Heterologous expression of dodecaheme “nanowire” cytochromes c from Geobacter sulfurreducens

Protein Expression and PuriWcation 47 (2006) 241–248 www.elsevier.com/locate/yprep

Heterologous expression of dodecaheme “nanowire” cytochromes c from Geobacter sulfurreducens 夽 Yuri Y. Londer ¤, P. Raj Pokkuluri, Valerie Orshonsky 1, Lisa Orshonsky 2, Marianne SchiVer Biosciences Division, Argonne National Laboratory, Argonne, IL 60439, USA Received 30 August 2005, and in revised form 11 November 2005 Available online 15 December 2005

Abstract Multiheme cytochromes c are diYcult to produce in heterologous systems. The genome of -proteobacterium Geobacter sulfurreducens contains more than a hundred genes coding for c-type cytochromes. Among those are two dodecaheme cytochromes c representing a new class of multiheme cytochromes, whose putative structure is a one-dimensional array of small highly homologous domains that contain three hemes and are covalently bound by short linkers. They are likely to form “nanowires” that are part of the electron transfer chain. We cloned the genes coding for the two cytochromes into a vector we developed for ligation-independent cloning of proteins targeted to the Escherichia coli periplasmic space. We expressed the proteins in E. coli co-transformed with a plasmid harboring the cytochrome c maturation genes. Expression levels were optimized by varying IPTG concentrations used for induction. Although both proteins appeared insoluble or strongly associated with cell membranes, they were solubilized using 0.5 M sodium chloride which was more selective than conventional solubilizing agents, such as HEGA-10 or -octylglucoside. The solubilized proteins were dialyzed and puriWed by cation exchange chromatography followed by gel Wltration. Mass-spectrometry analysis conWrmed that both puriWed proteins contained the complete set of covalently attached hemes, 12 per molecule. Their visible spectra were typical of c-type cytochromes. Both proteins were successfully crystallized. © 2006 Elsevier Inc. All rights reserved. Keywords: Geobacter sulfurreducens; Heterologous expression; Ligation-independent cloning; Multiheme cytochrome c; Nanowire

Cytochromes c are electron transfer proteins involved in respiratory processes of almost all organisms. They have heme prosthetic groups covalently bound to the polypeptide chain via two thioether bonds. Cytochromes c display the typical CXXCH sequence pattern in which the histidine residue serves as one of the axial ligands to the iron of the heme [1]. Multiheme cytochromes found in

the periplasm of Fe(III)-reducing bacteria [2,3] and in sulfur- and sulfate-reducing bacteria [4–6] play critical roles in the environmental processing of many metals, including radionuclides [7,8]. Multiheme cytochromes c are of increasing interest for two main reasons: they present a model for studying biological electron transport (e.g. [9–12]) and possess metal reductase activity that is of

夽 Disclaimer. This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor The University of Chicago, nor any of their employees or oYcers, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any speciWc commercial product, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favoring by the United States Government or any agency thereof. The views and opinions of document authors expressed herein do not necessarily state or reXect those of the United States Government or any agency thereof. * Corresponding author. Fax +1 630 252 3387. E-mail address: [email protected] (Y.Y. Londer). 1 Present address: Chicago Medical School, Rosalind Franklin University of Medicine and Science, 3333 Green Bay Road, North Chicago 60064, USA. 2 Present address: Adler School of Professional Psychology, 65 E. Wacker Place, Chicago, IL 60601, USA.

1046-5928/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2005.11.017

242

Y.Y. Londer et al. / Protein Expression and PuriWcation 47 (2006) 241–248

great environmental interest as bioreduction of toxic metals is believed to be an eYcient way of remediation of contaminated sites [7,8]. The capability to express proteins in heterologous systems has been an important enabling feature for structural and functional studies of proteins. Although recent progress in expression technology has signiWcantly increased the capability for protein expression [13,14], cytochromes c remain a recalcitrant class of proteins, mainly due to low eYciency of post-translational modiWcation (covalent attachment of hemes) in traditional expression hosts such as Escherichia coli. Advances in heterologous expression of multiheme cytochromes c used one of two avenues: either coexpression of E. coli gene cluster ccmABCDEFGH responsible for maturation of cytochromes c (normally active only under anaerobic conditions [15]) from a separate plasmid [16] or employing expression hosts proWcient in production of cytochromes, e.g., Desulfovibrio desulfuricans [17] or Shewanella oneidensis [18,19]. However, both methods have had very limited success in production of polyheme cytochromes (those with more than four hemes per molecule); so far only two examples have been published [19,20]. The present study reports the cloning, expression, and puriWcation of two homologous dodecaheme cytochromes c from Geobacter sulfurreducens—-proteobacterium capable of oxidizing organic compounds using Fe(III) and other metal ions or metal oxides as terminal electron acceptors [21] and, based on its genome sequence, predicted to have genes for an unusually large number of cytochromes c, more than one hundred [22]. Among others, the genome contains three ORFs encoding two proteins with 12 heme binding motifs and one with 27 heme binding motifs (GSU0592, GSU1996, and GSU2210, respectively3). These proteins consist of domains that contain three hemes; the domains are highly homologous to each other within the same protein as well as to similar domains from the other two proteins [23]. All three proteins have their counterparts in the genome of the cognate organism Geobacter metallireducens, with pairwise sequence identities higher than 70% [24]. An outstanding feature of these novel proteins is that their putative structure is a one-dimensional array; they probably function as natural “nanowires” transferring electrons within the periplasm. These proteins could be models for the rational design of nanoconductors. Earlier, we described cloning, expression, and puriWcation of all four single domains of GSU1996 (GenBank Accession No. AAR35372) and all three two-domain fragments (tandems) as well as X-ray structure for one of the single domains at 1.7 Å resolution [24] and a preliminary structure for one of the tandems [25]. Expression levels and puriWcation yields diVered signiWcantly among the single domains and, even more, among the tandems. Nevertheless,

3 Protein ID Nos. GSU0592, GSU1996, and GSU2210 correspond to ORFs 00991, 03300, and 03649, respectively, as used in [23].

we were able to obtain enough material for crystallization and the X-ray structures conWrmed our initial hypothesis that this is a novel class of cytochromes c characterized by multidomain composition consisting of highly homologous modules and by a mixed type of heme coordination. While in other known multiheme cytochromes c all hemes have two histidines as the axial ligands, in the present molecules each single domain has two hemes with bis-histidinyl coordination and the third heme has a histidine–methionine coordination. Histidine–methionine coordination is a feature previously observed only for small monoheme cytochromes c [23,24]. In this work, we addressed expression and isolation of the full-length GSU1996 and its homolog GSU0592 (GenBank Accession No. AAR33923). Both genes were cloned into a novel vector designed specially for ligation-independent cloning of periplasmic proteins and expressed in E. coli. The proteins were puriWed and crystallized. Correct post-translational processing of the proteins (heme incorporation) was conWrmed by mass spectrometry. Materials and methods Bacterial strains and plasmids Escherichia coli strain DH5 (Invitrogen) was used for subcloning and strain JCB7123 provided by Prof. S. Ferguson (University of Oxford, UK), co-transformed with plasmid pEC86 [16] was used for protein production. Plasmid pEC86 containing the ccm gene cluster was a gift from Dr. L. Thöny-Meyer (ETH, Zürich, Switzerland). Cultures were routinely grown in 2£ YT medium or on 2£ YT agar plates [26]. Growth media were supplemented with carbenicillin, 100 g/ml, and chloramphenicol, 34 g/ml, where appropriate. Construction of pLBM4 DNA manipulations followed standard published procedures [26]. Oligonucleotides were synthesized by MWG Biotech (High Point, NC). KOD DNA polymerase (Novagen) was used for PCR ampliWcations. PCR products were puriWed using QIAquick PCR puriWcation kit (Qiagen). For mutagenesis, QuikChange Multi Site-Directed Mutagenesis Kit (Stratagene) was used in accordance with the manufacturer’s instructions. Restriction enzymes and T4 DNA polymerase were bought from New England Biolabs. All constructs were conWrmed by DNA sequencing performed by MWG Biotech. Vector pLBM4 was made on the basis of pCKN5—a derivative of pCK32 [27], in which a NotI restriction site was introduced at the end of the DNA fragment coding for the OmpA leader sequence. pCKN5 was an intermediate step during design of pVA203 subsequently used for cloning of the single domains and tandems [24,25] (Fig. 1). To construct pLBM4, the entire region in pCKN5 encoding the mature cytochrome c7 gene and four cloning

Y.Y. Londer et al. / Protein Expression and PuriWcation 47 (2006) 241–248

243

Fig. 1. Design of vector pLBM4. NotI–HindIII fragment in pCKN5 encoding the mature cytochrome c7 gene and short 3⬘ untranslated region (A) was replaced by a short linker (B). Then an FspI restriction site was created and Ala(¡2)Phe mutation was introduced to give pLBM4 (C). Another FspI site in the body of plasmid was destroyed (not shown). Fragments of DNA and proteins sequences corresponding to the OmpA leader sequence are underlined. NotI (gcggccgc), HindIII (aagctt), and FspI (tgcgca) restriction sites are shown in italic.

sites downstream was excised by digestion with NotI and HindIII. The synthetic 5⬘-phosphorylated oligonucleotides NH-F (5⬘-pGGCCGCGCACGACGACA) and NH-R (5⬘pAGCTTGTCGTCGTGCGC) were hybridized and ligated into the digested pCKN5 (Fig. 1B). To create an FspI site in the linker and to remove one in the body of plasmid, double mutagenesis with primers M-Phe (5⬘-pGT TTCGCTACCGTTGCGTTTGCGCACGACGACAAGC) and M-Fsp (5⬘-pCAATGGCAACAACGTTACGCAAA CTATTAACTGGCG) was performed (Fig. 1C).

Table 1 Preparation of solubilization samples for GSU1996 No NaCl

0.5 M NaCl

Control OG TES buVera NaCl, 4 M Octylglucoside, 0.36 M HEGA-10, 0.18 M Water a

1200 — — — 800

HEGA Control OG

1200 1200 — — 150 — — 150 650 650

1200 250 — — 550

HEGA

1200 1200 250 250 150 — — 150 400 400

All volumes are in microliters.

Ligation-independent cloning DNA fragments coding for the mature sequences of cytochromes GSU0592 and GSU1996 were ampliWed from the G. sulfurreducens genomic DNA with primers CT1-LF (5⬘-CCG TTG CGTTTGCAAAAGATGCGGTATTCCA AAC) and CT1-LR (5⬘-GCTTGTCGTCGTGCATTACA TGTTGTGGCACTTG), CT2-LF (5⬘-CCGTTGCGTTT GCAAAGGAGACGAAAAATGTTC) and CT2-LR (5⬘GCTTGTCGTCGTGCATTACATGTTGTGGCACTTC AC), respectively. Then they were treated with T4 DNA polymerase (New England Biolabs) in the presence of 5 mM dTTP for 30 min at room temperature followed by heat inactivation of the polymerase. The vector was linearized with FspI and treated with T4 DNA polymerase in the presence of 3 mM dATP for 1 h at room temperature followed by heat inactivation of the polymerase. The annealing reactions including 30 ng of the vector and 50 ng of a PCR fragment were incubated 10 min at room temperature and transformed into competent DH5 E. coli cells. Solubilization tests for GSU1996 Small scale cultures (25 ml) were grown aerobically to mid-exponential phase at 30 °C at a shaking speed of 250 rpm and induced with 20 M IPTG. After overnight incubation at 30 °C and 200 rpm, cells were harvested and the cell pellets were resuspended in 1.2 ml of ice-cold TES buVer (0.5 M sucrose, 0.2 M Tris–HCl, pH 8.0, 0.5 mM EDTA). Then ice-cold water and/or solutions of detergents n-octyl--D-glucoside and HEGA-10 (both from Anatrace) and/or sodium chloride were added as summarized in Table 1. The suspensions were incubated on ice with gentle shaking for approximately 2 h, transferred to 2 ml microfuge tubes, and centrifuged in a benchtop centrifuge at the maximum speed for 20 min at 4 °C. Supernatants constituting the

periplasmic fractions were transferred into clean microtubes and absorbencies at 280 nm (for 1/10 dilutions) and 411 nm were measured. Expression and puriWcation of cytochromes Expression and puriWcation were performed according to slightly modiWed procedures described earlier [24,25,27]. E. coli cultures were grown aerobically to midexponential phase at 30 °C at a shaking speed of 250 rpm and induced with various amounts of IPTG (see Results and discussion). After overnight incubation at 30 °C and 200 rpm, the cells were harvested and the periplasmic fraction was isolated by osmotic shock. The cell pellet was gently resuspended in ice-cold TES buVer, 30 ml per liter of initial culture. Then ice-cold water and 5 M sodium chloride solution were added (15 and 5 ml, respectively, per liter of initial culture) and the suspension was incubated on ice with gentle shaking for 1–2 h and then centrifuged at 12,000g for 20 min at 4 °C. The supernatant constituted the periplasmic fraction. It was dialyzed against 20 mM sodium acetate pH 5.0 (GSU0592) or 20 mM sodium phosphate pH 5.8 (GSU1996), both containing 250 mM sodium chloride, and loaded onto 2 £ 5 ml Econo-Pac High S cartridges (Bio-Rad) equilibrated with the same buVer. For initial loading a peristaltic pump was used (1–2 ml/min). Then the cartridges were connected to an FPLC system (Pharmacia) and the protein was eluted with a 250 mM–1 M NaCl gradient. A few fractions (usually 3–5) with highest absorbencies at 411 nm were combined, concentrated in Centricon units (YM3 membrane; Millipore) to approximately 1 ml, loaded onto a Superdex-75 gel Wltration column (Pharmacia), and eluted with 20 mM sodium phosphate buVer, pH 7.75, containing 100 mM NaCl at a Xow rate of 1.0 ml/min.

244

Y.Y. Londer et al. / Protein Expression and PuriWcation 47 (2006) 241–248

Mass spectrometry Electrospray mass spectrometry was performed in the HHMI Biopolymer Laboratory and W.M. Keck Foundation Biotechnology Resource Laboratory at Yale University. Biochemical methods Spectrophotometric measurements were performed on Shimadzu UV160U spectrophotometer in a cell with a path length of 1 cm. Protein concentrations were determined by the Bradford assay with Coomassie Plus Protein Assay Reagent Kit (Pierce) and G. sulfurreducens cytochrome c7 [27] as a standard. Reduction of cytochrome samples was performed by addition of a few crystals of solid sodium dithionite (Sigma). Results and discussion Design of a new vector for ligation-independent cloning of periplasmic proteins Vector pCK32 [27] is a pUC derivative containing a short fragment of the pET-22b(+) polylinker (four restriction sites) downstream of the cytochrome c7 gene. Vectors pCKN5 and pVA203 [24,25] derived from pCK32 had a NotI site introduced at the end of the leader peptide coding sequence and thus allowed cloning without adding extra residues at the N-terminus of targets. However, to address multiple cytochromes from G. sulfurreducens a short polylinker may not be suYcient. Instead of incorporating additional sites, we adopted ligation-independent cloning (LIC)4 technology [28,29]. In LIC, PCR primers are designed to append sequences that, after treatment with T4 DNA polymerase in the presence of a single deoxyribonucleotide triphosphate, generate 12- to 15-base-pair overhangs that are complementary to overhangs generated in the vector. These overhangs anneal suYciently strongly to allow the transformation of hosts without ligation of the fragments as host repair enzymes ligate the plasmid. LIC possesses several advantages, especially in the context of high-throughput (automated) cloning. It eliminates the use of restriction endonuclease digestion and ligation of PCR products, allowing any gene to be cloned into the vector regardless of its sequence. LIC also generates very high cloning eYciencies (low background), greatly increasing the probability of successfully cloning target genes without labor-intensive screening. Unfortunately, no LIC vector is currently commercially available that would allow periplasmic targeting of the cloned proteins—a necessary condition of proper cytochrome c maturation [30]. Now that hundreds of hypothetical cytochrome c genes have been found in numerous recently sequenced genomes, genomic/proteo-

4

Abbreviation used: LIC, ligation-independent cloning.

mic considerations will demand high-throughput approaches to express cytochromes c. The LIC vector for periplasmic targeting described here addresses this need. Other advantages of periplasmic targeting—applicable to all proteins—include facilitated formation of disulWde bonds and relatively small number of proteases in the periplasm compared to the cytoplasm. We intended to construct a new vector on the basis of the existing ones employing the OmpA leader sequence [24,25,27] and design it so that no extra residues would be added to the N-terminus of target proteins after processing of the leader sequence. These considerations, along with the need to exclude one of the four bases from the LIC overhang region, impose signiWcant limitations on the choice of the nucleotide sequence in the vicinity of the cleavage site. First, it has been shown that the leader sequence must follow so called (¡3, ¡1) rule: residues at positions ¡3 and ¡1 relative to the cleavage site must be small and neutral for cleavage to occur correctly [31], and therefore, a majority of leader sequences, including OmpA, have alanines at both positions. Since alanines are encoded by codons beginning GC, only two options, A or T, are available for the “missing” nucleotide. Second, to be absolutely free in the choice of the N-terminal residue of target sequences, it must be the third base in the GCN triplet coding for alanine at position ¡1 that “stops” T4 DNA polymerase in preparing the PCR fragment for LIC. Therefore, the initial cleavage of the vector preceding T4 polymerase treatment must occur after the second base in the GCN triplet (at least in the complementary strand). Third, even though residue at position ¡2 is not believed to be critical for proper processing of the leader sequence, in many bacterial sequences it is hydrophobic and/or bulky (Y.Y.L., unpublished observation). One of the few combinations meeting all requirements was FspI as the cleavage site (TGC^GCA) and Phe as “¡2” residue. Since there was another FspI site in the body of plasmid, it was removed by mutagenesis. Cloning of the four-domain cytochromes Forty seven percent of the residues are identical for the two dodecaheme cytochromes (Fig. 2). However, while GSU1996 is predicted to have a cleavable N-terminal signal sequence, GSU0592 appears to be a membrane-anchored protein and we cloned only its soluble part starting at Lys26. Both genes were ampliWed from the G. sulfurreducens genomic DNA and cloned into pLBM4 as follows. For LIC processing, cleavage of the vector at the unique FspI site followed by treatment with T4 DNA polymerase in the presence of dATP generates 14-base, single-stranded overhangs (Fig. 3A). To introduce a target gene, PCR primers must encode complementary sequences so that treatment with the polymerase in the presence of dTTP will generate complementary single-stranded overhangs (Fig. 3B). The expressed precursor protein will consist of the modiWed OmpA leader sequence (that will be removed upon secretion into the periplasm) and the target protein sequence

Y.Y. Londer et al. / Protein Expression and PuriWcation 47 (2006) 241–248

245

Fig. 2. The sequence alignment of dodecaheme cytochromes c GSU0592 and GSU1996 from G. sulfurreducens, including leader peptide/membrane anchor. The Wrst residue of mature GSU1996 (Lys26) as predicted by SignalP software [31,36] and the Wrst residue of mature GSU0592 (Lys26) as it was cloned in this work are indicated by asterisks. The alignment was generated using Wisconsin Package, Version 10.3 (Accelrys, San Diego, CA).

without extra N-terminal residues. DNA sequencing conWrmed that the desired sequence was obtained, i.e., processing with T4 DNA polymerase was correct. Optimization of expression conditions For expression, we use the same approach based on coexpression of the ccm genes [32–34] as previously used to make cytochrome c7 (PpcA) from G. sulfurreducens [23,27] and fragments of GSU1996 [24,25]. E. coli strain JCB7123 [35] that produced the best results for the two-domain fragments of GSU1996 [25] was chosen as an expression host. As previously demonstrated, varying IPTG concentration used for induction can dramatically aVect the yield of mature cytochromes [25,27]. To quantitatively evaluate eVect of IPTG concentrations on expression levels, we determined absorbencies of the periplasmic fractions at 280 nm (at 1:5 dilutions) and 411 nm (Soret band for oxidized cytochromes c) as described in [25]. Values of A280 indicate the diVerences in the total protein concentration for diVerent samples. Results for GSU1996 (Fig. 4) demonstrate that the maximum yield is achieved for IPTG concentrations between 15 and 25 M. Similar experiments for GSU0592 found the optimal IPTG concentration of 3 M (data not shown). Solubilization and puriWcation of cytochrome GSU1996 JCB7123 cells produced c-type cytochromes as judged by distinct pink color of cell pellets. However, periplasmic

fraction obtained after osmotic shock contained only small amounts of the cytochrome and most of the colored substance remained in the pellet, manifesting essentially the same behavior as its N-terminal half alone [25], which indicates that the protein is either insoluble or strongly associated with the cell membranes. It is noteworthy that GSU1996 (as well as GSU0592) lacks long hydrophobic stretches and almost every fourth residue is charged. Therefore, in addition to two conventional detergents—noctyl--D-glucoside and HEGA-10 (decanoyl-N-hydroxyethylglucamide)—we also tried solubilizing the protein with sodium chloride as described in Materials and methods and Table 1. Results for solubilization of GSU1996 in the absence and presence of sodium chloride (0.5 M) are shown in Fig. 5. Sodium chloride signiWcantly increased the yield of soluble cytochrome, both with and without a detergent. Moreover, sodium chloride acts as a very selective solubilizing agent resulting in little or no increase in A280 (a measure of total protein solubilized) as compared to “nosalt” samples, whereas both detergents extracted signiWcant amounts of other proteins in addition to the cytochrome. Little or no increase in yields of soluble cytochrome was observed when ammonium sulfate (0.5 and 1.0 M) or higher concentrations of sodium chloride (up to 1.6 M) were used (data not shown). Cytochrome GSU1996 was further puriWed following the same protocol as used for puriWcation of its fragments—cation exchange chromatography followed by gel Wltration [24,25,27]. Since all three two-domain fragments of GSU1996, despite their high theoretical pI, required pH

246

Y.Y. Londer et al. / Protein Expression and PuriWcation 47 (2006) 241–248

Fig. 4. Yields of cytochrome GSU1996 in the periplasmic fraction as a function of IPTG concentration. One liter cultures were grown as described in Materials and methods and induced with varying concentrations of IPTG. Periplasmic fractions were isolated, and absorbencies at 280 nm (for 1:5 dilutions) and 411 nm were measured. The latter were normalized to A280 D 0.5 (for 1:5 dilutions) to account for diVerences in total protein concentration. Represented are the mean values of three replicate measurements. Standard deviations were 15% of the mean or better. Fig. 3. LIC processing of pLBM4 and PCR products. (A) Cleavage of pLBM4 with FspI followed by treatment with T4 polymerase in the presence of dATP generates 14-base LIC overhangs. (B) Treatment of PCR products with complementary termini (incorporated into the primers used to amplify target genes) with T4 polymerase in the presence of dTTP generates LIC overhangs complementary to those from pLBM4. The coding target sequence is uppercased. Shown is the actual sequence of GSU0592. (C) Annealing of the overhangs generates a product encoding the modiWed OmpA leader sequence (with Gln(¡2)Phe substitution as compared to the wild-type OmpA) followed by the target protein. Processing with signal peptidase occurs between Ala and Lys residues to generate mature target protein.

<7 to bind to cation exchanger [25], for chromatography we used the most acidic buVer (pH 5.8) of all tested in our previous work [25]. The only essential modiWcation of the procedure—prior to the ion exchange step the protein was dialyzed against a buVer containing 250 mM sodium chloride—was necessary because of apparent instability of the cytochrome in low salt buVers such as 20 mM phosphate: overnight dialysis would result in precipitation of a signiWcant fraction of protein (15–20% as judged by absorbance at 411 nm). At lower salt concentrations (100 or 150 mM) some protein did precipitate, while higher concentrations, such as 300 mM, interfered with binding to the cation exchanger. The protein bound to the ion exchanger was eluted with a sodium chloride gradient and then further puriWed by gel Wltration. The Wnal yield was 2 mg from 4 L of aerobic E. coli culture. PuriWcation of cytochrome GSU0592 Cytochrome GSU0592 was also solubilized in the presence of 0.5 M sodium chloride but under the conditions

Fig. 5. Solubilization of GSU1996. Periplasmic samples were prepared as described in Materials and methods and Table 1, and absorbencies at 280 nm (for 1/10 dilutions) and 411 nm were measured. Represented are the mean values of two replicate measurements. Standard deviations were 18% of the mean or better.

described above a signiWcant fraction (»50%) of it did not bind to cation exchanger at pH 5.8. Upon switching to a more acidic buVer—sodium acetate pH 5.0—binding increased dramatically (>80%). The protein bound was eluted with a sodium chloride gradient and then further puriWed by gel Wltration. The Wnal yield was 2.4 mg from 4 L of aerobic E. coli culture.

Y.Y. Londer et al. / Protein Expression and PuriWcation 47 (2006) 241–248

247

Preliminary characterization Both cytochromes were analyzed by electrospray mass spectrometry. Since the hemes are covalently bound to the polypeptide chain, mass spectrometry experiments give the total mass of the molecule (hemes + polypeptide) and it is a convenient and accurate way to determine the number of hemes per polypeptide. Molecular weight increases by 616 Da per covalently bound heme [33]. For both proteins masses were within 5 Da of expected molecular weights (Table 2), thus conWrming that they contained the correct number of 12 hemes. UV–visible spectra for both proteins were characteristic of c-type cytochromes. Peaks are summarized in Table 3, and both reduced and oxidized spectra for cytochrome GSU1996 are shown in Fig. 6. Both cytochromes were crystallized (Fig. 7) and we are currently working on their X-ray structures.

Table 2 Comparison of the theoretical molecular weights of puriWed cytochromes with those determined by ESMS Protein

Mass by ESMS

Theoretical MW

GSU0592 GSU1996

40,514 42,273

40,519 42,275

Table 3 Absorbance peaks for cytochromes GSU0592 and GSU1996 in UV– visible range Protein

Peaks (nm)

GSU0592 oxidized GSU0592 reduced GSU1996 oxidized GSU1996 reduced

355 355.5

410 419 411 420

528 523 529.5 523.5

552.5 553

Fig. 7. Crystals of cytochromes GSU0592 (A) and GSU1996 (B).

Summary This report addresses production in E. coli of two homologous dodecaheme cytochromes c from G. sulfurreducens representing a novel class of cytochromes. This is the Wrst time that large multidomain cytochromes (>40 kDa, 12 covalently bound hemes) have been produced in E. coli. To facilitate cloning of these (and other) cytochromes, a novel vector for ligation-independent cloning of periplasmic proteins was designed and validated, which should be very valuable for high-throughput production of cytochromes in the future. Success was achieved due to modulation of expression conditions (IPTG concentration) and development of solubilization procedure involving sodium chloride. An outstanding feature of these proteins is that their putative structure is a one-dimensional array of homologous small domains that contain three hemes that are covalently bound. It is very likely that they have elongated structures and form a “nanowire.” That unique trait can make them prospective candidates for the design of nanowire systems. Both proteins were crystallized and structure determination is under way. Acknowledgments We thank Dr. L. Thöny-Meyer (ETH, Zürich, Switzerland) for plasmid pEC86 and Prof. S. Ferguson (University of Oxford, UK) for E. coli strain JCB7123. We are grateful to Dr. M. Donnelly (ANL) for critical reading of the manuscript. This work was supported by the U.S. Department of Energy, the OYce of Biological and Environmental Research, NABIR program under Contract No. W-31-109-ENG-38. References

Fig. 6. Reduced (dashed line) and oxidized (solid line) spectra of cytochrome GSU1996 (concentration 41 g/ml).

[1] F.S. Mathews, The structure, function and evolution of cytochromes, Prog. Biophys. Mol. Biol. 45 (1985) 1–56.

248

Y.Y. Londer et al. / Protein Expression and PuriWcation 47 (2006) 241–248

[2] S. Seeliger, R. Cord-Ruwisch, B. Schink, A periplasmic and extracellular c-type cytochrome of Geobacter sulfurreducens acts as a ferric iron reductase and as an electron carrier to other acceptors or to partner bacteria, J. Bacteriol. 180 (1998) 3686–3691. [3] E. Afkar, Y. Fukumori, PuriWcation and characterization of triheme cytochrome c7 from the metal-reducing bacterium, Geobacter metallireducens, FEMS Microbiol. Lett. 175 (1999) 205–210. [4] M. Bruschi, Cytochrome c3 (Mr 26,000) isolated from sulfate-reducing bacteria and its relationship to other polyhemic cytochromes from Desulfovibrio, Methods Enzymol. 243 (1994) 140–155. [5] I.B. Coutinho, A.V. Xavier, Tetraheme cytochromes, Methods Enzymol. 243 (1994) 119–140. [6] S. Nørager, P. Legrand, L. Pieulle, C. Hatchikian, M. Roth, Crystal structure of the oxidised and reduced acidic cytochrome c3 from Desulfovibrio africanus, J. Mol. Biol. 290 (1999) 881–902. [7] D.R. Lovley, E.J.P. Phillips, Y.A. Gorby, E.R. Landa, Microbial reduction of uranium, Nature 350 (1991) 413–416. [8] D.R. Lovley, J.D. Coates, Bioremediation of metal contamination, Curr. Opin. Biotechnol. 8 (1997) 285–289. [9] M. Czjzek, L. ElAntak, V. Zamboni, X. Morelli, A. Dolla, F. Guerlesquin, M. Bruschi, The crystal structure of the hexadeca-heme cytochrome Hmc and a structural model of its complex with cytochrome c3, Structure 10 (2002) 1677–1686. [10] E. Harada, J. Kumagai, K. Ozawa, S. Imabayashi, A.S. Tsapin, K.H. Nealson, T.E. Meyer, M.A. Cusanovich, H. Akutsu, A directional electron transfer regulator based on heme-chain architecture in the small tetraheme cytochrome c from Shewanella oneidensis, FEBS Lett. 532 (2002) 333–337. [11] P.M. Matias, A.V. Coelho, F.M.A. Valente, D. Placido, J. LeGall, A.V. Xavier, I.A. Pereira, M.A. Carrondo, Sulfate respiration in Desulfovibrio vulgaris Hildenborough. Structure of the 16-heme cytochrome c HmcA at 2.5-Å resolution and a view of its role in transmembrane electron transfer, J. Biol. Chem. 277 (2002) 47907–47916. [12] C. Abergel, W. Nitschke, G. Malarte, M. Bruschi, J.M. Claverie, M.T. Giudici-Orticoni, The structure of Acidithiobacillus ferrooxidans c4cytochrome: a model for complex-induced electron transfer tuning, Structure 11 (2003) 547–555. [13] F. Baneyx, Recombinant protein expression in Escherichia coli, Curr. Opin. Biotechnol. 10 (1999) 411–421. [14] P. Jonasson, S. Liljeqvist, P.Å. Nygren, S. Ståhl, Genetic design for facilitated production and recovery of recombinant proteins in Escherichia coli, Biotechnol. Appl. Biochem. 35 (2002) 91–105. [15] J. Grove, S. Tanapongpipat, G. Thomas, L. GriYths, H. Crooke, J. Cole, Escherichia coli K-12 genes essential for the synthesis of c-type cytochromes and a third nitrate reductase located in the periplasm, Mol. Microbiol. 19 (1996) 467–481. [16] E. Arslan, H. Schulz, R. ZuVerey, P. Kunzler, L. Thöny-Meyer, Overproduction of the Bradyrhizobium japonicum c-type cytochrome subunits of the cbb3 oxidase in Escherichia coli, Biochem. Biophys. Res. Commun. 251 (1998) 744–747. [17] C. Aubert, E. Lojou, P. Bianco, M. Rousset, M.-C. Durand, M. Bruschi, A. Dolla, The Desulfuromonas acetoxidans triheme cytochrome c7 produced in Desulfovibrio desulfuricans retains its metal reductase activity, Appl. Environ. Microbiol. 64 (1998) 1308–1312. [18] K. Ozawa, A.I. Tsapin, K.H. Nealson, M.A. Cusanovich, H. Akutsu, Expression of a tetraheme protein, Desulfovibrio vulgaris Miyazaki F cytochrome c3, in Shewanella oneidensis MR-1, Appl. Environ. Microbiol. 66 (2000) 4168–4171. [19] K. Ozawa, F. Yasukawa, Y. Fujiwara, H. Akutsu, A simple, rapid, and highly eYcient gene expression system for multiheme cytochromes c, Biosci. Biotechnol. Biochem. 65 (2001) 185–189. [20] K.E. Pitts, P.S. Dobbin, F. Reyes-Ramirez, A.J. Thomson, D.J. Richardson, H.E. Seward, Characterization of the Shewanella oneidensis

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28] [29]

[30]

[31]

[32]

[33] [34]

[35]

[36]

MR-1 decaheme cytochrome MtrA: expression in Escherichia coli confers the ability to reduce soluble Fe(III) chelates, J. Biol. Chem. 278 (2003) 27758–27765. F. Caccavo Jr., D.J. Lonergan, D.R. Lovley, M. Davis, J.F. Stolz, M.J. McInerney, Geobacter sulfurreducens sp. nov., hydrogen- and acetateoxidizing dissimilatory metal-reducing microorganism, Appl. Environ. Microbiol. 60 (1994) 3752–3759. B.A. Methé, K.E. Nelson, J.A. Eisen, I.T. Paulsen, W. Nelson, J.F. Heidelberg, D. Wu, M. Wu, N. Ward, M.J. Beanan, R.J. Dodson, R. Madupu, L.M. Brinkac, S.C. Daugherty, R.T. DeBoy, A.S. Durkin, M. Gwinn, J.F. Kolonay, S.A. Sullivan, D.H. Haft, J. Selengut, T.M. Davidsen, N. Zafar, O. White, B. Tran, C. Romero, H.A. Forberger, J. Weidman, H. Khouri, T.V. Feldblyum, T.R. Utterback, S.E. Van Aken, D.R. Lovley, C.M. Fraser, Genome of Geobacter sulfurreducens: metal reduction in subsurface environments, Science 302 (2003) 1967–1969. P.R. Pokkuluri, Y.Y. Londer, N.E.C. Duke, W.C. Long, M. SchiVer, Family of cytochrome c7-type proteins from Geobacter sulfurreducens: the structure of one cytochrome c7 at 1.45 Å resolution, Biochemistry 43 (2004) 849–859. P.R. Pokkuluri, Y.Y. Londer, N.E.C. Duke, J. Erickson, M. Pessanha, C.A. Salgueiro, M. SchiVer, Structure of a novel c7-type three-heme cytochrome domain from a multi-domain cytochrome c polymer, Protein Sci. 13 (2004) 1684–1692. Y.Y. Londer, P.R. Pokkuluri, J. Erickson, V. Orshonsky, M. SchiVer, Heterologous expression of hexaheme fragments of a multidomain cytochrome from Geobacter sulfurreducens representing a novel class of cytochromes c, Protein Expr. Purif. 39 (2005) 254– 260. J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, second ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. Y.Y. Londer, P.R. Pokkuluri, D.M. Tiede, M. SchiVer, Production and preliminary characterization of a recombinant triheme cytochrome c7 from Geobacter sulfurreducens in Escherichia coli, Biochim. Biophys. Acta 1554 (2002) 202–211. C. Aslanidis, P.J. de Jong, Ligation-independent cloning of PCR products (LIC-PCR), Nucleic Acids Res. 18 (1990) 6069–6074. R.S. Haun, I.M. Serventi, J. Moss, Rapid, reliable ligation-independent cloning of PCR products using modiWed plasmid vectors, Biotechniques 13 (1992) 515–518. C. Sanders, H. Lill, Expression of prokaryotic and eukaryotic cytochromes c in Escherichia coli, Biochim. Biophys. Acta 1459 (2000) 131–138. H. Nielsen, J. Engelbrecht, S. Brunak, G. von Heijne, IdentiWcation of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites, Protein Eng. 10 (1997) 1–6. L. Thöny-Meyer, F. Fischer, P. Kunzler, D. Ritz, H. Hennecke, Escherichia coli genes required for cytochrome c maturation, J. Bacteriol. 177 (1995) 4321–4326. L. Thöny-Meyer, Biogenesis of respiratory cytochromes in bacteria, Microbiol. Mol. Biol. Rev. 61 (1997) 337–376. M.D. Page, Y. Sambongi, S.J. Ferguson, Contrasting routes of c-type cytochrome assembly in mitochondria, chloroplasts and bacteria, Trends Biochem. Sci. 23 (1998) 103–108. E.H. Gordon, E. Steensma, S.J. Ferguson, The cytochrome c domain of dimeric cytochrome cd1 of Paracoccus pantotrophus can be produced at high levels as a monomeric holoprotein using an improved ctype cytochrome expression system in Escherichia coli, Biochem. Biophys. Res. Commun. 281 (2001) 788–794. J.D. Bendtsen, H. Nielsen, G. von Heijne, S. Brunak, Improved prediction of signal peptides: SignalP 3.0, J. Mol. Biol. 340 (2004) 783– 795.