized[15]. Comparison of the 6 nucleotides from the 3' end of the first intron and each of the 3 exons of mouse GR with the rat PCR products described here [Fig. 2(D)] suggests that the rat GR gene is probably organized similarly to the mouse GR gene. The rat PCR4 sequence is likely to be the equivalent of the mouse exon IC, while the sequence corresponding to PCR3 may be expressed in a similar pattern to the mouse exon IA which was found to be expressed only in mouse T cell lines and at very low levels in thymus. The sequence corresponding to PCR1, which could not be detected in the RNase protection assay, is also likely to be expressed in some mRNAs, since this sequence has been isolated independently on four occasions, from both liver and lung in this report, from a rat hepatoma cell line in a previous report [9], and as the equivalent mouse exon 1B [15]. The mRNAs for several other steroid hormone receptors such as the progesterone receptor and oestrogen receptor also show degrees of heterogeneity in their 5' regions [16, 17] and it is possible that the variant 5' UTRs of GR may function in different situations to control receptor expression at the post-transcriptional level. This might explain situations where discrepancies have been found between the levels of GR mRNA and protein [2]. Acknowledgements--We would like to thank Anna Grusell for technical assistance, Anke van Eekelen for help with RNA preparation and Ian Catchpole and Kaj Grandien for reading the manuscript. This work was supported by a fellowship from the Karolinska Institute (to K.G.) and by grants from the Swedish Cancer Society (to K.G. and S.O.) and the Swedish Medical Research Council (No. 13X-2819).
REFERENCES !. Vanderbilt J. N., Miesfield R., Maler B. A. and Yamamoto K. R.: Intracellular receptor concentration limits glucocorticoid-dependent enhancer activity. Molec. Endocr. 1 (1987) 68-74. 2. Okret S., Dong Y., Brfnneg~ird M. and Gustafsson J.-A..: Regulation of glucocorticoid receptor expression. Biochimie 73 (1990) 51-59. 3. Okret S., Poellinger L., Dong Y. and Gustafsson J.-A..: Down-regulation of glucocorticoid receptor mRNA by
639
glucocorticoid hormones and recognition by the receptor of a specific binding sequence within a receptor cDNA clone. Proc. Natn. Acad. Sci. U.S.A. 83 (1988) 5899-5903. 4. Dong Y., Poellinger L., Gustafsson J.-.~. and Okret S.: Regulation of glucocorticoid receptor expression: evidence for transcriptional and posttranslational mechanisms. Molec. Endocr. 2 (1988) 1256-1264. 5. Kalinyak J. E., Dorin R. I., Hoffman A. R. and Perlman A. J.: Tissue-specific regulation of glucocorticoid receptor mRNA by dexamethasone. J. Biol. Chem. 262 (1987) 10441-10444. 6. Eisen L. P., Elsasser M. S. and Harmon J. M.: Positive regulation of the glucocorticoid receptor in human T-cells sensitive to the cytolytic effects of glucocorticoids. 3'. Biol. Chem. 263 (1988) 12044-12048. 7. Gomi L., Moriwaki K., Katagiri S., Kurata Y. and Thompson E. B.: Glucocorticoid effects on myeloma cells in culture: inhibition with induction of glucocorticoid receptor mRNA. Cancer Res. 50 (1990) 1873-1878. 8. Gadson P., McCoy J., Wikstrrm A. C. and Gustafsson J.-A..: Suppression of protein kinase C and the stimulation of glucocorticoid receptor synthesis by dexamethasone in human fibroblasts derived from tumour tissue, J. Cell. Biochem. 43 (1990) 185-189. 9. Miesfield R., Rusconi S., Godowski P. H., Maler B. A., Okret S., Wikstrrm A.-C., Gustafsson J.-A. and Yamamoto K. R.: Genetic complementation of a glucocorticoid receptor deficiency by expression of cloned receptor cDNA. Cell 46 (1986) 389-399. 10. Frohman M. A.: RACE: Rapid amplification ofcDNA ends. In PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego (1990) pp. 28-38. 11. Zong J., Ashraf J. and Thompson E, B.: The promoter and first, untranslated exon of the human glucocorticoid receptor are GC rich. Molec. Cell Biol. 10 (1990) 5580-5585. 12. Encio I. J. and Detera-Wadleigh S. D.: The genomic structure of the human glucocorticoid receptor. J. Biol. Chem. 266 (1990) 7182-7188, 13. Dieken E. S., Meese E. U. and Miesfield R. L.: nf glucocorticoid receptor transcripts lack sequences encoding the amino-terminal transcriptional modulatory domain. Molec. Cell BioL 10 (1990) 4574-4581. 14. Leclerc S., Xie B., Roy R. and Govindan M. V.: Purification of a human glucocorticoid receptor gene promoter-binding protein. J. Biol. Chem. 266 (1991) 8711-8719. 15. Str/ihle U., Schmidt A., Kelsey G., Stewart A. F., Cole T. J., Schmid W, and Schiitz G.: At least three promoters direct expression of the mouse glucocorticoid receptor gene. Proc. Natn. Acad. Sci. U.S,A. 89 (1992) 673 i-6735. 16. Wei L. L., Gonzalez-Aller C., Wood W. M., Miller L. A. and Horwitz K. B.: 5' heterogeneity in human progesterone receptor transcripts predicts a new amino-terminal truncated "C"-receptor and unique A-receptor messages. Molec. Endocr. 4 (1990) 1833-1840. 17. Keaveney M., Klug J., Dawson M. T., Nestor P. V., Neilan J. G., Forde R. C. and Gannon F.: Evidence for a previously unidentified upstream exon in the human oestrogen receptor gene. J. Molec. Endocr. 6 (1991) 111-115.
0960-0760/93 $6.00 + 0.00 Copyright © 1993 Pergamon Press Ltd
SHORT COMMUNICATION HETEROGENEITY IN THE 5' UNTRANSLATED REGION OF THE RAT GLUCOCORTICOID RECEPTOR mRNA KATHARINE L. GEARING, WILLIAM CAIRNS, SAM OKRET* and JAN-/~KE GUSTAFSSON Karolinska Institute, Department of Medical Nutrition, Huddinge University Hospital, F60 NOVUM, 141 86 Huddinge, Sweden (Received 18 March 1993; accepted 22 July 1993)
S u m m a r y - - W e have cloned several novel sequences upstream from the first coding exon of the rat glucocorticoid receptor (GR) m R N A using PCR. Analysis of these sequences in RNase protection assays showed that one of the cloned sequences represents the major G R 5" non-coding exon which is expressed in all tissues studied, both at different stages of development and under different hormonal conditions. This major exon is homologous to the human G R 5' untranslated region ( U T R ) . Three other sequences were cloned, but could not be detected in the RNase protection assay, suggesting that they are only minor transcripts, at least under the varying conditions of GR expression studied. One of these sequences is identical to a previously described rat G R e D N A sequence, while another was shown to be contiguous with the rat genomic D N A sequence.
INTRODUCTION
The sensitivity of differentiated cells to glucocorticoids appears to be determined mainly by the concentration of glucocorticoid receptor (GR) [1, 2]. GR is expressed in most tissues and its expression is controlled at the level of both transcription and translation [for a review, see 2]. GR is auto-regulated by its own ligands with glucocorticoids down-regulating GR protein and mRNA levels in most systems [3-5]. This regulation occurs mainly at the level of transcription, but a post-translational process is also thought to be involved [4]. The regulation of GR is further complicated since in some tissues the receptor is up-regulated rather than down-regulated by glucocorticoid administration [6-8]. We were interested in whether the complex regulation of GR expression could in part be accounted for by transcription from multiple promoters which could be regulated differently, or by differential splicing in the 5' untranslated region (UTR) which could affect post-transcriptional regulation of GR expression. Since the original 6.3 kb rat GR eDNA was not a full length clone, lacking part of the 5' UTR [9], we first extended the eDNA sequence. GR cDNAs with different sequences in their 5' UTRs were isolated and the relative abundance of these variant sequences was investigated by RNase protection mapping under various conditions of GR expression.
42°C for 1 h and the products were analysed in a 12% polyacrylamide gel. The eDNA was tailed at the 3' end with either dATP or dCTP using terminal transferase and was then converted to double stranded DNA using an oligonucleotide containing either a poly dT or poly dG stretch at the 3' end which is linked to an adapter sequence (PLIT; 5'GACTCGAGTCGACATCGTTTTTTTTTTTTTTTTT or PL2G; 5'GACTCGAGTCGACATCGCCCGGGGGGGGGGGG). The double stranded cDNAs were then amplified by PCR using a GR complementary oligonucleotide (GR2), together with an adapter oligonucleotide (PL3; 5'GACTCGAGTCGACATCG). After 30 cycles of PCR amplification, the products were diluted and re-amplified using another GR specific oligonucleotide (GR3) and PL3. The PCR products were cloned in M13 and recombinant clones containing GR eDNA sequences were identified by hybridization with the oligonucleotide GR4. RNase protection analysis
Total RNA was prepared from adult rat liver, lung, kidney, brain, spleen or thymus, or from liver, lung or brain at different stages of development. RNA was also prepared from liver, spleen and lung of adrenalectomized animals that had been treated twice with either saline solution or betamethasone (3 mg/kg body wt at 25 and 17.5 h prior to sacrifice). Probe preparation
EXPERIMENTAL
PCR amplification o f GR eDNA
The GR specific primers used for primer extension and PCR amplification (GRI~,) are shown in Fig. 2(A). Poly A + RNA prepared from rat liver and lung (1/zg) was annealed with 0.7 ng end labelled GR1 oligonucleotide. The RNA was copied using 15 U AMV reverse transcriptase at *To whom correspondence should be addressed. 635
Part of the sequence of each of the four PCR products [Fig. 2(B)] was subcloned in pGEM3Z (Promega). Antisense RNA, labelled with [nP]UTP (Amersham), was transcribed in vitro from linearized plasmids containing the PCR1, PCR2, PCR3 or PCR4 sequences using SP6 or T7 RNA polymerase. Total RNA (50/~g) or control yeast tRNA was precipitated with 105epm RNA probe. The RNAs were denatured at 85°C for 10 min and annealed at 45°C for 16 h in 80% formamide, 40 mM PIPES (pH 6.4), 1 mM EDTA, 0.4M NaCI. The RNAs were digested with RNase [40/zg/ml RNase A, 2/zg/ml RNase TI in 0.3 M NaCI,
536
Short Communication
10raM Tris-HCl (pH 7.4), 5mM EDTA] for 60min at 37°C, treated with proteinase K, phenol extracted and precipitated. The products were run on 8% denaturing polyacrylamide gels and exposed to film overnight.
•
--J
U'J e-
_J
M
RESULTS AND DISCUSSION kb
PCR amplification o f GR cDNA An oligonucleotide (GR I), complementary to a sequence n the 5' coding region of the reported rat GR cDNA [9], [see Fig. 2(A)] was used in primer extension analysis of poly A + RNA from rat liver and lung (Fig. I). At least 2 primer ;xtension products of approx. 350 and 800 nucleotides were ~roduced in both tissues indicating that up to 0,8 kb of the 5' UTR of GR mRNA was not present in the original cDNA ;lone. We decided to clone and sequence these cDNAs to ]etermine whether they could be the products of differential ;plicing or of transcription from tandem promoters. Several :DNA libraries were screened using the 5' region of the cnown cDNA as a probe, but only GR clones which :erminated within the coding sequence were isolated. We herefore decided to clone the primer extension products Jsing a PCR based procedure (RACE) [10]. The GR specific ~rimers used for PCR amplification and sequences of the bur clones obtained using this procedure (PCRI-4) are ;hown in Fig. 2. All four different cDNA sequences were independently solated from both liver and lung mRNA. These cDNAs ~ere much shorter than those predicted from the size of the ~rimer extension products, varying between 52 and 148 lueleotides in length. This is probably due to the presence )f polydA and polydC tracts in the different GR mRNAs ~hich could hybridize to the PLTI or PLG2 oligonucle)tides used to prime second strand synthesis of the cDNA. I'hese shorter PCR products could then be selectively Lmplified during the 60 rounds of PCR amplification.
1.6
•
0.51 • 0.40 •
0.34 •
7loning of rat GR genornic DNA sequences The four GR cDNA sequences detected all diverge at a :ommon point [Fig. 2(B)]. This corresponds to the position )f an intron-exon junction in both the human and mouse 7R genes [I 1-13]. We have isolated the rat genomic cDNA :lone (2GR I) from a 2 library (Clontech) which hybridized o the first coding exon of the GR cDNA. Analysis of this :lone showed that it contained the entire first coding exon md approx. 1 kb of upstream sequence. A 0.5 kb Nco I Yagment spanning this region was subcloned and was found o contain a sequence identical to the sequence of one of the >CR products (PCR2). The sequence across the divergent "egion is shown in Fig. 2(B). This sequence corresponds to ihat of a consensus splice acceptor site, suggesting that the ?CR2 product could be derived from an incompletely ;pliced RNA. It is also possible that it is derived from ;ontaminating genomic DNA, although this is unlikely as ~oly A ÷ RNA was used in the initial primer extension "eactions.
0.22 •
Fig. 1. Extension products from rat liver poly A+RNA, and from rat lung poly A+RNA using end labelled GR1 oligonucleotide as a primer. End labelled DNA size markers are shown. RNase protection analysis Since not all of the PCR products described above were long enough to design oligonucleotide probes for quantitative PCR or Northern blot analysis, an RNase protection assay was employed to investigate the relative abundance of each of the sequences in the GR m R N A population. Part of the sequence of each of the four PCR products [Fig. 2(B)] was used to generate 32p labelled antisense RNA probes. These RNAs contained a region of 40 nucleotides which correspond to the 5' end of the invariant first coding exon
Fig. ,2 (Opposite) Fig. 2. (A) Partial sequence of the rat GR eDNA ([9], nucleotides 27-182) is shown together with the sequences of the complementary oligonucleotides used in primer extension and PCR amplification. (B) Comparison of rat eDNA from A with rat genomic DNA sequence derived from 2 GR 1 and the four PCR products derived from primer extended rat poly A + RNA. The sequences shown for PCRI, PCR2, PCR3 and PCR4 are the sequences used to prepare antisense probes for the RNase protection assays described in Fig. 3. Only part of PCR4 is shown whereas the PCR1, PCR2 and PCR3 products are shown in their entirety. Regions of difference between these sequences are in bold type, regions differing between PCR products are underlined. The translation initiation codon is also indicated. (C) Comparison of part of the rat PCR4 sequence with the human GR eDNA sequence. The translation start site is indicated, as is the position of the first intron in the human GR gene. (D) Comparison of the rat PCR product sequences across the intron-exon boundary with the 3 different mouse GR 5' non-coding exons and the mouse
1
2
3
4
PCR
PCR
PCR
PCR
•
TTAATATTTGCCAATGGACTCCAAAGAATCCTTAGCTCCC
-CGCGAGCGGGCGAGCGCGCGGGTGCTGAGTTAATATTTGCCAATGGACTCCAAAGAATCCTTAGCTCCC
-~TTAATATTTGCCAATGGACTCCAAAGAATCCTTAGCTCCC
-ATGTCTTTTTTTTTTCTTTTGTAGTTAATATTTGCCAATGGACTCCAAAGAATCCTTAGCTCCC
-
cTTATTATGTCTTTTTTTTTTCTTTTGTAGTTAATATTTGCCAATGGACTCCAAAGAATCCTTAGCTCCCCCTGGTAGA-
GGCGGCACGGAGT~CCCCC~GGGCTCACATTAATATTTGCCA~J3GACTCCAAAGAATCCTTAGCTCCCCCTGGTAGA-
C A G T T T G C T T G G C C ~ G T A A T G G A C T T T T A T ~ C T C 4 ~ T A C A TATTTTCC.C4~CTCCCCTCCTC 5'GRI
5•-GGCGGCA•GGAGT••••••••GGGCTCACATTAATATTTGCCAATGGACTCcAAAGAATCCTTAGCTCccccTGGTAGAGAcGAAGTccCTGGAATTATAAACGGTT~CTG 5'GR4 C~GACCATCTCTGCTTCAG~ ~CU~.TTTCTT~TC~A~G 5'GR3 5'GR2
IC
IB
mouse intron rat PCR 2
mouse exon rat PCR 4
mouse exon rat PCR i
IA
GR cDNA
mouse exon rat PCR 3
D
human
5' 5'
5' 5'
5' 5'
TTTGTAG TTTGTAG
GCTGAG GCTGAG
CTCACA CTCACA
- exon - exon
- intron -
-
- intron
5' A G G A A G - i n t r o n 5' A G G A G A G -
2 2 Fig.
2 ( A - - D ) - - l e g e n d opposite.
*
rat PCR 4 cDNA CGCGTCCGCACGCCA-CTTGTT-ATCT-GGCTGCGGTGGGAGCCGCGA ...... GCGGGCGAGCGCG-CGGGTGCT-GAGTTAATATTTGCCAATGGACTCCAAAGA~ I I I I I II II I IIIII IIII IIIIIIII I I I I I III IIIIIIIIIIII I III IIIII IIIII I IIIIIIIIIIIIIII TGcGTTCAcAAGCTAAGTTGTTTATCTCGGCTGcGGCGGGAACTGcGGACGGTGGcGGGCGAGCGGcTCCTCTGcCAGAGTTGATATTCACTGATGGACTCCAAAGA~
C
cDNA
kGRI
GR
B
GR cDNA (rat)
A
-4
o
o
mo
638
Short Communication
40=~
RNA
PROBE
t
C
4
L
t
C
L
2
t
C
3
L
t
C
L
M P P 1 3
1
Fig. 3. RNase protection analysis of GR mRNA 5' untranslated region. RNase protection assay using each of the four PCR probes (probes 1, 2, 3 and 4) and total RNA from rat hepatoma 762 cells (C), rat liver RNA (L) and control samples using tRNA (t). Undigested probes PCRI and PCR3 are also shown (Pl and P3). The RNase protection products of 40 and 69 nucleotides are indicates (arrow). Sizes of labelled DNA markers (M) are 75, 142, 154, 200, 220, 298, 344, 394, 506, 516 nucleotides and 1.6 kb.
of the GR mRNA and a short upstream sequence which varied in length and composition depending on the PCR product it was derived from. Each probe was hybridized with total RNA prepared from adult rat liver, lung, kidney, brain, spleen or thymus, or from liver, lung or brain at different stages of development. RNA was also prepared from liver, spleen and lung of adrenalectom~zed animals that had been treated twice with either saline solution or the synthetic glueocorticoid betamethasone. The hybrid RNAs were treated with RNase and the digested products were analysed in denaturing polyacrylamide gels. In this assay, if
the sequence of PCRl is present in the pool of GR mRNA then a protected fragment of 53 nucleotides would be produced with an antisense probe to PCRI. If the PCR2, PCR3 or PCR4 sequences are present then fragments of 65, 52 and 69 nucleotides, respectively would be produced with their respective antisense probes. In all cases a 40 nucleotide fragment would be protected by any GR mRNA which did not contain that particular variable sequence. Results from a typical RNase protection assay are shown in Fig. 3. Quantitative differences in the total GR mRNA pool were seen between samples, but no qualitative
Short Communication differences were seen. In all the experimental conditions we tested, the sequence of PCR4 could be detected as a 69 nucleotide fragment whereas PCR1, PCR2 and PCR3 probes produced only the 40 nucleotide fragment corresponding to the invariant first coding exon. This suggests that transcripts containing these sequences may be produced only at very low levels or under certain physiological conditions. The major RNA species detected is highly homologous to the human GR cDNA [Fig. 2(C)] [11, 12], The human GR promoter has recently been characterized and was shown to contain sequences which mediate down-regulation of transcription in response to glucocorticoids [14]. No other transcripts have been described for human GR, although there is also evidence for heterogeneity in the 5' UTR of mouse GR from studies of cell lines expressing mutant forms of the receptor[13] and from a recent report in which three different mouse GR promoters and their corresponding 5' non-translated exons were cloned and characterized[15]. Comparison of the 6 nucleotides from the 3' end of the first intron and each of the 3 exons of mouse GR with the rat PCR products described here [Fig. 2(D)] suggests that the rat GR gene is probably organized similarly to the mouse GR gene. The rat PCR4 sequence is likely to be the equivalent of the mouse exon IC, while the sequence corresponding to PCR3 may be expressed in a similar pattern to the mouse exon IA which was found to be expressed only in mouse T cell lines and at very low levels in thymus. The sequence corresponding to PCR1, which could not be detected in the RNase protection assay, is also likely to be expressed in some mRNAs, since this sequence has been isolated independently on four occasions, from both liver and lung in this report, from a rat hepatoma cell line in a previous report [9], and as the equivalent mouse exon 1B [15]. The mRNAs for several other steroid hormone receptors such as the progesterone receptor and oestrogen receptor also show degrees of heterogeneity in their 5' regions [16, 17] and it is possible that the variant 5' UTRs of GR may function in different situations to control receptor expression at the post-transcriptional level. This might explain situations where discrepancies have been found between the levels of GR mRNA and protein [2]. Acknowledgements--We would like to thank Anna Grusell for technical assistance, Anke van Eekelen for help with RNA preparation and Ian Catchpole and Kaj Grandien for reading the manuscript. This work was supported by a fellowship from the Karolinska Institute (to K.G.) and by grants from the Swedish Cancer Society (to K.G. and S.O.) and the Swedish Medical Research Council (No. 13X-2819).
REFERENCES !. Vanderbilt J. N., Miesfield R., Maler B. A. and Yamamoto K. R.: Intracellular receptor concentration limits glucocorticoid-dependent enhancer activity. Molec. Endocr. 1 (1987) 68-74. 2. Okret S., Dong Y., Brfnneg~ird M. and Gustafsson J.-A..: Regulation of glucocorticoid receptor expression. Biochimie 73 (1990) 51-59. 3. Okret S., Poellinger L., Dong Y. and Gustafsson J.-A..: Down-regulation of glucocorticoid receptor mRNA by
639
glucocorticoid hormones and recognition by the receptor of a specific binding sequence within a receptor cDNA clone. Proc. Natn. Acad. Sci. U.S.A. 83 (1988) 5899-5903. 4. Dong Y., Poellinger L., Gustafsson J.-.~. and Okret S.: Regulation of glucocorticoid receptor expression: evidence for transcriptional and posttranslational mechanisms. Molec. Endocr. 2 (1988) 1256-1264. 5. Kalinyak J. E., Dorin R. I., Hoffman A. R. and Perlman A. J.: Tissue-specific regulation of glucocorticoid receptor mRNA by dexamethasone. J. Biol. Chem. 262 (1987) 10441-10444. 6. Eisen L. P., Elsasser M. S. and Harmon J. M.: Positive regulation of the glucocorticoid receptor in human T-cells sensitive to the cytolytic effects of glucocorticoids. 3'. Biol. Chem. 263 (1988) 12044-12048. 7. Gomi L., Moriwaki K., Katagiri S., Kurata Y. and Thompson E. B.: Glucocorticoid effects on myeloma cells in culture: inhibition with induction of glucocorticoid receptor mRNA. Cancer Res. 50 (1990) 1873-1878. 8. Gadson P., McCoy J., Wikstrrm A. C. and Gustafsson J.-A..: Suppression of protein kinase C and the stimulation of glucocorticoid receptor synthesis by dexamethasone in human fibroblasts derived from tumour tissue, J. Cell. Biochem. 43 (1990) 185-189. 9. Miesfield R., Rusconi S., Godowski P. H., Maler B. A., Okret S., Wikstrrm A.-C., Gustafsson J.-A. and Yamamoto K. R.: Genetic complementation of a glucocorticoid receptor deficiency by expression of cloned receptor cDNA. Cell 46 (1986) 389-399. 10. Frohman M. A.: RACE: Rapid amplification ofcDNA ends. In PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego (1990) pp. 28-38. 11. Zong J., Ashraf J. and Thompson E, B.: The promoter and first, untranslated exon of the human glucocorticoid receptor are GC rich. Molec. Cell Biol. 10 (1990) 5580-5585. 12. Encio I. J. and Detera-Wadleigh S. D.: The genomic structure of the human glucocorticoid receptor. J. Biol. Chem. 266 (1990) 7182-7188, 13. Dieken E. S., Meese E. U. and Miesfield R. L.: nf glucocorticoid receptor transcripts lack sequences encoding the amino-terminal transcriptional modulatory domain. Molec. Cell BioL 10 (1990) 4574-4581. 14. Leclerc S., Xie B., Roy R. and Govindan M. V.: Purification of a human glucocorticoid receptor gene promoter-binding protein. J. Biol. Chem. 266 (1991) 8711-8719. 15. Str/ihle U., Schmidt A., Kelsey G., Stewart A. F., Cole T. J., Schmid W, and Schiitz G.: At least three promoters direct expression of the mouse glucocorticoid receptor gene. Proc. Natn. Acad. Sci. U.S,A. 89 (1992) 673 i-6735. 16. Wei L. L., Gonzalez-Aller C., Wood W. M., Miller L. A. and Horwitz K. B.: 5' heterogeneity in human progesterone receptor transcripts predicts a new amino-terminal truncated "C"-receptor and unique A-receptor messages. Molec. Endocr. 4 (1990) 1833-1840. 17. Keaveney M., Klug J., Dawson M. T., Nestor P. V., Neilan J. G., Forde R. C. and Gannon F.: Evidence for a previously unidentified upstream exon in the human oestrogen receptor gene. J. Molec. Endocr. 6 (1991) 111-115.